
17,340 8,383 216MB
Pages 1159 Page size 2049 x 2697 pts Year 2010
•
•
SIXTH
1---"
•
eremy M. Berg
•
-
W. H. Freema n and Company • New York
Publisher: Sara Tenney Senior Acquisitions Editor: Kate Ahr Marketing Managers: Sarah Martin, John Britch Senior Developmental Editor: Susan Moran Media Editor: Alysia Baker Supplements Editors: Nick Tymoczko, Deena Goldman Photo Editor: Bianca Moscatelli Design Manager: Diana Blume Text Designer: Patrice Sheridan Senior Project Editor: Georgia Lee Hadler Manuscript Editor: Patricia Zimmerman Illustrations: Jeremy Berg with Network Graphics Senior Illustration Coordinator: Bill Page Production Coordinator: Susan Wein Composition: Techbooks Printing and Binding: RR Donnelley
Library of Congress Cataloging-in-Publication Data Berg, Jeremy Mark. Biochemistry / Jeremy M. Berg, John L. Tymoczko, Lubert Stryer. . 6th ed. p. cm. Includes bibliographical references and index. ISBN 0-7167-H724-5 hardcover 1. Biochemistry. 1. Tymoczko, John L., II. Stryer, Lubert III. Title. QP514.2.S662006 572 dc22 2005052751 ISBN: 0-7167-8724-5 EAN: 9780716787242 ©2007, 2002 by W. H. Freeman and Company; © 1975, 1981, 1988, 1995 by Lubert Stryer All rights reserved Printed in the United States of America First printing W. H. Freeman and Company 41 Madison Avenue New York, NY 10010 Houndmills, Basingstoke RG21 6XS, England www.whfreeman.com
To our teachers and our students
About th e Auth o rs
JEREMY M. BERG received hi s B.S. and M .S. degrees in C hemi stry from Stanford (where he did research with Keith Hodgson and Lubert Stryer) and hi s Ph .D. in chemistry from Harvard with Richard Holm . He then completed a postdoctoral fellowship with Carl Paba in Biophysics at Johns Hopkins U ni versity School of Medicine. He was an Assistant Professor in the Department of C hemistry at Johns Hopkins from 1986 to 1990. He then moved to Johns Hopkins University School of Medicine as Professor and Director of the Department of Biophysics and Biophysical Chemistry, where he remained until 2003 . In 2003 , he became the Director of the National Institute of General Medical Sciences at the National Institutes of Health. He is recipient of the American C hemical Society Award in Pure Chemistry (1994), the Eli L illy Award for Fundamental Research in Biological C hemi stry (1995), the Maryland Outstanding Young Scientist of the Year (1995), and the Harrison Howe Award (1997 ). While at John s Hopkins, he received the W. Barry Wood Teaching Award (selected by medical students as award recipient), the G raduate Student Teaching Award, and the Professor's Teaching Award for the Preclinical Sciences. He is coauthor, with Stephen L ippard, of the textbook Principles of
Bioinorganic Chemistry. JOHN L. TYMOCZKO is Towsley Professor of Biology at Carleton College, where he has taught since 1976. He currently teaches Biochemistry, Biochemistry Laboratory, Oncogenes and the Molecul ar Biology of Cancer, and Exercise Biochemistry and coteaches an introductory course, E nergy Flow in Biological Systems. Professor Tymoczko received his B.A. from the University of Chicago in 1970 and his Ph.D. in Biochemistry from the U niversity of C hicago with Shutsung Liao at the Ben May Institute for Cancer Research. H e then had a postdoctoral position with Hewson Swift of the Department of Biology at the Uni versity of Chicago. The focus of his research has been on steroid receptors, ribonucleoprotein particles, and proteolytic processing enzymes. LUBERT STRYER is Winzer Professor of Cell Biology, Emeritus, in the School of Medicine and Professor of Neurobiology, Emeritus, at Stanford University, where he has been on the faculty since 1976. He received his M .D . from H arvard Medical School. Professor Stryer has received many awards for his research on the interplay of light and life, including the Eli Lilly Award for Fundamental Research in Biological Chemistry and the Distingui shed Tnventors Award of the Intellectual Property Owners' Association . He was elected to the National Academy of Sciences in 1984 . He currently chairs the Scientific Advisory Boards of two biotechnology companies Affymax, Inc. , and Senomyx, Inc. and serves on the Board of the McKnight Endowment Fund for Neuroscience. The publication of his fir st edit ion of Biochemistry in 19 75 transformed the teaching of biochemistry.
PREFACE he more we learn, the more we discover connections threading through o ur biochemical world. 10 writing the sixth edition, we have made every effort to preseot these connections in a way that will help first-time students of biochemistry understand the subject and how very relevant it is to their lives .
Emphasis on Physiological Re levance Biochemistry is returning to its roots to renew the study of its role in physiology, with the tools of molecular biology and the information gained from gene sequencing in hand. In the sixth edition, we emphasize that an understanding of biochemical pathways is the underpinning for an understanding of physiological systems. Biochemical pathways make more sense to students when they understand how these pathways relate to the physiology of familiar activities such as digesti on, respi ration, and exercise. In this edition, particularly in the chapters on metabolism, we have taken several steps to ensure that students have a view of the bigger picture: • Discussions of metabolic regulation emphasize the everyday conditions that determine regulation : exercise versus rest; fed versus fasting . • New pathway-integration figures show how multiple pathways work together under a specific condition, such as during a fast. • More physiologically relevant examples have been added throughout the book. This physiological perspective is also evident in the new chapter on drug devel opment. The use of a foreign compound to inhibit a specific enzyme sometimes has surprising physiological consequences that reveal new physiological principles.
FAT CELL
B LO O~
FASTING or DIAB ETES
/
Glycerol
(
Fatty acids
M1""
"'I
Triacylglycerol
'-.
-{ J G1YFeroi
LIVER CELL
I Glycerol
Fatty acids
/ l(i) Fatty acids
ac;ds
Glucose
0
U IIi U •"'\ Ket one Acetyl I CoA
-r:: F'~
bodies
HEART·MUSCLE CELL RENAL-CORTEX CEll
it-
BRAIN CEll DURING STARVATION
/
"
"
(l[
Ketone bodies
.0
Active pathways: 1. 2. 3. 4. 5. 6.
.'"
Acetyl CoA
Fatty acid oxidation, Chapter 22 Formation of ketone bodies, Chapter 22 Gluconeogenesis, Chapter 16 Ketone bodies ~ acetyl CoA. Chapter 22 Citric acid cycle, Chapter 17 Oxidative phosphorylation, Chapter 18
CAC
(j)
®
" ' i ';
,.
gley Northeastern University Donald C. Beitz
fowa State University Peggy K. Borum Universi ty of Florida
Ulliversity of Iowa CaT1Jer College of Medicine Texas A&M Ulliversity
S tate University of New York. New Paltz
Newton Hilliard , Jr.
Huangen Ding
Gerwald Jogl
Louisiana State University University of f-Jouston
Brown University Kon tan tin V. Kandror Boston University School of Medicine
Thomas Ellenberger
A . Wali Karzai
Narvard Medical School
Stony
.I useph Eichberg
Eastern New Mexico Univers ity
Brool~
Randy Brewton
Ohio University
Universit), Ph.illip I~ . KI boa University of Uld(liluma
University of Tennessee
Ray Fall
Aileen F. Knowles
Scott D . Briggs
Universi ty of Colorado
, an Diego, tate University
Purdue University Martin L. Brock EasteTll Kentucky Universi ty
Wilson A. Francisco
John Koontz
Arizona State University
University of Tennessee
Terrence G . Frey
Robert Kranz
Roger Brownsey
San Diego State University
Washington University
Utliversity of British Columbia
K.
Min - Hao Kuo
Michael ~... Bruisl
Stanford University School of Medicine
Michigan State University
University uf the Sciences in Philadelphia
Ronald K . Gary
Patrick D. Larkin
University of Nevada. Las Vegas
'texas A&M University. Corpus Christi
John D, Brunstein University of British Columbia Mauricio Bustos
Alexandros Georgakilas
Sylvia Lee-Huang
East Carolina Ut liversity
New York University chool of M edicille
University of Maryland . Baltimore County
New York University Michael R. Green Univers ity of Massachusetts Medical School
Glen B. L egge
Robley J. Li ght
David L. Daleke
E . M . Gregory Virginia Tech harles B. Grissom
Xuedong Liu
Indiana Universi ty
University of U tail
University of olorado, Boulder
Amanda J. Bradley
University of British Columbia
W . Malcolm Byrnes J luward University College of Medicine Larry D . CroUd1
University of Nebraska Medical Center
Susan C. Evans
hristopher Garcia
l3uft Goldberg
University of /-Iouston Vin ce Li Cala
Louisiana S I.ate University Florida State Universi ty
xv
Andy LiWang
David C . Pendergrass
Marc E. Tisch ler
Texas A&M Un.iversity
Kansas University Cy nthia B. Peterson University of Tennessee
Unil)ersity of Arizona
Timothy M. Logan
f lorida State University• Michael A. Massiah (>Idahoma State Un iversity Douglas D . McAbee California State University, L01lg Beach James McAfee Pitlsbllrg State Univershy Megan M . McEv y
University of Arizonll
Patricia M . Moroney
Louisiana Slate University Mike Mossing
University oj Mississippi Michael P. Myers
California State University, l,ong Beach oller
University oj CaliJo'rrda, . 'anta Cruz Mary Kay Orgill
Universi ty of ML.souri O liver E. Owen Retired clinical investigator. administrator, (tl1d academician
University of Pennsylvania Douglas D. Root
University of NO'rth Texas Robert 1{osenbe(g
Iloward University Richard L Sabina !vi ediC(t1 College of Wisconsin Robert Sanders
Bryant W. Miles Texas A & M University •
Harry
Philip A . Rea
Liang Tong
Co lumbia University Michael U hler University of Michigan Ronald Vale
Un i11ersity of California, San Francisco Katherine Wall
University
oJ Toledo
Malcom Walford Rutgers Unil}Crsity
University of Kansas Jamie L Schl'~sman United St(Ltes NILval Academy Todd P. Silverstein Willamette University Melanie A. Simpson University of Nebrasha, Lillco ln
Joach im Weber
Kerry S. Smilh
C harles Yocum University of Michigan
Clemson U11iversiLy Deborah A . Spikes tony [hook University
Texas Tech University jan A. Wihon The Scripps Research InstiLute MareS. Wold
University oJ Iowa Carver College of Medicille
Robert Zand
University oj'Michigan
Takita Felder Sumler
Brent M. Z nosko
Winthrop University
Saint Louis University
David C. Teller
University of Washington Working with our colleagues at W. H. Freeman ,md Company has been a wonderful experience. We would especially like to acknowleJge the efforts of the following people. O ur d evelopmental editor, Susan Moran, has contributed immemcly to the s uccess of this pwject. Our project editor. Georgia Lee Had ler, managed the flow of the project. ·from final manuscript to flnal product with admirable efficien cy. The careful manuscript edi· tor, Patricia Zimmerman, enh,\nced the text's literary consistency and clarity. Design manager Diana Blume produced a design and layoul that are organizationally clear and es· thetically pleasing. Our photo editor, Bianca Moscatelli, tenacious.ly tracked down new images. nill Page. the illustra.tion coordinator, ably oversaw the rendering of new illustrations. and 'usan Wein, the production manager, astutely handled all the difficulties of schedul ing, compo ition, and manufacturing. Media ed itor A lysia Ba.ker and assistant editors Nick T ymoc£.ko and Deena Goldman were invaluable in their management of the med ia and supplements program. W e would also like to thank Timothy Driscoll for his wot:k in converting our living figures into Jmol. O ur acquisitions editor, Kate Ahr, was an outstanding director of the project. Her enthusiasm , encouragement, patience. and good humor kept us going when we were tired, frustrated, and discouraged . Marketing mavens John TIritch and Sarah Martin oversnw the introduction of this edition to the academi c world . We also thank the ales peop le at W . H . Freeman and Company for their e.xcdlent suggestions and v iew of the market. We thank Elizabeth Widdico n1be, President of W . H . Freeman and Company, for never losing faith in us. Finally, the project wou ld not have been possible without the unfailing support or our families speciall y our wives, Wendie Berg and Alison U nger. 111eir patience, encouragem ent, and enthusiasm have made this endeavor possible. We also thank our children, A lex, Corey, and Monica Berg and Janina and Nicholas Tymoczko, for their forbearance and good humor and for con stantly providing us a perspective on what is truly important in life .
•
xVI
Dav id C. 1 endergrass
Andy LiWang Texas A& M University
Florida State University
Kamas University y nth ia B. Peterson University of Tennessee
Mi chael A . Massiah
Philip A. Rea
Oklahoma. tate University
University of Pennsylvania
Douglas D. McAbee
Douglas D . Root
California State University, Long Beach
University of North Texas
James McAfee
Robert R osenberg
Pittsbll.rg State University
Howard Universi ty Richard L. Sabina Medical College of Wisconsin
Timothy IVI . Logan
Megan M . McEvoy University of Arizonll Bryant W. Mil es
Robert Sanders
Texas A[
/[OH - ].
With these relations in hand . we can easily calculate the co ncentration of hydrox ide ions in an aqueous solu tion given the pH. For example. at pH = 70, we know that [H '] = 10 - 7 M and so [O H - ] = 10 - 14 /10 - 7 = 10- 7 M. In acid ic solu tions, the concentration of hydrogen ions is higher than 10- 7 and , hence. the p H is below 7. For exampl e, in 0.1 M He l. [H +j = 10 - 1 M 14 1 13 and so pH = 1.0 and [OH j = '10- / 10- = 10 - M .
-
E 0.8 0 va> -o . ~'" 0.6 E Q; -0 . e 0.4 0.0 ._
-
::J
1:; 0
~" 0.2 u.
o ---'-'-- ---'-'-- ~b....... 7
T he reaction that we have been considering between two strands of D JA to [arm a double helix takes place readil y at pH 7.0. Suppose that we take the solution containing the double- heli cal DNA and treat it with a solution of concentrated base (wi th a high concentration of OI-l ). As the base is added. we monitor t he pH and the fraction of D NA in double-helical form (Figure 1.16). When the first additions of base are made. the pH rises. but the concentration of the dou b le- helical DNA does not change signi fi cantl y. However , as the pH approaches 9. the DNA double heli x begins to dissociate into its componen t single strands. As the pH continues to rise from 9 to 10, this dissociation becomes essentially complete. Why do the two strand s dissociate? T he hyd roxide ions can react with bases in DNA base pairs to remove certain protons. The most susceptible p roton is the one bound to the N-I nitrogen atom in a guanine base.
N H
,/H
N pK.= 9 .7 •
N
/
10
11
Figure 1.16 DNA denaturation by the addition of a base. The addition at base to a solution of doubl e-helical DNA initially at pH 7 causes the double helix to separate Into single strands. The process is half complete at slightly above pH 9.
o N
f
9
pH
Acid-Base Reactions Can Disrupt the Double Helix
o
8
H
f
.-;;::-
N
I
N
+
.-;;::-
N
NH,
H
+
NH,
Cuanine (C)
Proton dissociation for a substance HA has an equilibrium constant defmed by the express ion
The susceptibili ty o r a proton to Temoval by reaction with base is described by its pK. valu e:
pK. = - log( K. ) When the pH is eq ual
tb
the pK., we have pH = pK.
and so
and
Div iding by [H + J reveals that
1
=
[A - J/[ HA J
15
and so
16 CHAPTER 1 Biochemistry: An Evolving Science
[A - ]
=
[HA J
Thus, when the pH equals the pKa' the concentration of the deprotonated form of the group or molecule is equal to the concentration of the proto nated form ; the deprotonation process is halfway to compl etion. The pKa for the proton on N -1 of guanine is typically 9.7. When the pH approaches this value, the proton on N - l is lost (see Figure 1.1 6). Because this proton participates in an important hydrogen bond, its loss substantially destabilizes the DNA double helix . The DNA double helix is also destabilized by low pH. Below pH 5, some of the hydrogen bond acceptors that participate in base-pairing become protonated. In their protonated forms , these bases can no longer form hyd rogm bonds and the double helix separates. Thus, acid- base reactions that remove or donate protons at specific positions on the DNA bases can disrupt the doubl e helix.
Buffers Regulate pH in Organisms and in the Laboratory
12 10 8 I
a.
6
Gradual pH change
4
2
Water
00"--:1'=0---=20
30
40
50
60
Number of drops Figure 1.17 Buffer action. The addition of a strong acid, 1 M HCI, to pure water results. in an immediate drop in pH to near 2. In contrast. the addition of the acid to a 0.1 M sodium acetate (Na I CH,cO(r) solution results in a much more gradual cha nge in pH until the pH drops below 3.5.
A significant change in pH can disrupt molecular structure and initiate harmful reactions. Thus, systems have evolved to mitigate changes in pH in biological systems. Solutions that resist such changes are called buffers . Specifically, when acid is added to an unbuffered aqueous solution, the pH drops in proportion to the amount of acid added . In contrast, when acid is added to a buffered solution, the pH drops more gradually. Buffers also mitigate the pH increase caused by the addi tion of base. Compare the res ult of adding a 1 M solution of the strong acid HCI drop by drop to pure water with adding it to a solution containing 100 mM of the buffer sodium acetate (Na +CHJCOO - ; Figure 1.17). The process of gradually adding known amounts of reagent to a solution with which the reagent reacts while monitoring the results is called a titration . For pure water, the pH drops from 7 to close to 2 on the addition of the first few drops of acid. However, for the sodium acetate solution, the pH first falls rapidly from its initial value near 10, then changes more gradually un t.i I the pH reaches 3.5 , and then falls more rapidly again . Why does the pH decrease gradually in the middle of the titration? The answer is that, when hydrogen ions are added to this solution, they react with acetate ions to form acetic acid . This reaction consumes some of the added hydrogen ions so that the pH does not drop. Hydrogen ions continue reacting with acetate ions until essentially all the acetate ion is converted iilto acetic acid. After thi s point, added protons remain free in solution and the pH begins to fall sharply again. We can analyze the effect of the buffer in quantitative terms. The equi librium constant for the deprotonation of an acid is
Taking logarithms of both sid es yields 10g(K.)
=
10g([ H +]) + 10g( [A - J/[ HAJ).
Recalling the definitions of pK. and pH and rearranging gives pH = pKa + 10g([ A -J/[ HA J). This expression is referred to as the Henderson- Hasselbalch equation .
17
We can appl y the equation to our titration of sodium acetate. The pKa of acetic acid is 4.75. W e can calculate the ratio of the concentration of acetate ion to the concentration of aceti c acid as a function of pH by using the Hend erson- Hasselbach equation, slightly rearranged . [Acetate ion J/[ aceti c acid ] = [A - J/[ H A J = 10
PH
-
pK
/
' HPO 4 2 -
pK. = 7.21
H+
-==2 ====, PO 3, -
12
.•
At pH 9, thi s ratio is approximately 18, 000; very little acetic acid has been formed . At pH 4. 75 (when th e pH equals th e pK,,), the ratio is 1. At pl-l 3, the ratio is approximately 0.0 2; almost all of the acetate ion has been con verted into aceti c acid. W e can follow the conversion of acetate ion into acetic acid over the entire titration (figure 1.1 8). The graph shows that the region of relati vely constan t pH corresponds precisely to the region in which acetate ion is being protonated to form acetic acid . From thi s discussion, we see that buffers fun cti on best close to the pK. values of their acid component. Physiological pH is typically abou t 7.4. An important buffer in biological systems is based on phosphoric ac id (li,1 P04)' Th e acid can be d eprotonated in three steps to form a phosphate • Ion. H+
1.4 The Genomic Revolution
4
pK, - 12.67
10
~---i 100%
8 I
0.
6 4
2
o
'----L---=',-----c'-:c----:L---:::----:' 0% o 10 20 30 40 50 60
Number of drops Figure 1.18 Buffer protonation. When acid IS added to sodium acetate, the added hydrogen ions are used to convert acetate ion Into acetic acid. Because the proton con cen tra tion does not increase
signi ficantly. the pH remains relatively constant until all of the acetate has been converled in to acetic acid.
At about pH 7.4. inorganic phosphate exists primaril y as a nearl y equal mixture of H)'04 - and I-IPOl . Thus, phosp hate solutions function as effective buffers near pH 7.4. Th e concentration of inorganic phosphate in blood is typi cally approximately 1 mM, providing a useful buffer again st processes that produce either acid or base.
1.4
The Genomic Revolution Is Transforming Biochemistry and Medicine
Watso n a.nd C ri ck's di scover y of th e stru cture of DNA suggested th e hypothesis that hereditary informat ion is stored as a sequ ence of bases along long strands of D NA . This rema rkabl e ins ight prov ided an entirely new way of thinking about bi ology. H owever, at the time that it was made, thei r discovery wa full of poten tial bu t th e practi ca l con sequences were uncl ear. Trem endously fund amenta l ques tion s rem ained to be addressed . Is the hypoth es is correct ? H ow is the sequen ce information read and tra nslated into acti on ? What are the sequences o f naturall y occ urrin g DNA molecul es and b ow ca n s uch sequ ences be exp erimentall y tlctermined ? Throu gh ad van ces in bi ochemistry and relatetl sciences, we now have essenti all y co mpl ete an swers to these qu estio ns. ln deed , in the past decade, sc ientists have d etermtned the compl ete genom e sequences of hundred s of different orga ni sm s, including simple microorgani 'm s, plants, anim als of varying degrees of complexity, and hum an bein gs. Co mpari sons of th ese genom e seq uences with the use of method s introduced in C hapter 6 h ave been sources of in sight into many aspect.s of bi ochemi stry. Beca u. e of these achievem ents, biochemistry has been t ransform ed . In addition to its E:-x per imelltal and clini cal as pects, biochemistry has now becom e an information science.
18 CHAPTER 1 Biochemistry: An Evolving Science
The Sequencing of the Human Genome Is a Landmark in Human History
The sequenclng of th e human genome was a daunting task because it contain s approximately 3 billion (3 X 1 OQ) ba e pairs. For exan1ple. the seq uence ACATTT GCTTCTGACACAACTGTGTTCACTAGCAACCTC AAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGT r '.TGCCGTT AG rGCCCTGTGGGGCAAGGTGAACGTGGA .. _ is a part of one of the gelJes thal encodes hemog lobin. the oxygen carrier in our blood , T his gene is found on th e end of chromosome 9 among our _4 distinct ch romosomes. If we were to include the co mp lete seq uence of our entire genome, thi s chapter would run for more than 500 ,000 pages. The sequencing of our genome is trul y a landmark in human hi story. This seq uence co ntains a vast amount of information. some o f whi ch we can now extract and interpret, but much of whi ch we are onl y begi nnin g to understand. r'o r example, some hum an diseases have been linked to particular variations in genomic seq uence. Sickle -cell anemi a, di scussed in detail in C hapter 7, is caused by a single base change of an .1\ (noted in boldface type in the preceding sequence) to a T. W e wi ll e.ncounter many other exa mp les of diseases that have been linked to specific D A seyuence changes. in addition to the implications fo r understanding human health and disease, the genome sequence is a source of deep insight into other aspects of human biology and culture. For exampl e, by comparing the sequences of different indivi dual persons and popu lations. we can learn a great deal about human history. O n the basis of such analysis, aco mpelling case can be made that the human species originated in Africa, and the occurrence and even the timin g of important migrations of groups of human beings an be d emonstrated . fina lly, compariso ns o f the human genome with the genomes of other organisms are confirmin g th e t remendous unity that exists at the level of biochemistry and are revealing key steps that have been taken in the course of evolution from relatively simple. single-celled organisms to complex, multicellul ar orga ni sms such as human beings. For example, many genes key to the fun cti on of the human brain and nervous system have evoluti onary and functi onal relati ves that can be recognized in th e genomes of bacteria. Because many studi es that are possible in model organisms are diffi cult or unethical to conduct in human beings, th ese discov eries have many practical implications. Comparative genomics has become a powerful science. linking evolution and biochenustry. Genome Sequences Encode Proteins and Patterns of Expression
The structure of DNA revealed how information is tared in the base sequence along a DNA strand. But what information is stored and how is tlus information expressed? The most fUlldam en tal role of D A is to encode the sequences of protei ns. Like D A, protei ns are linea r polymers . However. proteins differ from DNA in two important ways. First. prote ins are built from 20 building blocks, called amino acids, rather than just four, as are present in DNA. T he chenucal co mpl exity provided by this variety of building blocks enables proteins to perform a wide range of functions. Second. proteins spontaneously fold up into elaborate three-dimensional stru ctures, determined only by th eir amino acid sequ nces (Figure 1.19). W have explored in depth how sol utions containin g two appropriate
19 1.4 The Genomic Revolution )
Amino acid sequence 1
Figure 1.19 Protein folding . Proteins are linear polymers of am ino acids that fo ld
> Amino add sequence 1
into elabo rate structures. The sequence
of amino acids determ ines t he threedimenSional struaure. Thus amino acid sequence 1 gives rise only to a pro tein w ith the shape depia ed in blue. nor the shape depicted in red
strands of DNA come togeth er to form a sol ution of double -heli cal molecules. A similar spontaneous folding process gives proteins their threedimensional structur e. A balance of hydrogen bonding, van der W aals in tcractions, and hydrophobic interactions overcome the entTopy lost in going fro m an unfolded ensemble of proteins to a homogenous set of well -folded molecules. Proteins and protein folding will be di scussed extensively in Chapter 2. Th e fund amental unit of hereditary information, th e gene, is hecoming increasingly difficult to precisely define as our knowl edge of the complexi ties of genetics and genomi cs in creases. The genes that are simplest to define encode the sequences of proteins. For these protein -encoding genes, a block ofDN/\ bases encodes the amino acid sequence of a specific protein molecule. A set o[ three bases al ong th e DNA strand , called a codon , deter mines th e identity of one amino acid within the protein sequence. T he relalion that links the D NA sequence to the encoded protein sequence is call ed the genetic code. O ne of the biggest surprises from the sequencing of the human genome is the small number of protein- encoding genes. Before U1 C genome- sequencing proj ect began, the consensus view was th at th e hum an genome wou ld indude approximately 100,000 protein- encoding genes. T he current anal ysi · 'uggests that the actual number is between 20,000 ,lnd 25,000 . W e shall use an estimate of 25.000 throu ghout trus book. H owever, additional mechanisms allow man y genes to encode more than olle protein. For exampl e, the genetic i.nforrnation in some genes is translated in more than one way to prod uce a set of proteins that differ [rom one another in parts of their amino acid sequ ences. In other cases, proteins are modified after they are sy nthesized through the addition of accessory chemical groups. Throu gh these indirect mechanisms. much more complex ity is en coded in our genomes than would be expected [rom the number of protein encoding genes alone. O n the bas is o f current knowled ge. the protein -encoding regions ac COLlnt for onl y about 3% of the human genom e. What is th e fun ction of the rest of the DNA ? -'ome of it contains i.nform ati on that regulates the expression of specifi c genes (i.e., th e production of specific proteins ) in particul ar cell types and physiological conditions. Essenti all y every cell contains the same 0 IA genome, yet cell types d iffe r considerably in the proteins that they produ ce . For example, hemoglobin is expressed only in precursors of red blood cells. even though the genes for hem oglobin are
-
20 CHAPTER 1 Biochemistry: An EvolVing Science
present in essenti all y every cell. Specific sets of genes are expressed in response to hormones, even though these genes are not ex pressed in the same cell in the absence of the hormon es. The control regions that regulate such differences account [or only a small amount of the remainder of our genomes. T he truth is that we do not yet understand all of the fun ction of much of the remainder of the 0 A. Some of it appears to be "j unk ," stretches of ON A that were inserted at som e stage of evolution and have remained . In some cases, thi s DNA may, in fa ct, serve important functions. In others, it may serve no function but, because it does not cause signifi cant harm , it has remained . Individuality Depends on the Interplay Between Genes and Environment
V,/ith the exception of monozygotic (" identical" ) t.wins, each person has a unique sequence of ON A base pairs. H ow different are we from one another at the genomic level ? An examination of variation across the genom e reveals that, on average, each pair of individual people has a different base in one position per thousand ; that is, the difference is approximately 0. 1'Yo. T his person -to -person vari ation is quite substantial compared with differences in populations. T hu s, the average difference between two people within one ethnic group is greater than the difference between the averages of two differen t ethn ic groups. The signifi cance of much of this genetic varia tion is not understood . A s noted earlier, variation in a single base within the genome can lead to a disease such as sickle-cell anemi a. Scienti sts have now identi fied the genetic variations associated with more than 100 diseases [or which the cause can be traced to a single gene . .Par other diseases and traits, we know that variation in many different genes contributes in significant and often compl ex ways. Many of the most prevalent human ailruents such as heart di sease are linked to variations in many genes . Furthermore, in most cases, the presence of a particular vari ation or set of variations does not in evitabl y result in the onset of a di sease but, instead, leads to a predisposition to the development of the disease. In addition to these geneti c differences, epigenetic f actors are important . They are factors associated with the genome but not simply represented in the seq uence of DNA. For example, th e conseq uences of so me of this genetic variation depend , often dramaticall y, on whether the unusual gene sequence is inherited from the mother or [rom the father. This phenomenon, kn own as genetic imprinting, depends on the co valent modification of DNA, particularl y the additi.on of methyl groups to particular bases. Epigenetics is a very active field of study and many novel discoveries can be expected . A lthoug h our genetic makeup and associated epigenetic character istics are importan t factors that contribute to di sease susceptibility and to other trails, factors in a person's environment also are signifi ca nt. What are these envi ronmental factor s? Perhaps th e most obvious are chem icals that we eat or are exposed to in some other way. The adage" yo u are what you eat" has considerable validi ty; it appli es both to substances that we ingest in significan t quantities and to those that we ingest in onl y t race amounts. T hroughout ou r st ud y of biochemi stry, we will encounter vi tamins and trace elements and their derivatives that play cru cial roles in man y processes. In man y cases, the roles o[ these chemical s were first revealed throu gh in vestigation of deficiency disorders observed in people who do not take in a sufficie nt qu antity of a particular vitamin or trace element. D espite the fact that the most important vitamins and trace elements have
Figure 1.20 Food pyramid. A heal thful diet includes a balance of food groups to supply an appropriate suppl y of calories and an appropria te mixture of biochemical building blocks. [Courtesy of t he U. 5 Department of Agriculture.)
Grains
Vegetables Fruits Oils Milk
Meats and beans
been know n [or som e time , new roles for these essential d ietary factors co n tinue to be di scovered . A healthful diet requires a balance of major food groups (Figure 1.20), In addition to prov iding vitamins and trace elements, food provides calories In the form of substances that can be broken down to release energy to dri ve other biochemi cal processes. Protein s, fats, and carbohydrates provide the building blocks used to construct the molecules oflife. Fi nall y, it is possible to get too much of a good thing. Human beings evolved under circum stances in which food , parti cularly rich foods such as meat, was scarce, W ith the development of agriculture and modern econom ies, rich foods are now plentiful in parts of th world . Some o[ the most prevalent diseases in the so -call ed developed world , such as heart disease and diabetes, can be attributed to the large quantities of fats and carbohydrates that are present in modern diets. We are now developing a deeper understanding of the biochemical consequences of these diets and the interplay between diet and genetic factors. Chemical s are only one importan t class of environmental factors. T he behaviors in which we engage also have biochemical consequ ences. Through physical acti vity, we consume the calories that we take in, en suring an appropriate balance between food intake an d energy expenditure . A ctivities ranging from exercise to emotional responses such as fear and love may activate specifi c biochemical pathways, leading to changes in levels of gene expres sion, th release of hormones, and other consequences. For exampl e, recen t discoveries reveal that high stress levels are assoc iated with the shortening of telomeres, stru ctures at the end s of chromosomes. Furthermore, the interp lay between biochemistry and behavior is bi lirectional. JlIst as our biochemistry is affected by ollr behavior, so, too, our hehavior is affected , a1thollgh certainly not completely determined, by our genetic makeup and other aspects of our biochemi stry. Genetic factors associated with a range of behavioral characteristics have been at least tentatively identified. Ju st as vitamin deficiencies and genetic di seases reveal ed fundam enta l prin cipl es of bi ochemistry and biology, investigati ons of variations in hehavi or and their linkage to gen etic and biochemical [actors are potential sources of great insight into mechani sms within the brain . For example , studi e of dw g addiction have revealed neural circuits and biochemi cal pathways that greatl y influence aspects of beha vior. U nraveling the interplay between biology and behavior is one of t he great chall enges in m odern science, and b ioch emistry is providi ng some of the most important concepts and tools for this endeavor.
21 1.4 The Genomic Revolution
22
CHAPTER 1 Biochemistry: An Evolving Science
APPEND IX: Visualizing Molecular Structures I: Small Molecules The aut hor ' of a biochemistry textbook face the problem of trying to present three-dimensiunaL moLecuLes in the two dimens ions ava il able on the pri nted page. T he in terplay between the three-dimensional structu res ofbiomolecul es and their biulogical functions will be discussed extensively throughout thi s book. Toward this end, we will frequentl y u se representations that, although of necessity are rendered in two dimensiuns, emphasize the th ree-dimensional structures of molecules. Stereochemical Renderings
Most of the chemical formulas in lhis book are drawn to depict the geometric arrangement of atoms, crucial to chemical bonding and reactivity, as accurately as possi ble. For example, the carbon atom of methane is sp:l hybridized and tetrahedral, with H-C~H angles of 109.5 degrees, w the carbon atom in formaldehyde is sp2 hybridized with bond angles of 120 degrees . H
\ _.'
o II
H
/ c" H H
H/
C
"H
To illustrate the cor rect stereochemistry about tetra hedral carbon atoms, wedges will be used to depict the di rection of a bond into or out of the plane of the page. A solid wedge with the broad end away from the carbon atom denotes a bond coming toward the vi ewer out of the plane. A dashed wedge, with its broad end at the ca rbon atom, represents a bond guing away from the viewer behind the plane of the page. The remaining two bonds are depicted a straight li nes.
Although representative of the actual ~t ructure of a com pound, stereochem ical structures are often diffi cult to draw q uickly, An alternaLive, less -representative method of depicting with tetrahedral carbon cen.ters relies on the use of Fischer projections.
w
w
x y
Fur depicting the m ol.ecular architecture of small mol ecules in more detail, two types of models will often be used : space filling and ball and st ick. These models how structLlfes at the atomi c level. the most realistic , The size and position of an atom in a space-f illing m odel are determined by its bond in g properties and van der Waals radius, or contact di stance. A van d er W aals rad iu s describes how closely two atoms can approach each other w hen they are not linked by a covalent bond, T he colors of the model are set by • conventi on, C arbon , black H ydrogen, white Nitrogen , blue Oxygen, red Sul fur, yellow Phosphorus, purple pace-f illing m odels of several simpl e molecul es are shown in Figure 1.21.
2. Ball-and-Stick Models . Ball -and -stick models are
Fische r Projectio ns
Z
Molecular Models fo r Small Mo lecules
1. Space -Pilling Models. T he space-filling models are
Formaldehyde
Methane
In a Fischer projection, the bonds to the central carbon are represented by hori zontal and vertical lines from the substituen t atom s to the carbon atom, which is assumed to be at the center of the cross. By convention, the hori zontal bonds are assumed to project out of the page toward the viewer, whereas the vertical bonds are assumed to project behind the page away from the viewer. The Glossary of Compound s found at the back of the book is a structural glossary of the key molecules in biochemistry, each presented in two forms: with stereochemically accu rate bond angles and as a Fisher projection.
~
z
-C ---y -
z w X
Fischer
projection
-
~
\ /
° 2
'-
Figure 7.11 Concerted model. All molecules exist either in the T state or in the R stat e. At each level o f oxygen loading, an equilibrium exists between the T and R states. The equilibrium shifts from strongly favoring the T state w ith no oxygen bound to strongly favoring the R state when the molecule is ful ly loaded with oxygen. The R state has a greater affinity for oxygen than does the T state.
R-state binding curve ;;:. • -• •
- .:..0 - -~ - - ;.... - ~--
1.0 ~
c
.-o
•• • • •
0 .8
~
~
••
:::I
-;0 0.6
-'"
'".-co
Observed hemoglobinbinding curve
••
• •
0.4
tJ
• •
,•
~
• ~ 0.2 • >-
0.0
o
.•
.'
• • • '
.'
• •
••
••• •
.-----
•••••• T-state binding curve 50
100
150
200
pO, (torr) Figure 7.12 T-to·R transition. The observed binding curve for hemoglobin can be seen as a com bination o f t he binding curves t hat woul d be o bserved if all molecules remained in the T stat e or if all o f t he mo l ecules were in the R state. The sigmoidal curve is o bserved because molecu les convert from the T stat e int o the R state as o xygen molecules bind.
oxygen affinity of its sites increases. Additional oxygen molecules are now more likely to bind to the three unoccupied sites. Thus, the b ' nding curve is shallow at low oxygen concentrations when all of the molecules are in the T state, becomes steeper as the fraction of molecules in the R state increases, and flattens out again when all of the sites within the R -state molecules become filled (Figure 7.12). These events produce the sigmoid binding curve so important for efficient oxygen transport . In the concerted model, each tetramer can exist in only two states, the T state and the R state. In an alternative model, the sequential model , the binding of a ligand to one site in an assembly increases the binding affinity of neighboring sites without inducing a full conversion from the T into the R state (Figure 7. 13).
,
K, ~
O2
'\
,
K, >
0,
O2
Figure 7.13 Sequential model. The binding o f a ligand changes the confo rmati o n o f the subunit to w hich it b inds. Thi s confo rmati onal change induces changes in neighboring subunit s that increase their affin it y for t he ligand.
Is the cooperative binding of oxygen by hemoglobin best described by the concerted or the sequential model? Neither model in its pure form full y accounts for the behavior of hemoglobin . Instead, a combined model is required . H emoglobin behavior is concerted in that hemoglobin with three sites occupied by oxygen is almost always in the quaternary stru cture associated with the R state. The remaining open binding site has an affinity for oxygen more than 20-fo ld greater than that of fully deoxygenated hemoglobin binding its first oxygen. However, the behavior is not fully concerted, because hemoglobin with oxygen bound to only one of four sites remains primarily in the T-state quaternary structure. Yet, this molecule binds oxygen three times as strongly as does fully deoxygenated hemoglobin, an observation consistent only with a sequential model. These results highlight the fact that the concerted and sequential models represent idealized limiting cases, which real systems may approach but rarely attain . Structural Changes at the Heme Groups Are Transmitted to the cxlf31-cx2f32 Interface
0. , ~,- 0.2~2 interface
\ Deoxyhemoglobin
Oxyhemoglobin Figure 7.14 Conformational changes in hemoglobin. The movement of th e iro n ion o n oxygenat ion bri ngs t he iro nassociated histi d ine res idue toward the porphyrin ring. The associat ed movement of the h istid ine-con t ain ing a helix alters t he interface bet ween the a J3 dimers. inst igating o th er structural changes. For compari son, the deoxyhemoglo bin st ructure is shown in gray beh ind the oxyhemoglobin stru cture in co lo r.
We now examine how oxygen binding at one site is able to shift the equilibrium between the T and R states of the entire hemoglobin tetramer. As in myoglobin, oxygen binding causes each iron atom in hemoglobin to move from outside the plane of the porphyrin into the plane. When the iron atom moves, the histidine residue bound in the fifth coordination site moves with it. This histidine residue is part of an ex helix, which also moves (Figure 7.14). The carboxyl terminal end of this ex helix lies in the interface between the two ex[3 dimers. The change in position of the carboxyl terminal end of the helix favors the T -to -R transition. Consequently, the structural transition at the iron ion in one subunit is directly transmitted to the other subunits. T he rearrangement of the dimer interface provides a pathway for communication between subunits, enabling the cooperative binding of oxygen. 2,3-Bisphosphoglycerate in Red Cells Is Crucial in Determining the Oxygen Affinity of Hemoglobin
For hemoglobin to function effi ciently, a requirement is that the T state remain stable until the binding of sufficient oxygen has converted it into the
190 •
19 1
Rstate. The T state of hemoglobin is highly unstable, however, pushing the equilibrium so far toward the R state that little oxygen would be released in physiological conditions. Thus, an additional mechanism is needed to properly stabilize the T state. This mechanism was discovered by comparing the oxygen-binding properties of hemoglobin in red blood cells with fully purified hemoglobin (Figure 7.15). Pure hemoglobin binds oxygen much more tightly than does hemoglobin in red blood cells. This dramatic difference is due to the presence within these cells of 2,3-bisphosphoglycerate (2,3 -BPG; also known as 2,3 -diphosphoglycerate or 2,3-DPG) .
7.2 Cooperative Binding of Oxygen
Pure hemoglobin lungs (no 2,3-BPG)
Tissues 1.0
'2 o .-
-
Hemoglobin (in red celis, with 2,3-BPG)
0.8
~
66%
::J
- .0 ./ 0 ,-, H .-.--
~ 0.6
"'oc .-
0.4
---
U
~
~.
0 .2
>0.0
2,3-Bisphosphoglycerate (2.3-BPG)
20
50
100
150
200
p02 (torr)
This highly anionic compound is present in red blood cells at approximately the same concentration as that of hemoglobin (-2 mM). Without 2,3 -BPG, hemoglobin would be an extremely inefficient oxygen transporter, releasing only 8% of its cargo in the tissues. How does 2,3 -BPG lower the oxygen affinity of hemoglobin so significantly? Examination of the crystaJ structure of deoxyhemoglobin in the presence of2,3-BPG reveals that a si ngle molecule of 2,3 -BPG binds in the center of the telramer, in a pocket present only in the T form (Figure 7.16). On T-to- R transition, this pocket collapses and 2,3-BPG is released . Thus, in order for the structuraJ transition from T to R to take place, the bonds between hemoglobin and 2,3 -BPG must be broken. In the presence of 2,3 -BPG, more oxygen -binding sites within the hemoglobin tetramer must be occupied in order to induce the T-to-R transition, and so hemoglobi n remains in the lower-affinity T state until higher oxygen concentrations are reached. The regulation of hemoglobin by 2,3-BPG is remarkable because 2,3 -BPG does not in any way resemble oxygen, the molecule on which hemoglobin
~1 subunit
Figure 7.15 Oxygen binding by pure hemog lobin compared with hemoglobin in red blood cells. Pure hemoglobin binds oxygen more tightly than does hemoglobin in red bloo d cells. This difference is due to the presence o f 2,3-bisphosphoglycerate (2,3-BPG) in red blood cells.
N
o His 2
Lys 82
o His 143
~2 His 2
"ll
o
~ 2 subunit
Figure 7.16 Mode of binding of 2,3-BPG to human deoxyhemoglobin. 2,3-Bisphosphoglycerate binds to the central cavity o f deoxyhemoglobin (left). There. it interacts with three positively charged groups on each J3 chain (right). [Drawn from 1B86.pdb.]
1.0 ~
0 .-"
--'"'"
Materna l red cells
0.8
~
:J
carries out its primary function. 2,3-BPG is referred to as an allosteric effeC!01 (from alios, "other," and stereos, "structure" ). Regulation by a molecule structurally unrelated to oxygen is possible because the allosteric effector binds to a site that is completely distinct from that for oxygen. We will encounter allosteric effects again when we consider enzyme regulation in C hapter 10.
Fetal red cells
0.6
'""0
.- 0.4 U
02 flows from matern al oxyhemoglobin to fetal deoxyhemoglobin
-'"
::::.. 0.2
"0.0
0
50
100
p02 (torr) Figure 7.17 Oxygen affinity of fetal red blood cells. Fetal red blood cells have a higher oxygen affinity than maternal red blood cells because fetal hemoglobin does no t bind 2,3-BPG as well as materna l hemoglobin does.
The binding of 2,3 -BPG to hemoglobin has other crucial physiological consequences. The globin gene expressed by human fetuses differs from that expressed by adults;fetal hemoglobin tetramers include two a chains and two 'Y chains. The 'Y chain, a result of another gene duplication, is 72% identical in amino acid sequence with the 13 chain. One noteworthy change is the substitution of a serine residue for His 143 in the 13 chain, part of the 2,:1BPG-binding site. This change removes two positive charges from the 2,3BPG -binding site (one from each chain) and reduces the affinity of 2,3-BPG for fetal hemoglobin . Consequently, the oxygen-binding affinity of fetal hemoglobin is higher than that of maternal (adult) hemoglobin (Figure 7.1 7). This difference in oxygen affinity allows oxygen to be effectively transferred from maternal to fetal red blood cells. We have here an example in which gene duplication and specialization produced a ready solution to a biological challenge in this case, the transport of oxygen from mother to fetus .
7.3
Tissues
r-
1.0 ~
66%
"-
0 0.8 .-
--'" -'"'" :J
'""0
·e '" ~
-
Lungs
0.6
77%
0.4
----
0 .2
"-
0.0
o
100
20
p02 (torr) Figure 7.18 Effect of pH on the oxygen affinity of hemoglobin. Lowering the pH from 7.4 (red curve) t o 7.2 (blue curve) results in the relea se of O 2 f rom o xyhemoglo bin.
192
Hydrogen Ions and Carbon Dioxide Promote the Release of Oxygen: The Bohr Effect
W e have seen how hemoglobin's cooperative release of oxygen helps deliver oxygen to tissues where it is most needed, as revealed by their low oxygen partial pressure. This ability is enhanced by the ability of hemoglobin to respond to other cues in its physiological environment signaling the need for oxygen . Rapidly metabolizing tissues, such as contracting muscle, generate large amounts of hydrogen ions and carbon dioxide (pp. 447 and 448). So that oxygen is released where the need is greatest, hemoglobin has evolved to release oxygen more readily in response to higher levels of these substances. Like 2,3-BPG, hydrogen ions and carbon dioxide are allosteric effectors of hemoglobin that bind to sites on the molecule that are distinci from the oxygen-binding sites. The regulation of oxygen binding by hydrogen ions and carbon dioxide is called the Bohr effect after Christian Bohr, who described this phenomenon in 1904. The oxygen affinity of hemoglobin decreases as pH decreases from a value of?.4 (Figure 7 .18). Consequently, as hemoglobin moves into a region oflower pH, its tendency to release oxygen increases. For example, transport from the lungs, with pH 7.4 and an oxygen partial pressure of 100 torr, to active muscle, with a pH of 7.2 and an oxygen partial pressure of 20 torr, results in a release of oxygen amounting to 77% of total carrying capacity. Only 66% of the oxygen would be released in the absence of any change in pH Structural and chemical studies have revealed much about the chemical basis of the pH effect. At least two sets of chemical groups are responsible for the effect: the a-amino groups at the amino termini of the a chain and the side chains of histidines 13146 and a1 22, all of which have pKa values near pH 7. Consider histidine 13146, the residue at the C terminus of the 13 chain. In deoxyhemoglobin, the terminal carboxylate group of 13146 forms a salt bridge with a lysine residue in the a subunit of the other al3 dimer. This interaction locks the side chain of histidine 13146 in a position from which it can participate in a salt bridge with negatively charged aspartate 94 in the same chain, provided that the imidazole group of the histidine residue is protonated (Figure 7.19). The other groups also participate in salt bridges in the T state. The for-
mation of these salt bridges stabilizes the T state, leading to a greater tendency
193 7.3 The Bohr Effect !X2
Lys 40
C terminus Added proton
+
131 Asp 94
PI His 146
Figure 7.l9 Chemical basis of the Bohr effect. In deoxyhemoglobin, three amino acid residues form two salt bridges that stabilize the T quaternary structure. The formatio n of one of the salt bridges depends o n t he presence o f an added proton on histid ine 13146. The proximity of th e negative charge on aspartate 1394 in deoxyhemoglobin favors protonation of thi s histidine. Notice th at the salt bridge bet ween histidine 13146 and aspartat e 1394 is stabilized by a hydrogen bond (green dashed line).
for oxygen to be released. For example, at high pH, the side chain of histidine ~146 is not protonated and the salt bridge does not form. As the pH drops,
however, the side ch ain of histidine [3146 becomes protonated, the salt bridge with as partate [394 forms, and the T state is stabilized. Carbon dioxide, a neutral species, passes through the red-blood- cell membrane into the cell. This transport is also facilitated by membrane transporters including proteins associated with Rh blood types. Carbon dioxide stimulates oxygen release by two mechanisms. First, the presence of high con centrations of carbon dioxideleads to a drop in pH within the red blood cell (Figure 7.20).
o o
o o ,
CO 2
=
0 1\
y
Body tissue
y
,
Blood capillary
Figure 7.20 Carbon dioxide and pH. Carbon d iox ide in the ti ssues diffuses into red blood cells. Inside a red blood cell, carbon diox ide react s w ith water to form carbonic acid, in a reaction catalyzed by the enzym e carbonic anhydrase. Carbo nic acid dissociates to form HCO, - and H+, resulting in a drop in pH inside the red cell.
•
pH 7.4, no CO 2
-
pH 7 .2,
-
pH
no CO 2 7.2, 40 torr CO 2
Tissues
Lungs
1.0 ~
c:
-
Carbon dioxide reacts with water to form carbonic acid, H 2 C0 3 . This reaction is accelerated by carbonic anhydrase, an enzyme abundant in red blood cells that will be considered extensively in C hapter 9. Carbonic acid is a strong acid with a pKa of3.S. Thus, once formed, carbonic acid dissociates to form bicarbonate ion, HCO:l - , and H+, resulting in a drop in pH. This drop in pH stabilizes the T state by the mechanism discussed previou sly. In the second m echanism, a direct chemical interaction between carbon dioxide and hemoglobin stimulates oxygen release. The effect of carbon dioxide on oxygen affinity can be seen by comparing oxygen-bindin g curves in the absence and presence of carbon dioxide at a constant pH (Figure 7.21). In the presence of carbon dioxide at a partial pressure of 40 torr at pH 7.2 , the am ount of oxygen released approaches 90% of t he maxi • mum carrylllg capacity.
-
.-o -~'" -'" '"oc: .-ti :::I
0.8 0.6
88%
0.4
(!!
to:"... 0.2
----- --
"0.0
o
20
100
p02 (torr) Figure 7.21 Carbon dioxide effects. The presence of carbon dioxide decreases the affinity of hemoglobin for oxygen even beyond the effect due to a decrease in pH, resulting in even more efficient oxygen transport from the tissues to the lungs.
194 CHAPTER 7 Hemoglobin: Portrait of a Protein in Action
Carbon dioxide stabili zes deoxyhemoglobin by reacting with the terminal amino groups to form carbamate groups, which are negatively charged, in contrast with the neutral or positive charges on the free amino groups. R
\
,N- H H
° + °
R
II
C
•
-
0.0
o
50
100
150
200
pO, (torr) Figure 7.29 Oxygen-binding curves for several Hill coefficients. The curve labeled n = 2.8 closely resembles the curve for hemoglobin.
The Concerted Model
The concerted model can be formulated in quantitative terms. Only four parameters are required: (1) the number of binding sites (assumed to be equivalent) in the protein, (2) the ratio of the concentrations of the T and R states in the absence of bound ligands, (3 ) the affinity
This is the measure of how much more tightly a subunit for a protein in the R state binds a ligand compared with a subunit for a protein in the T state. Note that c < 1 beca use KR and KT are dissociation constants and tight binding corresponds to a small dissociation constant. What is the ratio of the concentration of T-state proteins with one ligand bound to the concentration of R-state proteins with one ligand bound? The dissociation constant for a single site in the R state is K R. For a protein with n sites, there are n possible sites for the first ligand to bind. This statistical factor favors ligand binding compared with a single-site protein. Thus, [Rd = n [Ro][S]/KR ' Similarly, [T d = 11 [T 0] [S]/KT ' Thus,
Appendix
Similar analysis reveals that, for states with i ligands bound, [Ti]/[R ] = e'L. In other words, the ratio of the concentrations of the T state to the R state is reduced by a factor of e for each ligand that binds. Let us define a convenient scale for the concentration of S:
1.0
20 1
r-
0.8
0.6
a = [S]!KR
This defillition is useful because it is the ratio of the concentration of S to the dissociation constant that de termines the extent of binding. Using this definition, we see that
[R,l
=
n[Rol[Sl KR
=
n[Rola
0.4
0 .2
0.0
a
50
150
200
p02 (torr)
Similal'iy,
[T, l
ll[Tol[Sl K[
=
=
llcL [Rola
What is the concentration ofR-state molecules with two li gands bound? Again, we must consider the statistical factor that is, the number of ways in which a second ligand can bind to a molecule with one site occupied. The number of ways is n - 1. H owever, because which ligand is the "first" and which is the "second" does not matter, we must divide by a factor of 2. Thus, / 11
[Rzl
=
[R ll[Sl
KR n- 1 [RIJa 2 n- 1 (n [ RoJa)"
=
2
n
n -
1
2
[Rol" z
We can derive similar equations for the case with i ligands bound and for T states. We can now calculate the fractional saturation, Y. This is the total concentration of sites with li gands bound divided by the total concentration of potential binding sites . Thus,
([ Rll + [T I]) + 2([R2l + [T z]) + ...
+ n([ Knl + [Tn ]) Y =--~~~----~~~~------~~~~~ ,,([Rol + [Tol + [ K.] + [T il + .. . + [R" l + [T"J) Substituting into this equation, we find
,,[Rola + llc[T "la + 2( n(" - 1)/2)[RoJa 2 2
Figure 7.30 Modeling oxygen binding with the concerted model. The fractional saturati on (Y) as a functi o n p02: L = 9000, C = 0.014. and KR = 2.5 torr. The fraction of molecules in the T state with zero, one, and two o xygen molecules bound (To, TI , and T, ) and the fraction of molecules in the R state with two, three, and four oxygen mo lecules bound (R" R3, and R.,) are shown. The fractions of molecules in other forms are t oo low to be shown .
Substituting (Tal - L[Rol and summi ng these series yields
1'
-
2
-
y=
100
Z
+ 2(" (,, - 1)/2)c [T ola + ... + n[RoJa" + llc"[T oJla " n([ Rol + lTol + n[Rola + nc[T ola + ... + [Rola " + c" [T ol,,")
y =
a (1 +
+ Lca(l + cu ),, - ' --'---.,---'---:-----,---'----'-(1 + a)" + L(l + cu)" U )" - I
We can now use this equation to fit the observed data for hemoglobin by varying the parameters L, e, and Ki{ (with n =4 ). An excell ent fit is obtained with L = 9000 , e = 0.014, and KR = 2 .5 torr (Figure 7.30). In addition to the fractional saturation, the concentra tions of the species T o, T j, T Z, R 2 , R 3 , and ~ are shown . The concentrations of all other species are very low. The addition of concentrations is a major difference between the analysis using the Hill equation and this analysis of the concerted model. The Hill equation gives only the fractional saturation, whereas the analysis of the concerted model yields concentrations for all species. In the present case, this analysis yields the expected ratio ofTstate proteins to R -state proteins at each stage of bind ing. This ratio changes from 9000 to 126 to 1.76 to 0.02 5 to 0.00035 with zero, one, two, three, and four oxygen m olecules bound . This ratio provides a quanti tative measure of the switching of the population of he moglobin molecules from the T state to the R state. The sequential model can also be formulated in quantitative terms. However, the formulation entails many more parameters, and many different sets of parameters often yield similar fits to the experimental data.
202
CHAPTER 7 Hemo globin: Portrait of a Protein in Action
Key Terms heme (p . 184 )
partial pressure (p . 187)
sic kle -cell anemia (p . 194 )
protoporphy rin ( p. 184 )
sigmoid (p . 187)
h e mog lobin S (p . 195)
proximal histidine (p . 185 )
cooperative (p . 187)
malaria (p.196)
func tio nal mag ne tic resonance imaging (fMR l) (p. 185)
T state (p . 188) R state (p . 188)
thalassemia (p . 196)
superoxid e anion (p. 185 ) m etmyoglobin (p . 185)
concerted mode l (MWC model) (p. 189)
thalassemia major (Cooley ane mia) (p. 196)
d istal histidine (p . 186)
sequential model (p . 190)
a chain (p . 186)
2,3 -bisphosphoglycerate (p . 191)
a - h em oglobin stabilizing prote in (AHSP) (p . 197)
j3 chain (p . 186)
fetal h e m oglo bin (p . 192 )
n e uroglo bin (p. 197)
g lobin fold (p . 186)
Bo hr effect (p . 192)
cytuglobin (p . 197 )
aj3 dime r (p . 187)
carbonic anhydrase (p. 193 )
Hill plot (p . 200)
oxygen-binding c ur ve (p . 187)
carbamate (p . 19 4 )
Hill coefficient (p . 200)
he moglobin H (p . 196)
fraction a l saturation (p . 187)
•
Selected Readings Where to Start Perutz, M . F. 1978. Hemoglobin structure and respiratory transport.
Sickle-Cell Anemia and Thalasssemia Herrick, J . ]). 1910. Peculiar elongated and sickle-shaped red blood cor·
Sci. Am. 239(6):92- 125. Perutz, M . F. 1980. ~tereochemical mechanism of oxygen transport by haemoglobin. Proc. R Soc. Lond. Biul. S the turnover number, . as described above. However, most enzymes are not normally saturated with substrate. Under physiological conditions, the [S]/KM ratio is typically between 0.01 and 1,0. When [S1< < K ~j, the enzymatic rate is much less than kcat because most of the active sites are unoccupied. Is there a number that characterizes the kinetics of an enzyme under these more typical cellular conditions? Indeed there is, as can be shown by combining equations 14 and 20 to give
Va
=
cat k [E][S]
KM
(34)
TABLE 8.5 Turnover numbers of some enzymes
Enzyme Carbonic anhydrase 3-Ketosteroid
isomerase Acety [chol inesterase Penicillinase Lactate
dehydrogenase Chymotrypsin DNA polymerase I Tryptophan synthetase Lysozyme
Turnover number (per second) 600,000 280.000 25.000 2.000 1.000 100 15 2 0.5
222
TABLE 8.6 Substrate preferences of chymotrypsin
CHAPTER 8 Enzymes: Basic Concepts and Kinetics
Amino acid in ester
Amino acid side chain
Glycine
-H
1.3 X 10- 1
/Hl Valine
-CH
\
2.0
CH ,
Norvaline
-CH,CH,CH ,
3.6 X 10'
Norleucine
-
3.0 X 10'
Phenylalanine
-CH,-
CH,CH,CH,CH,
1.0 X 10'
Source: After A. Fersht, Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding (W. H. Freeman and Company, 1999), Table 7.3.
When [S]« K M , the concentration offree enzyme, [E], is nearly equal to the total concentration of enzyme [ElT; so
(35) Thus, when [S] « K M , the enzymatic velocity depends on the values of keat/KM , [S], and [Ely. Under these conditions, keat/KM is the rate constant for the interaction ofS and E. The rate constant keat/KM is a measure of catalytic efficiency because it takes into account both the rate of catalysis with a particular substrate (keat ) and the strength of the enzyme-substrate interaction (KM ). For instance, by using keat/KM values, one can compare an enzyme's preference for different substrates. Table 8.6 shows the keat/KM values for several different substrates of chymotrypsin. Chymotrypsin clearly has a preference for cleaving next to bulky, hydrophobic side chains. How efficient can an enzyme be? We can approach this question by determining whether there are any physical limits on the value of keat/K",. Note that this ratio depends on kl' k_I' and keat' as can be shown by substi· tuting for K M .
(36) TABLE 8.7 Enzymes for which kcat/KM is close to the diffusioncontrolled rate of encounter Enzyme Acetylcholi nesterase Carbonic anhydrase Catalase
1.6 X 10' 8.3 X 107
Crotonase
2.8 X 10 8
Fumarase
1.6 X 10 8
Triose phosphate isomerase
2.4 X 10' 1 X 108 9 7 X 10
i3-Lactamase Superoxide dismutase
4 X 10 7
Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding (W. H. Freeman and Company, 1999), Table 4.5. Source: After A, Fersht,
Suppose that the rate of formation of product (keat ) is much faster than the rate of dissociation of the ES complex (k- j ). The value of keat/KM then approaches kl . Thus, the ultimate limit on the value of keat/KM is set by kj , the rate of formation of the ES complex. This rate cannot be faster than the diffusion-controlled encounter of an enzyme and its substrate. Diffusion limits 8 9 1 the value of kl and so it cannot be higher than between 10 and 10 s -I M9 8 1 Hence, the upperlimit on keat/KM is between 10 and 10 s -I M- . The keat/KM ratios of the enzymes superoxide dismutase, acetyl8 cholinesterase, and triosephosphate isomerase are between 10 and 9 I 10 S-I M- . Enzymes that have keat/KM ratios at the upper limits have attained kinetic perfection. Their catalytic velocity is restricted only by the rate at which they encounter substrate in the solution (Table 8.7). Any further gain in catalytic rate can come only by decreasing the time for diffusion. Remember that the active site is only a small part of the total
~1l.1'lme
structure. Yet, for catalytically perfect enzymes, every encounter decween enzyme and substrate is productive. In these cases, there may be attractive electrostatic forces on the enzyme that entice the substrate to the active site. These forces are sometimes referred to poetically as Circe
effects. Diffusion in solution can also be partly overcome by confining substrates and products in the limited volume of a multienzyme complex. Indeed, some series of enzymes are associated into organized assemblies so that the product of one enzyme is very rapidly found by the next enzyme. In effect, products are channeled from one enzyme to the next, much as in an assembly line.
Circe effect The uti lization of attractive forces to lure a
substrate into a site in which it undergoes a transformation of structure. as defined by William P. Jencks. an enzymologist. who
coined the term. A goddess of Greek mythology. Circe lured Odysseus's men to her house and then transformed them into pigs,
Most Biochemical Reactions Include Multiple Substrates Most reactions in biological systems start with two substrates and yield two products. They can be represented by the bisubstrate reaction:
A+B,
'P+Q
Many such reactions transfer a functional group, such as a phosphoryl or an ammonium group, from one substrate to the other. Those that are oxidation-reduction reactions transfer electrons between substrates. Multiple substrate reactions can be divided into two classes: sequential reactions and double-displacement reactions.
Sequential Reactions. In sequential reactions, all substrates must bind to the enzyme before any product is released. Consequently, in a bisubstrate reaction, a ternary complex of the enzyme and both substrates forms. Sequential mechanisms are of two types: ordered, in which the substrates bind the enzyme in a defined sequence, and random. Many enzymes that have NAD + or NADH as a substrate exhibit the ordered sequential mechanism. Consider lactate dehydrogenase, an important enzyme in glucose metabolism (p. 447). This enzyme reduces pyruvate to lactate while oxidizing NADH to NAD + . .
+ NADH + H+ "",==:' HO
II + NAD+
C
CH 3 Lactate
In the ordered sequential mechanism, the coenzyme always binds first and the lactate is always released first, This sequence can be represented by using a notation developed by W. Wallace Cleland: NADH
Enzyme
Pyruvate
Lactate
NAD+
----iJ__--'JL-___________-.J1L-_---LJ_ Enzyme =='
E (NADH) (pyruvate) :;:,
E (lactate) (NAD+)
The enzyme exists as a ternary complex consisting of, first, the enzyme and substrates and, after catalysis, the enzyme and products, In the random sequential mechanism, the order of the addition of substrates and the release of products is random, An example of a random sequential reaction is the formation of phosphocreatine and AD P from ATP and creatine, which is catalyzed by creatine kinase (p. 416). , t
223
224 CHAPTER 8 Enzymes: Basic Concepts and Kinetics
+ ADP
Creatine
Either creatine or ATP may bind first, and either phosphocreatine or ADP may be released first. Phosphocreatine is an important energy source in muscle. Sequential random reactions also can be depicted in the Cleland notation. ATP
Creatine
Phosphocreatine
Enzyme--
111
'"
40
[11=5K; 20
o [Substrate]
226
,
pathways in the inflammatory response . Statins are drugs that reduce high cholesterol levels by competitively inhibiting a key enzyme in cholesterol biosynthesis (p. 339). In uncompetitive inhibition, the inhibitor binds only to the ES, com plex. This enzyme- sub strate- inhibitor complex, ESI, does not go on to form any product. Because some unprodu ctive ESI complex will always be present, Vmax will be lower in the presence of inhibitor than in its absence (Figure 8.18) . The uncompetitive inhibitor lowers that apparent value of K M . This occurs since the inhibitor binds to ES to form ESI , depleting ES. To maintain th e equilibrium between E and ES, more S binds to E. Thus, a lower concentration of S is required to form half of the max imal concentration of ES and the apparent value of KM is reduced . The herbicide glycophosphate, also known as Roundup, is an uncompetitive inhibitor of an enzyme in the biosynthetic pathway for aromatic amino acids. In noncompetitive inhibition (Figure 8.19), substrate can still bind to the enzyme- inhibitor complex. However, the enzyme- inhibitor- substrate complex does not proceed to form product. The value of Vmax is decreased to a new value called V~fx> whereas the value of KM is unchanged. The maximal velocity in the presence of a pure noncompetitive inhibitor, V~~fx ' is given by
227 8.5 Enzyme Inhibition
E+I
S \.
) ES + 1--7) E+P
II
Ki ESI 100
)()
No inhibitor
80 OJ
~
'"OJ ~
60
[11 ; Ki
.->
~
-'" OJ
'"
40 I I
20
[11 ; lOKi
[1) ; 5Ki
o [Substrate]
,
KM for uninhibited enzyme
K~fP for (I] ; Kj Vapp _ _ _ V-,;m ",a;,,-x_ max
1 + [IJ;Ki
(37)
Why is Vmax lowered though KM remains unchanged? In essence, the inhibitor simply lowers the concentration of functional enzyme. The resulting solution behaves like a more dilute solution of enzyme. Noncompetitive
inhibition cannot be overcome by increasing the substrate concentration. Deoxycyc1ine, an antibiotic, functions at low concentrations as a noncom petitive inhibitor of a proteolytic enzyme (collagenase). It is used to treat periodontal disease. Some of the toxic effects of lead poisoning may be due to lead's ability to act as noncompetitive inhibitor of a host of enzymes. Lead reacts with crucial sulfhydryl groups in these enzymes. Double-reciprocal plots are especially useful for distinguishing between competitive, uncompetitive, and noncompetitive inhibitors. In competitive inhibition, the intercept on the y -axis of the plot of 11 Va versus I /[S] is the
S E + I ---'\~.,.) ES --7) E + P K·I
S
EI 100
_"--c
l
ESI
)( >
No inhibitor
80
•
• •" 60
.• ->
[I] ; Ki
•
-•• 40 '" 20
[I] ; 10K;
[I] ; 5K;
o [Substrate]
,
Figure 8.19 Kinetics of a noncompetitive inhibitor. The reacti on pathway shows th at the inhibit or binds both to free enzyme and t o enzyme compl ex . Consequently. as with uncompetitive competition. Vma. cannot be attained, KM remain s unchanged. and so the reaction rate increases more slow ly at low substrate concentraticns t han is the case for uncompetiti ve com petition.
Figure 8.18 Kinetics of an uncompetitive inhibito,', The rea ction pathway sho ws that the inhibitor binds only to the enzyme-substrate complex. Consequently. Vm " cannot be atta ined. even at high subst rate concentrations. The apparent value for KM is lowered. becoming smaller as more inhibitor is added.
+ Competitive inhibitor
l /V "'- No inhibitor present
same in the presence and in the absence of inhibitor, although the slope is increased (Figure 8.20). The intercept is unchanged because a competitive inhibitor does not alter Vmax' T he increase in the slope of the 11 Va versus 1/ [S] plot indicates the strength of binding of cOlnpetitive inhibitor. In the presence of a competitive inhibitor, equation 28 is replaced by 1
1
Vo o
1/ [51
Figure B.20 Competitive inhibition illustrated on a double-reciprocal plot. A double-reciprocal plo t of enzyme ki netics in t he presence and absence of a competit ive in hibit or illustrates that t he inhi bitor has no effect on Vma> but increases KM o
+ Unncompetitive inhibitor
,~ , --/ No inhibitor present
l /V
o
1/ [SI
Figure B.21 Uncompetitive inhibition illustrated by a double-reciprocal plot. An uncompetit ive inhibitor does not effect t he slo pe of the dou ble-reciprocal plot. Vma> and KM are reduced by equivalent amounts,
I Ij 1 + -'--'KI
1
(38)
[S]
In other words, the slope of the plot is increased by the factor (1 + [IJI K j ) in the presence of a competitive inhibitor. Consider an enzyme with a KM of 10- 4 4 M . In the absence of inhibitor, Vo = Vmaxi 2 when [S] = 10- M . In the pres· ence of 2 X 10 - 3 M competitive inhibitor that is bound to the enzyme with a 3 K; of 10 - M , the apparent KM (K~P) will be equal to K M(1 + [I] I Kj), or 3 X 10 - 4 M. Substitution of these values into equation 37 gives 4 Vo = Vmax / 4, when [S] = 10- M. The presence of the competitive inhibitar thus cuts the reaction rate in half at this substrate concentration. In uncompetitive inhibition ( Figure 8.2 1), the inhibitor combines only with the enzyme- substrate complex . The equation that describes the double- reciprocal plot for an uncompetitive inhibitor is 1
Va
1
1
+- -
Vm ax
+ lIj
(39)
KI
The slope of the line, K MI V", ,,,, is the same as that for the uninhibited enzyme, b ut the intercept on the y-axis will be increased by 1 + [I ]I Kj , C onsequently, the lines in dou ble-reciprocal plots will be parallel. In noncompetitive inhibition (Figure 8.22), the inhibitor can combine with either the enzyme or the enzyme- substrate complex. In pure noncompetitive inhibition , the values of the dissociation constants of the inhibitor and enzyme and of the inhibitor and enzyme- substrate complex are equal. The value of Vmax is d ecreased to the new value V~~fx , and so the intercept on the vertical axis is increased. T he new slope, which is equal to KIV/V ~;,;" is larger by the same factor. In contrast with Vm ax , KM is not affected by pure noncompetitive inhibition .
Irreversible Inhibitors Can Be Used to Map the Active Site In Chapter 9, we will examine the chemical details of how enzymes func· tion. The fi rst step in obtaining the chemical mechanism of an enzyme is to determine what functional groups are required for enzyme activity. How can we ascertain these functional groups? X -ray crystallography of the
+ Noncompetitive inhibitor
l /V Figure B.22 Noncompetitive inhibition illustrated on a double-reCiprocal plot. A double-reciproca l plot of enzyme kinetics in the presence and absence of a no ncompetit ive inhibito r shows that KM is unaltered and V" ,., is decreased.
228
"'- No inhibitor present
o
- 1/ [SI
229 8.5 Enzyme Inhibition
H
o
{-
-
R/
"'-- R'
Hemiketal
For a ketohexose such as fructose, the C -2 keto group in the open -chain form of fructose reacts with a hydroxyl group within the same molecule to
307 11.1 Monosaccharides 0 "", " H I
C
H H 2C HO
OH
3C
o-D-Glucopyranose
H
H 4C H
OH
OH
Figure 11.4 Pyranose formation . The o pen-chain fo rm of glucose cyclizes when the C-5 hyd ro xyl gro up attacks the o xygen atom of t he C-1 aldehyde gro up to form an int ramo lecular hemiacetal. Two anome ric fo rms, designated U' and ~ , can result .
OH
sC
6 CH 2 0H D-elucose (open-chain form)
H
OH
!3-D-Glucopyranose
lorm an intramolecular hemiketal. The C -2 keto group can react with either the C-6 hydroxyl group to form a six-membered ring or the C oS hydroxyl group to form a five- m embered ring (Figure 11. 5). Thefive-membered ring is called af uranose b ecau se of its similarity to furan .
HO
o 3( -
H
H l
-
OH
H J -
OH
,
H
,
H > O"""
H
OH OH
o-Frudose (open-chain form)
H
u-D-Frudofuranose (a cyclic form of fructose)
Figure 11.5 Furanose formation . The open-cha in form of fru ct ose cyclizes to a fi ve-membered ring whe n t he C-5 hydroxyl group attacks t he C-2 keto ne t o form an intramo lecular hem ike tal. Two ano mers are possible, but only the a ano mer is sho wn.
The depictions of glucopyranose and fru ctofuranose shown in F igures 11.4 and 11, S are Haworth prujections. In such projections, the carbon atoms in the ring are not explicitly shown , The approx im ate pl ane of the ring is perpendicular to the plane of the paper, with the heavy line on the ring projecting toward the read er. L ike F ischer projection s, H aworth projection s ~low easy depiction of the stereochemi stry of su gar s, An additional asymmetri c center is created wh en a cyclic h emiacetal is formed . In glu cose, Co l, th e carbonyl carbon atom in the open- chain form , becomes an asymmetric center in the ring form . Thus, two ring structures can be formed: a -D-glucop yranose and i3- o -glucop yranose (see Figure 11.4). For D sugars drawn as Haworth projections, the designation a means
that the hydroxyl group attached tu C- l is on the opposite side of the ring from the CH20 H at the carbon atom tha t determines whether the sugar is designated Dor L (the chiral center); f3 means that the hydroxyl group is on the same side as the CH 20 H at the chiml center, The C - l carbon atom is called the anomeric carbon atom, and the a and i3 form s are called anomers. An equilibrium mixture of glucose is approximately one -third IX anom er , two- third s ~ anomer, and < 1% open -chain form . The same nom encl ature applies to the furanose ring form of fru ctose, except that a and i3 refer t o the hydroxyl groups attach ed to C- 2, the anom eric carbon atom (see F igure 11 .5) . F ructose forms b oth p yranose and furanose rings. The pyranose form predominates in fru ctose free in sol uti on , and t he furanose form pred omina tes in many fru ctose derivatives (Figure 11. 6).
l" H
o
OH : H>-"
H
H
OH
OH
~-D-Ribose
/ H /
o
OH
' H'"
H
H OH
H
~ - 2-0eoxY-D-ribose
3 08 CHAPTER 11
HOH 2C
HOH 2C CH20 H ~ O _:-:::-.... H HO/1
Carbo hydrates
H
o
~HO---
OH OH
CH20H
H
OH
H
H CH 20 H
H
OH
H HO
HO HO
OH OH
H
~-D- Fructofuranose
a -D- Fructofuranose
Figure 11.6 Ring structures of fructose. Fructose can form both five-membered furanose and six-membered pyra nose rings. In each case. both a and ~ ano mers are possible.
OH
HO
CH20H OH
H
a-o-Fructopyranose
H
p-D-Fructopyranose
Pentoses such as D-ribose and 2-deoxy - D-ribose form furanose rings, aswe have seen in the structure of these units in RNA and DNA.
Py ra nose and Furanose Rings Can Assume Different Conformations
Steric hi
The six-membered pyranose ring is not planar, because of the tetrahedral geom etry of its saturated carbon atoms. Instead, pyranose rings adopt two classes of conform ations, termed chair and boat because of the resemblance to these objects (Figure 11.7). In t h e chair form, th e substituents on the ring carbon atoms have two orientations: axial and equatorial. Axial bonds are n earl y perpendicular to the average plane of the rin g, whereas equatorial bonds are nearly parallel to this plane. Axial substit uents steri cally hinder each other if they emerge on the same side of the rin g (e.g., 1,3 -diaxial groups). In contrast, equ atorial substitu ents are less crowd ed . The chair form of f3 -D-glucopyranose predominates because all axial positions are occu· pied hy hydrogen atoms. The b ulkier OH and CH 20H groups emerge at the less- hi nd ered periphery. T he boat form of glucose is disfavored be· cause it is quite steri cally h indered . a a
a
e a_ a
e
a
H CH20H OH
OH H C-3-endo
H C-2-endo
Figure 11.8 Envelope conformations of ~-D-ribose. The C-3-endo and C-2- endo forms of ~ - D -ribose are shown. The color indicates the fou r atoms that lie approximately in a plane.
e
-0 e
e •
•
a
Figure 11.7 Chair and boat forms of J3-o-glucopyranose. The chair form is mo re stable o wing t o less steric hindrance because the ax ia l pOSi tions are occupied by hydrogen atoms. Abbreviations: a, axial: e. equatorial.
e __ e
e
e a
a
a
a
HO H ___ CH20 HO HO_
.
~ --i, -
H
-0
H
HH OH Chair form
Boat form
Furanose rings, like pyranose rings, are not p lanar. They can be puckered so that four atoms are nearly coplanar and the f ifth is about 0.5 Aaway from this plane (Figure 11.8). This conformation is called an envelope form because t he structure resembles an opened envelope with the back flap raised . In the ribose moiety of most biomolecules, either C-2 or C-3 is olltof the plane on the same side as C oS. These conformations are called C-2-endo and C-3 -endo, respectively.
Monosaccharides Are Joined to Alcohols and Amines Through Glycosidic Bonds
Q-Glycosid ic bond
CH 2 0H
Monosaccharid es may react with alcohols and amines to form modified monosaccharides. For example, D-glucose will react with methanol in an acid-catalyzed process : the anomeric carbon atom C- l , which is part of a hemiacetal (p . 306), reacts with the hydroxyl group of meth anol to form a sugar acetal, also called a glycoside. The reaction forms two glycosides : methyl {Y-D-glucopyranoside and methyll3-o-g1ucopyranosid e. These two glucopyranosides differ in the configuration at the anomeric carbon atom. The bond formed between the anomer ic carbon atom of a sugar and the hydroxyl oxygen atom of an alcohol is called a glycosidic bond specifically, anO-glycosidic bond. Alternatively, the anomeric carbon atom of a sugar can be linked to the nitrogen atom of an amine to form an N -glycosidic bond. We have already encou ntered such reaction products; nucleosides are adducts between sugars, such as ribose, and amines, su ch as adenine (p. 109). Some other important modified su gars are sh own in Figure 11.9. Compounds such as methyl glucopyranoside differ in reactivity from the parent monosaccharide. For example, unmodified glucose reacts with 2 oxidizing agents such as cupric ion (Cu I ) because the open-chain form has afree aldehyde group that is readily oxidized.
H
•
H OH
-
HO
OH
C
Cu 2 +
C
H
•
Cu'
\. /
H
C
OH
H
C
OH
H
C
OH
HO
C
H
H
C
OH
H
C
OH
,1--0 H
H Methyl ,,-D-glucopyranoside
H
OH
M ethyl ~- D -g lucopyranosi de N-Glycosi di c bo nd
CH 2 0H
,1--0 NR2
H H
H
CU20 )
H20, HO
CH 2 0H
CH 2 0H
Glycosides such as methyl glucopyranoside do not react, because they are not readily interconverted with a form that includes a free aldehyde group. Solutions of cupric ion (known as Fehling's solution) provide a simple test for sugars, such as glucose, that can exist as a free aldehyde or ketone . Sugars that react are call ed reducing sugars; those that do not are called nonreducing sugars. Reducing sugars can often n onspecifically bind to other molecules. For instance, as a reducing sugar, glucose can react with hemoglobin to form
H
H
CH 2 0H H
OH
HO
H
COO-
OH
H OH
H H
H
OH
~ -D-Acetylgaladosamine
(Fuc)
(GaINAc)
Il-o-Acetylglucosamine (GIeNAc)
C-
OH
H-
C-
OH
=
OH
H
OH
P-l-Fucose
R
H-
H
CH2 0H
Sialic acid (Sia) (N-Acetylneuraminate)
"lure 11.9 Modified monosaccharides. Carbohydrates can be modified by the addition of sOOstituents (shown in red) other than hydroxyl groups. Such modified carbohyd rates are expressed on cell surfaces.
309
3 10 CHAPTER 11
glycosylated hemoglobin. C hanges in the amount of glycosylated hemoglo· bin can be used to monitor the effectiveness of treatments for diabetes mellitus, a condition characterized by high levels of blood glucose (p. 7i3). Reaction with glucose has no effect on the oxygen-binding ability of hemoglobin.
Ca rbohyd rates
Phosphorylated Sugars Are Key Intermediates in Energy Generation and Biosyntheses One sugar modification deserves special note because of its prominence in metabolism. The addition of phosphoryl groups is a common modifica· tion of sugars. For instance, the first step in the breakdown of glucose to ob· tain energy is its conversion into glucose 6-phosphate. Several subsequenl intermediates in this metabolic pathway, such as dihydroxyacetone phos· phate and glyceraldehyde 3-phosphate, are phosphorylated sugars. CH 20PO,2 -
H
0
'----c"""
H
-of'
H
OH
OH
Glucose 6-phosphate (G-6P)
H
C
OH
CH 20PO,2
phosphate
Glyceraldehyde 3-phosphate
(DHAP)
(GAP)
Dihydroxyacetone
Phosphorylation makes sugars anionic; the negative charge prevents these sugars from spontaneously leavi ng the cell by crossing lipid -bilayer membranes. Phosphorylation also creates reactive intermediates that will more readily form linkages to other molecules. For example, a multiply phosphorylated derivative of ribose plays key roles in the biosyntheses of purine and pyrimidine nucleotides (p . 71 2).
11.2
(J- l ,4-Glycosi dic bond
CH 2 0H
Complex Carbohydrates Are Formed by the Linkage of Monosaccharides
A--O H HO
OH I
I
H
H
4
I
OH
H
OH
Figure 11.10 Maltose, a disaccharide. Tw o molecules o f glucose are linked by an a-1,4-glycosid ic bond t o fo rm the d isaccharid e mal tose. The angles in the bonds t o th e central oxygen do not deno t e c arbon ato m s. The angles are added o nly for ea se o f illustrati o n.
G lycosidic bonds can join one monosaccharide to another. Oligosaccharide; are carbohydrates built by the linkage of two or more monosaccharides by O-glycosidic bonds (Figure 11.10). In maltose, for example, two D-glucose residues are joined by a glycosidic linkage between the C-1 carbon atom on one sugar and the hydroxyl oxygen atom on C-4 of the adjacent sugar. The sugar on the C-1 side of the link is in the 0. configuration. In other words, th e bond emerging from C-l lies below the plane of the ring when viewed in the standard orientation. Hence, the maltose linkage is called an a-l ,4· glycosidic bond. Because monosaccharides have multiple hydroxyl groups, various glycosidic linkages are possible. Indeed, the wide array of these link· ages in concert with the wide variety of monosaccharides and their many iso· meric forms makes complex carbohydrates structurally diverse molecules.
Sucrose, Lactose, and Maltose Are the Common Disaccharides A disaccharide consists of two su gars joined by an O -glycosidic bond. Three abundant disaccharides are sucrose, lactose, and maltose (Figure 11.1 1). Sucrose (common table sugar), a transport form of carbohydrates in plants, is obtained commercially from cane or beet . The anomeric carbon atomsof a glucose unit and a fructose unit are joined in this disaccharide; the config· uration of this glycosidic linkage is ex for glucose and J3 for fru ctose.
H
H
OH
HO H
OH
Lactose
Maltose
(p-D-Galactopyranosyl-( I -> 4 )-a-D-glucopyranose
(a-D-Glucopyranosyl-(I -> 4)-a-D-glucopyranose
Sucrose
la.D·Glucopyranosyl-(1 -> 2)-P-D-fructofuranose
H
OH
Consequently, sucrose is not a reducing sugar, because neither component monosaccharide is readily converted into an aldehyde or ketone, in contrast with most other sugars. Sucrose can be cleaved into its component monosac charides by the enzyme sucrase. Lactose, the disaccharide of milk, consists of galactose joined to glucose
Figure 11.11 Common disaccharides. Sucrose, lactose, and maltos e are commo n dietary components. The angles in the bonds to the central oxygens do not denote carbon atoms.
by a ~ - 1 , 4-g l ycosid ic linkage. Lactose is hydrolyzed to these monosaccha rides by lactase in human beings (p. 451 ) and by {3 -galactosidase in bacteria. In maltose, two glucose units are joined by an a-1,4-glycosidic linkage, as stated earlier. Maltose is produced by the hydrolysis of starch and is in turn hydrolyzed to glucose by maltase. Sucrase, lactase, and maltase are located on the Quter surfaces of epithelial cells lining the small intestine (Figure 11.12).
, Figure 11.12 Electron micrograph of a microvillus. Lactase and other enzymes that hydrolyze carbohydrates are present o n microvi lli that proj ect from the o uter face of theplasma membrane of intestinal epithelial ce lls. [From M. S. Mooseker and L. G. Titney, J Cell. Bioi. 67(1975}:725- 743.]
Glycogen and Starch Are Mobilizable Stores of Glucose Large polymeric oligosaccharides, formed by the linkage of multiple mono saccharides, are call ed polysaccharides. Polysaccharides play vital roles in energy storage and in maintaining the structural integrity of an organism. If all of the monosaccharides are the same, these polymers are called homopolymers. The most common homopolymer in animal cells is glycogen, the storageform of glucose. As will be considered in detail in Chapter 2 1, glycogen is a very large, branched polymer of glucose residues. Most of the glucose units in glycogen are linked b y a-1 ,4-glycosidic bonds. Branches are formed by ((·1 ,6-glycosidic bonds, present about once in 1 0 units (Figure 11.13).
H 0.
Y
a · ! ,6-Glycosidic bond
0, OH
6
CH,
0OH
H
OH
Figu re 11.13 Branch point in glycogen. Two chai ns of glucose mo lecules j oi ned by ",-1, 4-glycosidic bonds are linked by an (Y-1,6-glycosidi c bond to create a branch point. Such an ",-1 ,6glycosidic bond forms at approximately every 10 glucose units, mak ing glycogen a highly branched mo lecule.
311
312 CHAPTER 11 Carbohydrates
The nutritional reservoir of carbohydrates in plants is starch, of which there are two forms . Amylose, the unbranched type of starch, consists of glucose residues in a-1,4 linkage. Amylopectin, the branched form , has about one a-l ,6 linkage per 30 a-l, 4 linkages, and so it is like glycogen except fo r its lower degree of branching. More than half the carbohydrate ingested by human beings is starch . Roth amylopectin and amylose are rapidly hydrolyzed by a -amylase, an enzyme secreted by the salivary glands and the pancreas.
Cellulose, the Major Structural Polymer of Plants, Consists of Linear Chains of Glucose Units
COO -
H
Calacturonic acid
Ce llulose, the other major polysaccharide of glucose found in plants, serves a structural rath er than a nutriti onal role . Cellu lose is one of the most abun15 dant organic compounds in the biosphere. Some 10 kg of cellulose is syn· thesized and degraded on Earth each year. It is an unbranched polymer of glucose residues joined by [3 - 1,4 linkages . The [3 configuration allows eel· lulose to form very long, straight chains. Fibrils are formed by parallel chains that interact with one another through hydrogen bonds . The a- l,4 linkages in glycogen and starch produce a very different molec ul ar architecture from that of cellulose. A hollow helix is formed instead of a straight chain (Figure 11 .14). These differin g conseq uences of the a and [3 linkages are biologicall y important. The straight chain formed by [3 linkages is op· timal for th e constructi on of fibers havin g a hi gh tensil e strength . In contrast, the open helix formed by a linkages is well suited to forming an accessible store of sugar . Although mammals lack cellulases and therefore cannot digest wood and vegetable fibers, cellulose and other plant fibers are still an important constituent of our diet as a component of dietary fiber. Dietary fiber pro· d uces a feeling of satiety. Soluble fiber such as pectin (polygalacturonic acid) slows the movement of food through the gastrointestinal tract, allowing better digestion and absorption of nutrients. Insoluble fibers, such as cellulose, increase the rate at wh ich di gestion products pass through the large intes· tine. This increase in rate may minimi ze exposure to toxins in our di et.
Cellulose (P-I,4 linkages)
Figure 11.14 Glycosidic bonds determine polysaccharide structure. The 13-1.4 linkages favor st raight chains. which are o ptimal fo r struct ural purposes. The 0
GleNAe
Oligosaccharides Can Be "Sequenced" How is it possible to determin e the structure of a glycoprotein the oligosaccharide structures and their points of attachment? Most approaches m ake use of enzymes that cleave oligosacch arides at specific types of linkages. The first step is to detach the oligosacch.aride from th e protein . For example, N- linked oli gosaccharides can be released from proteins by an enzyme such as peptide N -glycosidase F, which cleaves the N -glycosidic bonds linking the oligosaccharide to the protein . T he oligosaccharides can then be isolated and analyzed . MALDI -T OF or other mass spectrometric techniques (Section 3.5) provide the m ass of an oligosaccharide fragm en t. However, many possible oligosaccharide structures are con sisten t with a given mass. More-complete info rmation can be obtained b y cleaving the oligosaccharide with enzym es of varying specificities. For example, f3 -1 ,4galactosidase cleaves f3- glycosidic bonds exclusively at galactose residues. The products can again be analyzed by mass spectrometry (Figure 11. 25). The repetition of this process with the use of an array of enzym es of differ ent specificity will eventually reveal the structure of the oligosacch aride. (A)
I
....
•uc
~
•
'"a ~
• ,.c • > .-• -• •
N
'0
C
eX> •
"''" "'"' ~
~
'"
(8)
I ~
c
•
,.c '0 C
..,.
'"
•
•
~
.•~ -••
~ ~
~
'" f.--~------- '-'"" ~~ -~- ~--~-----1000
1200
1400
1600
1800
2000
OH HO
OR
Mannose 6-phosphate residue
Figure 11.24 Formation of a man nose 6-phosphate marker. A glycopro tein destined for delivery to Iysosomes acqu ires a phosp hate marker in t he Golgi co mpartment in a two-step process. First, a phosphotransferase adds a phosphoN -acetylglucosamine unit to the 6-0H gro up of a man nose, and then a phosphodiesterase remo ves the added sugar t o generate a mannose 6-phosphate residue in the core o ligosaccha ri de.
Figure 11.25 Mass spectrometric "sequenc ing" of oligosaccharides. Carbohydrate-cleaving enzymes were used t o release and specifical ly cleave the o ligo sacchari de component of the glycoprotein fetu in fro m bo vine serum. Parts A and B show the masses obtained with MALDI-TO F spectrometry as well as t he correspo nd ing structures of the o ligosaccharide-digest ion products (using t he sa me scheme as that in Figure 11.18): (A) digestion wi t h pept ide N -glycosidase F (to re lease the oligosaccharide from t he pro tein) and neuraminidase: (6) digestion with peptide N -glycosi dase F, neuram inidase, and i3-1A-ga lactosidase. Kno w ledge of the enzyme specifi cit ies and the masses of the product s permits t he characteri zati o n of t he o ligosacchari de. See page 315 for t he carbo hydrate key. [After A. Varki, R. Cummings, J. Esko, H. Freeze, G. Hart, and J. M arth (Ed s.). Essentials of G/ycobiology (Cold Spring Harbo r Labo ratory Press, 1999), p. 596.]
319
320 CHAPTER 11 Carbohydrates
Proteases applied to glycoproteins can reveal the points of oligosaccha· ride attachment. Cleavage by a specific protease yields a characteristic pat· tern of peptide fragments that can be analyzed chromatographically. Fragments attached to oligosaccharides can be picked out because their chromatographic properties will change on glycosidase treatment. Mass spectrometric analysis or direct peptide sequencing can reveal the identity of the peptide in question and, with additional effort, the exact site of oligosaccharide attachment. Glycosylation greatly increases the complexity of the proteome. A given protein with several potential glycosylation sites can have many different glycosylated forms (sometimes called glycoforms), each of which may be generated only in a specific cell type or developmental stage. Now that the sequencing of the human genome is complete, the characterization of the much more complex proteome, including the biological roles of specifically modified proteins, can begin in earnest.
11.4
Lectins Are Specific Carbohydrate-Binding Proteins
The diversity and complexity of the carbohydrate units of glycoproteins suggest that they are functionally important. Nature does not construct complex patterns when simple ones suffice. Cellulose and starch, for exam· pie, are built solely from glucose units. In contrast, glycoproteins contain multiple types of residues joined by different kinds of glycosidic linkages. An enormous number of patterns in the composition and structure of surface sugars are possible because (1) different monosaccharides can be joined to one another through any of several OH groups, (2) the C-1 linkage can have either an a or a Jj configuration, and (3) extensive branching is possible. Indeed, many more different oligusaccharides can be formed from four sugaTl than can oligopep tides from four aminu acids. Why all this intricacy and diversity? It is becoming evident that carbo· hydrates are information-rich molecules that guide many biological processes. The diverse carbohydrate structures displayed on cell surfaces are well suited to serve as sites of interaction between cells and their envi· ronments. Proteins termed lectins (from the Latin legere, "to select") are the partners that bind specific carbohydrate structures on opposing cell surfaces. Lectins are ubiquitous: they are found in animals, plants, and • • m ICroorgamsms. Lectins Promote Interactions Between Cells
The ch ief function of lectins in animals is to facilitate cell- cell contact. A lectin usually contains two or more binding sites for carbohydrate units. The binding sites oflectins on the surface of one cell interact with arrays of carbohydrates displayed on the surface of another cell. Lectins and carbo· hydrates are linked by a number of weak interactions that ensure specificity yet permit unlinking as needed. The interactions between one cell surface and another resemble the action of Velcro; each interaction is weak but the • composite IS strong. Lectins can be divided into classes on the basis of their amino acid sequences and biochemical properties. One large class is the C type (for calcium-requiring) found in animals. These proteins each have a homologous domain of 120 amino acids that is responsible for carbohydrate binding. The structure of one such domain bound to a carbohydrate target is shown in Figure 11.26. •
~
Figure 11.26 Structure of a C-type carbohydrate-binding domain of an animal lectin. Notice that a calcium ion links a mannose res idue to the lectin. Selected intera ctions are shown, with some hydrogen atoms omitted for clarity.
Glu
•• •
Mannose
" calcium ion on the protein acts as a bridge between the protein and the sugar through direct interactions with sugar OH groups. In addition, two glutamate residues in the protein bind to both the calcium ion and the sugar, and other protein side chains form hydrogen bonds with other OH groups on Ihe carbohydrate. The carbohydrate-binding specificity of a particular lectin is determin ed by the amino acid residues that bind the carbohydrate . ~
Protein s termed selectins are m embers of the C- type family. l(;S Selectins bind immune-system cel ls to sites of injury in the inflammatory response (Figure 11 .27) . The L, E, and P forms of selectins bind specifically to carbohydrates on lym p h -node vessels, endothelium , or activated blood platelets, respectivel y. New therapeutic agents that control inflammation may em erge from a deep er understanding of how selecti ns bind and distinguish different carbohydrates. L-Selectin, originally thought to participate only in the immune response, is produced by embryos when Ihey are ready to attach to the endometrium of the mother's uterus. For a short period of time, the endometrial cells present an oligosaccharide on the cell surface. When the embryo attach es throu gh lecti ns, the attachment activates signal pathways in the endometrium to make implantation of the embryo possible. Plants also are rich in lectins. Although the exact role of lectins in plants is unclear, they can serve as potent insecticides. T he binding specificities of lectins fro m plants have been well characterized (Figure 11 .28) . Bacteria, too, contain lectins . Escherichia coli bacteria are able to adhere to the ep ithelial cells of the gastrointestinal tract because lectins on the E. coli surface recognize oligosaccharide units on the surfaces of target cells. These lectins are located on slender hairlike appendages called fimbriae (Pili). GlcNAc 1~- I.4
GlcNAc
I ~- 1 ,4
GlcNAc
Binds to wheat-germ agglutinin
Gal
1 ~- 1 ,3
GalNAc Binds to peanut lectin
Gal
Gal
GlcNAc
GlcNAc
I ~- 1.4
~-1.4 1
0- 16'-
....'
Man
/oL 12 I-'
•
Binds to phytohemagglutinin
Figure 11.27 Selectins mediate cell - cell interactions. The scanning electron micrograph sho ws lymphocytes adhering to the endothelial lining o f a lymph node. The L selectins on the lymphocyte surface bind spec ifically t o carbohydrates o n th e lining of the lymph-node vessels. (Co urtesy of Dr. Eugene Butcher.]
Figure 11.28 Binding selecti vities of plant lectins. The plant lectins wh eatgerm aggl utin in, peanut lectin, and phytohemagglutinin recognize different o ligosaccharides.
Influenza Virus Binds to Sialic Acid Residues
W Some viruses gain entry into specific host cells by adhering to cell surface carbohydrates. For example, influenza virus recognizes sialic acid residues present on cell -surface glycoproteins . The viral protein that binds to these sugars is called hemagglutinin (Figure 11 .29). l(;S
321
322 CHAPTER 11 Carbohydrates
Hemagglutinin Lipid bilayer Neuraminidase
Figure 11.29 Viral receptors. Influenza virus targets cell s by binding t o sialic ac id residues (purple d iamonds) located at the t ermini of oligosacchari des present on cell-surface glycoproteins and glycolipids. These carbohydrates are bound by hemagglutinin (interaction Circles), o ne of the major proteins expressed on the surface o f the vi rus. The other major vi ral surface prot ein, neuraminidase, is an enzyme that cleaves o ligosaccharide chains t o release t he viral particle at a later stage of the viral life cycle.
Host cell membrane
After the virus penetrates the cell membrane, another viral protein, neur· aminidase (sialidase), cleaves the glycosidic bonds to the sialic acid residues, freeing the virus to infect the cell. Inhibitors of this enzyme such as oseltamivir _ (Tamiflu) and zanamivir (Relenza) are important anti -influenza agents.
Summary 11.1 Monosaccharides Are Aldehydes or Ketones with Multiple • Hydroxyl Groups An aldose is a carbohydrate with an aldehyde group (as in glyceralde· hyde and glucose), whereas a ketose contains a keto group (as in dihy. droxyaceton e and fructose). A sugar belongs to the D series if the absolute configuration of its asymmetric carbon atom farthest from the aldehyde or keto group is the same as that of D-glyceraldehyde. Most naturally occurring sugars belong to the D series. The C- l aldehyde in the open-chain form of glucose reacts with the C -S hydroxyl group to form a six-membered pyranose ring. The C-2 keto group in the open· chain form of fructose reacts with the C -S hydroxyl group to form a five -membered furanose ring. Pentoses such as ribose and deoxyribose also form furanose rings. An additional asymm etric center is formed at the anomeric carbon atom (C- l in aldoses and C -2 in ketoses) in these cyclizations. The hydroxyl group attached to the anomeric carbon atom is on the opposite side of the ring from the CH 2 0 H group attached to the chiral center in the u anom er, whereas it is on the same side of the ring as the CH 2 0 H group in the 13 anomer. Not all the atoms in the rings lie in the same plane. Rather, pyranose rings usually adopt the chair can· formation, and furanose rings usually adopt the envelope conformation. Sugars are joined to alcohols and amines by glycosidic bonds from the anomeric carbon atom. For example, N -glycosidic bonds link sugars to purines and pyrimidines in nucleotides, RNA, and DNA.
11.2 Complex Carbohydrates Are Formed by the Linkage of Monosaccharides Sugars are linked to one another in disaccharides and polysaccharides by O-glycosidic bonds. Sucrose, lactose, and maltose are the common disaccharides. Sucrose (common table sugar) consists of a-glucose and 13fructose joined by a glycosidic linkage between their anomeric carbon atoms. Lactose (in milk) consists of galactose joined to glucose by a 13-1,4 linkage. Maltose (in starch) consists of two glucoses joined by an 0'-1,4 linkage. Starch is a polymeric form of glucose in plants, and glycogen serves a similar role in animals. Most of the glucose units in starch and glycogen are in 0'-1,4 linkage. Glycogen has more branch points formed by C1-1,6 linkages than does starch, and so glycogen is more soluble. Cellulose, the major structural polymer of plant cell walls, consists of glucose units joined by 13-1,4 linkages. These 13 linkages give rise to long straight chains that form fibrils with high tensile strength. In contrast, the CI linkages in starch and glycogen lead to open helices, in keeping with their roles as mobilizable energy stores. Cell surfaces and the extracellular matrices of animals contain polymers of repeating disaccharides called glycosarninoglycans. One of the units in each repeat is a derivative of glucosarnine or galactosamine. These highly anionic carbohydrates have a high density of carboxy1ate or sulfate groups. Proteins bearing covalently linked glycosaminoglycans are proteoglycans.
323 Key Terms
III Carbohydrates Can Attach to Proteins to Form Glycoproteins Specific enzymes link the oligosaccharide units on proteins either to the side-chain oxygen atom of a serine or threonine residue or to the side-chain amide nitrogen atom of an asparagine residue. Protein glycosylation takes place in the lumen of the endoplasmic reticulum. The N- linked oligosaccharides are synthesized on dolichol phosphate and subsequently transferred to the protein acceptor. Additional sugars are attached in the Golgi complex to form diverse patterns.
11.4 Lectins Are Specific Carbohydrate-Binding Proteins Carbohydrates on cell surfaces are recognized by proteins called lectins. In animals, the interplay of lectins and their sugar targets guides cell-cell contact. The viral protein hemagglutinin on the surface of the influenza virus recognizes sialic acid residues on the surfaces of cells invaded by the virus. A small number of carbohydrate residues can be joined in many different ways to form highly diverse patterns that can be distinguished by the lectin domains of protein receptors.
Key Terms monosaccharide (p. 304) triose (p. 304) ketose (p. 304) aldose (p. 304) enantiomer (p. 304) tetrose (p. 304) pentose (p. 304) hexose (p. 304) heptose (p. 304) diastereoisomer (p. 305 ) epimer (p. 305) hemiacetal (p. 306)
pyranose (p. 306) hemiketal (p . 306) furanose (p . 307) anomer (p. 307) glycosidic bond (p. 309) reducing sugar (p. 309) nonreducing sugar (p. 309) oligosaccharide (p. 310) disaccharide (p. 310) polysaccharide (p. 311) glycogen (p. 311 ) starch (p . 311)
cellulose (p. 312) proteoglycan (p. 3 12) glycosaminoglycan (p. 312) glycosyltransferase (p. 314) glycoprotein (p. 316) endoplasmic reticulum (p. 317) Goigi complex (p. 317) dolichol phosphate (p. 317) lysosome (p. 3 18) glycoform (p. 320) lectin (p. 320) selectin (p. 321)
324
CHAPTER 11 Carbohydrates
Se lected Readings Where to Start Sharon, N ., and Lis, H . 1993. Carbohydrates in cell recogni tion . Sci. Am. 268( 1):82 89. Lasky, L. A. 1992 . Selectins: Interpreters uf cell -specific carbo hyd rate information during infl ammati on . Science 258:964- 969. Weiss, P., and Ashwell , G. 1989. The asialogl ycuprotein recepto r: Prope rti es and modul atio n by liga nd . Prog. Clirl. BioI. II"'O - 168 ~-
--
(00-
figure 12.27 Locating the membrane-spanning helix of glycophorin. (A) Amino acid Jequence and transmembrane disposition of glycophorin A from the red-blood-cell membrane. rrfteen Q-linked carbohydrate units are shown as diamond shapes. and an N-linked unit is iOOwn as a lozenge shape. The hydrophobic residues (yellow) buried in the bilayer form a transmembrane (X helix. The carboxyl-terminal part of the molecule. located on the cytoplasmic SIde of the membrane. is rich in negatively charged (red) and positively charged (blue) residues. ~I Hydropathy plot for glycophorin. The free energy for transferring a helix of 20 residues from II'/! membrane to water is plotted as a funct ion of the position of the first residue of the helix ~ II'/! sequence of the protein. Peaks of greater than +84 kJ mol - I (+ 20 kcal mol - 1) in h)IIropathy plots are indicative of potential transmembrane helices. [(A) Courtesy of Dr. Vincent Marchesi; (8) after D. M. Engelman. T. A. Steitz. and A. Goldman. Identifying nonpolar mbilayer helices in amino acid sequences of membrane proteins. Annu. Rev. Biophys. Biophys. CMm. I~1986):321-353. Copyright © 1986 by Annual Reviews. Inc. All rights reserved.]
o
20
40
60
80
100
First amino acid residue in window
342
+ 168
--,
~
CHAPTER 12 Lipids and Cell Membranes
0
E + 84 :>1 ~
>
"' . ".
"
""
,,,.·.. :;'" .. _. :-t~ ,
." ,
"'.' • -.< •... -...
'.
'
...~ . -.. i':;·, '."'_: . .:,.: I : , ::'-.....'-' -:: . .,'"
- ~'. _
-
.
.'
~
',":.\'
ctl
346
SNARE (soluble N-ethylmaleimide-sensitive-factor attachment protein receptor) proteins help draw appropriate membranes together to initiate the
347 Summary
fusion process. These proteins, encoded by gene families in all eukaryotic celis, largely determine the compartment with which a vesicle will fuse. The specificity of membrane fusion ensures the orderly trafficking of membrane vesicles and their cargos through eukaryotic cells .
Summary Biological membranes are sheetlike structures, typically from 60 to 100 A thick, that are composed of protein and lipid molecules held together by non covalent interactions. Membranes are highly selective permeabi lity barriers. They create closed compartments, which may be entire cells or organelles within a cell. Proteins in membranes regulate the molecular and ionic compositions of these compartments. Membranes also control the flow of information between cells. 12.1 Fatty Acids Are Key Constituents of Lipids Fatty acids are hydrocarbon chains of various lengths and degrees of unsaturation that terminate with a carboxylic acid group. The fatty acid chains in membranes usually contain between 14 and 24 carbon atoms; they may be saturated or unsaturated. Short chain length and unsaturation enhance the fluidity of fatty acids and their derivatives by lowering the melting temperature. 12.2 There Are Three Common Types of Membrane Lipids The major classes of membrane lipids are phospholipids, glycolipids, and cholesterol. Phosphoglycerides, a type of phospholipid, consist of a glycerol backbone, two fatty acid chains, and a phosphorylated alcohol. Phosphatidylcholine, phosphatidy lserine, and phosphatidylethanolamine are major phosphoglycerides. Sphingomyelin, a different type of phospholipid, contains a sphingosine backbone instead of glycerol. Glycolipids are sugar-containing lipids derived from sphingosine. C holesterol, which modulates membrane fluidity, is constructed from a steroid nucleus. A common feature of these m embrane lipids is that they are amphipathic molecules, having one hydrophobic and one hydrophilic end. 12.l Phospholipids and Glycolipids Readily Form Bimolecular Sheets in Aqueous Media Membrane lipids spontaneously form extensive bimolecular sheets in aqueous solutions. The driving force for membrane formati on is the hydrophobic interactions among the fatty acid tails of membrane lipids. The hydro philic head groups interact with the aqueous medium. Lipid bilayers are cooperative structures, held together by many weak bonds. These lipid bilayers are highly impermeable to ions and most polar molecules, yet they are quite fluid , which enables them to act as a solvent for membrane proteins. 12.4 Proteins Carry Out Most Membrane Processes Specific proteins mediate distinctive membrane functions such as transport, communication, and energy transduction. Many integral membrane proteins span the lipid bilayer, whereas others are only partly embedded in the membrane. Peripheral membrane proteins are bound to membrane surfaces by electrostatic and hydrogen -bond
Figure 12.38 Neurotransmitter release. Neurotransmitter-contai ning synaptic vesicles are arrayed near t he plasma membrane of a nerve cell. Synaptic vesicles fuse wi th the plasma membrane, releasing the neurotransmitter into the synaptic cleft. [T. Reese/ Don Fawcett/ Photo Researchers.]
348 CHAPTER 12 Lipids and Cell Membranes
interactions. Membrane-spanning proteins have regular structures, including J3 strands, although the ex helix is the most common memo brane -spanning structure. Sequences of 20 consecutive nonpolar amino acids can be diagnostic of a membrane-spanning a-helicalre· gion of a protein . 12.5 Lipids and Many Membrane Proteins Diffuse Rapidly in the Plane of the Membrane Membranes are structurally and functionally asymmetric, as exempli· fied by the restriction of sugar residues to the external surface of mam· malian plasma membranes. Membranes are dynamic structures in which proteins and lipids diffuse rapidly in the plane of the membrane (lateral diffusion), unless restricted by special interactions. In contrast, the rotation of lipids from one face of a membrane to the other (trans· verse diffusion, or flip -flop) is usually very slow. Proteins do not rotate across bilayers; hence, membrane asymmetry can be preserved. The degree of fluidity of a membrane part! y depends on the chain length of its lipids and the extent to which their constituent fatty acids are un· saturated. In animals, cholesterol content also regulates membrane fluidity. 12.6 Eukaryotic Cells Contain Compartments Bounded by Internal Membranes An extensive array of internal membranes in eukaryotes creates com· partments within a cell for distinct biochemical functions. For in· stance, a double membrane surrounds the nucleus, the location of most of the cell's genetic material, and the mitochondria, the location of most ATP synthesis. A single membrane defines the other internal compartments, such as the endoplasmic reticulum . Some compart· ments can exchange material by the process of membrane budding and fusion.
Key Terms fatty acid (p. 327) phospholipid (p. 329) sphingosine (p. 329) phosphoglyceride (p. 329) sphingomyelin (p. 330) glycolipid (p. 331) cerebroside (p. 33 1) ganglioside (p. 331 )
cholesterol (p . 331) arnphipathic molecule (p. 332) lipid bilayer (p. 333) liposome (p. 334) integral membrane protein (p. 336) peripheral membrane protein (p. 336) hydropathy plot (p. 341) lateral diffusion (p. 342)
fluid mosaic model (p . 343) lipid raft (p. 344) receptor-mediated endocytosis (p. 346) SNA RE (soluble N-ethylmaleimidesensitive-factor attachment protein receptor) proteins (p. 347)
Selected Readings Where to Start De Weer, P. 2000. A century of thinking abo ut cell membranes. Allllu. R ev. Physiol. 62 :9 19- 926. Bretscher, M . S. 1985 . The molecules of the cell membrane. Sci. Am. 253(4): 100- 108.
Unwin, N ., and H enderson, R. 1984. The structure of proteins in biological membranes. Sci. Am. 250(2):78- 94. Deisenhofer, J ., and Michel, H . 1989. The photosynthetic reaction cen tre from the purple bacterium Rhodopseudomonas viridis. EMBO f. 8:2149- 2170. Singer, S. J., and Nicolson, G . L. 1972. The fluid mosaic model of the structure of cell membranes. Science 175:720- 73 \.
Jacobson, K., Sheets, E. D., anu Simson, R., 1995. Revisiting the fluid mosaic model of membranes. Science 268: 1441 - 1442.
Books Gennis, R . B. 1989 . Biomembranes: Molecular Structure and Fun,tiOil Springer Verlag. Vance, D. E. , and Vance, J. E. (Eds. ). 1996. Biochemistry of Lip", Lipoproteins, and Membranes. Elsevier. Lipowsky, R., and Sackmann, E. 1995. The Structure and Dynamics r( Membranes, Ebevier. Racker, E. 1985. Reconstitutions of Transporters, Receptors, and Pathological Sta tes. Academic Press.
Problems Tanford , C. 1980 . The J-Iydropl1obic Effect : Formation of Miceli" llnd Biological Membranes (2d ed .). Wiley- lnte rscience.
Membrane Lipids and Dynamics Simons, K., and Vaz, W . L. 2004 . Model systems . lipid rafts, and cell membranes. Annu. Rev. Rinphys. Biomol. S tTUct. 33:269- 295. Anderson. T. C ., a nd M cConnell , H . M . 2002. A thermodynamic model for extended complexes of cholesterol and phospho lipid . Biop/iys. ]. 83:2039- 2052. SaxIOIl, M. j., and J acobso n, K . 1997 . Single - particle trac king: Applicatiun:s to membrane dynamics. A1111U . Rev. Biopl1Ys. Biomol. Siruci. 26:373- 399. Bloom, M., Evans, E., and Mouritsen, O . G . 1991 . Physical prope rties oflhe fluid li pid -bi layer component of cell m embranes: A pe"peclive. Q Rev. Biopl,ys. 24:293- 397 . Elson. E. L. 1986. Membrane dynami cs studi ed hy fluorescence correlalion spectroscopy and photobleachin g recovery. Soc. Gen. Physiol. Ser. 40 367- 383. lachowski. A .. and D evaux, P. F. 1990. Trdnsmembrane movements of lipids. Experientia46 :644- 656 . Devaux, P. F. 1992. Protein involvement in transmembrane lipid asym ~ melry. Annu. Rev. Biophys. Biornol. S troet . 2 1:4 17- 439 . Silvius, j. R. 1992. Solu b ilizatio n and fun ctional recon stitution of biomembrane components. A nnu. Hev. /JiopJtys. Biolnol. S truct. 21 :323- 348. Yeagle, P. L" A lbert, A. D .. floesze-13attaglia . K. . Youn g . j. . a nd Frye, J. 1990. C ho lesterol dynami cs in m e mbranes . Biophys. ]. 57:413-424. ~aglc, J. F.. and 'T'ristram -Nagle, S. 2000 . L ipi d bilayer structure . Curr. Opill. Struct. Bioi. 10:474- 480. Dowhan, W. 199 7. Molecular basis for m emhrane phospholipid di ver sit y: Why are t he re so m a n y lipids ? Annu. Rev. Bivellem. 66:199-212. Huijbregts. R. r. H ., de Kroon , A . l. P. M., and de Kruij[f, 13. 1998 . Rapid tram~m embrane movement of newly synthesized phosphatidylethanolamine across the inner membrane of ESc/len'cll ia
coli.]. Biol. Chem. 273:1 8936- 18942.
Structure of Membrane Proteins \v~ian . P. , Cross, 1'. A .. and Jap, B. K. 2004. Stru ctural genomics of membrane proteins. Ge nome J3iol. 5:2 1S. Werlen, P. J.. Remigy, H. W ., de Groot, B. L.. Fotiadis, IJ ., Phili ppsen, A., Slahlberg. H .. Grubmull er, H ., and Engel, A . 2002. Progress in Ihe analys is of m embrane p rotein structure and fun ction . FEB~ Lett. 529 :6:'-72.
349
Popot, j. -L., and Engleman, D . M . 2000 . H elical membrane protein fo lding, stabi lity and e volutio n. Annu . Rev. Biochem. 69:88 1- 922. \,Vhitc, 5. H .. and Wimley. W . C. 1999. Membrane protein fo lding and stability: Physical p rinciples . Annu. Rev. Hinrhys. Binmol. S tTUct. 28 :319 365. Marassi, F. M .. an d Opella , S. J . 199R. NMR , tructural stud ies o f mem brane proteins. CurroOpin. S tTUct. BioI. 8:640- 648. Li powsky, R . 1991. T h e confo rm a ti on of m e mbranes. Nature 149:475- 481. A ltenbac h , C. , Marti, 1'., Khorana, I I. G .. and Hubbell. W . L. 1990 . Transmembrane protein Slr uct ure : Spin labelin g of bacteria · rhodop sin mutants. ~cienee 248: 1088 1092 . Fasman, G . D., and Gilbert, W . A. 1990. The predi ction of transmembrane protein sequences and their conformation: An evaluation . Trends Bioehem. ~ci. 15:89 92 . Jen nings, M. L. 1989 . Topography of membrane protein s. Annu. Rev.
13iochem. 58:999 1027. Engelman. D. M ., Steitz, 1'. A ., and Goldman , A . 1986. Identifying non -polar trans bila yer helices in amino acid sequences of mem brane proteins. Annu. ReI). Hinphys. Hinphys. Chem. 15:32 1- 353. Udenfriend . S., and Kodukola , K. 199 5. H ow glycosy l- phosphatid ylinos itol-an chored membrane protein s are mao e. J\nnu . Rev.
Riochem. 64 :563- 591 .
Intracellular Membranes Skehel, j. j., and Wiley, D. C . 2000 . Receptor bindmg and me m brane fusion in virus entry: -r'he innuenza hemagglutinin . Annu . Rev. Biochern. 69 :531 - 569. Roth. M . G . 1999. Lipid regula tors of m embran e traffi c throu gh th e Golgi complex. Trends Cell BiD/, 9:174- 179. J a hn, [{ ., and Sudhof. T. C . 1Y99 . M embrane fu, ion and exocytosis. A mlll. Rev. Biocirem. 68:863- 91 1. Stroud. R . M .. and Walter , P. 1999 . Signal sequ ence recognition and protein targeti ng . CurroOp in. S truct. Riol. 9:754- 759. T eter, S. A ., and KJion sky, D . j. 1999. H ow to get a folded protein aCross a m embrane. Trends Cell Bioi. 9: 428- 43 1. H ettema, E. H ., Dist el, B., and Tabak, 1-1 . r. 1999. Im po rt o f proteins in to peroxisomes. Biochirn. Biophys. A cta 145 1: 17- 34 .
Membrane Fusion Sollner,T H ., and Rothm an. j. E. 1996. M olec ul ar machinery mediating vesicle budding , doc king and fusion . Experientia 52: 1021- 1025. Ungar . D .. and I-Iughso n. F. M . 2003 . S AR E protein structure and function . A,mu. Rev. Cell Dev. Bioi. 19:491- 517.
Problems I. Population demity. I-I ow man y phospholipid molecules a re there 2 in a 1-l'-m regio n of a phospholipid bilayer m e mbrane ? Ass ume 2 that a phospholipid molecule occupies 70 A o f th e s urface area.
2. Lipid diffusion. Wha t is th e average distance traversed by a membrane li pid in 1 )l.s , 1 m s, anJ 1 8? Assume a diffu s ion coeffiCient of 1O - ~ c m 2s - 1.
J. Protein diffusion . The di ffu sion coe ffi c ie nt, D , of a r ig id s pherical molecule is give n by
o=
kT / 6'IT7Ir
fective v isco sity of 1 poise (1 poise = 1 e r g s - 1 c m -.1)? W h at is the average distan ce t raversed by this protein in 1 )l.S, 1 m s , and
1 s ? Assume that this protein is a n unhydrated, rigid sphere of d e n s ity 1. 35 g e m - J
4. Cold sensitivity. S o m e a nti biotics ac t as carri e r s t hat bind an io n o n o n e s ide of a m embrane, diffuse through t h e membrane, and re lease the io n on the oth e r s ide. The co n duc tance of a lipid bilayer m e mbran e containin g a carri er a n tibio ti c decreased abruptly when t h e tempe rat ure wa s lowered from 40°C to 36°C . In contrast, there was li tt le c hange in co n d u c tance of t h e same bilayer membrane wh en it co n tai n ed a c h an n e l- fo rmin g antibi -
in which 1) is the visco s it y of the solvent, r is the radiu s o f th e 16 sphere, k is the J30llZman co n stant (1. 38 X 10 erg degree- ' ),
otic . Why?
and T is th e absolute te mperature. What is the diffu s ion coeffi -
5. Flip-flop 1. The transverse diffus ion of phos pho lipids in a
cient at 3rC o f a 10 0 - kd prote in in a m e mbrane th at has an e f-
bilaye r m e mbran e was investi g a ted by u s ing a p a ramag n e ti c
350
CHAPTER 12 lipids and Cell Me mbranes
analog of phosphalidylcholine. called spin-labeled phosphatidyl-
No cholesterol
choline.
+ Cholesterol
1 ..N
O·
Tm
Temperature -
Spin-labeled phosphatidylcholine
The nitroxide ( 0 ) group in spin- labeled phosphatidylcholine gives a distinctive paramagnetic resonance spectrum. This spectrum disappears when nilroxides are converted into am ines by reducing agents such as ascorbate. Lipid vesicles containing phosphatidylcholine (95%) and the spin-labeled analog (5%) were prepared by sonication and puri fied by gel-filtration chromatography. The outside diameter of these liposomes was about 250 A (25 nm). The amplitude of the paramagnetic resonance spectrum decreased to 35% of its initial value within a few minutes of the addition of ascorbate. There was no detectable change in the spectrum within a few minutes after the addition of a second aliquot of ascorbate . However. the ampli tude of the residual spectrum decayed exponentially with a half-time of 6. 5 hours . How would you interpret these changes in the amplitude of the paramagnetic spectrum?
6. Flip-flop 2. Although proteins rarely if ever flip-flop across a membrane. the distribution of membrane lipids between the membrane leaflets is not absolute except for glycolipids. Why are glycosylated lipids less likely to flip -flop ? 7. Cis versus trans. Why might most unsaturated fatty acids in phospholipids be in the cis rather than the trans conformation? D raw the structure of a 16-carbon fatty acid as Ca) saturated. (b) trans monounsaturated. and (c) cis monounsaturated.
Ca) What is the effect of cholesterol? Cb ) Why might this effect be biologically important? 12 . Hydropathy plots. O n the basis of the following hydropathy plots for three proteins. predict which would be membrane pro· teins. What are the ambiguities with respect to using such plots to determine if a prolein is a membrane protein?
Ca) + 168 >< cu
"0
.-c:
>..c: ~
'"0.. 0 ~
"0
>-
+84 0
- 84
J:
- 168
20
400
First amino acid residue in wi ndow Cb) >
..c: ~
'"0
+ 168 +84 0
0.. ~
"0
>-
J:
- 84 _ 168 L--" :-~L--'-_ _-'-_'---_ _ _'----'----,:-'-,-_ 20 200
First amino acid residue in window
Chapter Integration Problem Data Interpretation Problems
11. Cholesterol effects. The red cu rve on the following graph shows the fluidity of the fatty acids of a phospholipid bilayer as a function of temperature. The blue curve shows the fluidity in the presence of cholesterol.
13. The proper environment . An understanding of the structure and function of membrane proteins has lagged behind that of other proteins. The primary reason is that membrane proteilll are more difficult to purify and crystallize . Why might this be the case?
Chapter
1
Membrane Channels and Pumps
.-
Closed
- - Open
The fl o w o f ions thro ugh a single membrane channel (c hannels a re sho wn in red in the illustration at the left) can be detect ed by the patc h-clamp technique, which records current changes as the channel transits between o pen and closed states. [(Left) After E. Neher and B. Sakmann. The patch clamp tec hnique. Copyright © 1992 by Scientific American, Inc. All rights reserved. (Right) Courtesy of Dr. Mauri cio MontaL]
he lipid bilayer of biological membranes is intrinsically impermeable to ions and polar molecules, yet certai n such species must be able to cross these membranes for normal cell function . Permeability is conferred by two classes of membrane proteins, pumps and channels. Pumps use a source of free energy such as ATP hydrolysis or light absorption to drive the thermodynamically uphill transport of ions or molecules. Pump action is an example of active transport . Channels, in contrast, enable ions to flow rapidly through membranes in a thermodynamically downhill direction. Channel action illustrates passive transport, or facilitated diffusion . Pumps are energy transducers in that they convert one form of free en ergy into another. Two types of ATP-driven pumps, P-type ATPases and the ATP-binding cassette (ABC) transporters, undergo conformational changes on ATP binding and hydrolysis that cause a bound ion to be trans ported across the membrane. A different mechanism of active transport utilizes the gradient of one ion to drive the active transport of another. An example of such a secondary transporter is the E. coli lactose transporter, a well -studi ed protein responsible for the uptake of a specific sugar from the environment of a bacterium . Many transporters of thi s class are present in the membranes of our cells. The expression of these transporters determines which metabolites a cell can import from the environment. Hence, adjust ing the level of transporter expression is a primary means of controlling metabolism. Pumps can establish persistent gradients of particular ions across membranes. Specific ion channels can allow these ions to flow rapidly across membranes down these gradients. These channels are among the most fascinating molecules in biochemistry in their ability to allow some ions to flow
O utl i n e 13.l
I
The Transport of Molecules Across a Membrane May Be Active or Passive
13.2 Two Families of Membrane Proteins Use ATP Hydrolysis to Pump Ions and Molecules Across Membranes 13.3 Lactose Permease Is an Archetype of Secondary Transporters That Use One Concentration Gradient to Power the Formation of Another 13.4 SpeCifiC Channels Can Rapidly Transport Ions Across Membranes 13.5 Gap Junctions Allow Ions and Small Molecules to Flow Between Communicating Cells 13.6 Specific Channels Increase the Permeability of Some Membranes to Water
3S1
352 CHAPTER 13 Membrane Channels and Pumps
freely through a membrane while blocking the flow of even closely related species. These gated ion channels are central to the functioning of our nerv· ous systems, acting as elaborately switched wires that allow the rapid now of current. We conclude with a discussion of a different class of channel: the cell· to-cell channel, or gap junction, allows the flow of metabolites or ions be· tween cells. For example, gap junctions are responsible for synchronizing muscle-cell contraction in the beating heart.
The Expression of Transporters Largely Defines the Metabolic Activities of a Given Cell Type Each cell type expresses a specific set of transporters in its plasma memo brane. The set of transporters expressed is crucial because these transporters largely determine the ionic composition inside cells and the compounds that can be taken up from the cell's environment. In some senses, the array of transporters ex pressed by a cell determines the cell's characteristics because a cell can execute only those biochemical reactions for which it has taken up the substrates. An example from glucose metaboli sm illustrates this point. As we will see in the discussion of glucose metabolism in Chapter 16, tissues differ in their ability to employ different molecules as energy sources . Which ti ssues can make use of glucose is largely governed by the expression of different members of a family of homologous glucose transporters call ed GLUT1, GLUT2, GLUT3, GLUT4, and GLUTS in different cell types. GLUT3, for example, is expressed only on neurons and a few other cell types. This transporter binds glucose relatively tightly so that these cells have first caU on glucose when it is present at relatively low concentrations. These are just the first of many examples that we will encounter demonstrating the critic~ rol e that transporter expression plays in the control and integration of metaboli sm.
13.1
The Transport of Molecules Across a Membrane May Be Active or Passive
We first consider some general principles of membrane transport. Two fac· tors determine whether a molecule will cross a membrane : (1) the perme· ability of the molecule in a lipid bilayer and (2) the availability of an energy source.
Many Molecules Require Protein Transporters to Cross Membranes As stated in Chapter 12, some molecules can pass through cell membranes because they dissolve in the lipid bilayer. Such molecules are called lipophilic molecules. The steroid hormones provide a physiological example. These cholesterol relatives can pass through a membrane in their path of movement, but what determines the direction in which they will move? Such molecules will pass through a membrane down their concentration gradient in a process called simple diffusion . In accord with the Second Law of Thermodynamics, molecules spontaneously move from a region of higher co ncentration to one of lower concentration . Matters become more complicated when the molecule is highly polar. For example, sodium ions are present at 143 mM outside a typical cell and at 14 mM inside the cell, yet sodium does not freely enter the ceil, because the charged ion cannot pass through the hydrophobic m embrane interior.
35 3
Insome circumstances, as during a nerve impulse, sodium ions must enter the cell. How are they able to do so? Sodium ions pass through specific channel s in the hydrophobic barrier formed by membrane proteins. This means of crossing the membrane is calledfaeilitated diffusion , because the diffusion across the membrane is facilitated by the channel. It is also called passive transport, because th e energy driving the ion movement originates from the ion gradient itself, without any contribution by the transport system. Channels, like enzymes, display substrate specificity in that they facilitate the transport of some ions, but not other, even closely related, ions . How is the sodium gradient established in the first place? In this case, sodium mu st move, or be pumped, against a concentration gradient. Because moving th e ion from a low concentration to a higher concentration results in adecrease in entropy, it requires an input of free energy. Protein transporters embedded in the membrane are capable of using an energy source to move the molecule up a concentration gradient. Because an input of energy from another source is required, this means of crossing the membrane is called
13.1 Active and Passive Transport Compared
active transport.
Free Energy Stored in Concentration Gradients Can Be Quantified An unequal distribution of molecules is an energy-rich condition because free energy is minimized when all concentrations are equal. Consequently, toattain such an unequal distribution of molecules, or concentration gradient, requires an input of free energy. Can we quantify the amount of energy required to generate a concentration gradient (Figure 13.1)? Consider an uncharged solute molecule. The free -energy change in transporting this species from side 1, where it is present at a concentration of el, to side 2, where it is present at concentration C2 , is l1G = RTln(C2/C l) = 2. 303RTlog1 0(C2/ Cl)
30
-Io E 20 l.)
c/C"N'/C"N/P\~O - :1
o
H
0
CH 3 Creatine phosphate
2-
Phosphoryl-Transfer Potential Is an Important Form of Cellular Energy Transformation
The standard free energi es of hydrolysis provide a convenient means of comparing the phosphoryl-transfer potential of phosphorylated compounds. Such comparisons reveal that A TP is not the only compound with a high phosphoryl -transfer potential. Tn fact, some compounds in biological systems have a higher phosphoryl -transfer potential than thaI of ATP. These compounds include phosphoenolpyru vate (PEP), 1,3bi sphosphoglycerate (l ,3- BPG ), and creatine phosphate (Figure 15.6). Thus, PEP can transfer its phosphoryl group to ADP to form ATP. Indeed, this transfer is one of the ways in which ATP is generated in the breakdown of sugars (pp . 436 and 444) . It is significant that ATP has a phosphoryl -transfer potential that is intermediate among the biologically important phosphorylated molecules (Table 15 .1). This intermediate position enables ATP to function effici ently as a carrier of phosphory l groups. The amount of ATP in muscle suffices to sustain contractile acti vity for less than a second. Creatine phosphate in vertebrate muscle serves as a reservoir of high-potential phosphoryl groups that can be readily transferred to ATP. Indeed, we use creatine phosphate to regenerate ATP from ADP every time that we exercise strenuously. This reacti on is catalyzed by creatine kinase . CreHtine kinase
1.1-Bisphosphoglycerate (1.1-BPG) Figure 15.6 Compounds with high phosphoryl-transfer potential. These compou nds have a higher phosphoryltransfer potential than that of ATP and can be used to phosphorylate ADP to form ATP.
C reatine phosphate + ADP
pools is the basis of creatine's use as a dietary supplement by athletes in sports requiring short bursts of intense activity. After the creatine phosphate pool is depleted, ATP must be generated through metabolism (Figure 15.7). TABLE 15.1 Standard free energies of hydrolYSiS of some phosphorylated compounds kcal mol- 1
Compound Phosphoenolpyruvate l.3-Bisphosphoglycerate Creat ine phos phate ATP (to AOP) Glucose 1-phosphate Pyrophosphate Glucose 6-phosphate Glycerol 3-phosphate
- 61.9 - 49.4 - 43.1 - 30.5 - 20.9 -19.3 - 13.8 -9.2
-14.8 -11.8 - 10.3 - 7.3 - 5.0 - 4.6 - 3.3 - 2.2
/
417
Aerobic metabolism (Chapters 17 and 18)
ATP
15.3 The Oxidation of Carbon Fuels
Creatine phosphate
1
Anaerobic metabolism (Chapter 16)
~ OJ
c:
w
Seconds
15.3
,
Minutes
~
Hours
Figure 15.7 Sources of ATP during exercise. In t he initi al seconds. exercise is powered by existi ng high-p hosp horyl-transfer compo unds (ATP and creatine p hosphate). Subsequently. th e ATP must be regenerated by metabol ic pat hways.
)
The Oxidation of Carbon Fuels Is an Important Source of Cellular Energy
ATPserves as the principal immediate donor offree energy in biological systems rather than as a long -term storage form of free energy. In a typical cell , an ATP molecule is consumed within a minute of its formation. Although the total quantity of ATP in the body is limited to approximately 100 g, the turnover of thissmall quantity of ATP is very high. For example, a resting human being consumes about 40 kg of ATP in 24 hours. During strenuous exertion, the rate of utilization of ATP may be as high as 0.5 kg/ minute. For a 2-hour run , 60 kg (132 pounds) of ATP is utilized . Clearly, having mechanisms for regenerating ATP is vital. Motion, active transport, signal amplification , and biosynthesis can take place only if ATP is continually regenerated from ADP (Figure 15.8). The generation of ATP is one of the primary roles of catabolism . The carbon in fuel molecules such as glucose and fats is oxidized to C O 2 , and th e energy released is used to regenerate ATP from ADP and Pi. In aerobic organisms, th e ultimate electron acceptor in th e oxidation of carbon is O 2 and th e oxidation product is C O 2 . Con sequently, th e more reduced a carbon is to begin with, the m ore free energy is released by its oxidation . F igure 15 .9 shows the t.G OI of oxidation for one-carbon com pounds. Although fu el molecules are more compl ex (Fi gure 15 .10) than the single-carbon compounds depicted in Figure 15.9 , when a fuel is oxidized , the oxidation takes place one carbon at a ti me. The carbon -oxidation en ergy is used in some cases to create a co III pound with high phosphor y1- transfer potential and in other cases to create an ion gradient. In either case, the end point is the formation of A TP. Most energy - - - - - - - - --
-
C H/ \ .....H H
6C a' o~idation (kJ mol- ') /jGoloxidation
(kcal mol-' )
Oxidation of fuel molecules or Photosynthesis Figure 15.8 ATP- ADP cycle. This cycle is the fundamental mode of energy exchange in biological systems.
- - - - - - - - - - - . Least energy
o
OH
o H/
IC
Io
' H
Methane
Methanol
Formaldehyde
Formic acid
Carbon dioxide
-820
-703
-523
- 285
o
- 196
- 168
-125
-68
o
Figure 15.9 Free energy of oxidation of single-carbon compounds.
ADP
AlP '"
Figure 15.10 Prominent fuels. Fats are a more efficient fuel source than ca rbo hydrates such as glucose because the carbon in fats is more reduced.
H } --
H OH OH
HO
H
OH Fatty acid
Glucose
Compounds with High Phosphoryl-Transfer Potential Can Couple Carbon Oxidation to ATP Synthesis
H
C
OH
CH 20P032Glyceraldehyde 3-phosphate (GAP)
How is the energy released in the oxidation of a carbon compound converted into ATP? As an example, consider glyceraldehyde 3-phosphate (shown in the margin), which is a metabolite of glucose formed in the oxidation of that sugar. The C-l carbon (shown in red) is at the aldehyde-oxidation level and is not in its most oxidized state. Oxidation of the aldehyde to an acid will release energy.
o
"""C..... H
H-
IC-
Oxidation
OH
,
H
C
OH
CH20P032-
CH 20P0 32Glyc@raldehyde 3-phosphate
3-Phosphoglyceric acid
However, the oxidation does not take place directly. Instead, the carbon oxidation generates an acyl phosphate, 1 ,3 -bisphosphoglycerate_The electrons released are captured by NAD + , which we will consider shortly.
H
C
,
OH
H
C
OH
+ NADH + H'
CH20P032-
CH20P032-
1,3-Bisphosphoglycerate (1,3-BPG)
Glyceraldehyde 3-phosphate (GAP)
For reasons similar to those discussed for ATP, 1,3 -bisphosphoglycerate has a high phosphoryl-transfer potential. Thus, the cleavage of 1,3-BPG can be coupled to the synthesis of ATP.
H
C
OH
ICH20P032-
1,3-Bisphosphoglycerate
+ ADP
----»
H-
C
OH
ICH 0P0 2-
+
AlP
2 3 3-Phosphoglyceric acid
The energy of oxidation is initially trapped as a high-phosphoryl -transfer potential compound and then used to fOTm ATP. The oxidation energy of a carbon atom is transformed into phosphoryl-transfer potential, first as 1, 3-bisphosphoglycerate and ultimately as ATP. We will consider these reactions in mechanistic detail on p . 440.
Ion Gradients Across Membranes Provide an Important Form of Cellular Energy That Can Be Coupled to ATP Synthesis As described in C hapter 13, electrochemical potential is an effective means of storing free energy. Indeed, the electrochemical potential of ion gradients 41 8
CD Gradient created
419
Oxidation of fuels pumps protons out.
15.3 The Oxidation of Carbon Fuels
++ ++
- - - -
ADP ATP + P; '--....._ _7f + H2 0
-
Figure 15.11 Proton gradients. The o xidation of fuels can power the formation of proton grad ients by the action of specific proto n pumps. These proton grad ients can in turn drive the synthesis of ATP when the pro tons fl ow through an ATP synthesizing enzyme.
(2) Gradient used Influx of protons forms ATP.
across membranes, produced by the oxidation of fuel molecules or by photosynthesis, ultimately powers the synthesis of most of the ATP in cells. In general, ion gradients are versatile means of coupling thermodynamically unfavorable reactions to favorable ones. Indeed, in animals, proton gradients generated by the oxidation of carbon fuels account for more than 90% of ATP generation (Figure 15.11). This process is called oxidative phosphorylation (Chapter 18). ATP hydrolysis can then be used to form ion gradients of different types and functions. The electrochemical potential of a Na + 2 gradient, for example, can be tapped to pump Ca + out of cells or to transport nutrients such as sugars and amino acids into cells.
Energy from Foodstuffs Is Extracted in Three Stages Let us take an overall view of the processes of energy conversion in higher organisms before considering them in detail in subsequent chapters. Hans Krebs described three stages in the generation of energy from the oxidation of foodstuffs (Figure 15.1 2) .
In the first stage, large molecules in food are broken down into smaller units. This process is digestion. Proteins are hydrolyzed to their 20 different amino acids, polysaccharides are hydrolyzed to simple sugars such as glucose, and fats are hydrolyzed to glycerol and fatty acids. This stage is strictly a preparation stage; no lIseful energy is captured in this phase. In the second stage, these numerous small molecules are degraded to a few simple units that playa central role in metabolism. In fact, most of them sugars, fatty acids, glycerol, and several am ino acids are converted into the acetyl unit of acetyl CoA (p. 422). Some ATP is generated in this stage, but the amount is small compared with that obtained in the third stage. [n the third stage, ATP is produced from the complete oxidation of the acetyl unit of acetyl CoA. The third stage consists of the citric acid cycle and oxidative phosphorylation, which are the final common pathways in the oxidation of fuel molecules. Acetyl CoA brings acetyl units into the citric acid cycle [also called the tricarboxylic acid (TCA) cycle or Krebs cycle], where they are completely oxidized to CO 2 . Four pairs of electrons are transferred (three to NAD + and one to FAD) for each acetyl
FATS
POLYSACCHAR IDES
PROTEINS Stage I
Fatty acids and glycerol
Glucose and other sugars
Amino acids
Stage II
CoA
Citric acid cyde
2 CO 2
Stage III
Oxidative phosphorylation
H2 0 ATP Figure 15.12 Stages of catabolism. The extraction of energy from fuels can be di vided into three stages.
420 CHAPTER 15 Metabolism: Basic Concepts and Design
group that is oxidized . Then, a proton gradient is generated as electrons fl ow from the reduced forms of these carriers to 2 , and this gradi ent is used to synthesize ATP.
°
15.4
Metabolic Pathways Contain Many Recurring Motifs
At first glance, metabolism appears intimidating because of the sheer num· ber of reactants and reactions. N evertheless, there are unifying themes that make the comprehension of thi s compl exity m ore manageable. These uni· fying them es include common m etabolites, reactions, and regul atory schem es that stem from a common evolutionary heritage. Activated Carriers Exemplify the Modular Design and Economy of Metabolism
W e have seen that phosphoryl transfer can be used to drive otherwise endergonic reactions, alter the energy of co nformation of a protein , or serve as a signal to alter the activity of a protein . The phosphoryl-group donor in all of these reactions is ATP. In oth er word s, ATP is an activated carrier of phosphory l groups because phosphoryl transf er from ATP is an exergonic process. The use of activated carriers is a recurring motif in biochemistry, and we will consider several such carriers here. Many such activated carri· ers function as coenzymes:
Rea ctive site
H
~
N+
0 0 ,._ /
0
-.f "" o 0
NH,
/ o ...,P "
-rJ
H
HO
N
OHH
0
0,
HO
(7
,N
#
~N N=Z
OR
Figure 15.13 Structures of the oxidized fo rms of nicotinamide-derived electron carriers, Ni cotinamide ad enine dinucleotide (NAD I ) and nicotinamide adenine dinucleot ide phosphate (NADP+ ) are prom inent carriers o f high-energy electrons. In NAD I , R = H: in NADP+. R = PO,'-,
H
1. Activated Carriers of Electrons for Fuel Oxidation . In aerobic organisms, the ultimate electron acceptor in the oxidation of fu el molecules is O2, H owever , electrons are not transferred directly to 0 2' Instead , fuel molecules transfer electrons to special carri ers, which are either pyridine nucleotides or jlavins. The reduced forms of these carriers then transfer their hi gh-potential electrons to O 2 , N icotinamide adenine dinucl eotide is a major electron carrier in the oxi· dation of fuel molecules (Figure 15, 13). The reactive part of NAD I is its nicotinamide ring, a pyridine derivative synthesized from the vitamin niacin. In the oxidation of a substrate, the nicotinamide ring of NAD + accepts a hydrogen ion and two electrons, which are equivalent to a hydride ion (H:- ), The reduced form of this carrier is called NADH, Tn th e oxidized form , the nitrogen atom carries a positive charge, as indicated by NAD + , AD + is the electron acceptor in many reactions of the type OH .
+
NAD H
+
H+
In this dehydrogenation, one hydrogen atom of the substrate is directly transferred to NAD + , whereas the other appears in the solvent as a proton, Both electrons lost by the substrate are transferred to the nicotinamide ring, The other maj or electron carrier in the oxidation of fuel molecul es is the coenzyme fl avin adenine dinucleotide (Figure 15.14). The abbreviations for the ox idi zed and reduced forms of this carrier are FAD and FADH"respectively. FAD is the electron acceptor in reactions of the type
421
o - --,-~
15.4 Recurring M oti f s
H
~ NH
N
""'"
Reactive sites
I
~" ~ 7 ' N' "'0 H
HHH
(
H
I (I (I
, .-
OH OH
0-
( - OHO -
H2 C "
I
:I
0"/1
, p,
:I
~:p
Figure 15,14 5tructure of the oxidized form of flavin adenine dinucleotide (FAD). Th is electro n ca rrier consists o f a flavin mononucleo tide (FMN) unit (shown in blue) and an AMP unit (shown in black),
~
d"o~
'-o~
HO
OH
The reactive part ofFAD is its isoalloxazine ring, a derivative of the vitamin riboflavin (Figure 15 .15). FAD, like NAD +, can accept two electrons. In doing so, FAD, unlike NAD+, takes up two protons. These carriers of high-potential electrons as well as flavin mononucleotide (FMN), an electron carrier related to FAD, will be considered further in Chapter 18. 0
H
H H3 (
N
HJC
~
NH
+ 2 H+ + 2 e~
N
HJC H
N
0
pyruvate + AlP
+ AlP
or
Note: AG, the actua l fre e-energy change. has been calculated from AG"" and known concentrat ions reactants under typical physiologica l cond it ions. Glycolysis can proceed only if the o. G va lues of all reactions are negative. The small posit ive 6 G val ues o f three of the above reactions ind icate that the concentrations of metabolites in vivo in cells undergOing glycolYSiS are not precisely known.
another. This enzyme requir~s catalytic amounts of 2.3 -bisphosphoglycerate (2.3-BPG) to maintain an active-site histidine residue in a phosphory lated form. This phosphoryl group is transferred to 3-phosphoglycerate to re-form 2.3-bisphosphoglycerate. Enz-His-phosphate + 3-phosphoglycerate, >. Enz-His + 2.3-bisphosphoglycerate The mutase then functions as a phosphatase: it converts 2.3-bisphosphoglycerate into 2-phosphoglycerate. The mutase retains the phosphoryl group to regenerate the modified histidine. Enz-His + 2.3 -bisphosphoglycerate ~,= Enz-His-phosphate + 2-phosphoglycerate The sum of these reactions yields the mutase reaction: ' 2-phosphoglycerate
3-Phosphoglycerate,
In the next reaction. the dehydration of 2- phosphoglycerate introduces a double bond. creating an enol. Enolase catalyzes this formation of the enol phosphate phosphoenolpyruvate (PEP). This dehydration markedly elevates the transfer potential of the phosphoryl group. An enol phosphate has a high phosphoryl-transfer potential. whereas the phosphate ester of an ordinary al cohol. such as 2-phosphoglycerate. has a low one. The I1 C o' of the hydrolysis of a phosphate ester of an ordinary alcohol is - 13 kJ mol - I (- 3 kcal mol- I). whereas that of phosphoenolpyruvate is - 62 kJ mol - I (- 15 kcal mol- I). Why does phosphoenolpyruvate have such a high phosphoryl -transfer potential? The phosphoryl group traps the molecule in its unstable enol form. When the phosphoryl group has been donated to ATP. the enol un dergoes a conversion into the more stable ketone namely. pyruvate.
° 0."'(.. . . . / oPo, -
:'1
2-
(
AlP
-
o
o
:'1
0 "'( ........ / OH (
II / ("
H
-
/ ( "'"
H
H
Phosphenolpyruvate
;/( "", ...-::' 0
--.
I
:1
o·
(/
I
(H,
H
Pyruvate
Pyruvate
(enol form)
6.G0 in
~G in
kJ mo l- ' (kea l m ol - ')
1
Enzyme
Reaction type
kJ mo l- ' (kca l mo l- ' )
Hexokinase Phosphoglucose isomerase Phosphofructokinase Aldolase Triose phosphate isomerase Glyceraldehyde 3-phosphate dehydrogenase ~,osphoglycerate kinase Phosphoglycerate mutase Enolase Pyruvate kinase
Phosphoryl transfer Isomerization Phospho ryl transfe r Aldol cleavage Isomeri zation Phosphory latio n cou pled
- 16.7 (-4.0 ) +1.7 (+0.4) - 14.2 (- 3.4) + 23.8 (+ 5.7) + 7.5 (+1.8) + 6.3 (+1.5)
- 33.5 (- 8.0) - 2.5 (- 0 .6) - 22.2 (- 5.3) - /.3 (- 0.3) +2.5 (+0.6)
- 18.8 (- 4.5) + 4.6 (+ U)
+1.3 (+0.3) +0.8 (+0.2) - 3.3 (- 0.8) - 16.7 (- 4.0)
- 1.7 (- 0 04 )
to oxidation
Phos pho ryl transfe r Phosphoryl shift Dehydratio n Phosphory l t ransfer
+1.7 (+004 ) - 31.4 (- 7.5)
445 16.1 Glycolytic Pathway
446
Thus, the high phosphoryl-transfer potential of phosphoenolpyruvate arises primarily from the large driving force of the subsequent enol- ketone conversion. Hence, pyruvate is formed, and ATP is generated concomitantly. The virtually irreversible transfer of a phosphoryl group from phosphoenolpyruvate to ADP is catalyzed by pyruvate kinase. Because the molecules of ATP used in forming fructose 1,6-bisphosphate have already been regenerated, the two molecules of ATP generated from phosphoenolpyruvate are "profit."
CHA~P~IE;R~I~6~GJ.ly:c: o~ ly:si~s~an:dA Gluconeogenesis
Glucose ATP
AlP
Two ATP Molecules Are Formed in the Conversion of Glucose into Pyruvate
F-l ,6-BP
The net reaction in the transformation of glucose into pyruvate is DHAP
GAP
Glucose NAD+
+
2 Pi
+
2 ADP + 2 NAD I 2 pyruvate + 2 ATP
)
+
2 NADH
+
2H+
+ 2 H20
NADH-
Thus, two molecules of ATP are generated in the conversion of glucose into tux> molecules of pyruvate. The reactions of glycolysis are summarized in Table 16.1. Note that the energy released in the anaerobic conversion of glucose into two molecules of pyruvate is about -96 kJ mol- I (-23 kcal mol- I). We shall see in C hapters 17 and 1 8 that much more energy can be released from glucose in the presence of oxygen.
PEP
2x
2ATP
NADH_+ NAD+ -
+-
Ethanol Location of redox-balance steps. The generat io n and consumption of NADH. located within the glycolytic pathway.
Pyruvate NADH
co, Acetaldehyde
Lactate
NAD + Is Regenerated from the Metabolism of Pyruvate The conversion of glucose into two molecules of pyruvate has resulted in the net synthesis of ATP. However, an energy-converting pathway that stops at pyruvate will not proceed for long, because redox balance has not been maintained. As we have seen, the activity of glyceraldehyde 3-phosphate dehydrogenase, in addition to generating a compound with high phosphoryltransfer potential, of necessity leads to the reduction ofNAD+ to NADH. In the cell, there are limited amounts of NAD +, which is derived from the vitamin niacin, a dietary requirement for human beings. Consequently, NAD+ must be regenerated for glycolysis to proceed. Thus, the final process in the pathway is the regeneration ofNAD + through the metabolism of pyruvate. The sequence of reactions from glucose to pyruvate is similar in most 0[ganisms and most types of cells. In contrast, the fate of pyruvate is variable. Three reactions of pyruvate are of primary importance: conversion into ethanol, lactate, or carbon dioxide (Figure 16.9)_ The first two reactions are fermentations that take place in the absence of oxygen. In the presence of oxygen, the most common situation in multicellular organisms and in many unicellular ones, pyruvate is metabolized to carbon dioxide and water through the citric acid cycle and the electron-transport chain. We now take a closer look at cO 2 these three possible fates of pyruvate. Acetyl CoA
NADH
Ethanol
Further oxidation
Figure 16.9 Diverse fates of pyruvate. Ethanol and lactate can be formed by reactions that include NADH. Alternatively, a two-carbon unit from pyruvate can be coupled to coenzyme A (see p. 420) to form acetyl CoA.
1. Ethanol is formed from pyruvate in yeast and several other microorganisms. The first step is the decarboxylation of pyruvate. This reaction is catalyzed by pyruvate decarboxylase, which requires the coenzyme thiamine pyrophosphate. This coenzyme, derived from the vitamin thiamine (BI ), also participates in reactions catalyzed by other enzymes (p. 4711). The second step is the reduction of acetaldehyde to ethanol by NADH, in a reaction catalyzed by alcohol dehydrogenase. This process regenerates NAD +.
0
- :I
H+
C,,-- .& 0 0'/ C:?'
ICH,
CO 2
\, / Pyruvate deca rboxylase
Pyluvate
NADH + W
~O
H,
•
ICH,
NAD+
\, ./
C
•
Fermentation
H, / OH H- C
•
An ATP-generating process in which organic
compounds act as both donors and accep-
ICH,
Alcohol
dehydrogenase
tors of electrons. Fermentation can take
place in the absence of 0 , - Discovered by
Ethanol
Acetaldehyde
Louis Pasteur, who described fermentation as " la vie sans rair" ("a life without air"),
The active site of alcohol dehydrogenase contains a zinc ion that is coordinated to the sulfur atoms of two cysteine residu es and a nitrogen atom of histidine (Figure 16.10). This zinc ion polarizes the carbonyl group of the substrate to favor the transfer of a hydride from NADH. The conversion of glucose into ethanol is an example of alcoholic ferrnentation. The net result of this anaerobic process is Glucose
+ 2 Pi +
2 ADP
+
2H+
) 2 ethanol
+
2 CO 2
+
2 A TP
+
NADH
Hydride donor
Cys
2 H 20
Note that NAD + and NADH do not appear in this equation, even though they are crucial for the overall process. NADH generated by the oxidation of glyceraldehyde 3-phosphate is consumed in the reduction of acetaldehyde to ethanol. Thus, there is no net oxidation--'reduction in the conversion of glucose into ethanol (Figure 16.11). The ethanol formed in alcoholic fermen tation provides a key ingredient for brewing and winemaking.
Acetaldehyde His Hydride acceptor
2. Lactate is formed from pyruvate in a variety of microorganisms in a process called lactic acid fermentation . The reaction also takes place in the cells of higher organisms when the amount of oxygen is limiting, as in muscle cells during intense activity. The reduction of pyruvate by NADH to form lactate is catalyzed by lactate dehydrogenase.
Figure 16.10 Active site of alcohol dehydrogenase. The active site contains a zinc ion bound to two cysteine residues and one histidine residue. N otice that the zinc ion binds the acetaldehyde substrate through its oxygen atom, polarizing the substrate so that it more easily accepts a hydride from NAOH. Only the nicotinamide ring of NADH is shown.
-
NADH + H+
0 ", ./0 C
HO'-
I
C-
H
I
Lactate dehydrogenase
CH, Lactate Figure 16.11 Maintaining redox balance. The NAOH produced by the glyceraldehyde 3-phosphate d ehydrogenase reaction must be reoxidi zed to NAD+ for the glycolytic pathway to continue. In alcoholic fermentation, alcohol dehydrogenase oxidizes NADH and generates ethanol. In lactic acid fermentation (not shown), lactate dehydrogenase oxidizes NADH while generating lacti c acid.
The overall reaction in the conversion of gl ucose into lactate is Glucose
+
2 Pi
+
2 ADP --+) 2 lactate
+
2 A TP
+
2 H 20
As in alcoholic fermentation, there is no net oxidation- reduction. The NADH formed in the oxidation of glyceraldehyde 3-phosphate is consumed in the reduction of pyruvate. The regeneration of NAD I- in the reduction of
O~C/H H-
IC- OH ICH 0PO,2-
0 ~C /OPO,2Glyceraldehyde 3-phosphate
H-
I'C- OH ICH 0PO,2-
Glyceraldehyde
2 1.3.Sisphosphoglycerate
' -phosphate
(l,l-BPG)
2
dehydrogenase
-
•
•
•
°H
H+
.,;;-C,,--.,;::-O C
°
CH, Pyruvate
\. /
NAO '
CO2
•
H,
.,;::-0 C
ICH,
Acetaldehyde
Alcohol dehydrogenase
H, / OH H- C
ICH,
Ethanol
447
448
TABLE 16.2 Examples of pathogenic obligate anaerobes
CH APTER 16 Glycolysis and Gluconeogenesis
Bacterium
Result of infection
Clostridium tetoni Clostridium botulinum
Tetanus (lockjaw) Botulism (an especialiy severe type of food poi soning) Gas gangrene (gas is produced as an end point o f the fermentation. distorting and destroying the tissue) Cat scratch fever (flu-like symptoms) Abdominal, pelvic, pulmonary, and bl ood infectio ns
Clostridium perfringens
Bartonella hensela Baderoides (rogilis
pyruvate to lactate or ethanol sustains the continued process of glycolysis under anaerobic conditions.
3. Only a fraction of the energy of glucose is released in its anaerobic conversion into ethanol or lactate. Much more energy can be extracted aerobically by means of the citric acid cycle and the electron-transport chain. The entry point to this oxidative pathway is acetyl coenzyme A (acetyl CoAl, which is formed inside mitochondria by the oxidative d ecarboxylation of pyruvate. Pyruvate
+
NAD +
+
CoA -~) acetyl eoA
+
CO 2
+
NADH
This reaction, which is catalyzed by the pyruvate dehydrogenase complex, will be considered in detail in Chapter 17. The NAD + required for this reaction and for the oxidation of glyceraldehyde 3-phosphate is regenerated when NADH ultimately transfers its electrons to O 2 through the electrontransport chain in mitochondria.
Fermentations Provi de Usable Energy in the Absence of O xygen
TABLE 16.3 Glucose
Fermentations yield only a fraction of th e energy available from the complete combustion of glucose. Why is a relatively inefficient metabolic pathway so extensively used? The fundamental reason is that oxygen is not required. The ability to survive without oxygen affords a host of living accommodations such as soils, deep water, and skin pores. Some organisms, called obligate anaerobes, cannot survive in the presence of O 2 , a highly reactive compound. The bacterium Clostridium perjringens, the cause of gangrene, is an example of an obligate anaerobe. Other pathogenic obligate anaerobes are listed in Table 16.2 . Skeletal muscles in most animals can function anaerobically for short periods. For example, when animals perform bursts of intense exercise, their ATP needs rise faster than the ability of the body to provide oxygen to the muscle. The muscle functions anaerobically until fatigue sets in, which is caused, in part, by lactate buildup. Although we have considered only lactic acid and alcoholic fermentation, microorganisms are capable of generating a wide array of molecules as end points to fermentation (Table 16.3). Indeed, many food Starting and ending points of various fermentations products, including sour cream, yogurt, various cheeses, beer, wine, and sauerkraut, result from fermentation . lactat e ->
Lactate Glucose Ethanol Arginine Pyrimidines Purines
Ethylene glycol Threonine Leucine Phenylalanine
-> -> --> --> --> --> --> --> -->
acetate ethanol
acetate carbon dioxide carbon dioxide
format e acetate propionate 2-alkylacet ate
propionate
Note: The products o f some fermentations are the substra les fOl ot hers.
The Binding Site for N AD + Is Similar in M any Dehydrogenases The three dehydrogenases - glyceraldehyde 3-phosphate dehydrogenase, alcohol dehydrogenase, and lactate dehydrogenase have quite different three-dimensional structures. However, their NAD + binding domains are strikingly similar (Figure 16.12). This nucleotide-binding region is made up of four ex helices and a sheet of six
Nicotinamide-binding half
449 16.1 Glycolytic Pathway Nicotinamide
~ Figure 16.12 NAD I -binding region in dehydrogenases. Notice that the nicotinamide-binding half (yellow) is struc turally similar to the adenine-binding half (red). The two hal ves together form a structura l motif called a Rossmann fold. Th e NAD+ molecule binds in an extended confo rmation. [Drawn from 3LDH.pdb.]
Pyrophosphate Adenine-binding half Adenine
NAD
parallel ~ strands. Moreover, in all cases, the bound NAD+ displays nearly the same confonnation. This common structural domain was one of the first recurring structural domains to be discovered. It is often called a Rossmannfold after Michael Rossmann, who first recognized it. This fold likely represents a primordial dinucleotide-binding domain that recurs in the dehydrogenases of glycolysis and other enzymes because of their descent from a common ancestor.
Glucose
Glucose-6P (G-6P)
Galactose
,
Fructose (adipose tissue) "
Fructose and Galactose Are Converted into Glycolytic Intermediates
F-l ,6-BP
Although glucose is the most widely used monosaccharide, others also are important fuels . Let us consider how two abundant sugars fructose and galactose can be funneled into the glycolytic pathway (Figure 16.13). There are no catabolic pathways for metabolizing fructose or galactose, and so the strategy is to convert these sugars into a metabolite of glucose. Fructose can take one of two pathways to enter the glycolytic pathway. Much of the ingested fructose is metabolized by the liver, using the fructose l -phosphate pathway (Figure 16.14). The first step is the phosphorylation offructose to fructose l-phosphate by fructokitUlSe. Fructose l-phosphate is then split into glyceraldehyde and dihydroxyacetone phosphate, an intermediate in glycolysis. This aldol cleavage is catalyzed by a specific fructose l -phosphate aldolase. Glyceraldehyde is then phosphorylated to glyceraldehyde 3-phosphate, a glycolytic intermediate, by triose kinase. In other tissues, fructose can be phosphorylated to fructose 6-phosphate by hexokiTUIse. Galactose is converted into glucose 6-phosphate in four steps. The first reaction in the galactose- glucose interconversion pathway is the phosphorylation of galactose to galactose i -phosphate by galactokinase. ATP
CH 2 0H
ADP + H+
HO )
Galactokinase
OH
0y OH
p
1:"'-. I: 0
o Galadose
Galactose 1-phosphate
2-
Fructose (liver)
2x
Pyruvate Figure 16.13 Entry points in glycolysis for galactose and fructose.
(
Fructose
J
AlP Fructokin ase
Galactose l -phosphate then acquires a uridyl group from uridine diphosphate glucose (UDP-glucose), an intermediate in the synthesis of glycosidic linkages (p _314)_
ADP Fructose I-phosphate Fru ctose I-phosphate aldolase
Glyceraldehyde Triose ki na se
ATP
Dihydroxyacetone phosphate
-
ADP UDP-glucose
Galactose I-phosphate
Glyce ralde hyde 3-phosphate
-
Galadose I-phosphate uridyl transferase
Figure 16.14 Fructose metabolism. Fructose enters the glycolytic pathway in the liver through the fructose I-phosphate pathway.
HO
luridinel
+
"\ OH / HO \
J,
OH
2-
/ .0 '-p ,I: ~
"'
(j UDP-galactose
'-
0
Glucose I-phosphate
UDP-ga ladose 4-epi merase
UDP-glucose
The products of this reaction, which is catalyzed by galactose i-phosphate uridyl transferase, are UDP-galactose and glucose l -phosphate. The galactose moiety of UDP-galactose is then epimerized to glucose. The configuration of the hydroxyl group at carbon 4 is inverted by UDP -galactose
4 -epimerase. The sum of the reactions catalyzed by galactokinase, the transferase, and the epimerase is Galactose + A TP
--l»
glucose l -phosphate + ADP + H +
Note that UDP-glucose is not consumed in the conversion of galactose into glucose, because it is regenerated from UDP -galactose by the epimerase. This reaction is reversible, and the product of the reverse direction also is important. The conversion of UDP -glucose into UDP-galac-
tose is essential for the synthesis of galactosyl residues in complex polysaccharides and glycoproteins if the amount of galactose in the diet is inadequate to meet these needs. Finally, glucose l -phosphate, formed from galactose, is isomerized to glucose 6-phosphate by phosphoglucomutase. We shall return to this reaction when we consider the synthesis and degradation of glycogen, which proceeds through glucose l -phosphate, in C hapter 21. 450
451
Many Adults Are Intolerant of Milk Because They Are Deficient in Lactase
16.1 Glycolytic Pathway
W
Many adults are unable to metabolize the milk sugar lactose and ex~ perience gastrointestinal disturbances if they drink milk. Lactose intolerance, or hypolactasia, is most commonly caused by a d eficiency of the enzyme lactase, which cleaves lactose into glucose and galactose. CH, OH
CH,OH
CH,OH
HO
HO
} - -IO
lactase
o
+ HO
OH OH
OH Lactose
OH Galactose
OH OH Glucose
"Deficiency" is not quite the appropriate term, because a decrease in lactase is normal in the course of development in all mammals. As children are weaned and milk becomes less prominent in their diets, lactase activity normally declines to about 5 to 10% of the level at birth. This decrease is not as pronounced with some groups of people, most notably Northern Europeans, and people from these groups can continue to ingest milk without gastrointestinal difficulties. With the appearance of milk-producing domesticated animals, an adult with active lactase would hypothetically have a selective advantage in being able to consume calories from the read ily available milk. What happens to the lactose in the intestine of a lactase-deficient person? The lactose is a good energy source for microorganisms in the colon, and they ferment it to lactic acid while also generating methane (CH 4 ) and hydrogen gas (H2)' The gas produced creates the uncomfortable feeling of gut distension and the annoying problem of flatulence. The lactate produced by the microorganisms is osmotically active and draws water into the intestine, as does any undigested lactose, resulting in diarrhea. If severe enough, the gas and diarrhea hinder the absorption of other nutrients such as fats and proteins. The simplest treatment is to avoid the consumption of products containing much lactose. Alternatively, the enzyme lactase can be ingested with milk products. Galactose Is Highly Toxic If the Transferase Is Missing
W
Less common than lactose intolerance are disorders that interfere ~ with the metabolism of galactose. The disruption of galactose metabolism is referred to as galactosemia. The most common form, called classic galactosemia, is an inherited deficiency in galactose i-phosphate uridyl transferase activity. Afflicted infants fail to thrive. They vomit or have diarrhea after consuming milk, and enlargement of the liver and jaundice are common, sometimes progressing to cirrhosis. Cataracts will form, and lethargy and retarded mental development also are common. The bloodgalactose level is markedly elevated, and galactose is found in the urine. The absence of the transferase in red blood cells is a definitive diagnostic criterion. The most common treatment is to remove galactose (and lactose) from the diet. An enigma of galactosemia is that, although elimination of galactose from the diet prevents liver disease and cataract development, the majority of patients still suffer from central nervous system malfunction, most commonly a delayed acquisition oflanguage skills. Female patients also dis play ovarian failure.
Scanning electron micrograph of Lactobacillus. The anaerobic bacterium Lactobacillus is shown here (artificially colored) at a magnification of 22.24SX . As suggested by its name, this genus of bacteria ferments glucose into lactic acid and is widely used in the food industry. Lactobacillus is also a component of the normal human bacterial flora of the urogenital tract where. because of its ability to generate an acidic environment, it prevents the growth of harmful bacteria. [Dr. Denni s Kunkel/PhotoTake.]
452 CHAPTER 16 Glycolysis and Gluconeogenesis
Cataract formation is better understood . A cataract is the clouding of the normally clear lens of the eye. Tf the transferase is not active in the lens of the eye, the presence of aldose reductase causes the accumulating galactose to be reduced to galactitol. H HO,,-- / H
O~ / H C
H HO
C
IC
i-
OH
+ W
H
HO
C
H
H
C
OH
CH 20H Galactose
H
NADPH
HO
IC IC
H
C
NADP+
\,/ Aldose
reductase
C
HO )
OH H H OH
CH 2 0H Galactitol
Galactitol is osmotically active, and water will diffuse into the lens, instigating the formation of cataracts . In fact, there is a high incidence of cataract formation with age in populations that consume substantial am ounts of milk into adulthood.
16.2
The Glycolytic Pathway Is Tightly Controlled
The glycolytic pathway has a dual role: it degrades glucose to generate ATP and it provides building blocks for synthetic reactions, such as the format ion of fatty acids. The rate of conversion of glucose into pyruvate is regulated to meet these two major cellular needs. In metabolic pathways, enzymes catalyzing essentially irreversible reactions are potential sites of control. Jn glycolysis, the reactions catalyzed by hexokinase, phosphofructokinase, and pyruvate kinase are virtually irreversible; hence, these enzymes would be expected to have regulatory as well as catalytic roles. In fact, each of them serves as a control site. These enzymes become more active or less so in response to the reversible binding of allosteric effectors or covalent modification. In addition, the amounts of these important enzymes are varied by the regulation of transcription to m eet chan ging metabolic needs . The time reo quired for reversible allosteric control, regulation by phosphorylation, and transcriptional control is m easured typically in milliseconds, seconds, and hours, respectively. We will consider the control of glycolysis in two different tissues skeletal muscle and liver.
Glycolysis in Muscle Is Regulated to Meet the Need for ATP G lycolysis in skeletal muscle provides ATP primarily to power contraction. Consequently, the primary control of muscle glycolysis is the energy charge of the cell the ratio of ATP to AMP. Let us examine how each of the key regulatory enzymes responds to changes in the amounts of ATP and AMP present in the cell.
Phosphofructokinase.
Phosphofructokinase is the most important control site in the mammalian glycolytic pathway (Figure 16.1 5) . High levels of ATP allosterically inhibit the enzyme (a 340 -kd tetramer) . ATP binds to a specific regulatory site that is distinct from the catalytic site. The binding of ATP lowers the enzyme's affinity for fructose 6- phosphate. Thus, a high concentration of ATP converts the hyperbolic binding curve of fructose
453 16.2 Control of Glycolysis Catalytic sites
sites
~ Figure 16.15 Structure of
Catalytic sites
phosphofructokinase. lhe structure of phosphofructokinase fro m E. coli comprises a tetramer of four identical subunits. N otice the separation of the catalytic and allosteric sites. Each subunit of the human liver enzyme consist s of two domains that are similar to the E. coli enzyme. [Drawn fro m 1PFK.pdb.)
6-phosphate into a sigmoidal one (Figure 16.16). AMP reverses the in hibitory action of ATP, and so the activity of the enzyme increases when the ATP/ AMP ratio is luwered. In other words, glycolysis is stimulated as the energy charge falls. A decrease in pH also inhibits phosphofructokinase activity by augmenting the inhibitory effect of ATP. The pH might fall when muscle is functioning anaerobically, producing excessive quantities of lactic acid. The inhibitory effect protects the muscle from damage that would result from the accumulation of too much acid. Why is AMP and not ADP the positive regulator of phosphofructoki nase? When AT P is being utilized rapidly, the enzyme adenylate kinase (Section 9.4) can form ATP from AD P by the following reaction : ADP + ADP,
' ATP + AMP
Thus, some ATP is salvaged from ADP, and AMP becomes the signal for the low-energy state. Moreover, the use of AMP as an allosteric regulator provides an especially sensitive control. We can understand why by consid ering, first, that the total adenylate pool ([ATP), [ADP), [AMP)) in a cell is constant over the short term and, second , that the concentration of ATP is greater than that of ADP and the concentration of ADP is, in turn, greater than that of AMP. Consequently, small -percentage changes in [ATP) result in larger-percentage changes in the concentrations of the other adenylate nucleotides. This magnification of small changes in [AT PJto larger changes in [AMP] leads to tighter control by increasing the range of sensitivity of phosphofructokinase. Hexokinase. Phosphofructokinase is the most prominent regulatory enzyme in glycolysis, but it is not the only one. Hexokinase, the enzyme catalyzing the first step of glycolysis, is inhibited by its product, glucose
low [AIPI
1 .-v -o
~ c o .-
High [AIPI
[Fructose 6-phosphatel
'
Figure 16.16 Allosteri c regulation of phosphofructokinase. A high level of AlP inhibits t he enzyme by decrea sing its affinity fo r fru ct ose 6-phosphate. AMP diminishes and citrate enhances the inhibitory effect of AlP.
4S4
6-phosphate. High concentrations of this molecule signal that the cell no longer requires glucose for energy or for the synthesis of glycogen, a storage form of glucose (p. 311), and the glucose will be left in the blood. A rise in glucose 6-phosphate concentration is a means by which phosphofructokinase communicates with hexokinase. When phosphofructokinase is inactive, the concentration of fructose 6-phosphate rises. In turn, the level of glucose 6phosphate rises because it is in equilibrium with fructose 6-phosphate. Hence, the inhibition of phosphofructokinase leads to the inhibition of hexokinase. Why is phosphofructokinase rather than hexokinase the pacemaker of glycolysis? The reason becomes evident on noting that glucose 6-phosphate is not solely a glycolytic intermediate. In muscle, glucose 6-phosphate can also be converted into glycogen. The first irreversible reaction unique to the glycolytic pathway, the committed step (Section 10.1), is the phosphorylation of fructose 6-phosphate to fructose 1,6-bisphosphate. Thus, it is highly appropriate for phosphofructokinase to be the primary control site in glycolysis. In general, the enzyme catalyzing the committed step in a metabolic sequence is the most important control element in the pathway.
CHAPTER 16 Glycolysis and Gluconeogenesis
•
Pyruvate Kinase. Pyruvate kinase, the enzyme catalyzing the third irreversible step in glycolysis, controls the outflow from this pathway. This final step yields ATP and pyruvate, a central metabolic intermediate that can be oxidized further or used as a building block. ATP allosterically inhibits pyruvate kinase to slow glycolysis when the energy charge is high. Finally, alanine (synthesized in one step from pyruvate, p. 686) also allosterically inhibits pyruvate kinase in this case, to signal that building blocks are abundant. When the pace of glycolysis increases, fructose 1,6bisphosphate, the product of the preceding irreversible step in glycolysis, activates the kinase to enable it to keep pace with the oncoming high flu x of intermediates_ A summary of the regulation of glycolysis in resting and active muscle is shown in Figure 16.17.
Figure 16.17 Regulation of glycolysis in muscle. At rest (left). glycolysis is not very active (thin arrows). The high concentratio n of ATP inhibits phosphofructokinase (PFK). py ruvate kinase. and hexo kinase. G lucose 6phosphate is converted into glycogen (Chapter 21). During exercise (right). the decrease in the ATP/ AMP rati o resulting from muscle contractio n activates phosphofructokinase and hence glycolysis. The flux down the pathway is increased. as represented by the thick arrows.
AT REST (glycolysis inhibited)
DURING EXERCISE (glycolysis stimulated)
Glucose
Glucose
Hexokinase
8
Glycogen ...(~- Glucose 6-phosphate - -
Negative feedback
Hexokinase
Glycogen - -;.) Glucose 6-phosphate
fructose 6-phosphate
Fructose 6-phosphate
PFK
ATP (
Fructose l.6-bisphosphate
* *
ATP
/
PFK (
_
Pyruvate kinase
Pyruvate
ATP/AMP
High energy charge ATP/AMP
ATP
Phosphoenolpyruvate ATP
'\
Fructose 1.6-bisphosphate
FeedfolWard stimulation
*,,(., Relaxed muscle fiber
low energy charge
Phosphoenolpyruvate Musclefiber contraction
ATP (
"'" Pyruvate kinase
Pyruvate
CO 2 + H2 0 (long, slow run)
Lactate (sprint)
1 ",M F-2,6-6P
100
45• 5
1 ",M F-2,6-6P
16.2 Control of Glycolysis
80
.~ v -o
~ 60
o
.-~
o
20
o
1
2
3
4
5
o
[Fructose 6-phosphate] (mM)
(A)
1
2
3
4
5
[ATP] (mM)
(6)
Figure 16.18 Activation of phosphofructokinase by fructose 2, 6-bisphosphate. (A) Th e sigmoidal dependence of velocity o n substrate concentration becomes hyperboli c in the presence of 1 fLM fructose 2,6-bisphosphate. (B) ATP, acting as a substrate, initially stimulates the reaction. As the concentration of ATP increases, it acts as an alloster ic inhibitor. The inhibitory effect of ATP is reversed by fructose 2,6-bisphosphate. [After E. Van schaftingen, M. F. Jett, L. Hue, and H. G. Hers. Proe. Natl. Acad. Sci. U.s.A. 78(1981):3483- 3486.]
The Regulation of Glycolysis in the Liver Reflects the Biochemical Versatility of the Liver The liver has more-diverse biochemical functions than muscle. Significantly, the liver maintains blood-glucose levels : it stores glucose as glycogen when glucose is plentiful, and it releases glucose when supplies are low. It also uses glucose to generate reducing power for biosynthesis (p. 577) as well as to synthesize a host of biochemicals . So, although the liver has many of the regulatory features of muscle glycolysis, the regulation of glycolysis in the liver is more complex. Phosphofructokinase. Regulation with respect to ATP is the same in the liver as in muscle. Low pH is not a metabolic signal for the liver enzyme, because lactate is not normally produced in the liver. Indeed, as we will see, lactate is converted into glucose in the liver. Glycolysis also furnishes carbon skeletons for biosyntheses, and so a signal indicating whether building blocks are abundant or scarce should also regulate phosphofructokinase. In the liver, phosphofructokinase is inhibited by citrate, an early intermediate in the citric acid cycle (p. 482). A high level of citrate in the cytoplasm means that biosynthetic precursors are abundant, and so there is no need to degrade additional glucose for this purpose. Citrate inhibits phosphofructokinase by enhancing the inhibitory effect of ATP. One means by which glycolysis in the liver responds to changes in blood glucose is through the signal molecule fructose 2,6-bisphosphate (F -2,6-BP), a potent activator of phosphofructokinase (Figure 16.18). In the liver, the concentration of fructose 6-phosphate rises when blood-glucose concentration is high, and the abundance of fructose 6-phosphate accelerates the synthesis of F -2 ,6 -BP (Figure 16.19). Hence, an abundance of fructose 6phosphate leads to a higher concentration of F-2,6-BP. The binding offructose 2,6-bisphosphate increases the affinity of phosphofructokinase for fructose 6· phosphate and diminishes the inhibitory effect of ATP. Glycolysis is thus accelerated when glucose is abundant. Such a process is called feedforward stimulation. We will turn to the synthesis and degradation of this important regulatory molecule after we have considered gluconeogenesis.
Glucose
F-6P
F-2,6-6P activates PFK PFK
Succi"yl CoA
HN
1
"'1: ""
0 2,
N...... /
P "'0
,'/ I
o
GDP
>
GTP
48 7 17.2 Reactions of the Citric Acid Cycle His
CoA
~ Figure 17.14 Structure of succinyl
CoA synthetase. The enzyme is composed of two subunits. The a subunit contains a Rossmann fold that binds t he ADP component of CoA , and the 13 subunit contains a nucleotide-activating region called the ATP-grasp domain. The ATP-grasp domain is shown here binding a molecule of ADP. No tice the histid ine resi due is between the CoA and the ADP. Thi s histidine residue picks up the phosphoryl group from near the CoA and swings over to t ransfer it t o the nucleoti de bo und in the ATP-grasp domain. [Drawn from lCGLpdb.]
Rossmann fold a subunit
AlP grasp ~
subunit
~/
Succinyl CoA synthetase is an a 2132 heterodimer; the functional unit T is one al3 pair. The enzyme mechanism shows that a phosphoryl group is transferred first to succinyl CoA bound in the a subunit and then to a nucleoside diphosphate bound in the 13 subunit. Examination of the time-dimensional structure of succinyl CoA synthetase reveal s that each subunit comprises two domains (Figure 17.14). The amino-terminal domains of the two subunits have different structures, each characteristic of its role in the mechanism . The amino -terminal domain of the a subunit forms a Rossmann fold (p. 449), which binds the ADP component of succinyl CoA. The am ino-terminal domain of the 13 subunit is an ATP-grasp do main, found in many enzymes, which here binds and activates GDP. Succinyl CoA synthetase has evolved by adoptin g these domains and harnessing them to capture the energy associated with succinyl CoA cleavage, which is used to drive the generation of a nucleoside triphosphate.
Oxaloacetate Is Regenerated by the Oxidation of Succinate Reactions of four- carbon compounds constitute the final stage of the citric acid cycle: the regeneration of oxaloacetate. (00-
FAD
FAD H,
H
.....COO-
' C.....
HI-
(
II
IC
-ooc/" "H
(00Succinate
Fumarate
coo-
H, O
\-" ,
HO'H-
IC- IH IC- fjll Icoo-
NAD+
NADH
Malate
The reactions constitute a metabolic motif that we will see again in fatty acid synthesis and degradation as well as in the degradation of some amino acids. A methylene group (CH 2) is converted into a carbonyl group (C 0) in three steps: an oxidation, a hydration, and a second oxidation reaction . Oxaloacetate is thereby regenerated for another round of the cycle, and more energy is extracted in th e form of F ADH2 and NADH . Succinate is oxidized to fumarate by succinate dehydrogenase. T he hydrogen acceptor is FAD rather than AD + , which is used in the other three oxidation reactions in the cycle. FAD is the hydrogen acceptor in this reaction
+ H'
O~
/ coo-
"'c
H-
IC-
H
cooOxaloacetate
488 CHAPTER 17 The Citric Ac id Cycle
because the free -energy ch ange is insufficient to reduce NAD +. FAD is nearly always the electron acceptor in oxidations that remove two hydrogen atoms from a su bstrate. In su ccinate dehydrogenase, the isoalloxazine ring of FAD is covalently attached to a hi stidine side chain of the enzyme (denoted E-FAD ). E- FAD + succinate
OH COO-
H
Fumarate
OH
H
. coo-
H
L-Malate
,.Go, for the reduction of CO 2 to the level of hexose is +477 kJ mol - 1 ( + 114 kcal mol-I ). A mole of 600-nm photons has an energy content of 199 kJ (47.6 kcal) Assume that the proton gradient generated in producing the required NADPH is sufficient to drive the synthesis of the required ATP.
eu .-E '" '" (l) ~
:::l
~o-
0
10
20
30
40
50
Leaf temperature (0C) (a) Which data were most likely generated by the C 4 plant and which by the C 3 plant? Explain. (b) Suggest some possible explanations for why the photosyn thetic activity falls at higher temperatures. Graph B illustrates how the photosynthetic activity of C 3 and C 4 plants varies with CO 2 concentration when temperature (30°C ) and light intensity (high) are constant. 40
(6) ~
~"O
Q)
C
"-a
"ou (l)
(4
Cl)
-
30 Z'" 'S: =-= '" QJ
.- E u 'iii '"
'"
plant
...
- --
0to
'"
(l)
.-Qju '"N _-
20 ..cO", _ U (l)
>--'0 -c:
-
(, plant
",00 O"'~ Q) QJ (l)
..c a 10 Cl.EE
eu
Q)
'" E "0'"
.-
~
~
0
100
200
300
400
500
Intracellular CO, (milliliters per liter) (c) Why can C 4 plants thrive at CO 2 concentrations that do not support the growth of G j plants? (d ) Suggest a plausible explanation for why C 3 plants continue to increase photosynthetic activity at higher CO 2 concentrations, whereas C 4 plants reach a plateau.
Cha pter
Glycogen Metabolism
Epinephrine
~
",
Glycogen
Glucose for energy
Signaling cascades lead to the mobilization of glycogen to produce glucose, an energy source for runners. [(Left) M ike Powel l/Al lsport.)
I Outline J 21.1 Glycogen Breakdown Requires the Interplay of Several Enzymes 21 .2 Phosphorylase Is Regulated by Allosteric Interactions and Reversible Phosphorylation 21 .3 Epinephrine and Glucagon Signal the Need for Glycogen Breakdown 21.4 Glycogen Is Synthesized and Degraded by Different Pathways
lycogen is a readily mobilized storage form of glucose. It is a very large, branched polymer of glucose residues that can be broken down to yield glucose molecules when energy is needed (Figure 21.1). Most of the glucose residues in glycogen are linked by a -1, 4-g1ycosidic bonds. Branches at about every tenth residue are created by a-1 ,6-glycosidic bonds. Recall that ex-glycosidic linkages form open helical polymers, whereas f3 linkages produce nearly straight strands that form structural fibrils, as in cellulose (p . 312). Glycogen is not as reduced as fatty acids are and consequently not as energy ri ch . Why isn 't all excess fuel stored as fatty acids rather than as glycogen? The controlled release of glucose from glycogen maintains blood· glucose levels between meals. The circulating blood keeps the brain supplied
21.5 Glycogen Breakdown and Synthesis Are Reciprocally Regulated CH 20H
-
0
CH 2 0H
}--o
)
0
OH
-----~' Nonreducing
o
o
HO
ends
CH20H
CH 2 0H
1
I
/
n-',6 linkage
02-OH
OH
6
CH 2
a-I ,4 linkage CH 20H ~O
OH
OH
o
o
o OH
•
OH
OH
R OH
Figure 21.1 Glycogen structure. In this structure o f two o uter branches of a glycogen molecule, the resi dues at t he nonreducing ends are shown in red and the residue that starts a branch is shown in green. The rest of the glycogen molecule is represented by R.
592
with glucose, which is virtually the only fuel used by the brain, except during prolonged starvation. Moreover, the readily mobilized glucose from glycogen is a good source of energy for sudden, strenuous activity. U nlike fatty acids, the released glucose can provide energy in the absence of oxygen and can thus supply energy for anaerobic activity. The two major sites of glycogen storage are the liver and skeletal muscle. The concentration of glycogen is higher in the liver than in muscle (10% ver sus 2% by weight), but more glycogen is stored in skeletal muscle overall because of muscle's much greater mass. G lycogen is present in the cytoplasm in the form of granu les ranging in diameter from 10 to 40 nm (Figure 21.2 ). In the liver, glycogen synthesis and degradation are regulated to maintain blood-glucose levels as required to meet the needs of the organism as a whole. In contrast, in muscle, these processes are regulated to meet the energy needs of the muscle itself.
Glycogen granules
.
•'
Figure 21.2 Electron micrograph of a liver cell. The dense particl es in the cytoplasm are glycogen gra nul es. [Court esy of Dr. George Palade.]
Glycogen Metabolism Is the Regulated Release and Storage of Glucose Glycogen degradation and synthesis are simple biochemical processes . G lycogen degradation consists of three steps: (I) the release of glucose 1-phosphate from glycogen, (2) the remodeling of the gl ycogen substrate to permit further degradation, and (3 ) the conversion of glucose 1-phosphate into glucose 6-phosphate for further metabolism. The glucose 6phosphate derived from the breakdown of glycogen has three fates (Figure 21.3): (1 ) it is the initial substratefor glycolysis, (2) it can be converted into free glucose for release into the bloodstream, and (3) it can be processed by the pentose phosphate pathway to yield NADPH and ribose derivatives. The conversion into free glucose takes place mainly in the liver. Glycogen synthesis requires an activated form of glucose, uridine diphosphate glucose (UDP-glu cose), which is formed by the reaction of UTP and glucose I-phosphate. UDP-glucose is added to the nonreducing ends of glycogen molecules. As is the case for glycogen degradation, the glycogen molecule must be remodeled for continued synthesis. The regulation of glycogen degradation and synthesis is complex. Several enzymes taking part in glycogen metabolism allosterically respond to metabolites that signal the energy needs of the cell. Through these allosteric responses, enzyme activity is adjusted to meet the needs of the cell. In addition, hormones may initiate signal cascades that lead to the reversible phosphorylation of enzymes, which alters their catalytic rates.
Regulation by hormones adjusts glycogen metabolism to meet the needs of the entire organism.
21.1
Glycogen
Glycogen
n- 1
Glycogen ph osph oryl ase
Glucose l -phosphate Pho ph oglucomutase
[
GLYCOLYSIS
Glucose 6-phosphate Muse/e,
Liver
brain
Glucose
1 PENTOSE PHOSPHATE
6-ph osphatase
Pyruvate
Lactate
CO 2
+ H 20
Ribose + NADPH
Glucose
Blood for use by other tissues Figure 21.3 Fates of glucose 6-phosphate. Glucose 6pho sphate der ived fro m glycogen can (1) be used as a fuel fo r anaero bi c or aerob ic metabol ism as in, f o r inst ance, muscle; (2) be convert ed into f ree glucose in th e liver and subsequent ly re leased into t he blood; (3) be p rocessed by the pentose phosphat e path w ay t o generate NA DPH or ri bose in a variety o f ti ssues.
Glycogen Breakdown Requires the Interplay of Several Enzymes
The efficient breakdown of glycogen to provide glucose 6-phosphate for further metabolism requires four enzyme activities: one to degrade glycogen, two to remodel glycogen so that it remains a substrate for degradation, and one to convert the product of glycogen breakdown into a form suitable for further metabolism. We will examine each of these activities in turn . 593
594 CHAPTER 21
Glycogen Metabolism
Phosphorylase Catalyzes the Phosphorolytic Cleavage of Glycogen to Release Glucose l-phosphate Glycogen phosphorylase, the key enzyme in glycogen breakdown, cleaves its substrate by the addition of orthophosphate (Pi) to yield glucose j -phosphate. The cleavage of a bond by the addition of orthophosphate is referred to as
phosphorolysis. Glycogen + Pi (n residues)
",,==,'
glu cose I-phosphate
+ glycogen (n - I residues)
Phosphorylase catalyzes the sequential removal of glucosyl residues from the nonreducing ends of the glycogen molecule (the ends with a free OH group on carbon 4; p . 309). Orthophosphate splits the glycosidic linkage between C-I of the terminal residue and C-4 of the adjacent one. Specifically, it cleaves the bond between the C - 1 carbon atom and the glycosidic oxygen atom, and the 0. configuration at C -1 is retained . HPO.'
,
o
HO
'--OR
"--
+
•
HO OH
OH
OH Glycogen (n residues)
OPO/
Glucose I-phosphate
HO
OR
OH Glycogen (n - 1 residues)
Glucose I-phosphate released from glycogen can be readily converted into glucose 6-phosphate (p . 595), an important metabolic interm ediate, by the enzyme phosphoglucomutase. The reaction catalyzed by phosphorylase is readily reversible in vitro. At pH 6.8, the eq uilibrium ratio of orthophosphate to glucose I-phosphate is 3.6. The value of l1G o, for this reaction is small because a glycosidic bond is replaced by a phosphoryl ester bond that has a nearly equal transfer paten· tial. However, phosphorolysis proceeds far in the direction of glycogen breakdown in vivo because the [P;]I[glucose I -phosphate] ratio is usually greater than 100, substantially favoring phosphorolysis. We see here an example of how the cell can alter the free -energy change to favor a reaction's occurrence by altering the ratio of substrate and product. The phosphorolytic cleavage of glycogen is energetically advantageous be· cause the released sugar is already phosphorylated. In contrast, a hydrolytic cleavage would yield glucose, which would then have to be phosphorylated at the expense of a molecule of ATP to enter the glycolytic pathway. An add itional advantage of phosphorolytic cleavage for muscle cells is that no transporters exist for glucose I-phosphate, negatively charged under physiological conditions, so it cannot be transported out of the cell.
A Debranching Enzyme Also Is Needed for the Breakdown of Glycogen G lycogen phosphorylase acting alone degrades glycogen to a limited extent. However, the enzym e soon en counters an obstacle. The 0. -1 ,6-g1ycosidic bonds at the branch points are not susceptible to cleavage by phosphorylase. Indeed, phosphorylase stops cleaving 0. -1 ,4 linkages when it reaches a ter· minal residue four residues away from a branch point. Because about 1 in 10 residues is branched, cleavage by the phosphorylase alon e would come to a halt after the release of six glucose molecul es per branch. How can the remainder of the glycogen molecule be mobilized for use as a fuel ? Two additional enzymes, a transferase and ex -1, 6-glucosidase, remodel
1,6 linkage
595
--------'-'--
21 .1 Glycogen Breakdown
CORE r 8 Pi
1,4 linkage
Phosphorylase
8 ~ Glucose I-phos phate
Figure 21.4 Glycogen remodeling. First, cr.-l A-glycosidic bonds on each branch are cleaved by phosphorylase. leaving fo ur residues along each branch. The t ransferase shifts a block of three glucosyl residues f rom one outer branch to the other. In th is reaction, the cr. -lA-glycosidic link between the blue and the green residues is broken and a new cr.-1A link between the blue and the yellow residues is formed. The green residue is then removed by u -l ,6-glucosidase, leaving a linear chain with al l cr.-1A linkages, suitable for further cleavage by phosphorylase.
CORE Transferase
CORE (X- l ,6-Glucosidase
the glycogen for continued d egradation by the phosphorylase (Figure 21.4).
The transf erase shifts a block of three glucosyl residues from une outer branch to the other. This transfer exposes a sing le glucose residue joined b y an ct-l,6 -glycosidic linkage. a -l,6 -G lucosidase, also known as the debranching enzyme, hyd rolyzes the a -1, 6-glycosidic bond.
H2 0
HD
"-... ,
+
0- 1,6-Gluco-
sidase
HO
OH OH
RO
OR'
RO OH
OR' OH
Glycogen (n residues)
Glucose
Glycogen (n - I residues)
A free glucose m olecule is released and then p hosphorylated by t he glycolytic en zyme hexokinase. T hus, the transferase and a -I, 6-glucosidase convert the branched structure into a linear on e, which paves t he way for further cleavage by p hosphorylase. It is noteworthy that, in eukaryotes, the transferase and the a -I ,6-glucosidase activities are p resent in a single 160-kd polypeptide chain, providin g yet another exampl e of a bifu nctional en zym e (p.466). Furthermore, these en zymes may h ave addi tional features in common (p. 606).
Phosphoglucomutase Converts Glucose l-phosphate into Glucose 6-phosphate Glucose I -phosphate formed in the phos phorolytic cleavage of glycogen must be converted into glucose 6- phosphate to enter the metabolic mainstream . This shift of a phosphoryl group is catalyzed by phusphuglucomutase. Recall that this enzym e is also used in galactose m etabolism (p. 450). To effect this shift, the en zym e exchan ges a phosphoryl group with the sub strate (Figure 21 .5). The catalytic site of an active mutase molecul e contains a phosphorylated serine residue. T he phosphor yl group is transferred from
?
596 CHAPTER 21 Glycogen Metabolism
o,
2-
, ,
~o/\~O Senne
~OH
0
,
Figure 21.5 Reaction catalyzed by phosphoglucomutase. A phosphoryl group is transferred from the enzyme to t he substrate, and a di fferent phosphoryl group is transferred back to restore t he enzyme to it s initial state.
2-
,
,
OH
OH Glucose
Glucose
Glucose
I-phosphate
1,6-bisphosphate
6-phosphote
the serine residue to the C- 6 hydroxyl group of glucose 1-phosphate to form glucose 1,6-bisphosphate, The C-1 phosphoryl group of this intermediate is then shuttled to the same serine residue, resulting in the formation of glucose 6-phosphate and the regeneration of the phosphoenzyme. These reactions are like those of phosphoglycerate mutase, a glycolytic en· zyme (p , 444 ), The role of glucose 1 ,6 -bisphosphate in the inter conversion of the phosphoglucoses is like that of 2,3 -bisphosphoglycerate (2,3 -BPG) in the interconversion of 2 -phosphoglycerate and 3- phosphoglycerate in gly· colysis, A phosphoenzyme intermediate participates in both reaction s.
The Liver Contains Glucose 6-phosphatase, a Hydrolytic Enzyme Absent from Muscle A major function of the liver is to maintain a nearly constant level of glucose in the blood. The liver releases glucose into the blood during muscular activity and between meals. The released glucose is taken up primarily by the brain and skeletal muscle. In contrast with unmodified glucose, however, the phosphorylated glucose produced by glycogen breakdown is not trans· ported out of cells. The li ver contains a hydrolytic enzyme, glucose 6-pllOsphatase that enables glucose to leave that organ . This enzyme cleaves the phosphoryl group to form free glucose and orthophosphate. This glucose 6· phosphatase is the same enzyme that releases free glucose at the conclusion of gluconeogenesis. It is located on the lumenal side of the smooth endoplasmic reticulum membrane. Recall that glucose 6-phosphate is trans· p orted into the endoplasmic reticulum; glucose and orthophosphate formed by hydrolysis are then shuttled back into the cytoplasm (p. 463 ), G lucose 6-phosphate
+ H 20 --t>
glucose
+ Pi
Glucose 6-phosphatase is absent from most other tissues. These tissues reo tain glucose 6-phosphate for the generation of ATP. In contrast, glucose is not a major fuel for the liver.
Mechanism: Pyridoxal Phosphate Participates in the Phosphorolytic Cleavage of Glycogen We now examine the catalytic mechanism of glycogen phosphorylase. This en· zyme is a dimer of two identical 97-kd subunits. Each subunit is compactly folded into an amino-terminal domain (480 residues) containing aglycogen-binding site and a carboxyl-terminal domain (360 residues; Figure 21.6). The catalytic site in each subunit is located in a deep crevice formed by residues from both domains. The special challenge faced by phosphorylase is to cleave glycogen phosphorolytically rather than hydrolytically to save the ATP required to phosphorylate free glucose. Thus, water must be excluded from the active site.
Glycogenbinding site
Lys 680 Lys 568 Catalytic sites
PLP Arg 569
N-terminal do main Gly 135 Gly 134 Glycogenbinding site
Binding site of phosphate (P,) substrate ( -t erm inal do ma in
1!, Figure 21.6 Structure of glycogen phosphorylase. This enzyme for ms a homodimer: "® one subunit is shown in whi te and the other in yellow. Each catal ytic site includes a PYridoxa l phosphate (PLP) group. linked to lysine 680 o f the enzyme. The bind ing site for the phosphate (Pi) substrate is shown. Notice that the cata lytic site lies between the ( -t erm ina l domain and th e glycogen-binding site. A narrow crevice. which binds four or five glucose units of glycogen. connects the two sit es. The separation of the sites allows t he cat alyt ic site to phosphorolyze several glucose units bef ore the enzyme must rebind the glycogen substrate. [Drawn from 1NOl.pdb.]
Several clues suggest a mechanism by which phosphorylase achieves the exclusion of water. First, both the glycogen substrate and the glucose I-phosphate product have an a configuration at C-l. A direct attack of phosphate on C-1 of a sugar would invert the confi guration at this carbon because the reaction would proceed through a pentacovalent transition state. The fact that the glucose 1-phosphate form ed has an a rather than a ~ confi guration suggests that an even number of steps (most simply, two ) is required. The most likely explanation for these results is that a carbunium ion intermediate is formed . A second clue to the catalytic mechanism of phosphorylase is its requirement for pyriduxal phosp hate (PLP), a derivative of pyridoxine (vitaminBn, p. 423 ). The aldehyde group of this coenzyme forms a Schiff base with a specific lysine side chain of the enzyme (Figure 21. 7) . Structural studies indicate that th e reacting orthophosphate group takes a position between the 5 ' -phosphate group of PLP and the glycogen substrate (Figure 21.8). The 5'-phosphate group of PLP acts in tandem with orthophosphate by serving as a proton donor and then as a proton acceptor (that is, as a general acid- base catalyst). Orthophosphate (in the HPol - form ) donates a proton to the oxygen atom attached to carbon 4 of the departing glycogen chain and simultaneously acquires a proton from PLP. The carbocation (carbonium ion ) intermediate form ed in this step is then attacked by orthophosphate to form a-glucose 1- phosphate, with the con comitant return of a hydrogen atom to pyridoxal phosphate . The special role of
o H
.'
N~
H
Lysine
OH • • • •
o
~+ N H PLP
Figure 21.7 PLP- Schiff-base linkage. A pyridoxal phosphate (PLP) grou p (red) forms a Schiff base with a lysine resid ue (blue) at the active site of phosphory lase.
59 7
Carbocation
5 98
---------------------
intermediate
CHAPTER 21 Glycoge n Metabolism
HOH,C H HO--...c __
+
HOR
,
/
H •
PLP
PLP
Figu re 21.8 Phosphorylase mechanism. A bound HP0 4 2 - group (red) favors the cleavage of the glycosidic bond by donating a proton to the departing glucose (black). Thi s reaction results in the formation of a carbocation and is favored by the transfer of a proton from the protonated phosphate group of the bound pyridoxal phosphate (PLP) group (blue). The carbocation and the orthophosphate combine to form glucose 1-phosphate.
pyridoxal phosphate in the reaction is necessary because water is excluded from the active site. The glycogen-binding site is 30 A away from the catalytic site (see Figure 21.6), but it is connected to the catalytic site by a narrow crevice able to accommodate four or five glucose units. The large separation between the binding site and the catalytic site enables the enzyme to phosphorolyze many residues without having to dissociate and reassociate after each catalytic cycle. An enzyme that can catalyze many reactions without having to dissociate and reassociate after each catalytic step is said to be processive- a property of enzymes that synthesize and degrade large polymers. We will see such enzymes again when we consider DNA and RNA synthesis.
21.2
Phosphorylase Is Regulated by Allosteric Interactions and Reversible Phosphorylation
Glycogen metabolism is precisely controlled by multiple interlocking mechanisms. The focus of this control is the enzyme glycogen phosphorylase. Phosphorylase is regulated by several allosteric effectors that signal the energy state of the cell as well as by reversible phosphorylation, which is responsive to hormones such as insulin, epinephrine, and glucagon. We will examine the differences in the control of glycogen metabolism in two tissues: skeletal muscle and liver. These differences are due to the fact that the muscle uses glucose to produce energy for itself, whereas the liver maintains glucose homeostasis of the organism as a whole. •
Muscle Phosphorylase Is Regulated by the Intracellular Energy Charge
The dimeric skeletal-muscle phosphorylase exists in two interconvertible forms: a usually active phosphorylase a and a usually inactive phosphorylase b (Figure 21.9). Each of these two forms exists in equilibrium between an active relaxed (R) state and a much less active tense (T ) state, but the equilibrium for phosphorylase a favors the R state, whereas the equilibrium for phosphorylase b favors the T state (Figure 21.10). Muscle phosphorylase b is active only in the presence of high con centrations
Catalytic sites
Phosphoserine residues Catalytic sites
Phosphorylase a (in R state)
Phosphorylase b (in T state)
1)
Figure 21.9 Structures of phosphorylase a and phosphorylase b. Phosphorylase a is phosphory lated on serine 14 o f each subunit. This modification favo rs the structure of the more acti ve R state. One subunit is shown in white, with helices and loops important for regulation sho wn in blue and red . The other subunit is shown in ye llow, with the regu latory ;tructures shown in o range and green. Phosphorylase b is not phosphorylated and exist s predominantly in th e T state. Notice that the catalyti c sites are partly occluded in the Tstate. [Drawn fro m 1GPA.pdb and 1NOJ.pdb.]
Phosphorylase a
Phosphorylase b Active _
of AM P, which binds to a nucleotide-binding site and stabilizes t h e conformation of phosphorylase b in the active state (Figure 21.11 ). ATP acts as a negative allosteric effector by competing with AMP. Thus, the transition of phosphorylase b between the active R state and the less-active T state is controlled by the energy charge of the muscle cell. Glucose 6-phosphate also favors the less-active state of phosphorylase b, an example of feedback inhibition. Phosphorylase b is converted into phosphorylase a by the phosphorylation of a single serine resid ue (serine 14) in each subunit, This conversion is initiated by hormones. Fear or the excitem ent of exercise will cause levels of the hormone epinephrine to increase, T he increase in hormone levels and the electrical stimulation of muscle re sult in phosphorylation of the enzyme to the phosphorylase a form, The regulatory enzyme phosphorylase kinase catalyzes this covalent modification , Under most physiological conditions, phosphorylase b is inactive because of the inhibitory effects of AT? and glucose 6-phosphate. In contrast, phosphorylase a is fully active, regardless of the levels of AMP, ATP, and glucose 6-phosphate. In resting muscle, nearly all the enzyme is in the inactive b form. When exercise comm ences, the elevated level of AMP leads to the activation of phosphorylase b. Exercise will ~so result in hormone release that generates the phosphorylated a form of the en zyme, The absence of glucose 6-phosphatase in muscle ensures that glucose 6-phosphate derived from glycogen remains within the cell for energy transformation.
site
-, /~~--,
2 ATP 2 ADP
R state
,
\, .-
u .-u'"
-'"
Glucose added
E
~
c:
L.U
b
Syntha se
1 o
b 2
4
6
8
Minutes Figure 21.21 Blood glucose regulates liverglycogen metabolism. The infusion of glucose into the bloodstream leads t o the inact ivation of phosphorylase, followed by the activation of glycogen synthase, in the liver. [After W. Sta lmans. H. De Wulf, L. Hue, and H.-G. Hers. fur. }. Biochem.
41(1974 ):117- 134.]
After exercise, people often consume carbohydrate-rich foods to restock their glycogen stores. How is glycogen synthesis stimulated? When blood -glucose levels are high, insulin stimulates the synthesis of glycogen by inactivating glycogen synthase kinase, the enzyme that maintains glycogen synthase in its phosphorylated, inactive state (Figure 21. 20). The first step in the action of insulin is its binding to a receptor tyrosine kinase in the plasma membrane (Section 14. 2). The binding of insulin activates the tyrosine kinase activity of the receptor so that it phosphorylates insulin-receptor substates (lRSs). These phosphorylated proteins trigger signal-transduction pathways that eventually lead to the activation of protein kinases that phosphorylate and inactivate glycogen synthase kinase. T he inactive kinase can no longer maintain glycogen synthase in its phosphorylated, inactive state. Protein phosphatase 1 dephosphory lates glycogen synthase, activating it, and restoring glycogen reserves. Glycogen Metabolism in the Liver Regulates the Blood-Glucose Level
After a meal rich in carbohydrates, blood -glucose levels rise, and glycogen synthesis is stepped up in the liver. Although insulin is the primary signal for glycogen synthesis, another is the concentration of glucose in the blood, which normall y ranges from about 80 to 120 mg per 100 ml (4.4-6 .7 mM ). The liver senses the concentration of glucose in the blood and takes up or releases glucose accordingly. The amount of liver phosphorylase a decreases rapid ly when glucose is infused (Figure 21. 21). After a lag period, the amount of glycogen synthase a increases, which results in glycogen synthesis. In fact, phosphorylase a is the glucose sensor in liver cells. The binding of glucose to phosphorylase a shifts its allosteric equil ibri um from the active R form to the inactive T form . This conformational change renders the phosphoryl group on serine 14 a substrate for protein phosphatase 1. PP1 binds t ightly to phosphorylase a only when the phosphorylase is in the R state but is inactive when bound _When glucose induces the transition to the T fo rm , PPl dissociates from the phosphorylase and becomes active. Recall that the R ( ) T transition of muscle phosphorylase a is unaffected by glucose and is thus unaffected by the rise in blood -glucose levels (p. 598)_ How does glucose activate glycogen synthase? Phosphorylase b, in contrast with phosphorylase a, does not bind the phosphatase. Consequently, the conversion of a into b is accompanied by the release of PP1, which is then free to activate glycogen synthase and dephosphorylate glycogen phosphorylase (Figure 21.22). T he removal of the phosphoryl group of inactive glycogen synthase b converts it into the active a form. Initially, there are about 10 phosphorylase a molecules per molecule of phosphatase . Hence, the activity of glycogen synthase begins to increase only after most of phosphorylase a is converted into b. This remarkable glucose-sensing system depends on three key
Glycogen phosphorylase a (T state)
Glycogen phosphorylase b (T state)
6 11 21.5 Regulation of Glycogen Metabolism
p, Glycogen phosphorylase a (R state)
/)
o + Phosphorylasebinding region
PP1
Glycogen-binding •
region
Glucose (. ) Glycogen synthase b
Glycogen synthase a
Figure 21.22 Glucose regulation of liverglycogen metabolism. Glucose binds to and inhibits glycogen p hosphorylase a in the liver. fa cili tating the formati on of the T stat e of phosphorylase a. The T state o f phosphorylase a does not bind prote in phosphate 1 (PP1). leading to the dissociation and activation of PP1 from glycogen phosphorylase a. The free PP1 dephosphorylates glycogen phosphorylase a and glycogen synthase b. leading t o the inactivation of glycogen breakdown and the activati o n of glycogen synthesis.
elements: (1) communication between the allosteric site for glucose and the serine phosphate, (2) the use of PP1 to inactivate phosphorylase and activate glycogen synthase, and (3) the binding of the phosphatase to phosphorylase a to prevent the premature activation of glycogen synthase. A Biochemical Understanding of Glycogen-Storage Diseases Is Possible
W
Edgar von Gierke described the first glycogen-storage disease in t;p 1929. A patient with this disease has a huge abdomen caused by a massive enlargement of the liver. There is a pronounced hypoglycemia between meals . Furthermore, the blood-glucose level does not rise on administration of epinephrine and glucagon. An infant with this glycogen-storage disease may have convulsions because of the low blood-glucose level. The enzymatic defect in von Gierke disease was elucidated in 1952 by Carl and Gerty Corio They found that glucose 6-phosphatase is missing from the liver of a patient with this disease. This finding was the first demonstration of an inherited deficiency of a liver enzyme. The liver glycogen is normal in structure but present in abnormally large amounts. The absence of glucose 6-phosphatase in the liver causes hypoglycemia because glucose cannot be formed from glucose 6-phosphate. This phosphorylated sugar does not leave the liver, because it cannot cross the plasma membrane. The presence of excess glucose 6-phosphate triggers an increase in glycolysis in theliver, leading to a high level ofiactate and pyruvate in the blood . Patients who have von Gierke disease also have an increased dependence on fat metabolism. This disease can also be produced by a mutation in the gene that encodes the glucose 6-phosphate transporter. Recall that glucose 6-phosphate must be transported into the lumen of the endoplasmic reticulum to be hydrolyzed by phosphatase (p . 463). Mutations in the other three essential proteins of this system can likewise lead to von G ierke disease. Seven other glycogen-storage diseases have been characterized (Table 21.1). In Pompe disease (type IT), Iysosomes become engorged with glycogen because they lack a-1 ,4 -glucosidase, a hydrolytic enzyme confined to these organelles (Figure 21.23) . The Coris elucidated the biochemical defect in another glycogen-storage disease (type III), which cannot be distin guished from von Gierke disease (ty pe I) by physical examination alone. Tn type III disease, the structure of liver and muscle glycogen is abnormal and
I 1
~m
Figure 21.23 Glycogen-engorged lysosome. Thi s electron micrograph shows skeletal muscle from an infant with type II glycogen-storage disease (Pompe disease). The Iysosomes are filled with glycogen because of a deficiency in 0 -1,4glucosidase. a hydrolyti c enzyme con fined to Iysosomes. The amount of glycogen in the cyt o plasm is normal. [From H.-G. Hers and F. Van Hoof. Eds .. Lysosomes and Storage Diseases (Academic Press. 1973). p. 205 ]
TABLE
21.1 Glycogen-storage diseases Glycogen in the affected organ
Type
Defective enzyme
Organ affected
I Von Gierke disease
Glucose 6-pho sphatase or transport system
Li ve r and kidney
Increased amount; normal structure.
,,-l A-Glucosidase (lysosomal)
All organs
Massive increase in
Amylo-l ,6-glucosidase (debranching enzyme)
Muscle and li ve r
Branching enzyme (", -1,4 , «-1,6)
Liver and spleen
Normal amount; very long outer bra nches.
Phosphorylase
Muscle
Moderatel y increased amount; normal struct ure.
II Pompe
amount; normal structure.
disease III Cori
Increased amount; short outer branches.
Clinical features Massive enlargement of the liver. Failure to thri ve. Severe hypoglycemia. ketosis. hyperuricemia. hyperlipemia. Ca rdi o resp iratory failure ca uses death, usually before age 2. Li ke type I, but milder
course.
disease IV
Andersen
disease V McArdle
disease
Progressive ci rrh osis of the liver. Liver failure causes death, usually before age 2. Limi ted ability to perform strenuous
exercise because of painful
muscle cramps. Otherwise patient
VI Hers
Phosphorylase
Liver
Increased amount.
is normal and well developed. Like type I. but milder
course.
disease VI I
Phosphofructoki nase
Muscle
VIII
Phosphorylase ki nase
li ver
Increased amount; normal stru cture. Increased amount; normal structure.
Like type V. Mild liver enlargement
M ild hypoglycemia.
Note: Types I through VII are inherited as autosomal recessives. Type VIII is sex linked.
300
::; 200 "-
-a.-
C .t!l. ,
McArdl e disease After Light exercise acclimation leading to to light • cramps exerCise
'------. Heavy
100
j
Normal
o Figure
. Rest ExerCise
. Rest ExerCise
21.24 NMR study of human arm
muscle. The level o f ADP du rin g exercise increases much more in a patient with McArd le glycogen-st orage d isease (type V) than in normal co ntro ls. [After G. K. Radda.
Biochem. Soc. Trans. 14(1986):517-525.]
the amount is markedly increased . Most strikin g, the outer branches of the glycogen are very short. Patients having this type lack the debranching enzyme (a-l,6-glucosidase), and so only the outermost branches of glycogen can be effectively utilized . Thus, only a small fraction of this abnormal glycogen is functionally active as an accessible store of glucose. A d efect in glycogen metabolism confined to muscle is found in McArdle disease (type V). Muscle phosphory lase activity is absent, and a patient's capacity to perform strenuous exercise is limited because of painful muscle cramps. The patient is otherwise normal and well developed. Thus, effective utilization of muscle glycogen is not essential for life. Phosphorus· 31 nuclear magnetic resonance studi es of these patients have been very informative . The pH of skeletal -muscle cell s of normal people drops during strenuous exercise because of the producti on of lactate. In contrast, the muscle cells of patients with McArdle disease become more alkaline during exercise because of the breakdown of creatine phosphate (p . 416) . Lactate does not accumulate in these patients, becau se the glycolytic rate of their muscle is much lower than normal ; their glycogen cannot be mobilized. NM R studies have also shown that the painful cramps in this disease are correlated with high levels of ADP (Figure 21. 24). NMR spectroscopy is a valuable, noninvasive technique for assessing dietary and exercise therapy for this disease.
Summary Glycogen, a readily mobilized fuel store, is a branched polymer of glucose residues. Most of the glucose units in glycogen are linked by a-l ,4-glycosidic bonds. At about every tenth residue, a branch is created by an a - I,6 -glycosidic bond. Glycogen is present in large 612
amounts in muscle cells and in liver cells, where it is stored in the cytoplasm in the form of hydrated granules. 21.1 Glycogen Breakdown Requires the Interplay of Several Enzymes Most of the glycogen molecule is degraded to glucose I-phosphate by the action of glycogen phosphorylase, the key enzyme in glycogen breakdown. The glycosidic linkage between C-I of a terminal residue and C-4 of the adjacent one is split by orthophosphate to give glucose 1-phosphate, which can be reversibly converted into glucose 6-phosphate. Branch points are degraded by the concerted action of an oligosaccharide transferase and an a-I ,6 -glucosidase.
21.2 Phosphorylase Is Regulated by Allosteric Interactions and Reversible Phosphorylation Phosphorylase b, which is usually inactive, is converted into active phosphorylase a by the phosphorylation of a single serine residue in each subunit. This reaction is catalyzed by phosphorylase kinase. The b form in muscle can also be activated by the binding of AMP, an effect counteracted by ATP and glucose 6-phosphate. The a form in the liver is inhibited by glucose. The AMP-binding sites and phosphorylation sites are located at the subunit interface. In muscle, phosphorylase is activated to generate glucose for use inside the cell as a fuel for contractile activity. In contrast, liver phosphorylase is activated to liberate glucose for export to other organs, such as skeletal muscle and the brain . 2l.3 Epinephrine and Glucagon Signal the Need for Glycogen Breakdown Epinephrine and glucagon stimulate glycogen breakdown through specific 7TM receptors. Muscle is the primary target of epinephrine, whereas the liver is responsive to glucagon. Both signal mol ecul es initiate a kinase cascade that leads to the activation of glycogen phosphorylase.
21.4 Glycogen Is Synthesized and Degraded by Different Pathways Glycogen is synthesized by a different pathway from that of glycogen breakdown. UDP-glucose, the activated intermediate in glycogen syn thesis, is formed from glucose I-phosphate and UTP. Glycogen syn thase catalyzes the transfer of glucose from UDP -glucose to the C-4 hydroxyl group of a terminal residue in the growing glycogen molecule. Synthesis is primed by glycogenin, an autoglycosylating protein that contains a covalently attached oligosaccharide unit on a specific tyrosine residue. A branching enzyme converts some of the a-I ,4 linkages into a-I,6linkages to increase the number of ends so that glycogen can be made and degraded more rapidly. 21.5 Glycogen Breakdown and Synthesis Are Reciprocally Regulated Glycogen synthesis and degradation are coordinated by several amplifying reaction cascades. Epinephrine and glucagon stimulate glycogen breakdown and inhibit its synthesis by increasing the cytoplasmic level of cyclic AMP, which activates protein kinase A. Protein kinase A activates glycogen breakdown by attaching a phosphate to phosphory lase kinase and inhibits glycogen synthesis by phosphorylating glyco gen synthase. The glycogen-mobilizing actions of protein kinase A are reversed by protein phosphatase I , which is regulated by several hormones. Epinephrine inhibits this phosphatase by blocking its attachment to glycogen molecules and by turning on an inhibitor. Insulin, in contrast, triggers a cascade that phosphorylates and inactivates glycogen synthase kinase, one of the enzymes that inhibits glycogen synthase.
613 Summary
614 CHAPTER 21 Glycogen Metabolism
Hence, glycogen synthesis is decreased by epinephrine and increased by insulin. Glycogen synthase and phosphorylase are also regulated by noncovalent allosteric interactions. In fact, phosphorylase is a key part of the glucose-sensing system of liver cell s. Glycogen metabolism exemplifies the power and precision of reversible phosphorylation in regulating biological processes .
Key Terms glycogen phosphorylase (p. 594)
epinephrin e (adrenaline) (p . 601)
glycogen syn thase (p. 60S)
phosphorolysis (p. 594 )
glucagon (p . 601)
glycogenin (p. 606)
pyridoxal phosphate (PLP) (p. 596)
protein kinase A (PKA) (p. 603)
phosphorylase kinase (p. 6(0)
uridine diphosphate glucose (UDP -glucose) (p . 604)
protein phosphatase 1 (PP1 ) (p. 608)
calmoduli n (p . 601)
insulin (p . 610)
Selected Readings Where to Start Krebs, E. G. 1993. Protein phosphorylation and cell ular regulation I. Biosci. Rep. 13 :127- 142. Fischer. E. H. 1993. Protein phosphorylation and cellular regulation II . Angew. Chelll. Int. Ed. 32:11 30- 1137. Johnson , L. N. 1992. Glycogen phosphorylase: Control by phosphorylation and allosteric effectors. FASED I 6: 22 74- 2282. Browner, M . F, and Fletteri ck, R . J . 1992. Phosphorylase: A biological transducer. Trends Biochem. Sci . 17:66 71.
Martin, J . L., Johnson , L. N., and Withers, S. G . 1990. Comparison of the binding of glucose and glucose I-phosphate derivatives to 'j'. state glycogen phosphorylase b. Biochemistry 29 :1074:;- 10757.
Priming of Glycogen Synthesis Lomako, J ., Lomako, W. M., and \.Vhelan, W . ]. 2004. G lycogenin: The primer for mammalian and yeas t glycogen synthesis. Biochim. Biophys. Acta 1673:45- 55. Lin, A ., Mu, J ., Yang, j ., and Roach, P. J. 1999. Self-glucosylation of glycogenin , the initiato r of g lycogen bio::;ynthesis, involves an inter·
Books and General Reviews Shulman, R. G., and Rothman , D. L. 1996 . Enzymatic phosphorylation of musd e glycogen synthase: A mechan ism for maintenance of m etabo lic homeostasis. Proc. Natl. Acad. Sci . U. S. A. 93:7491 - 7495. Roach. P. J ., Cao, Y., Corbett, C. A. , DePaoli , R. A., Farkas, I., Fiol, C. J " Flotow. H., Graves , P. R , Hardy, T A., and Hrubey, T. W . 1991 . Glycogen metabo lism and signal transduction in mammals and yeast . Adv. Enzyme Reg"l. 31:101 - 120. Shulman , G . I., and Landau, B. R . 1992. Pathways of glycogen repleti on . Physiol. Rev. 72:10 19 !O33.
X-ray Crystallographic Studies Buschiazzo, A., U galde, ]. E .. Guerin, M . E., Shepard, W" Ugalde, R. A., and Alzari, P. M. 2004 . C rystal structure of glycogen synthase: Homolugous enzymes catalyze glcogen synthesis and degradation. EM BO}. 23:3196- 3205 . Gibbons, B. J ., Roach, P. ]., and Hurley, T D. 2002. Cyrstal structure of the au tocatalytic init iator of glycogen biosynthesis, glycogenin . f. Mol . Dial. 319 :463- 477. Lowe, E. D" Noble, M. E" Skamnaki, V. T, Oikonomakos, N . G., Owen , D. J ., and Johnson, L. N. 1997. The crystal structure of a phosphorylase kinase peptide substrate complex: Kinase substrate recognition . EMBOj. 16:6646- 6658. Barford, 0 " H u, S. H ., and Johnson , L. N . 1991. Structural mechanism fo r glycogen phosphorylase control by phosphorylation and AM P.
j. Mol. BioI.
2 1~ :233-2 60.
Sprang, S. R. , Withers, S. G " Goldsmith, E. J ., F letterick, R J ., and Madsen, N . B . 1991. Structural basis fo r the activation of glycogen phosphorylase b by adenosine mo nophosphate. Science 254:1367- 13 71. Johnson, L. N. , and Barford, D. 1990. G lycogen phosphorylase: The structural basis of the allosteric response and comparison with other allosteric protei ns. j. BioI. Chem . 263:2409- 241 2. Browner , M . F" Fauman , c. e., and Fletterick, R. ]. 1992. Track ing conformational stales in allosteric transitions o f phosphorylase. Biochemistry, 3 1: 1 1297 11304.
suhuni t reacti on. Arch. Biochem. Biophys. 363: 163- 170. Roach , P. ]., and Skurat, A . V. 1997 . Self-glucosylating initiator proteins and their role in glycogen biosynthesis. Prog. Nucleic Acid Res. Mol. Bioi. 37:289- :116. Smythe, c., and Cohen, P. 1991 . The discovery of glycogeni n and the priming mechanism for glycogen biogenesis. Eur. j. Bioch~n. 200:625-63 1.
Catalytic Mechanisms Skamnaki, V. T, Owen, D . J. , Noble, M . E. , Lowe, E. D. , Lowe, G., Oikonomakos, N. G. , and Jo hnson, L. N . 1999. Catalytic mecha· nism of phosphorylase kin ase probed by mutatio nal stu dies. Biochemistry 38:14718 14730. Buch binder, J . L., and F letterick, R . J. 1996. Role of th e acti ve site gate of glycogen phosphorylase in allosteric inhibition and substrate binding. I Bioi. Chem . 271 :22305 22309. Palm, D ., Klein , H . W ., Schinzel, R , Buehner, M ., and Hel mreich, E. ]. M. 1990. The role of pyridoxal 5' -phosphate in glycogen phosphorylase catalys is. Biochemistry 29: I 099- 1107.
Regulation of Glycogen Metabolism Jope, R. S., and Johnson, G. V. W. 2004. The glamour and gloom of glycogen synthase kinase-3. Trends Biochem. Sci. 29 :95- ]02. Doble, B. W., and Woodgett, J. R 2003. GSK-3: Tricks ofthetradefor a multi-tasking kinase. }. Cell Sci. 11 6:117S- 11R6. Pederson, B. A., C heng, C., Wilson, W . A ., and Roa ch, P. J. 2000. Regulation of glycogen synthase: Identificati on of residues in· valved in reg ulation by the allosteri c ligand glucose-6-P and by phosphorylation . I Bioi. Chern . 273:27733- 27761. Melendez, R " Melendez- Hevia, E ., and C anela, E. I. 1999. The fractal structure of glycogen: A clever solution to optimize cell metabo· li sm. Biophys. j. 77:1327- 1332 . Franch, J., Aslesen , R., and Jensen, J . 1999. R egulation of glycogen syn· thesis in rat skeletal muscle after glycogen -dep leting contractile ac· tivity: Effects of adrenaline o n glycogen synthesis and activation
of glycogen synthase and glycogen phosphorylase. Biochelll. j. 344 (pLl ):231- 235.
Problems 61 5 ,\ ggen, J. B., Nairn , A. c., and Chamberlin, R. 2000. Regu lation of protei n phosphatase-1. Chern. BioI. 7:RI 3- R23. Egloff, M. P., Johnson, D. Y, Moorhead, G ., Cohen, P. T. , Cohen, P., and Barford, D. 1997. Structural basis for the recognition of regulatory subunits by the catalytic subunit of protein phosphatase 1. EMBO ]. 16:1876- 1887. WU, J.. Liu , J., Thompson, 1.. O liver, C. J., Shenolikar, S. , and llrautigan, D . L. 1998. A conserved domain for glycogen binding in protein phosphatase-1 targeting subunits. F EBS Lett. 439: 1 ~5- 19 1.
Genetic Diseases Chen, Y -T. , and Burchell , A. 1995. Glycogen storage diseases. In The Metabolic Basis of Inherited Diseases (7th cd. , pp. 935-965 ), edited by C. R. Scriver., A, L. Beaudet, W. S. Sly, D. Valle, J. B. Stanbury, J. B. Wyngaarden, and D . S. Fredrickson. McG raw-HilI. Burchell, A., and Waddell,!. D . 199 1. The molecular basis of the hepatic microsomal glucose-6-phosphatase system. Biochim, Biophys. Acta 1092: 129- 137. Lei, K. J. , Shelley, L. L., Pan, C. J., Sid bury, J. R., and Chou, J. y. 1993. Mutations in the glucose-6- phosphatase gene that cause glycogen storage disease type Ia. Science 262: 580- 583.
Ross, B. D ., 1{add., G . K., Gadi.n, D. G .. Rocker, G., Esiri, M., and Falconer-Smith, J. 1981. Examination of a case or suspected M cArdle's syndrom e by " P N M R. N. Engl. j. Med . 304: 1338- 1342.
Evolution Holm, L., and Sander, C, 1995. Evolutionary link between glycogen phosphorylase and a DNA modifying enzyme. EM BO j. 14:1287- 1293. Hudson, J. W. , Golding, G . 13., and Crerar , M . M. 1993. Evolution of allosteric control in glycogen phosphorylase. }. Mol. Bioi. 234:700- 721. Rath, V. L. , and 1'letterick, R. J. 1YY4 . Parallel evolution in two homologues or phosphorylase. Nat. S truct. BioI. 1:681 - 690, Melendez, R., Melendez-H evia , E., and Cascante, M . 1997. How did glycogen stru ctu re evolve to sati ~fy the requ irement for rapid mobilization of glucose? A problem of physical constraints in structllre building.}. Mol. Eval. 45:446- 455. Rath , V. L., Lin , K., Hwang, P. K., and Flellerick, R. J. 1996. The eva · lution of an allosteric site in phosphorylase. Stnlcttlre 4:4b3- 4 73.
Problems I. Carbohydrate conversion. Write a balanced equation for the formation of glycogen from galactose .
2. If a little is good, a lot is better. a -Amylose is an unbranch ed glucose polymer , W hy would this polym er not be as effective a storage form of gl ucose as glycogen )
3. Tellta le products. A sample of glycogen from a pat ient with liver disease is incubated with orthophosphate, phosphorylase, the transferase, and the deb ranching en zyme (a -1,6-glucosidase). T he ratio of glucose i -phosphate to glucose formed in this mixture is 100. What is the most likely enzymatic deficiency in this patient'
4. Excessive storage. Suggest an explanatio n for the fact t hat the amo unt of glycogen in type I glycogen -storage disease (von Gierke disease) is increased .
5. A shattering experience. C rystals of phosphorylase a grown in the presence of glucose shatter when a substrate such as glucose I·phosphate is added. Why?
6. Recouping an essential phosphoryl. The phosphoryl group o n phosphoglu comutase is slowly lost by hydrol ysis. Propose a mechanism that utilizes a known catalytic intermediate for restoring this essential phosphoryl group . H ow might this phos phory l dono r be fo rmed?
i. Hydrophobia . Why is water excluded from the acti ve site of phosphorylase? Predict the effect of a mutation that allows water molecules to enter. 8. Removing all traces, In human liver extracts , the catalytic activity of glycogenin was detectable only after t reatm en t with a-amylase (p . 606 ), \Vhy was a -amylase n ecessary to reveal the glycogenin activity ? 9. Two in one. A si ngle polypeptide chain houses the transferase and debranchin g enzym e , Cite a potential advantage of t hi s arrangement.
10. H ow did they do that ? A strain of mice has been developed that lack the enzyme phosphorylase kinase, Yet, after strenuous exercise, the glycogen stores of a mouse o f this strain are de pleted , Explain how this depletion is possible ,
11 , Metabolic mutants. Predict the majo r co nsequence of each of the following mutations: (a) Loss of the AMP -binding site in muscle phosphorylase . (b ) Mutation of Ser 14 to A la 14 in liver p hosphorylase. (c) Overexpression of phosphorylase kinase in the li ver. (d ) Loss of the gene that encodes inhibitor 1 of protein phosphatase 1 . (e) Loss of the gene t hat encod es t he glycogen -targeting su bunit of protein phosphatase 1, (f) L oss of the gene that encodes glycogenin ,
12, More metabolic mutants. I3riefly, predict the major conseq u ences of each of the followin g mutations affecting glycogen utilization. (a) L oss of GTPase activity of the G - protein a subuni t. (b ) Loss of the gene t hat encodes inhibitor 1 of protein phosphatase 1. (c) Loss of ph osphodiesterase activity. 13, Multiple phosphorylations. Protein kinase A acti vates muscle phosphorylase kinase by rapidly phosphorylating its J3 subuni ts. T he a subunits of phosphorylase kinase are t hen slowly phos phorylated , which makes the a and J3 subunits susceptibl e to the action of protein phosphatase 1. What is t he fun ctional signifi cance of the slow phosphorylation of a )
14 . The wrong swi tch, What would b e the consequences for glycogen m obil ization of a mutation in phosphorylase kinase that leads to t he phosphorylation of the a subunit before that o r the J3 subunit'
616
CHAPTER 21 Glycogen Metabolism
Mechanism Problem
15. Family resemblance. Pro pose m echani sms for the two en zym es catalyzing steps in glycogen d ebran ching on the b asis of their potential m em ber, h ip in the a -am ylase famil y.
glycogen . The cell s were t hen manipulated according to the following p rotocol, and glycogen was isolated and analyzed by SD S-PAGE and W estern blotting by using an antibody to glycogen..in with and without a- amylase treatm ent. The results are presented in the adj oining illustration .
Chapter Integration and Data Interpretation Problems
212158-
16. Glycogen isolation 1. T he li ver is a m ajor storage site for glycogen . Purified from two samples of human liver, glycogen was either treated or not treated with a-amylase and subseq uen tly ana lyzed by SD S-PAGE and Western blotting with the use of an ti bod ies to glycogen in . T he results are p resen ted in th e adjoinin g illustration
V>
.U
QJ
"-
Citrate
'./
'"
~ o
.0
Figure 22.31 Dependence of the catalytiC activi t y of acetyl CoA carboxylase on the concentration of citrate. (A) Citrate can partl y activate the phospho rylated carboxylase. (B) The dephospho ry lated form of the carboxylase is highly active even when citrate is absent. Citrate partly overcomes the inhibition produced by phosphorylation. [After G. M. Mabrouk, I. M. Helm y, K. G. Thampy, and S. J. Wakil.
~
:g
Highly phosphorylated
amino group on the tar• get protem . A chain of four or more ubiquitin molecules is especially effective in signaling the n eed for degradation (F igure 23.4). The ubiquitin ation reaction is processive: a chain of ubiquitin molecules can be generated by t he linkage of the E:-amino group of lysine residue 48 of one ubiquitin molecul e to th e terminal carboxylate of another. What determin es whether a protein becomes ubiquiti nated? One signal turns out to be unexpectedly simple. The half-life of a cytoplasmic protein is determined to a To target large extent by its amino -terminal residue (Table 23.2). This "",protein , dependency is referred to as t he N -terminal rule. A yeast protein with methionine at its N terminus typically has a half-life of more than 20 hours, whereas one with arginine at this position has a half-life of about 2 minutes. A highly -terminal residue su ch as arginine or d estabilizing leucine favors rapid ubiquitination, whereas a stabilizing residue such as methionine or proline does n ot. Other sign als thought to identify proteins for degradation include cyclin destruction boxes, which are amino acid sequences that mark cell-cycle proteins for destruction , and PEST sequ ences, whi ch contain the amino acid sequence proline Iso peptide bonds (P, single-letter abbreviation ), glutamic acid (E), serine (S), and threonine (T ). ~ Figure 23.4 Structure of tetraubiquitin_ Fo ur ubiqu iti n mo lecu les are li nked by isopeptide bo nds. No t ice that each E 3 enzymes are the readers of N -terminal residues. isopept ide bond is form ed by the linkage o f the carboxylate Although most eukaryotes have only one or a small 1111m bei group at the end of the ext end ed C term inus with the e-amino of distinct El enzymes, all eukaryotes have many .. group o f a lysine residue. Dashed lines indicat e the positions of E2 and E3 enzymes. Moreover, there appears to be only a t he extended C-termini that were no t observed in th e crystal single famil y of evol utionarily related E2 proteins but three structure. Th is unit is the primary signal f o r degradatio n when linked t o a t arget protein. [Draw n from 1TBE.pdb.] distinct families of E3 proteins, altogether consisting of
hundreds of members. Indeed, the E 3 famil y is one of the largest gene fam ili~~ in human beings. T he diversity of target proteins that must be tagged for destruction requires a large number of E3 proteins as readers.
653 23.2 Regulation of Prot ei n Tu rnover
Three examples demonstrate the importance of E3 proteins to nor mal cell fun ction . Proteins that are not broken d own owing to a d efective E3 may accumul ate to create a disease of protein aggregation such as juvenile and earl y -onset Parkinson disease. A d efect in another member of the E3 fam il y causes A ngelman syndrome, a severe neurological disorder characterized by mental retardation, absence of speech , uncoordinated movement, and hyperactivity. Conversely, un controlled protein turnover also can create dangerous pa thological conditions. For example, human pa pilloma virus (HPV ) encodes a protein that activates a specific E 3 enzym e. The enzyme ubiquitinates the tum or suppressor p3 3 and other proteins that control D N A repair, wh ich are then d estroyed . T he activation of this E3 enzyme is observed in more than 90% of cervical carcinomas . Thus, the inappropriate m arking of key regulatory proteins for destruction can trigger further events, leadin g to tumor formation .
The Proteasome Digests the
a subunits
Ubiquitin-Tagged Proteins ~ subu nits
If ubiquitin is the mark of death, what is the execu tioner? A large protease complex called the proteasome or the 26S pro~ subunits teasome digests the ubiquitinated proteins. This ATP-driven a subun its multisubunit p rotease spares ubiquitin, which is then recycled. The 26S proteasom e is a complex of two compon ents: a 20S catalytic u nit and a 19S regulatory unit. The 20S unit is constructed from two copies each of 14 homologous subunits and has a mass of 700 kd (Figure 23.:;). The subunits are arranged in four rings of 7 subunits that stack to fo rm a structure resem bling a barrel. The outer two rings of the barrel are made up of a subunits and the inner two rings of 13 subunits. The 20S catalytic core is a sealed barrel. Access to its in terior is controlled by a 19S regulatory unit, itself a 700- kd compl ex mad e up of 20 subunits. Two such 19S complexes bind to the 20S proteasome core, one at each end , to form the complete 26S proteasom e (Figure 23.6). T he 19S unit binds specif ically to polyubiquitin chains, thereby ensuring that only ubiq uitinated proteins are d egraded . Key components of the 19S com plex are six ATPases of a type called the AAA class (ATPase associated with various cellular activities). ATP hydrolysis likely assists the 19S complex to un fold the substrate and induce conform ati onal changes in the 20S catalytic core so that the substrate can be passed into the center of the complex . The proteolytic active sites are sequestered in the interior of the barrel to protect potential substrates un til they are directed into the barrel. There are three types of active sites in the 13 subunits, each with a different specif icity, but all employ an N -terminal threonine. The hyd roxyl group of the threo nine residue is converted into a nucleophile that attacks the carbonyl groups of peptide bonds to form acyl-enzym e intermediates (p . 244). Substrates are degraded in a p rocessive m anner without the release of d egradation intermediates, until the substrate is red uced to pep tides ranging in length from seven to nine residues. Finall y, an isopeptidase in the 19S unit cleaves off intact ubiquitin m olecules from th ese peptides. T he ubiquitin is recycled and the peptide products are further degraded by other cellular proteases to yield individual amino acids. T hus, the ubiquitination path way and the proteasome cooperate to d egrad e unwanted proteins. Figure 23.7 p resents an overview of the fa tes of amino acids following p roteasomal d igestion .
N-terminal threonine nucleophile ~ Figure 23.5 205 proteasome. The
205 proteasome comp rises 28 homologous subun its (u, red; 13. blue). arranged in four rings o f 7 subun it s each. Some o f the 13 subunits incl ude protease act ive sites at their am ino t ermin i. [Subun it d raw n from 1RYP.pdb.]
195 cap
205 catalytiC core
195 cap
Figure 23.6 265 proteasome. A 195 cap is attached t o each end o f the 20 5 cat alyt iC unit. [Fro m W. Baumeister, J. Walz. F. Zuh l. and E. Seemuller. Cell 92(1998):367- 380; courtesy o f Dr. Wo lfgang Ba umeister.]
654 CHAPTER 23 Protein Turnover and Amino Acid Catabolism
Figure 23.7 The proteasome and other proteases generate free amino acids. Ubiquitinated proteins are processed to peptide fragments from which the ubiquitin is subsequently removed and recycled. The peptide fragments are further d igested t o yield free amino acids. which can be used for biosynthetic reactions. most notably pro t ein synthesi s. Alternatively. t he amino group can be removed and processed t o urea (p. 661) and the carbon skeleton can be used to synthesize carbohydrat e or fat s or used directly as a f uel fo r cellular respiration.
Ubiquitinated protein
Proteasome
•
ilJ
•
Peptide fragments
Released ubiquitin
Proteolysis
I
I
I
I
I
I I
I
""
Amino acids Left intact for biosynthesis
Amino groups
Nitrogen disposal by the urea cycle
Carbon skeletons Glucose or glycogen synthesis
Fatty acid synthesis
Celiular respiration TABLE 23.3 Processes regulated by protein degradation Gene transc ription
Protein Degradation Can Be Used to Regulate Biological Function
Cell-cycle progression O rgan formation
Circad ian rhythms Inflammato ry response
Tumor suppression Cholesterol metabolism Antigen processing
o N ~
N
H
#
o
N
Bortelomib (a dipeptidyl boronic acid)
Table 23.3 lists a number of physiological processes that are controlled at least in part by protein degradation through the ubiquitin- proteaso me pathway_ In each case, the proteins being degraded are regulatory proteins_ Consider, for example, control of t he inflammatory response. A transcription factor called NF -KB (NF for nuclear facto r) initiates the expression of a num ber of the genes that take part in this response. This factor is itself activated by the degradation of an attached inhibitory protein, J-KB (I for inhibitor)_ In response to inflammatory signals that bind to membrane-bound receptors, [-KB is phosphorylated at two serine residues, creating an E3 binding site. The binding ofE3leads to the ubiquitination and degradation of I-KB, unleashing NF-KB. The liberated transcription factor migrates to the nucleus to stimulate the transcription of the target genes_The NF- KB- I-KB system~ lustrates the interplay of several key regulatory motifs: receptor-mediated signal transduction, phosphorylation , compartmentalization, controlled and specific degradation, and selective gene expression . The importance of _b ubiquitin- proteasome system for the regulation of gene expression is highlighted by the recent approval of bortezomib (Velcade), a potent inhibitor
of the proteasome, as a therapy for multiple myeloma. Bortezomib is a dipeptidyl boronic acid inhibitor of the proteasome.
The Ubiquitin Pathway and the Proteasome Have Prokaryotic Counterparts ->{Jy Both the ubiquitin pathway and the proteasome appear to be pres-
T ent in all eukaryotes. Homologs of the proteasom e are found in prokaryotes, although the physiological roles of these homologs have not been well established. The proteasomes of some archaea are quite similar in overall structure to their eukaryotic counterparts and similarly have 28 sub units (Figure 23.8). In the archaeal proteasome, however, all ex outer-ring subunits and all 13 inner-ring subunits are identical; in eukaryotes, each ex or 13 subunit is one of seven different isoforms . This specialization provides distinct substrate specificity. Although ubiquitin has not been found in prokaryotes, ubiquitin's molecular ancestors were recently identified in prokaryotes. Remarkably, these proteins take part not in protein modification but in biosynthesis of the coenzyme thiamine (p. 423) . A key enzym e in thiamine biosynthesis is ThiF, which activates the protein ThiS as an acyl adenylate and then adds a sulfide ion d erived from cysteine (Figure 23 .9) . ThiF is homologous to human El, which includes two tandem regions of 160 amino acids that are 28% identical in amino acid seq uence with a region of ThiF from E. coli.
Archaeal proteasome
Figure 23.8 Proteasome evolution. The archaeal proteasome cons ists of 14 identical 0: subunits and 14 identical f3 subunits. In the eukaryotic protea some. gene duplicati on and specia lization has led to 7 distinct subunits of each type. The overall archit ecture of the proteasome is conserved.
H3C pp.,
o/ c." _ "0
+
ATP
./
"
Thi F
"
ThiS
ThiS "SH "
C
O~ ' AMP
"
N
.y
AMP
\. -?\. ThiF
»
I C
O~ '
SH
Eukaryotic proteasome
N~
NH,
CH,OH
IN+
)
CH 3 Thiamine
Figure 23.9 Biosynthesis of thiam ine. The biosynthesis of thi amine begins with the addition of sulfide to the carboxyl terminus of the protein ThiS. This protein is activated by adenylation and conjugated in a manner analogous t o the first steps in the ubiquitin pathway.
The evolutionary relationships between th ese two pathways were cemented by the determination of the three-dimensional structure of ThiS, which re vealed a structure very similar to that of ubiquitin, despite being only 14% identical in amino acid sequen ce (Figure 23 .10). Thus, a eukaryotic system for protein m odification evolved from a preexisting prokaryotic pathway for coenzyme biosynthesis.
~ Figure 23.10 Structures of ThiS and
Ubiquitin ThiS C terminus
C terminus
ubiquitin compared. Notice that ThiS is structurally similar t o ubiquitin despite only 14% sequence identity. This observation suggests that a prokaryo tic prot ein such as ThiS evolved into ubiquitin. [Drawn from 1UBI.pdb and 1FOZ.pdb.]
655
•
656 CHAPTER 23 Protein Turnover and Amino Acid Catabolism
23.3
The First Step in Amino Acid Degradation Is the Removal of Nitrogen
What is the fate of amino acids released on protein digestion or turnover; The first call is for use as building blocks for biosynthetic reactions. However, any not needed as building blocks are degraded to compound~ able to enter the metabolic mainstream. The amino group is first removed, and then the remaining carbon skeleton is metabolized to glucose, one 01 several citric acid cycle intermediates, or to acetyl CoA. The major site 01 am ino acid degradation in m amm als is the li ver, although muscles readily degrade the branched-chain am ino acids (Leu, lIe, and Val ). The fate of the a -amino group will be considered first, followed by that of the carbon skeleton (Section 23.5).
Alpha-Amino Groups Are Converted into Ammonium Ions by the Oxidative Deamination of Glutamate The a-amino group of many amino acids is transferred to a-ketoglutaratl to form glutamate, which is then oxidatively deaminated to yield ammo nium ion (NH4 +). - OOC
R
)-1
+H3
H
•
COO-
+H3N
COO-
Glutamate
Amin o acid
Aminotransferases catalyze the transfer of an a-amino group from an a-amino acid to an a-ketoacid. These enzymes, also called transaminases, generally funne l a-amino groups from a variety of amino acids to a-ketoglutarate for conversion into NH4 +. j
. :-. H - OOC
0
0
H3
+
Rl
Am inotransferase
-ooe
R,
•
+H3N
•
- OOC
R,
+
-ooe
H
Rl
Aspartate aminotransferase, one of the most important of these enzymes, catalyzes the transfer of the amino group of aspartate to a-ketoglutarate. Aspartate + a -ketoglutarate ,
Carboxyphosphate
Bicarbonate
Carbamic acid
The active site for this reaction lies in a domain formed by the amino- terminal third of CPS. T his domain form s a structure, caIled an A TP -grasp f old, that surrounds AT P and hold s it in an orientation suitable for nucleophilic attack at the 'Y phosphoryl group. Proteins containing ATP-grasp folds catalyze the formation of carbon- nitrogen bon ds through acyl-phosphate intermediates. Such AT P-grasp folds are wi dely used in nucleotide biosynthesis. In the second step catalyzed by carbamoyl p hosphate synt hetase, car bamic acid is phosphorylated by another m olecule of ATP to form carbamoyl phosphate. ATP
\ / Carbamic acid
2- 0
AD P )
~
!I
O' j 'P"",- ......... C"-
o
site
p.
NH,
!
Glutamin e hydrolysis site
0
NH2
Carbamoyl phosphate
This reaction takes place in a second AT P -grasp domain within the en zyme. T he active sites leading to carbamic acid fo rmation and carbamoyl phosphate formation are very sim ilar , revealing that t his enzyme evolved by a gene du plication even t . Indeed, du plication of a gene encoding an ATP grasp domain fo llowed by specialization was cen tral to the evolu tion of nucleotide biosyn thetic processes (p . 715). The Side Chain of Gl utam ine Can Be Hydroly zed to Generate Ammon ia
Glutamine is the primary source of ammonia for carbam oyl phosphate syn thetase. In this case, a second polypeptide component of the en zym e hydrolyzes glu tamine to form amm onia and glu tamate . The active site of the glutamine- hydrolyzing componen t contains a catalytic dyad compri sing a cysteine and a histidine residue. Such a catalyti c d yad , remini scent of the acti ve site of cysteine proteases (p . 251 ), is conserved in a family of amidotransferases, incl ud ing CT P synthetase and GMP synthetase. Intermediates Can Move Between Active Sites by Channel ing
Carbamoyl phosphate sy nthetase contains three different active sites (see Figure 25.3), separated fro m one another by a total of 80 A (F igure 25 .4 ).
Carbamic acid phosphorylation site
-l:l
Figure 25.3 Structure of carbamoyl phosphate synthetase. Not ice that the enzyme contains sites for t hree react ions. Th is enzyme consist s o f t wo chai ns. The smaller chain (yellow) contains a site f o r glutamin e hyd rolysis t o generate ammonia. The larger chain incl udes two ATP-grasp do mai ns (blue and red). In o ne ATP-grasp doma in (blue), bicarbo nate is phospho ry lated t o carboxyphosphat e, w hich then reacts wi th ammonia t o generate carbami c acid. In the other ATPgra sp domai n. th e carbam ic acid is phospho ry lat ed to produce carbamoyl phosphat e. [Drawn fro m 1JDB.pdb.)
712 CHAPTER 25 Nucleotid e Bi osynthesis Glutamine
~
Figure 25.4 Substrate channel ing. The three acti ve sites of carbamoyl phosphate synthetase are linked by a channel (yel low) through whic h intermediates pass. Gl utam ine enters one active site. and carbamoyl phosphate. which incl udes the nitrogen ato m from the gl utamine side chain. leaves • another 80 A away. [Drawn from lJDB.pdb.]
Carbam ic acid
Carba moyl ph osphate
~---:
Intermediates generated at one site move to the next without leaving the enzyme. These intermediates move within the enzy me by means of substrate channeling, similar to the process described for tryptophan synthetase (p . 696). The ammonia generated in the glutamine-hydrolysis active site travels 4S A throu gh a channel within the enzyme to reach the site at which . The carbamic acid generated at this carboxyphosphate has been generated o site d iffuses an additional 3S A through an extension of the channel to reach the site at which carbamoyl phosphate is generated. This channeling serves two roles: (1) intermediates generated at one active site are captured with no loss caused by d iffusion and (2) lab ile intermediates, such as carboxyphosphate and carbamic acid (w hich decompose in less than 1 s at pH 7), are protected from hydrolysis. We will see additional examples of substrate channeling later in this chapter. Orotate Acquires a Ribose Ring from PRPP to Form a Pyrimidine Nucleotide and Is Converted into Uridylate
Carbamoyl phosphate reacts with aspartate to form carbamoylaspartate in a reaction catalyzed by aspartate transcarbamoylase (Section 10.1). C arbamoylaspartate then cyclizes to form di hydroorotate, which is then oxidized by N AD + to form orotate .
•
o
o
C
C
II
p.,
HN/
"'--NH 2
NADH
+
II
HN/
"'--NH
J
ooc-1 H Ca rbamoyl phosphale
A
H H
Carbamoylaspart.le
H
NAD+
" " '\
'~o
H H Dihydroorolale
,
W
\/
•
~o
OOC I
H Orotate
At this stage, orotate couples to ribose, in the form of 5-phosphoribosyl-lpyrophosphate ( P R PP), a form of ribose activated to accept nucleotide bases. PRPP is synthesized fro m ribose-S-phosphate, formed by the pentose phosphate pathway, by t he addition of pyrophosphate from ATP. Oro tate reacts with PRPP to form orotidylate, a pyrimidine nucleotide. T his reaction is driven by the hydrolysis of pyrophosphate. The enzyme
that catalyzes this addition, pyrimidine phosphoribosyltransferase, is homologous to a number of other phosphoribosyltransferases that add different groups to PRPP to form the other nucleotides. Orotidylate is then decarboxylated to form uridylate (UMP ), a major pyrimidine nucleo tide that is a precursor to RNA. This reaction is catalyzed by orotidylate decarboxylase.
o
C/o. 0
~
I o
H Orotate
+
HNI-
w
0=
co,
\
0= • 2-0 3POH 2C
/'
N'- -:
o
H
HO OH HO Orotidylate
OH
5-Phosphoribosyl-l-pyrophosphate (PRPP)
HO OH Uridylate
Orotidylate decarboxylase is one of the most proficient enzymes known. In its absence, decarboxylation is extremely slow and is estimated to take place once every 78 million years; with the enzyme present, it takes place approximately once per second, a rate enhancement of 10 17 -fold.
PP,
o 0=
Nucleotide Mono-, Di-, and Triphosphates Are Interconvertible
How is the other major pyrimidine ribonucleotide, cytidine, formed? It is synthesized from the uracil base of UMP, but the synthesis can take place only after UMP has been converted into UTP. Recall that the diphosphates and triphosphates are the active forms of nucleotides in biosynthesis and energy conversions. Nucleoside mono phosphates are converted into nucleoside triphosphates in stages . First, nucleoside mono phosphates are con verted into diphosphates by specific nucleoside monophosphate kinases that utilize ATP as the phosphoryl-group donor. For example, UMP is phosphorylated to UDP by UMP kinase. UMP + ATP
~,~'>
O~
HO
N--,{
OH
Orotidylate
UDP + ADP
Nucleoside diphosphates and triphosphates are interconverted by nucleoside diphosphate kinase, an enzyme that has broad specificity, in contrast with the monophosphate kinases. X and Y represent any of several ribonuc1eosides or even deoxyribonucleosides: XDP + YTP
~,~>
XTP + YDP
CTP Is Formed by Amination of UTP
After uridine triphosphate has been formed, it can be transformed into cytidine triphosphate by the replacement of a carbonyl group by an amino group. Gin + H2 0
t
GIU
NH,
0=
0,=
o
O~ ATP
N---'J
ADP
+
,
p.
HO
UTP
OH
HO
OH
CTP
713
Like the synthesis of carbamoyl phosphate, this reaction requires ATP and uses glutamine as the source of the amino group. The reaction proceeds through an analogous mechanism in which the 0 -4 atom is phosphorylated to form a reactive intermediate, and then the phosphate is displaced byammonia, freed from glutamine by hydrolysis. CTP can then be used in many biochemical processes, including RNA synthesis.
714 CHAPTER 25 Nucleotide Biosynthesis
C~' Aspartate
Glycine
{N
C N'O-Formyl'--> N(6 "';C- 7'- tetrahydrofolate 12 4 1 9 8 ( "'----C, 3 ,......C_ ( -Glutamine N NlO-Formyl- / N \ tetrahydrofolate ribose-P Purine
Glutamine
ring structure
IMP
ATP
25.2
Purine Bases Can Be Synthesized de Novo or Recycled by Salvage Pathways
Purine nucleotides can be synthesized in two distinct pathways. First, purines are synthesized de novo, beginning with simple starting materials such as amino acids and bicarbonate (Figure 25 .5)_ Unlike the bases of pyrimidines, the purine bases are assembled already attached to the ribose ring. Alternatively, purine bases, released by the hydrolytic degradation of nucleic acids and nucleotides, can be salvaged and recycled. Purine salvage pathways are especially noted for the energy that th ey save and the remarkable effects of their absence (p. 725).
GTP to RNA
Salvage Pathways Economize Intracellular Energy Expenditure dATP
dGTP to DNA
Figure 25.5 De novo pathway for purine nucleotide synthesis _ The origins o f t he atoms in the purine ring are indicated.
Free purine bases, derived from the turnover of nucleotides or from the diet, can be attached to PRPP to form purine nucleoside monophosphates, ill a reaction analogous to the formation of orotidylate. Two salvage enzymes with different specificities recover purine bases. Adenine phosphoribosyltransferase catalyzes the formation of adenylate (AMP ): Adenine + PRPP --+) adenylate + PP j whereas hypoxanthine-guanine phosphoribosyltransferase (HGPRT) catalyzes the formation of guanylate (GMP ) as well as inosinate (inosine monophosphate, IMP), a precursor of guanylate and adenylate _
o N
,;?'
"'---J N-
f '
N~
Hypoxanthine
HO Inosinate
OH
NH
Guanine + PRPP
) guanylate + PP j
Hypoxanthine + PRPP --+) inosinate + PP j Similar salvage pathways exist for pyrimidines . Pyrimidine phosphoribosyltransferase will reconnect uracil, but not cytosine, to PRPP. The Purine Ring System Is Assembled on Ribose Phosphate
De novo purine biosynthesis, like pyrimidine biosynthesis, requires PRPP but, for purines, PRPP provides the foundation on which the bases are constructed step by step. The initial committed step is th e displacement of pyrophosphate by ammonia, rather than by a preassembled base, to produce 5-phosphoribosyl-.l-amine, with the amine in the 13 configuration . Glutamine phosphoribosyl amidotransferase catalyzes this reaction. This enzyme comprises two domains: the first is homologous to the phosphori bosy Itransferases in salvage pathways, whereas the second produces ammonia from glutamine by hydrolysi s. However, this glutamine-hydrolysis domain is distinct from the domain that performs the same function in carbamoyl phosphate synthetase. In glutamine phosphoribosyl amidotransferase, a cysteine residue located at the amino terminus facilitates glutamine hydrolysis. To prevent wasteful hydrolysis of either substrate, the amidotransferase assumes the active configuration only on binding of both PRPP
and glutamine. As is the case with carbamoyl phosphate synthetase, the ammonia generated at the glu tamine-hydrolysis active site passes through a channel to reach PRPP without being released into solution .
0-........
HO
The Purine Ring Is Assembled by Successive Steps of Activation by Phosphorylation Followed by Displacement
OH PRPP
+ NH, --...
Glu
-> pp.o
+ H2 0
Gin
NH,
HO
OH
5-Phosphoribosyl -l -amine ATP
ADP
Nu
\/
Pi
\ /
,
Disp laceme nt
\ / Nu
De novo purine biosynthesis proceed s as follows (Figure 25 .6).
(3)
CD ATP
+ Gly
P·ribose-NH,
"'-
0) 0
ADP
II
NH3+
+
p.0
./
II
0
0
THF..... C
H ...........-N"-. .......... CH, P-rib ose C
H·,C." 'N· H H THF
"'-
II 0
./
+
p.0
ATP
,
H ...........-N"-. .......... CH, P-ribose C
II 0
Glydnamide
Formylglydnamide
•
ribonucleotide
ribonucleotide
H ...........-N"-. .......... CH,
~
P-ribose H,N
Phosphoribosylamin e
ADP
'H
H2O
+ ,
+ Gin
Glu
Formylglycinamidine ribonucleotide /
ATP ADP
....... + ATP
PI
+
o H,C
!N
H,C
N
\" C-
...........- "-. .{/ P-ribose C
0 C/· , -
b
--"'---- P-ribose C
®
NH, 5 ~ Amino i m i d az ol e
ribonucleotide
ATP
+
@
Asp ADP
+
p. 0
5-Aminoimidazole-
4-(N-succinylcarboxamide) ribonucleotide
Figure 25.6 De novo purine biosynthesis. P) Glycine is 1o coupled to t he amino gro up of phosphoribosylamine. (2) N _ Formyltetrahydrofolate (THF) transfers a formyl group to the amino group o f the glycine residue. (3) The inner amide group is phosphorylated and converted into an amidine by the addition of ammonia derived from glutamine. (4) An intramo lecular coupling reaction forms the five-membered imidazole ring. (5) Bicarbonate adds first to the exocyclic amino group and then to a carbon atom of the imidazole ring. (6) The imidazole carboxylate is phosphory lated, and the p hosphate is disp laced by the amino group of aspartate.
715
716 CHAPTER 25
1. The carboxylate group of a glycine residue is activated by phosphory. lation and then coupled to t he amino group of phosphoribosylamine. A new amide bond is formed , and the amino group of glycine is free to act as a nu· cleophile in the next step.
Nucleotide Bi osyn th esis
2. Formate is activated and then add ed to this amino group to form formylglycinamide ribonucleotide. In som e organism s, two distinct en· zym es can catal yze this step. O ne enzyme transfers the formyl group from 10 N -formy ltetrahydrofolate (p. 690). The other enzyme activates formate as formyl phosphate, which is added directly to the glycine amino group. The inner amide group is act ivated b y phosphorylation and then can· verted into an amidine by the add ition of ammonia d erived from glutamine.
3.
4. The prod uct of this reaction, formylglycinamidine ribonucleotide, cy· clizes to form the five -m embered imidazole ring found in purines. Although this cyclization is likely to be favorable thermodynamically, a molecul e of ATP is consumed to ensure irreversibility. The familiar pattern is repeated : a phosphoryl group from the ATP molecule activates the car· bonyl gro up and is displaced by the nitrogen atom attached to the ribose m olecul e. Cyclization is thus an intramolecular reaction in which the nucleophile and phosphate-activated carbon atom are present with in the same molecule.
5. Bi carbonate is activated by phosphorylation and t hen attacked by the exocyclic am ino group. The product of the reaction in step 5 rearranges to transfer the carboxylate group to the imidazole ring. Interestingly, mammals do not require ATP for this step; bicarbonate apparently attaches directly to the exocyclic amino group and is then transferred to the imidazole ring. 6. The imidazole carboxylate group is phosphorylated again and the phosphate group is d isplaced by the amino group of aspartate. Thus, a six· step process li nks glycine, formate, ammonia, bicarbonate, and aspartate to form an intermediate t hat contains all but two of the atoms necessa ry for the form ation of the purine ring. Three more steps complete ring construction (Figu re 25 .7). Fumarate, an intermediate in the citric acid cycle, is eli minated, leaving the nitrogen atom from aspartate joined to the imidazole ring . T he use of aspartate as an ooc. H
-
C.
!
N" P-ribose/
N
0
':>< ::'::'
0, 3' growth
Elongation Takes Place at Transcription Bubbles That Move Along t he DNA Template The elongation phase of RNA synthesis begins after the formation of the first phosphodiester bond . An important change is the loss of u ; without u, the core enzyme binds more strongly to the DNA template . Indeed, RNA polymerase stays bound to its template until a termination signal is reached. The region containing RNA polymerase, DNA, and nascent RNA is called a transcription bubble because it contains a locally melted "bubble" of DNA (Figure 29 .8) . The newly synthesized RNA forms a hybrid helix with the template DNA strand. This RNA- DNA helix is about R bp long, which corresponds to nearly one turn of a double helix (p. 112). The 3' -hydroxyl group of the RNA in this hybrid helix is positioned so that it can attack the a-phosphorus atom of an incoming ribonucleoside triphosphate. The core enzyme also contains a binding site for the other DNA strand. About 17 bp of DNA are unwound throughout the elongation phase, as in the initiation phase. The transcription bubble moves a distance of 170 A (17 nm) in a second, which corresponds to a rate of elongation of about 50 nucleotides per second. Although rapid, it is much slower than the rate of DNA synthesis, which is ROO nucleotides per second . /
RNA polymerase
Coding strand
Template strand
Rewin ding
Unwinding
5'
3' ......
3':"LL..J.J."
5'.J.Nascent
RNA
5' ppp . . /
(A)
Figure 29.8 Transcription bubble. (A) A schemati c representat io n of a transcri ption bubble in the elongation of an RNA transcript. Duplex DNA is unwound at the forward end of RNA polymerase and rewound at its rea r end. The RNA - DNA hybrid rotates during elongation. (B) A surface model based on the crystal stru cture o f t he RNA po lymerase holoenzyme shows the unwound DNA (yellow and green) fo rming the transcription bubble. Notice that the template strand (green) is in contact w ith the catalytic Mg2+ (pink). [(B) From K. S. Murakami, S. Masuda, E. A. Campbell, O. Muzzin, and S. A. Darst.
Science 296(2002):1285-1290.]
RNA-DNA h-YbLr.J.. idY helix
Movement of polymerase
" " Elongation site
)
Nontem plate ;...--- stra nd
(B)
l'
The lengths of the RNA- DNA hybrid and of the unwound region of DNA stay rather constant as RNA polymerase moves along the D NA template. This finding indicates that DNA is rewound at about the same rate at the rear of RNA polymerase as it is unwound at the front of the enzyme. The RNA- DNA hybrid must also rotate each time a nucleotide is added so that the 3' -OH end of the RNA stays at the catalytic site. The length of the RNA- DNA hybrid is determined by a structure within the enzyme that forces the RNA- DNA hybrid to separate, allowing the RNA chain to exit from the enzyme and the DNA chain to rejoin its DNA partner (Figure 29.9). For many years, RNA pol ymerase was thought not to proofread the RNA transcript . However, recent studies have indicated that RNA polymerases do show proofreading nuclease acti vity, particular! y in the presence of accessory proteins. Studies of single molecules of RNA polymerase reveal that the enzymes hesitate and backtrack to correct errors. The error rate of 4 the ord er of one mistake per 10 or lOS nucleotides is higher than that for DNA replication , including all error-correcting mechanisms. The lower fi de ity of R NA synth esis can be tolerated because mistakes are not transmit ted to progeny. For most genes, many RNA transcripts are synthesized; a few defective transcripts are unlikely to be harmful. Sequences Within the Newly Transcribed RNA Signal Term ination
The termination of transcription is as precisely controlled as its initiation . In the termination phase of transcription, the formation of phosphodiester bonds ceases, the RNA- DNA hybrid dissociates, the melted region of DNA rewinds, and RNA polymerase releases the DNA. What determines where transcription is terminated ? The transcribed regions of DNA templates contain stop signals. The simplest one is a palindromic GC-rich region fol lowed by an AT-rich region . The RNA transcript of this DNA palindrome is self-complementary (Fi gure 29 .10). H ence, its bases can pair to form a hairpin structure with a stem and loop, a structure favored by its high content of G and C residues. Guanine cytosine base pairs are more stable than adenine- thymine pairs because of the extra hydrogen bond in the base pair. This stable hairpin is followed by a sequence of four or more uracil residu es, which also are crucial for termination. The RN A transcript ends within or just after them. How does this combination hairpin-oligo(U) structure terminate transcription? First, it seem s likely that RNA polymerase pauses immediately after it has synthesized a stretch of RNA that folds into a hairpin . Furthermore, the RNA- DNA hybrid helix produced after the hairpin is unstable because its r U- dA base pairs are th e weakest of the four kinds. Figure 29.10 Termination signal. A termination signal found at the 3' end of an mRNA transcri pt consists of a series of bases that form a stable stem-loop structure and a series of U residues.
• DNA
RNA
~ Figure 29.9 RNA- DNA hybrid
separation. A structure w ithin RNA polymerase forces the separation of the RNA- DNA hybrid. Notice that the DNA st rand exits in one direct ion and the RNA product exits in another. [Drawn from 116H.pdb.]
U ~ C ""G I
I
U
/G
'G . C I I
A· U
I I e·G I I e·G I I G· C I I e·G I I e·G I I G· C
- U- A-A - U- C- C- C- A- C- A/ 5'
\.A-1luE3!u~-:Ju[3u~OH 3'
829
830
Initiation
CHAPTER 29 RNA Synthesis and Processing
Termination in absence
or p
DNA template - - ' --,...,...,...,... - - - - - ' ' - - - - p
sites
5'
RNA transcripts Figure 29.11 Effect of p protein on the size of RNA transcripts.
s· s· 5'
3'
r
3'
No p
> 235 species
present at start of synthesis ~ added 30 seconds later
3'
3'
padded 2 minutes later
> 105 species > 135 species > 175 species
Hence, the pau se in transcription caused by the hairpin permits the weakly bound nascent RNA to dissociate from the DNA template and then from the enzyme. The sol itary DNA template strand rejoins its partner to re-form the DNA duplex, and the tran scription bubble closes. The rho Protein Helps to Terminate the Transcription of Some Genes
RNA polym erase needs no help to terminate transcription at a hairpin followed by several U residues . At other sites, however, termination requires the participation of an additional factor . This disco very was prompted by the observation that some RNA molecules synthesized in vitro by RNA polymerase acting alone are longer than those made in vivo. The missing factor, a protein that caused the correct termination, was isolated and named rho (p). Additional information about th e action of p was obtained by adding this termination factor to an incubation mixture at various times after the initiation of RNA synthesis (Figure 29. 11 ). RNAs with sedimentation coefficients of lOS, 13S, and 1 7S were obtained when p was added at initiation, a few seconds after initiation, and 2 minutes after initiation, respectively_ If no p was added, transcription yielded a 23S RNA product. It is evident that the template co ntains at least three termination sites that respond to p (yielding 10S, 13S, and 17S RNA) and one termination site that does not (yielding 23S RNA ). Thus, specific termination at a site producing 23S RNA can occur in the absen ce of p. However, p detects additlOnal termination signals that are not recognized by RNA polymerase alone. How does p provoke the termination of RNA synthesis? A key clue is the finding that p hydrolyzes ATP in the
presence of single-stranded RNA but not in the presence of DNA or duplex RNA. Hexameric p, which is structurally similar and homologous to ATP synthase (p . 522) , specificall y binds single-stranded RNA; a stretch of 72 nuc1eotides is bound in such a way that the RNA passes through the center of the structure (Figure 29. 12). The p
I
I "'" RNA polymerase
protein is brought into action by sequences located in the nascent RNA that are rich in cytosine and poor in guanine. The
Figure 29.12 Mechanism for the termination of transcription by p protein. This protein is an ATP-dependent helicase that binds the nascent RNA chain and pulls it away fro m RNA po lymerase and the DNA template.
ATPase activity of p enables the protein to pull the nascent RNA while pursuing I +H,
C " tRNA "
o Cy.-IHNAc"
o Ala-IRNA c"
Does this m ischarged tR NA recogni ze t he codon for cysteine or for alanin e? The answer came when the tR A was added to a cell -free proteinsy nthesizing system . T he template was a random copolym er of U and G in the ratio of 5:1, which normally incorporates cysteine (encoded by UG U) but not alanine (encoded by GCN ). However, alanine was incorporated into a polypeptide when Ala-tRNA C y. was added to the incu bation mixture. T he same result was obtained when mRNA fo r hemoglobin served as the templ ate and C4C]alanyl-tH. N A Cys was used as the mischarged aminoacyltR JA. When the hemoglobin was di gested wi th try psin, the only radioactive peptide prod uced was one that norm ally contain ed cysteine but not alanine. Thus, the amino acid in aminoacy l - t~ NA does not playa role in selecting a codon. In recent years, the ability of mischarged tRNAs to transfer their amino acid cargo to a growing polypeptide chain has been used to synthesize peptides with amino acids not found in proteins incorporated into specific sites in a p rotein . Aminoacyl- tRNAs are first linked to these unnatural amino acids by chemical methods. T hese mischarged aminoacyl- tRNAs are added to a cell -free protein-synthesizin g system along with speciall y engineered mRNA that contains codons correspond in g to the an ticodons of the mischarged aminoacyl-tRN As in the d esired positions. The proteins produced have unnatural amino acids in the expected positions. M ore than 100 differen t unnatural amino acids have been incorporated in this way. However, only L-am ino acids can be used; apparentl y this stereochem istry is requi red fo r peptide -bond formation to take place. Some Transfer RNA Molecules Recognize More Than One Codon . Because of Wobble in Base-Pairing
Anticodon
3'
5'
- X'- Y'- Z/• • •
X
5'
• • •
• • •
Y- Z3'
Codon
W hat are the rules that govern the recogni tion of a codon by the anticodon of at RNA ? A simple hypothesis is that each of the bases of the codon forms a W atson-Crick type of base pair with a complementary base on the anti· codon. The cod on and anticodon would then be lined up in an antiparallel fas hi on . tn the diagram in the m argin, the prime denotes the complemen· tary base. Thus X and X' wo uld be either A and U (or U and A ) or G and C (or C and G). According to thi s model, a particular anticodon can recognize only one cod on . T he facts are otherwise. As found experimen tally, some pure tR NA mol· ecules can recognize more than one codon. For example, the yeast alanyl tR A binds to three codons: G CU, G CC, and GCA . The first two bases of these codons are the same, whereas the third is diffe rent . C oul d it be that recogniti on of the third base of a codon is sometimes less di scriminating than recogni t ion of the other two ? T he pattern of degeneracy of the genetic code indicates that this might be so. XYU and XYC always encode the same amino acid ; X YA and XYG usuall y do. F rancis C rick surmised from these
data that the steric criteria might be less stringent for pairing of the third base than for the other two. Models of various base pairs were built to determine which ones are similar to the standard A . U and G . C base pairs with regard to the distance and angle between the glycosidic bonds. Inosine was included in this study because it appeared in several anticodons. With the assumption of some steric freedom (" wobble" ) in the pairing of the third base of the codon , the combination~ shown in Table 30.3 seemed plausible. The wobble hypothesis is now firmly established. The anticodons of tRNAs of known sequence bind to the cod ons predi cted by this hypothesis. For example, the anticodon of yeast alanyl-tRNA is JGC. This tRN A recognizes the cod ons GCU, GCC, and GCA. Recall that, by convention, nucleotide sequences are written in the 5' --+ 3' direction unless otherwise noted. Hence, I (the 5' base of this anticodon) pairs with U, C, or A (the 3' base of the cod on ), as predicted .
o HN ~
/ -----N
N
\.
ribose Inosine
TABLE 30.3 Allowed pairings at the third base of the codon according to the wobble hypothesis First base of anticodon
Third base of codon G U A orG Uor C U, C. or A
C A
•
U G ribose "
ribose~
,_'" N
N
0 -"'"
o,
,, , ,
,,
•
• • ,
,
NJ
1
, ,
~
/ N~
~
H, , , ,
,
,, , ,
,, ,•
o
N
ribose/ ' Inosine-cytidine base pair
Inosine-adenosine base pair
Two generalizations concerning the codon anticodon interaction can be made:
1. The first two bases of a cod on pair in the standard way. Recognition is precise. Hence, codons that differ in either uf their first two bases must be recognized by different tR NAs. For example, both UUA and CUA encode leucine but are read by different tR As. 2. The first base of an anticodon determines whether a particular tRNA molecule reads one, two, or three kind s of codons: C or A (one codon), U or G (two cod ons), or I (three codons). Thus, part of the degeneracy of the genetic code arises from imprecision (wobble) in the pairing of the third base uf the codon with the first base of the anticodon. We see here a strong reason for the frequent appearance of inosine, one of the unusual nucleosides, in anticodons. Inosine maximizes the number of coduns that can be read by a particular tRNA molecule. The inosines in tRNA are formed by the d eaminat ion of adenosine after the synthesis of the primary transcript. Why is wobble tolerated in the third position of the codon but not in the first two? The 30S subunit has three uni versally conserved bases adenine 1492, adenine 1493, and guanine 530 in the l oS RNA that form hyd ro gen bonds on the minor- groove side bu t only with correctly formed base pairs of the cod on- anticodon duplex (Figure 30.21 ). These interactions serve to check whether W atson- Crick base pairs are present in the first two
bS RNA A 1493:..--
Armcc 101 A ~6
Codon U 1
Figure 30.21 165 rRNA monitors basepairing between the codon and the anticodon. Adenine 1493, one of three un iversally conserved bases in 165 rRNA. forms hydrogen bonds with the bases in both the codon and the anticodo n only if the codon and ant icod on are correctl y paired . [Fro m J M . O gle and V. Ramakri shnan. Annu. Re v. Biochem . 74 (2005):129- 177, Fig. 2a.]
875
30S ribosomal subunit /" Initiation factors
positions of the codon- anticodon duplex. No such inspection device is pres· ent for t he third position; so more· varied base pairs are tolerated. Th is mechanism for ensuring fidelity is analogous to the minor -groove interac· tions utilized by DNA polymerase for a similar purpose (p. 794). Thus, the ribosome plays an active role in decoding the codon- anticodon interactions.
30S ' IFHF3 IF2 (CTP)' IM et -tRNA,
+ mRNA
30.4
fM et GTP
5'
mRNA
3 05 initiation comptex
IFl + IF3
50S subunit + H2 0
IF2, CDP + P;
fMet
70S initiation complex
Figu re 30.22 Translation initiation in prokaryotes. Initiation facto rs aid the assembly f irst of th e 305 in it iation complex and th en of the 70S initiation compl ex.
Protein Factors Play Key Roles in Protein Synthesis
Although r RNA is paramount in the process of tran slation, protein factors also are required for the efficient synthesis of a protein. Protein factors par· ticipate in the initiation , elongation, and termination of protein synthesis. P-Ioop NTPases of the G-protein family play particu larly important roles. Recall that these proteins serve as molecular switches as they cycle between a GTP-bound form and a GD P -bound form (p . 387).
Formylmeth ionyl-tRNA f Is Placed in the P Site of the Ribosome in the Formation of the 70S Initiation Complex Messenger RNA and formylmethionyl-tRNA r mu st be brought to the rio bosome for protein synthesis to begin . How is this accomplished? Three protein initiation factors (IF1 , IF2, and TF3 ) are essential. The 30S riboso· mal subunit first forms a complex with 1F1 and IF3 (Figure 30.22 ). Binding of IF3 to the 30S subunit prevents it from prematurel y joining the 50S sub· unit to form a dead-end 70S complex, d evoid of m RNA and fMet·tRNA r. 1F1 binds near the A site and thereby directs the fMet -RNA r to the P site. IF2, a member of the G-protein family, binds GTP, and the concomitant conformational change enables IF2 to associate with formylmethion yltRNA r. The IF2- GTP- initiator-tRN A complex binds with mRNA (cor· rectly positioned by t he Shine- Dalgarno sequence interaction w ith the 16S rRNA) and the 30S subu nit to form the 305 initiation complex. Structural changes then lead to the ejection of TF1 and IF3. IF2 stimulates the associ· ation of the 50S subunit to the comp lex. The G TP bound to IF2 is hydrolyzed, leading to the release of I F 2. Th e result is a TUS initiation complex. When the 70S initiation complex has been form ed, the ribosome is ready for the elongation phase of protein synthesis . The fMet-tRNA r molecule occupies the P site on the ribosome. The other two sites for tRNA mole· cules, the A site and the E site, are empty. Formylmethionyl-tRNA r is po· sition ed so that its anticodon pairs with the initiating AU G (or GUG or UUG ) codon on mRNA . This interaction sets the readin g frame for the translation of t he entire mRNA. .
EF·T"
Elongation Factors Deliver Am inoacyl-tRNA to the Ribosome
Guanine
nucleotide -
The second phase of protein synthesis is the elongation cycle. This phase begins with the insertion of an aminoacyl-tRNA into the empty A site on the ribosome. The particular species in serted depend s on the mRNA codon in the A site. The cognate aminoacyl -tRNA does not simply leave the synthetase and diffu se to the A site. Rather, it is d elivered to the A site in asso· ciati on with a 43- kd protein called elongation fa ctor Tu (EF -Tu ). Elongation factor Tu, another member of the G -protein family, req uires G TP to bind aminoacyl -tRNA (Figure 30. 23) amI to bind the ribosome. The binding of Amlnoacyl· tRNA ---,.~ Figure 30.23 Structure of elongation factor Tu. The structure of a complex between
elongation fa ct or Tu (EF-Tu) and an aminoacyl-tRNA. Notice the P-Ioop NTPase domain (purple shad ing) at t he amino-termina l end of EF-Tu. Thi s NTPase domain is similar to those in other G proteins. [Draw n fro m lB23.pdb.]
876
EF -Tu to aminoacyl -tRNA serves two functions . First, EF -Tu protects the delicate ester linkage in aminoacyl-tRNA from hydrolysis . Second, the GT P in EF -Tu is hydrolyzed to GOP when an appropriate complex between the EF -Tu- aminoacyl-tRNA complex and the ribosome has formed. If the anticodon is not properly paired with the codon, hydrolysis does not take place and the aminoacyl-tRNA is not transferred to the ribosome. This mechanism allows the free energy of GTP hydrolysis to contribute to the fidelity of protein synthesis. GTP hydrolysis also releases EF -Tu from the ribosome. EF -T u in the GOP form must be reset to the G TP form to bind another aminoacyl-tRNA. Elongation factor T s, a second elongation factor, joins the EF-Tu complex and induces the dissociation of GOP. Finally, GTP binds to EF -Tu, and EF -T s is concomitantly released. It is noteworthy that EFTu does not interact with fMet-tRNAr- Hence, this initiator tRNA is not delivered to the A site. In contrast, Met-tRNA m , like all other aminoacyl tRNAs, does bind to EF -Tu . These findings account for the fact that interned AUG codons are not read by the initiator tRNA. Conversely, IF2 rec ognizes fMet-tRNA f but no other tRNA.
-y
This GTP- GDP cycle of EF -Tu is reminiscent of those of the heterotrimeric G proteins in signal transduction (p. 387) and the Ras proteins in growth control (p. 398). This similarity is due to their shared evolutionary heritage, seen in the homology of the amino -terminal domain of EF -T u to the P -loop N TPase domains in the other G proteins. The other two domains of the tripartite EF -Tu are distinctive; they mediate interactions between aminoacyl-tRNA and the ribosome. In all these related en zymes, the change in conformation between the GTP and the GOP forms leads to a change in interaction partners. A further similarity is the require ment that an additional protein catalyzes the exchange of GTP for GOP; ET- T s catalyzes the exchange for ET-Tu, just as an activated receptor does for a heterotrimeric G protein. The Formation of a Peptide Bond Is Followed Translocation of tRNAs and mRNA
by the GTP-Driven
After the correct aminoacyl-tRNA has been placed in the A site, the transfer of the polypeptid e chain from the tRNA in the P site is a thermodynamically spontaneous process, driven by the formation of the stronger peptide bond in place of the ester linkage. However, protein synthesis cannot continue without the translocation of the mRNA and the tRNAs within the ribosome. The mRNA must move by a distance of three nucleotides so that the next codon is positioned in the A site for interaction with the incoming aminoacyl -tRNA. At the same time, the deacylated tRNA moves out of the P site into the E site on the 30S subunit and the peptidyl -tRNA moves out of the A site into the P site on the 30S subunit. The movement of the peptidyltRNA into the P site shifts the mRNA by one codon, exposing the next codon to be translated in the A site. The three-dimensional structure of the ribosome undergoes significant change during translocation, and evidence suggests that translocation may result from properti es of the ribosome itself. However, protein factors accelerate the process. Translocation is enhanced by elongatiunJactor G (EF -G, also call ed translocase). A possible mechanism for accelerating the translocation process in shown in Figure 30.24. First, EF -G in the GTP form binds to the ribosome near the A site, interacting with the 23S r RNA of the 50S subunit. The binding of EF -G to the ribosome stimulates the GTPase activity of EF -G. On GTP hydrolysis, EF -G undergoes a conformational change that displaces the peptidyl-tRNA in the A site to the P site, carrying
877 30.4 Protein Factors
EF-G
p.,
o
Figure 30.24 Translocation mechanism. In the GTP form , EF-G binds t o the EF-Tu-bi nding site on the 50S subunit Thi s stimulates GTP hydrolysis, inducing a conformatio nal change in EF-G that forces the tRNA s and mRNA t o move through th e ribosome by a dist ance corresponding to one co don.
the m RNA and the deacylated tRNA with it. The dissociation ofEF -G leaves the ribosome ready to accept the next aminoacyl -tRNA into the A site.
,adenine
Protein Synthesis Is Terminated by Release Factors That Read Stop Codons
\.OH
The final phase of translation is termination . How does the synthesis of a polypeptide chain come to an end when a stop codon is encountered? Aminoacyl-tRNA does not normally bind to the A site of a ribosome if the codon is UAA, UClA, or UAG, because normal cells do not contain tRNAs with anticodons complementary to these stop signals. Instead, these stop cuduns are recognized by release factors (RF s), which are proteins that promote the release of the completed protein from the last tRNA. One of these release factors, RF1 , recognizes UAA or UAG. A second factor, RF2, recognizes UAA or UGA. A third factor, RF3, mediates interactions between RFl or RF2 and the ribosome. RF3 is another G protein homologous to EF -Ill. RF1 and RF2 are compact proteins that in eukaryotes resemble a tRNA molecule. When bound to the ribosome, the proteins unfold to bridge the gap between the stop codon on the mRNA and the peptidyl transferase center on the 50S subunit. Although the precise mechanism of release is not known, the release factor may promote, assisted by the peptidyl transferase , a water m olecule's attack on the ester linkage, freeing the polypeptide chain . The detached polypeptide leaves the ribosome. Transfer RNA and messenger RNA remain briefly attached to the 70S ribosome until the entire complex is dissociated in a GTP -dependent fashion in response to the binding of EF -G and another factor, called the ribosome re lease factor (RRF ) (Figure 30.25)
""'0
R
NH polypeptide/
tRNA \
o o ,adenine
\. HO
OH
+ H
H -'"
R
NH polypeptide/
RFl Peptide cleaved from tRNA )
UAA
UAA
UM
Figure 30.25 Termination of protein synthesis. A release factor recogn izes a stop codon in the A site and st imu lates the release o f th e comp leted p ro t ei n fro m th e tRNA in t he P site.
878
30.S
879
Eukaryotic Protein Synthesis Differs from Prokaryotic Protein Synthesis Primarily in Translation Initiation
30.5 Eukaryotic Protein Synthesis
The basic plan of protein synthesis in eukaryotes and archaea is simil ar to that in bacteria. The major structural and mechan istic themes recur in all domains of life. However, eukaryotic protein synthesis entail s more protein components than does prokaryotic protein sy nthesis, and some steps are more intricate. Som e noteworthy sim ilarities and differences are as follows : 1. I~ ibosomes . Eukaryotic ribosomes are larger. They consist of a 60S large subunit and a 40S small subunit, which come together to form an 80S particle having a mass of 4200 kd, compared with 2700 kd for the prokaryotic iOS ribosome. The 40S subunit contains an 18S RNA that is homologous to the prokaryotic 16S R NA. The 60S subunit contains three RNA s: t he 5S RNA, which is homologous to the prokaryotic 5S rRNA; the 28S RNA. which is homologo us to the prokaryotic 23S molecul es; and the 5.8S RNA, which is homologous to the 5' end of the 23 S RNA of prokaryotes. 2. Initiator tRNA. In eukaryotes, the initiating amino acid is methionine rather than N-formylmethionine. However, as in prokaryotes, a special tRNA participates in initiation. This aminoacyl-tR NA is called MettRNA i or Met-tRNA r (the subscript "i" stands for initiation , and Hf" indi cates that it can be formylated in vitro).
3. lnitiation. T he initiating codon in eukaryotes is always AUG. Eukaryotes, in contrast with prokaryotes, do not have a specific purine- ri ch sequence on the 5' side to distinguish initiator AUGs from internal ones . Instead, the AUG nearest the 5' end of mR A is usually selected as the start site. A 40S ribosome, with a bo und Met-tRNA i , attaches to the cap at the 5' end of eukaryotic mRNA (p. 846) and searches for an AUG codon by moving step-by-step in the 3' direction (Figure 30.26) . T his scanning process is catalyzed by helicases that move along the mRNA powered by ATP hydrolysis. Pairing of the anticodon of Met-tRNA i with the AUG codon of mR A signals that the target has been found . In almost all cases, eukaryotic mR A has only one start site and hence is the tem plate for a single protein . In contrast, a prokaryotic mRNA can have multiple Shine Dalgarno sequences and, hence, start sites, and it can serve as a tem plate for the synthesis of several proteins. Eukaryotes utilize many more initiation factors than do prokaryotes, and their interplay is much more intricate. The prefix el F denotes a eukaryotic initiation factor. For example, eI F -4E is a protein that binds directly to the 7·methylguanosine cap (p. 846). whereas eIF-2. in association with GTP. delivers the met-tRNA i to the ribosome. T he difference in initiation mechanism between prokaryotes and eukaryotes is, in part. a consequence of the difference in RNA processing. The 5' end of mRNA is readily available to ribosomes immediately after transcription in prokaryotes. In contrast. premRNA must be processed and transported to the cytoplasm in eukaryotes before translation is initiated. The 5' cap provides an easil y recogni zable starting point. In addition, the complexity of eukaryotic translation initia tion provides another mechanism fo r regulation of gene expression that we shall explore further in Chapter 31 . 4. The Structure of mRNA. Eukaryoti c mRNA is circular. T he elF -4E protein that binds to the mR A cap structure also binds to the poly(A ) tail through two protein intermediaries. The protein binds first to the
mRNA
Cap Initiation factors + GlP ~ MeHRNA; 405 subunit
Met
405 subunit
with initation
n AlP
components
n AD? + Pi Met
60S sub unit
Initldtion
fadors
Met
80S initiation complex
Figure 30.26 Eukaryotic translation initiation. In eukaryotes, translation initiation starts with the assembly o f a complex on the 5' cap that includes the 405 subunit and M et - tRNA,. Driven by ATP hydrol YS iS, this complex scans th e mRNA until th e first AUG is reached . The 60S subunit is then added to fo rm the 80S initiation complex.
5'
elF -4G protein , which in turn binds to a protein associated with the poly(A ) tail, the poly(A)-bindin g protein (PABPI ; Figure 30 .27). Cap and tail are thu s b ro ught together to form a circle of mRNA. The circul ar structure m ay facilitate the rebinding of the riboso mes fo ll owing protein- synth esis termination .
eIF-4 G
m
PASPI
PASPI
3'
80S
Figure 30.27 Protein interactions circularize eukaryotic mRNA. [After H. Lodish et aI., Molecular Cell Biology. 5th ed. (w. H. Freeman and Company, 2004). Fig. 4.31.]
S. Elongation and Termination. Eukaryotic elongation factors EFI ex and EFl i3'Y are the counterparts of prokary· otic EF -Tu and EF -T s. The GTP form of EFl CI. deli vers aminoacyl-tRNA to the A site of the ribosome, and EFI i3'Y catalyzes the exchan ge of GTP for bound GOP. Eukaryotic EF2 mediates GTP -driven translocation in much the sam.e way as does prokaryotic EF -G. T ermination in eukaryotes is carried out by a single release factor, eRFl , compared with two in prokaryotes . Finally, elF -3, like its prokaryotic counterpart IF3, prevents the reassociation of ribosomal subunits in the absence of an initiation compl ex .
30.6
Figure 30.28 Ribosomes are bound to the endoplasmic reticulum. In t his electron micrograph, ribosomes appear as small black dots bindi ng t o the cytoplasmic side of the endoplasmic reticulum to give a rough appearance. In contrast , the smooth endoplasmic reticulum is devoid of ribosomes. [From G. K. Voletz, M. M. Rol ls, and T. A. Rapoport, EMBO Rep. 3(2002): 944 -950.]
Ribosomes Bound to the Endoplasmic Reticulum Manufacture Secretory and Membrane Proteins
A newly synthesized protein in E. coli can stay in the cytoplasm or it can be sent to the plasma membrane, the outer m embrane, the space between them, or th e extracellular m edium . Eukaryotic cells can direct proteins to internal sites such as lysosomes, mitochondria, chloroplasts, and the nu cleus. How is sorting accomplished ? In eukaryotes, a key choice is made soon after the synthesis of a protein begins. The ultimate destination of a protein d epends broadly on the location of the ribosom e on which it is being synthesized . In eukaryotic cells, a ribosom e remains free in the cyto plasm unl ess it is directed to the endoplasmic reticulum (ER), the extensive m embrane system that comprises about half the total m embran e of a cell. The region that binds riboso m es is called the rough ER because of its studded appearance, in co ntrast with the smooth ER , which is devoid of ribosomes (Figure 30. 28). Free ribosomes synthesize proteins that remain within the cell , either within the cytoplasm or directed to organelles bounded b y a double membrane, such as the nucleus, mitochondria and chloroplasts. Ribosomes bound to the ER usually synthesize proteins d estined to leave the cell or to at least contact the cell exterior from a position in the cell membrane. These proteins fall into three m ajor classes: secretory proteins (proteins ex· ported by the cell), lysosomal proteins, and proteins spanning the plasma membrane. Virtually all integral m embrane proteins of the cell , except those located in the membranes of mitochondri a and chloropl asts, are form ed by ribosomes bound to the ER. A vari ety of strategies are used to send proteins synthesized by free ribosom es to the nucleus, peroxisomes, mitochondria, and chloroplasts of eukaryotic cells. However, in this section, we will focus on the targeting of proteins p roduced by ribosomes bound to the endoplasmic reticulum.
Signal Sequences Mark Proteins for Trans location Across t he Endoplasm ic Ret iculum Membrane The synthesis of proteins destined to leave the cell or become embedded in the plasma membrane begins on a free ribosome but, shortly after synthesis begins, it is halted until the ribosome is directed to the cytoplasmic side of 880
the endoplasmic reticulum . When the ribosome docks with th e membrane, protein sy nthesis begins again. As th e newly forming peptide chain exits the ribosome, it is transported, cotranslationally, through the membrane into the lumen of the endoplasmic reticulum. Free ribosom es that are synthesizing proteins for use in the cell are identical with those attached to the ER. What is the process that directs the ri bosome synthesizing a protein destined to enter the ER to bind to the ER? The translocation consists of four components. Cleavage site Human growth hormone
MA TGS
Human proinsulin Bovine proalbumin
TSLLLAFGLLCLPWLQEGSA
FPT
MALWM R LLPLLALLALWGPDPAAA
FVN
M
WVTFISLLLFSSAYS
RGV
VLSLLYLLTAIPHIMS
DVQ
5 L L I L V L C F L P K L AA L G
KVF
F L V N V A L V F MV V Y I S Y I Y A
APE
L L VVAVIACMLIGFADPASG
CKD
I F C LIM L L G L SA 5 AA T A
5 I F
•
Mouse antibody H chain
M
Chicken lysozyme
M
Bee promellitin
Drosophila glue protein lea maize protein 19 Yeast invertase Human influenza virus A
M M
M A A
MLLOAFLFLLAGFAA
ISA
SMT
M A L LV L L Y A F V A G
DQ I
1. The Signal Sequence. The signal sequence is a sequence of 9 to 12 hydrophobic amino acid residues, sometimes containing positively charged amino acids (Figure 30.29). This sequence is usually near the amino terminus of the nascent polypeptide chain . The presence of the signal sequence identifies the nascent peptide as one that must cross the ER membrane. Some signal sequences are maintained in the mature protein, whereas others are cleaved by a signal peptidase on the lumenal side of the ER membrane (see Figure 30.29). 2. The Signal-Recognition Particle (51
~
o
..c
0-
e 1:;
-
OJ OJ
-
o c .-o
-1.0
1:; .-~ Cl
-
0.2
90 ~ 2 __________~___
CHAPTER 31 The Control of Gene Expression
gene -regulatory processes. Other aspects of eukaryotic gene regulation are quite different from those in prokaryotes. They relate primarily to the role of DNA packaging in eukaryotic genomes.
Multiple Transcription Factors Interact with Eukaryotic Regulatory Sites The basal transcription complex described in Chapter 29 initiates transcription at a low frequency. Recall that several general transcription factors (the preinitiation complex) join with RNA polymerase II to form the basal transcription complex. Additional transcription factors must bind to other sites for a gene to achieve a high rate of mRNA synthesis. In contrast with the regulators of prokaryotic transcription, few eukaryotic transcription factors have any effect on transcription on their own. Instead, each factor recruits other proteins to build up large complexes that interact with the transcriptional machinery to activate transcription. A major advantage of this mode of regulation is that a given regulatory protein can have different effects, depending on what other proteins are present in the same cell. This phenomenon, called combinatorial control, is crucial to multicellular organisms that have many different cell types. Even in unicellular eukaryotes such as yeast, combinatorial control allows th, generation of distinct cell types.
Eukaryotic Transcription Factors Are Modular Transcription factors usually consist of several domains. The DNA-binding domain identifies and binds regulatory sequences that can either be adjacenl to the promoter or at some distance from it. Some activators also incl ude a regulatory domain , which prevents DNA binding under certain conditions. After a transcription factor has bound to the DNA, the activation domain initiates transcription through interactions with RNA polymerase II or its associated proteins. The DNA -binding domain is essential for determining which genes are transcribed. A transcription factor is activated in response to a stimulus and is then responsible for activating the transcription of a set of genes . For exam· pie, the transcription factor NF -KB is activated in response to injury, and it activates the transcription of genes that produce an immune response, help· ing to fight infection. The DNA-binding domain recognizes and binds to a short conserved recognition sequence in the promoter region of each gene or in a more distant enhancer. Often, to increase specificity, the recognition sequence is repeated at regular intervals, and the activators must dimerize before binding to the repeated recognition sequences. Transcription factors can be grouped into families on the basis of the structure of their sequence· specific DNA-binding domains. The helix-tum-helix, homeodomain, bZip, and zinc-finger domains introduced in Section 31.1 are examples of common DNA-binding domains. Transcription factors can often act even if their binding sites lie at a can· siderable distance from the promoter. These distant regulatory sites are called enhancers (p. 838). The intervening DNA can form loops that bring the enhancer-bound activator to the promoter site, where it can act on other transcription factors or on RNA polymerase.
Activation Domains Interact with Other Proteins The activation domains of transcription factors generally recruit other pro· teins that promote transcription. Some of these activation domains interact directly with RNA polymerase II. In other cases, an activation domain may
have multiple interaction partners. These activation domains act through intermediary proteins, which bridge between the transcription factors and the polymerase. An important target of activators is mediator, a complex of 25 to 30 subunits that is part of the preinitiation complex. Mediator acts as a bridge between enhancer-bound activators and promoter-bound l{NA polymerase II (Figure 31.1 8). Activation domains are less conserved than DNA-binding domains. In fact, very little sequence similarity has been found. For example, they may be acidic, hydrophobic, glutamine rich, or proline ri ch. However, certain feat ures are common to activation domains. First, they are redundant. That is, a part of the activation domain can be deleted without loss of function. Second, as described earlier, they are modular and can activate transcription when paired with a variety of DNA-binding domains. Third, activation domains act synergistically : two activation domains acting together create a much stronger effect than either acting separately. We have been addressing the case in which gene control' requires the ex pression of a gene. In many cases, the expression of a gene must be halted by ceasing gene transcription. The agents in such cases are transcriptional repressors. In contrast with activators, repressors bind proteins that block the association of RNA polymerase II with the DNA.
903 31.3 Eukaryotic Regulation of Transcription
Mediator
DNA
Transcription factor
RNA polymerase II
Figure 31.18 Mediator. Med iator. a large complex of pro tein subunits. act s as a bridge between transcription fa ct ors beari ng activation domains and RNA po lymerase II. The se interactions help recru it and stabilize RNA polymerase II near spec ific genes that are then transcribed.
Nucleosomes Are Complexes of DNA and Histones
The control of eukaryotic gene transcription is complicated by the fact that DNA in eukaryotic chromosomes is not bare. Instead, eukaryotic DNA is tightly bound to a group of small basic proteins called histones. In fact, histones constitute half the mass of a eukaryotic chromosome. The entire complex of a cell's DNA and associated protein is called chromatin. Five major histones are present in chromatin: four histones, called H2A, H2B, H 3, and H4, associate with one another; th e other histone is called H1. Histones have strikingly basic properties because a quarter of the residues in each histone are either arginine or lysine. Chromatin is made up of repeating units, each containing 200 bp of DNA and two copies each of H2A, H2B, H 3, and H4 , called the histone octamer. These repeating units are known as nucleosomes. Strong support for this model comes from the results of a variety of experiments, including observations of appropriately prepared samples of chromatin viewed by electron microscopy (Figure 31. 19). C hromatin viewed with the electron microscope has the appearance of beads on a string; each bead has a diameter of approximately 100 A. Partial digestion of chromatin with DNase yields the
I
I
100 nm
Figure 31.19 Chromatin structure. An electron mi crograph of chro matin shOWing its "beads on a st ri ng" character. [Courtesy of Dr. Ad a O lins and Dr Dona ld Olins.]
Amino-terminal tail
(C)
(8)
(A)
~ Figure 31 .20 Nucleosome core particle. The structure consists of a core of eight
histone proteins surrounded by DNA. (A) A view show ing the DNA wrapping around the histone core. (B) A view related to that in part A by a 90-degree rotation. Not ice that the DNA forms a left-handed superhel ix as it wraps around the core. (e) A schematic view. [Drawn from 1AOI.pdb.]
isolated beads . These particles consist of fragments of DNA about 200 bp in length bound to the eight histones. More-extensive digestion yields a shorter DNA fragment of 145 bp bound to the histone octamer. The smaller complex formed by the histone octamer and the 145 -bp DNA fragment is the nucleosome core particle. The DNA connecting core particles in undigested chromatin is called linker DNA. Histone Hl binds, in part, to the linker DNA. Eukaryotic DNA Is Wrapped Around Histones to Form Nucleosomes
The overall structure of the nucleosome was revealed through electron microscopic and x -ray crystallographic studies pioneered by Aaron Klug and his colleagues. More recently, the three-dimensional structure of a reconstituted nucleosome core (Figu re 31.20) was determined to higher resolution b y x-ray diffraction methods. As was shown by Evangelos Moudrianakis, the four types of histone that make up the protein core are homologous and similar in structure (Figure 31.21). The eight histones in the core are arranged into a (H3 h(H4)2 tetramer and a pair of H2A- H 2B dimers. The tetramer and H2A
H28
H3
H4
~ Figure 31.21 Homologous histones. Histones H2A, H2B, H3, and H4 adopt a similar
three-dimensiona l structure as a consequence of common ancestry. Some parts of the tails at the termini of the proteins are not shown. [Drawn from 1AOl.pdb.]
904
dimers come together to form a left -handed superhelical ramp around which the DNA wraps. In addition, each histone has an amino-terminal tail that extends out from the co re structure. These tails are flexible and contain a number of lysine and arg inine residues. As we shall see, covalent modifications of these tails play an essential role in modulating the affinity of the histones for DNA and other properties. The DNA forms a left-handed superhelix as it wraps around the outside of the histone octamer. The protein core forms contacts with the inner surface of the DNA superhelix at many points, particularly along the phosphodiester backbone and the minor groove. N ucleosomes will form on almost all DNA sites, although some sequences are preferred because the dinucleotide steps are properly spaced to favor bending around the histone core. A histone with a different structure from that of the others, called histone HI , seals off the nucleosome at the location at which the linker DNA enters and leaves. The amino acid sequences of histones, including their amino-terminal tails, are remarkably conserved from yeastthrough human beings. The winding of DNA around the nucleosome core contributes to the packing of DNA by decreasing its linear extent. An extended 200-bp stretch of DNA would have a length of about 6RO A. Wrapping this DNA around the histone octamer reduces the length to approximately 100 A along the long dimension of the nucleosome. Thus the DNA is compacted by a factor of 7. However, human chromosomes in metaphase, which are highly con 4 densed , are compacted by a factor of 10 Clearly, the nucleosome is just the first step in DNA compaction. What is the next step? Theo nucleosomes themselves are arranged in a helical array approximately 360 A across, forming a series of stacked layers approximately 110 A apart (Figure 31.22). The folding of these fibers of nucleosomes into loops further compacts DNA. The wrapping of DNA around the histone core as a left-handed helix also stores negative supercoils; if the DNA in a nucleosome is straightened out, the DNA will be underwound (p. 789 ). T his underwinding is exactly what is needed to separate the two DNA strands during replication and transcnptlOn. •
905 31.3 Eukaryotic Regulation of Transcription
•
The Control of Gene Expression Can Require Chromatin Remodeling Does chromatin structure playa role in the control of gene expression? Early observations suggested that it does indeed . DNA that is densely packaged into chromatin is less susceptible to cleavage by the nonspecific DNA-cleaving enzyme DNase 1. Regions adj acent to genes that are being transcribed are more sensitive to cleavage than are other sites in the genome, suggesting that the DNA in these regions is less compacted than it is elsewhere and more accessible to proteins. In addition, some sites, usuall y within 1 kb of the start site of an active gene, are exquisitely sensitive to DNase I and other nucleases. These hypersensitive sites correspond to regions that have few nucleosomes or contain nucleosomes in an altered conformational state. Hypersensitive sites are cell-type specific and developmentally reg ulated. For example, globin genes in the precursors of erythroid cells from 20- hour- old chicken embryos are insensitive to DNase 1. However, when hemoglobin synthesis begins at 35 hours, regions adjacent to these genes become highly su sceptible to digestion . In tissues such as the brain that produce no hemoglobin, the globin genes remain resistant to DNase I through out development and into ad ulth ood. These studies suggest that a prerequisite for gene expression is a relaxing of the chromatin structure. Recent experiments even more clearly revealed the role of chromatin structure in regulating access to DNA binding sites. Genes required for
lloA
( 11 nm)
I
360 A (36 nm)
Figure 31.22 Higher-order chromatin structure. A pro posed model fo r chromatin arranged in a helical array co nsist ing o f six nucleosomes per t urn of helix. The DNA double heli x (shown in red) is wo und around each histone octamer (shown in blue). [After J. T. Finch and A. Klug. Proc. Na tl. Acad. Sci. U. S. A
73(1976):1897-1901.]
906 CHAPTER 31 Expression
The Control of Gene Z n ~=
'1b
Figure 31.23 GAL4 binding sites. The yeast transcription fa ctor GAL4 binds to DNA sequences of the form 5'-CGG(N)l1CCG-3'. Two zin c-based domains are present in the DNA-bind ing region of this protein. Notice that these domains contact the 5' -CGG-3' sequences, leaving the cent er of t he si t e uncontacted. [Drawn from lD66.pdb.]
Start site
TATA
CAGOG
Enhancer • region
Z n ~==
galactose utilization in yeast are activated b y a DNA-binding protein called GAL4, which recognizes DNA binding sites with two 5' -CGG -3' sequ ences separated by 11 base pairs (Figure 31. 23) . Approximately 4000 potential GAL4 binding sites of the form 5' -CGG( N)II CCG-3' are present in the yeast genome, but only 10 of them regulate genes necessary for galactose metabolism. What fraction of the potential binding sites are actually bound by GA L4? This question is addressed through the use of a technique called chromatin immunoprecipitation (ChIP). GAL4 is first cross-linked to its DNA binding sites in chromatin. The DNA is then fragmented into small pieces, and antibodies to GAL4 are used to isolate the chromatin fragments containing GAL4. The cross-linking is reversed , and the DNA is isolated and characterized. The results of these studies reveal that only approxi· mately 10 of the 4000 potential GAL4 sites are occupied by GAL4 when th e cells are growing on galactose; more than 99% of the sites appear to be blocked. Thus, whereas in prokaryotes all sites appear to be equally accessi· ble, chromatin structure shields a large number of the potential binding sites in eukaryotic cells. GAL4 is thereby prevented from binding to sites that are unimportant in galactose metabolism. These lines of evidence and others reveal that chromatin structure is al· tered in active genes compared with inactive ones. How is chrom atin struc· ture modified? As we shall see later (p. 9 10), specific covalent m odifications of histone proteins are crucial. In addition, the binding of specific proteins to enhancers at specific sites in the genome plays a role.
(AGOG
Enhancers Can Stimulate Transcription in Specific Cell Types
CAGCTG
W e now return to the action of enhan cers (p . 902). Recall that these DNA sequences, although they have no promoter activity of their own, greatly increase the activities of many promoters in eukaryotes, even when the enhan cers are located at a distance of several thousand base pairs from the gene being expressed . Enhancers function by serving as binding sites for specific regulatory proteins (Figure 31.24). An enhancer is effective only in the specific cell types in which appropriate regulatory proteins are expressed . In many cases, these DNA-binding proteins influence transcription initiation by perturbing the local chromatin structure to expose a gene or its regulatory sites rather than by direct interactions with RNA polymerase. This mechanism accounts for the ability of enhancers to act at a distance.
nATAAnAA (CATGTAAGG
Figure 31 .24 Enhancer binding sites. A schematic structure for the region 1 kb upstream of the start site for the muscle creatine kinase gene. One binding site of the form 5' -CAG CTG-3' is present near the TATA box. The enhancer region farther upstream contains two binding sites for the same protein and two additional binding sites for other proteins.
Sets
muscle
cells expressing p-galactosidase
Figure 31.25 An experimental demonstration of enhancer function. A promoter for muscle creatine kinase artificially drives the transcripti on of ~ - galactos i dase in a zebrafish embryo. Only specific sets of muscle cells produce ~-galactosidase , as vi sualized by t he formatio n of the blue product on treatment of the em bryo with X-Gal. [From F. Muller, D. W. Williamson, J. Kobolak, L. Gauvry, G. Goldspink, L. Orban, and N. Maclean. Mol.
907 31.3 Eukaryotic Regulation of Transcription
Reprod. Dev. 47(1997):404- 412.]
T he properties of enhancers are illustrated by studies of the enhancer controlling the muscle isoform of creatine kinase (p. 416) . The results of mutagenesis and other studies revealed the presence of an enhancer located between 1350 and 1050 base pairs upstream of the start site of the gene for this enzyme. Experimentall y inserting this enhancer near' a gene not normally expressed in muscle cells is sufficient to cause the gene to be expressed at high levels in muscle cells but not in other cells (Figure 31.25).
The Methylation of DNA Can Alter Patterns of Gene Expression The degree of methylation of DNA provides another mechanism, in addition to packaging with histones, for inhibiting gene expression inappropriate to a specific cell type. Carbon 5 of cytosine can be methylated by specific methyltransferases. About 70% of the 5' -CpG -3' sequences in mammalian genomes are methylated. However, the distribution of these methylated cytosines varies, depending on the cell type. Consider the l3-globin gene. In cells that are actively expressing hemoglobin, the region from approximately 1 kb upstream of the start site to approximately 100 bp downstream of the start site is less methylated than the corresponding region in cells that do not express this gene. The relative absence of 5-methylcytosines near the start site is referred to as hypomethylation. The methyl group of 5-methylcytosine protrud es into the major groove where it could easily interfere with the binding of proteins that stimulate transcription .
H
N
deoxyribose 5-Methylcytosine
The distribution of CpG sequences in mammalian genomes is not T uniform . Many C pG sequences have been converted into TpG through mutation by the deamination of 5-methylcytosine to thymine. However, sites near the 5' ends of genes have been maintained because of their role in gene expression. Thus, most genes are found in CpG islands, regions of the genome that contain approximately four times as many C pG sequences as does the remainder of the genome. .>(J)'
Steroids and Related Hydrophobic Molecules Pass Through Membranes and Bind to DNA-Binding Receptors We next look at an example that illustrates how transcription factors can stimu late changes in chromatin structure that affect transcription. We will consider in some detail the system that detects and responds to estrogens. Synthesized and released by the ovaries, estrogens, such as estradiol, are cholesterol -derived, steroid hormones (p. 753) . They are required for the development of female secondary sex characteristics and, along with progesterone, participate in the ovarian cycle. Because they are hydrophobic molecules, estrogens easily diffuse across cell membranes. When inside a cell , estrogens bind to highly specific, solu ble receptor proteins. Estrogen receptors are members of a large family of
CH 3 ,/
H
Estradiol (an estrogen)
OH
908 CHAPTER 31 Expression
The Contro l of Gene
proteins that act as receptors for a wide range of hydrophobic molecules, in· cluding other steroid hormones, thyroid hormones, and retinoids. I
o /'
o
I - OOC
I Thyroxine (L-3,5,3 ', 5' -Tetraiodothyronine) (a thyroid hormone)
All-trans-retinoic acid
(a retinoid)
The human genome encodes approximately 50 members of this family, often referred to as nuclear hormone receptors. The genomes of other multicellular eukaryotes encode similar numbers of nuclear hormone receptors, although they are absent in yeast. All these receptors have a similar mode of action . On binding of the signal molecule (called, generically, a ligand), the ligand- receptor complex modifies the expression of specific genes by binding to control elements in the DNA. Estrogen receptors bind to specific DNA sites (referred to as estrogen response elements or E R Es) that contain the consensus sequence S' -AGGTCANNNTGACCT -3'. As expected from the symmetry of this sequence, an estrogen receptor binds to such sites as a dimer. A comparison of the amino acid sequences of members of this famil y reveals two highly conserved domains: a DNA-binding domain and a ligandbinding domain (Figure 31. 26). The DNA -binding domain lies toward the center of the molecule and consists of a set of zinc-based domains different from the Cys2His2 zinc-finger proteins introduced near the beginning of the chapter. These zinc-based domains bind to specific D NA sequences by virtue of an 01 helix that lies in the major groove in the specific DNA com· plexes formed by estrogen receptors.
Ligandbinding _ pocket
DNA-binding domain
Ligand-binding domain
~ Figure 31.26 Structure of two nuclear hormone receptor doma ins. Nucl ear ho rmone
recepto rs con t ain t wo cruc ial conserved doma ins: (1) a DNA-binding domain toward the center of the sequence and (2) a ligand-binding do main t o ward the carbo xy l term inus. The structu re of a dimer of t he DNA-bind ing domain bound to DNA is sho wn, as is o ne mono mer of the normally d imeric ligand-binding domain. [Drawn from 1HCQ and 1LBD.pdb.]
CH OH 3
Estradiol
\
~
)
~ Figure 31 .27 ligand binding to
nuclear hormone receptor. The ligand lies completely surrounded within a pocket in the liga nd-binding domain. Notice that the last c< helix, helix 12 (shown in purple), folds into a groove on the side o f the structure on ligand bind ing. [Drawn from 1LDB and 1ERE.pdb.]
Helix 12
•
Nuclear Hormone Receptors Regu late Transcription by Recruiting Coactivators to the Transcription Complex
The second highly conserved domain of the nuclear receptor proteins lies near the carboxyl terminus and is the ligand-binding site. This domain folds into a structure that consists almost entirely of a. helices, arranged in three layers. The ligand binds in a hydrophobic pocket that lies in the center of this array of helices (Figure 31.27). This domain changes conformation when it binds estrogen . How does ligand binding lead to changes in gene expression? The simplest model wou ld have the binding of ligand alter the DNA-binding properties of the receptor, analogously to the lac repressor in prokaryotes. H owever, experiments with purified nuclear hormone recep tors revealed that ligand binding does not significantly alter DNA -binding affinity and specificity. Another mechanism is operative. Because ligand binding does not alter the ability of nuclear hormone receptors to bind DNA, investigators sought to determine whether specific proteins might bind to the nuclear hormone receptors only in the presence of ligand. Such searches led to the identification of several related proteins called coactivators, such as SRC-l (steroid receptor coactivator-i ), GRIP-l (glucocorticoid receptor interacting protein -i), and NcoA-l (nuclear hormone receptor coactivator-1). T hese coactivators are referred to as the p160 family because of their size. T he binding of ligand to the receptor induces a conformational change that allows the recruitment of a coactivator (Figure 31. 28). In many cases, these coactivators are enzymes that catalyze reactions that lead to the modification of chromatin structure.
Estrogen
(ligand)
-\
Coactivator )
\
)
a helix
Figure 31.28 Coactivator recruitment. The binding of ligand to a nuclear hormone receptor induces a conformationa l change in the ligand-binding domain. This change in conformation generat es favorab le sites for the binding of a coactivator.
909
Steroid-Hormone Receptors Are Targets for Drugs
910 CHAPTER 31 Expression
The Control of Gene
....
Molecules such as estradiol that bind to a receptor and trigger signaling pathways are called agonists. Athletes sometimes take natural and synthetic agonists of the androgen receptor, a member of the famil y of nuclear hormone receptors, because their binding to the androgen receptor stimulates the expression of genes that en hance the development of lean muscle mass. CH,
CH, 0
OH II''''
/'
\
CH,
o
o
·CH,
# Dianabol (methandrostenolonej (a synthetic androgen)
Androstendione
(a natural androgen)
Referred to as anabolic steroids, such compounds used in excess are nol without side effects. In men, excessive use leads to a decrease in the secretion of testosterone, to testicular atrophy, and sometimes to breast enlargement (gynecomastia) if some of the excess androgen is converted into estrogen. In women, excess testosterone causes a decrease in ovulation and estrogen secretion ; it also causes breast regression and growth of facial hair. Other molecules bind to nuclear hormone receptors but do not effectively trigger signaling pathways . Such compounds are called antagonists and are, in many ways, like competitive inhibitors of enzymes. Some important drugs are antagonists that target the estrogen receptor. For example, tamoxiJen and raloxifene are used in the treatment and prevention of breast cancer, because some breast tumors rely on estrogen-mediated pathways for growth . These compounds are sometimes called selective estrogen receptor modulaton (SERMs). OH
HO-
\
~ O----'/~-IN Tamoxifen
Helix 12
Tamoxifen
"l:l
Figure 31.29 Estrogen receptor- tamoxifen complex. Tam ox ifen binds in the pocke t normally occupi ed by estrogen. Ho wever, notice t hat part o f the tam ox ifen structure extends fro m this pocket, and so he li x 12 cannot pack in its usual posi t ion. Instead. this he lix blo cks the coacti vato r-binding site. [Drawn from 3ERT.pdb.]
Raloxifene
The determination of the structures of complexes between the estrogen receptor and these drugs revealed the basis for their antagonist effect (Figure 31 .29). Tamoxifen binds to the same site as estradiol does. However, tamoxifen has a group that extends out of the normal ligand-binding pocket, as do other antagonists . These groups block the normal conformational changes induced by estrogen. Tamoxifen blocks the binding of coactivators and thus inhibits the activation of gene expression. Chromatin Structure Is Modulated Through Covalent Modifications of Histone Tails
We have seen that nuclear receptors respond to signal molecules by recruit ing coactivators. Now we can ask, How do coactivators modulate transcriptional activity? These proteins act to loosen the histone complex from the DNA, exposing additional DNA regions to the transcription machinery.
911 - - - - - - - - - - -- 31.3 Eukaryotic Regulation of Transcription Histone H3 tail
Coenzyme A
~ Figure 31.30 Structure of histone acetyltransferase. The amino -terminal tail of
histone H3 extends into a pocket in wh ich a lysine side chain c an accept an acety l group from acetyl e o A bound in an adjacent si te. [Drawn from 1QSN.pdb.]
Much of the effectiveness of coactivators appears to result from their ability to covalently modify the amino-terminal tails of histones as well as regions on other proteins. Some of the p160 coactivators and the proteins that they recruit catalyze the transfer of acetyl groups from acetyl CoA to specific lysine residues in these amino-terminal tails.
o o
H
•
+
~
""'N H
CoA------.
S
o
Lysine in histone tail
- ---.,
""
N H
H
+
•
CoA
SH
+
H+
N H
o
Acetyl eoA
Enzymes that catalyze such reactions are called histone acetyltransferases (HATs) . The histone tails are readily extended ; so they can fit into the HAT active site and become acetylated (Figure 31.30). What are the consequences of histone acetylation? Lysine bears a positively charged ammonium group at neutral pH. The addition of an acetyl group generates an uncharged amide group. This change dramatically reduces the affinity of the tail for DNA and modestly decreases the affinity of the entire histone complex for DNA, loosening the histone complex from the DNA. In addition, the acetylated lysine residues interact with a specific acetyllysine-binding domain that is present in many proteins that regulate eukaryotic transcription. This domain, termed a bromodomain, comprises approximately 110 amino acids that form a four-helix bundle containing a peptide-binding site at one end (Figure 31.31). Bromodomain -containing proteins are components of two large complexes essential for transcription. One is a complex of more than 10 polypeptides that binds to the TATA-box-binding protein. Recall that the TATA -box-binding protein is an essential transcription factor for many genes (p . 837). Proteins that bind to the TATA -box-binding protein are called TAPs (for TATA-box-binding protein associated factors ). In partic ular, T AF1 contains a pair of bromodomains near its carboxyl terminus. The two domains are oriented such that each can bind one of two acetyllysine residues at positions 5 and 12 in the histone H 4 tail. Thus, acetylation
Histone H4 tail
Acetyllysine
~ Figure 31.31 Struct ure of a
bromodomain. Th is fo ur-hel ixbundle doma in binds pep t ides contai ni ng acetyllysi ne. An acetylated pept ide o f histo ne H4 is shown bound in th e stru ct ure. [Drawn f rom 1EGl. pdb. ]
CD
)
(3)
)
o
)
8)
)
®
)
Transcription factor
Exposed site
Coactivator Acetylated lysine residues
RNA polymerase II
Remodeling • engine
Figure 31.32 Chromatin remodeling. Eukaryoti c gene regu lation begins with an activated t ranscription fa ctor bound to a specific site on DNA . One scheme for the initiation of tran scripti on by RNA polymerase II requires fi ve steps: (1) rec ruitm ent of a coactivator, (2) acetyl ation o f lysine residues in the histone tails, (3) binding of a remode lingengine complex t o the acetylated lysi ne residues, (4) Al P-d ependent remode ling of the chro matin structure to expose a bindi ng site for RNA polymerase or for other factors, and (5) recru itment of RNA polymerase. Only two subunits are shown fo r each complex, although the actual complexes are much larger. Other schemes are possible.
of the histone tails provides a mechanism for recruiting other components of the transcriptional machinery. Bromod omains are also present in some components of large complexes known as chromatin-remodeling engines. These complexes, which also contain domains homologous to those of helicases, utilize the free energy of ATP hydrolysis to shift the positions of nucleosomes along the DNA and to induce other conformational changes in chromatin (Figure 31.32). Histone acetyla· tion can lead to a reorganization of the chromatin structure, potentiallyex. posing binding sites for other factors. Thus, histone acetylation can activate transcription through a combination of three mechanisms: by reducing the affin· ity of the his tones for DNA, by recruiting other components of the transcriptional machinery, and by initiating the remodeling of the chromatin structure. N uclear horm one receptors also include regions that interact with com· ponents of the mediator complex. Thus, two m echani sm s of gene regulation can work in concert. Modification of his tones and chromatin remodeling can open up regions of chromatin into which the transcription complex can be recruited through protein protein interactions. Histone Deacetylases Contribute to Transcriptional Repression
Just as in prokaryotes, some changes in a cell's environment lead to the reo pression of genes that had been active. The modification of histone tails again plays an important role. H owever, in repression , a key reaction appears to be the de acetylation of acetylated lysine, catalyzed by specific histone deacetylase enzym es. Tn many ways, the acetylation and deacetylation of lysine residues in histone tail s (and, likely, in other proteins) is analogous to the phosphoryla· tion and dephosphorylation of serine, threonine, and tyrosine residues in other stages of signaling processes. Like the addition of phosphoryl groups, the addition of acetyl groups can induce conformational changes and gener· ate novel binding sites. Without a m eans of removing these groups, how· ever, these signaling switches will become stuck in one position and lose their effectiveness. Like phosphatases, deacetylases help reset the switches. Acetylation is not the only m odifi cation of his tones and other proteins in gene- regul ation processes. T he m ethylation of specific lysine and arginine residues also can be important. The elucidation of the roles of these processes is a very active area of research at present. 912
31.4
913
Gene Expression Can Be Controlled at Posttranscriptional Levels
31.4 Posttranscriptional Gene Regulation
The modulation of the rate of transcriptional initiation is the most common mechanism of gene regul ation. However, other stages of transcription also are targets for regulation in some cases. In addition, the process of translation provides other points of intervention for regulating the level of a protein produced in a cell. These mechanisms are quite distinct in prokaryotic and eukaryotic cells because prokaryotes and eukaryotes differ greatly in how transcription and translation are coupled and in how translation is initiated. We will consider two important examples of posttranscriptional regulation: one from prokaryotes and the other from eukaryotes. In both examples, regulation depends on the formation of distinct secondary struc tures in mRNA. •
Attenuation Is a Prokaryotic Mechanism for Regulating Transcription Through the Modulation of Nascent RNA Secondary Structure A new means for regulating transcription in bacteria was discovered by Charles Yanofsky and his colleagues as a result of their studies of the tryp tophan operon. This operon encodes five enzymes that convert chorismate into tryptophan (p . 694). Analysis of the 5' end of trp mRNA revealed the presence of a leader sequence of 162 nucleotides before the initiation codon of the first enzyme. The next striking observation was that bacteria produced a transcript consisting of only the first 130 nucleotides when the tryptophan level was high, but they produced a 7000 -nucleotide trp mRNA, including the entire leader sequence, when tryptophan was scarce. Thus, when trytophan is plentiful and the biosynthetic enzymes are not needed , transcription is abruptly broken off before any coding mRNA for the enzymes is produced. The site of termination is call ed the attenuator, and this mode of regulation is called attenuation. Attenuation depends on features at the 5' end of the mRNA product (Figure 31.33). The first part of the leader sequence encodes a 14-amino-acid leader peptide. Foll owing the open reading frame for the peptide is a region of RN A representing the attenuator, which is capable of forming several al ternative structures . Recall that transcription and translation are tightly coupled in bacteria. Thus, the translation of the trp mRNA begins soon after the ribosom e-binding site has been synthesized. How does the level of tryptophan alter transcription of the trp operon? An important clue was the finding that the 14-amino-acid leader peptide includes two adjacent tryptophan residues. A ribosome is able to translate the leader region of the mRNA product only in the presence of adequate concentrations of tryptophan. When enough tryptophan is present, a stem-loop structure
(A)
Figure 31.33 Leader region of trp mRNA . (A) The nucleotide sequence of the 5' end of trp mRNA includes a short open reading frame that encodes a peptide comprisi ng 14 amino acids; the leader encodes two t ryptophan residues and has an untranslated attenuator region (blue and red nucleotid es). (8 and C) The attenuator regi on can adopt t wo distinct stem-loop structures.
Attenuator M et - Lys - Ala - lie - Phe - Val- Leu - Lys - Gly - Trp - Trp - Arg - Thr - Ser - Stop , ' , 5'- ... AUG AAA GCA AUU UUC GUA CUG AAA GGU UGG UGG CGC ACU UCC UGA(N)4,CAGCCCGCCUAAUGAGCGGGCU UUU UUUUGAACAAAAU. .. 3 '
(S) AAU
U G A CC G G'C CG C' G C'G G·C -CA ' UUUU UUUUGAACAAAAU-
(C)
AA G' C U'A U'A U'A U·A -CAGCCCGCCUAAUGAGCGGGCU UUU U-
(B)
(A)
ww c •••••••• : I r:
••
Ribosome
Terminates transcription
Alternative structure No termination
trp mRNA RNA polymerase
forms in the attenuator region, which leads to the release of RNA polymerase from the DNA (Figure 31.34). However, when tryptophan is scarce, transcription is terminated less frequently. Little tryptophanyl-tRNA is present, and so the ribosome stalls at the tandem UGG codons encoding trypto· phan. This delay leaves the adjacent region of the mRNA exposed as transcription continues. An alternative RNA structure that does not fun ction as a terminator is formed , and transcription continues into and through the coding regions for the enzymes. Thus, attenuation provides an elegant means of sensing the supply of tryptophan required for protein synthesis. Several other operons for the biosynthesis of amino acids in E. coli also are regulated by attenuator sites. The leader peptide of each contains an abundance of the amino acid residues of the type synthesized by the operon (Figure 31.35). For example, the leader peptide for the phenylalanine operon includes 7 phenylalanine residues among 15 residues . The threonine operon encodes enzymes required for the synthesis of both threonine and isoleucine; the leader peptide contains 8 threonine and 4 isoleucine residues in a 16-residue sequence. The leader peptide for the histidine operon in· cludes 7 histidine residues in a row. In each case, low levels of the corre· sponding charged tRNA causes the ribosome to stall, trapping the nascent mRNA in a state that can form a structure that allows RNA polymerase to read through the attenuator site.
Figure 31 .34 Attenuation. (A) In the presence of adequate concentrations of tryptophan (and, hence, Trp-tRNA), translation proceeds rapidly and an RNA structure forms that terminates transcript ion. (B) At low concentrations o f trypt ophan, translation stalls w hile awaiting Trp-tRN A, giving t ime for an alternati ve RNA structure to form that does not terminate transcripti on efficiently.
Figure 31.35 Leader peptide sequences. Amino acid sequences and the co rresponding mRNA nucleotide sequences of the (A) threo nine operon, (B) phenylalan ine o peron, and (C) histid ine operon. In each case. an abundance of one amino acid in the leader peptide sequence leads t o attenuation.
Met - Lys - Arg - lie - Ser - Thr - Thr - lie - Thr - Thr - Thr - lie - Thr - lie - Thr - Thr .
(A) 5'
AUG AM CGC AUU AGC ACC ACC AUU ACC ACC ACC AUC ACC AUU ACC ACA
3'
Met - Lys - His - lie - Pro - Phe - Phe - Phe - Ala - Phe - Phe - Phe - Thr - Phe - Pro - Stop
(B) 5'
AUG AM CAC AUA CCG UUU UUC UUC GCA UUC UUU UUU ACC UUC CCC UGA
3'
Met - Thr - Arg - Val. - Gin - Phe - Lys - His - His - His - His - His - His - His - Pro - Asp -
(C) 5'
AUG ACA CGC GUU CM UUU AM CAC CAC CAU CAU CAC CAU CAU CCU GAC
3'
Genes Associated with Iron Metabolism Are Translationally Regulated in Animals RNA secondary structure plays a role in the regulation of iron metabolism in eukaryotes. Iron is an essential nutrient, required for the synthesis of hemoglobin, cytochromes, and many other proteins. However, excess iron can be quite harmful because, untamed by a suitable protein environment, iron can initiate a range of free -radical reactions that damage proteins, lipids, and nucleic acids. Animals have evolved sophisticated systems for the accumula· tion of iron in times of scarcity and for the safe storage of excess iron for later use. Key proteins include transferrin , a transport protein that carries iron \n the serum, transferrin receptor, a membrane protein that binds iron-loaded transferrin and initiates its entry into cells, and f erritin, an impressively 914
efficient iron-storage protein found primarily in the liver and kidneys. Twenty-four ferritin polypeptides form a nearly spherical shell that encloses as many as 2400 iron atoms, a ratio of one iron atom per amino acid (Figure 31.36). Ferritin and transferrin-receptor expression levels are reciprocally related in their responses to changes in iron levels. When iron is scarce, the amount of transferrin receptor increases and little or no new ferritin is synthesized. Interestingly, the extent of mRNA synthesis for these proteins does not change correspondingly. Instead, regulation takes place at the level of translation. Consider ferritin first . Ferritin mRNA includes a stem-loop structure termed an iron-response element (IRE) in its 5' un translated region (Figure 31.37). This stem-loop binds a 90-kd protein, called an IREbinding protein (IRP), that blocks the initiation of translation. When the iron level increases, the IRP binds iron as a 4Fe-4S cluster. The IRP bound to iron cannot bind RNA, because the binding sites' for iron and RNA substantially overlap. Thus, in the presence of iron, ferritin mRNA is released from the IRP and translated to produce ferritin, which sequesters the excess iron . An examination of the nucleotide sequence of transferrin-receptor mRNA reveals the presence of several IRE-like regions . However, these regions are located in the 3' untranslated region rather than in the 5' untranslated region (Figure 31.38). Under low -iron conditions, IRP binds to these IREs. However, given the location of these binding sites, the transferrin-receptor mRNA can still be translated. What happens when the iron level increases and the IRP no longer binds transferrin -receptor mRNA? Freed from the IRP, transferrin -receptor mRNA is rapidly degraded. Thus, an increase in the cellular iron level leads to the de struction of transferrin-receptor mRNA and, hence, a reduction in the production of transferrin-receptor protein .
(A)
Iron
oxide-hydroxide core
(8) ~ Figure 31.36 Structure of ferritin.
G
(A) Twenty-four ferritin po lypept ides form a nearl y spheri cal shell. (B) A cutaway view reveal s th e core that stores iron as an iron OXide- hydrox ide complex. [Draw n from lIES.pdb.]
A· U C' G A .U C
A . U Iron-response C.G element
U· G U· A C·C
G' C C'G UG.C
A· U G' C G' C
5'- - -
' ' --
Coding region
- -_ _ _ _ _ __
_ _ -3'
Figure 31.37 Iron-response element. Ferritin mRNA includes a stem-loop stru cture, t ermed an iron-response element (IRE), in its 5' untranslated region. The IRE binds a specific protein that blocks the translation of this mRNA under low iron conditions.
Iron-response elements
Coding region - - -3'
Figure 31.38 Transferrin-receptor mRNA. This mRNA has a set of iron-respon se elements (IREs) in its 3' untranslated region. The bind ing of th e IRE-bindi ng protein t o these elements stabi lizes the mRNA but does not interfere w ith translation.
915
916 CHAPTER 31 Expression
(A)
(B)
The Control of Gene
4Fe-4S cluster -
High-iron conditions
~ Figure 3139 The IRE-BP is an
aconitase. (A) Aconitase cont ains an unstable 4Fe-4S cluster at it s center. (B) Under cond it ions of low iro n, the 4Fe-4S cl ust er d issociates and appro priate RNA molecules can bind in it s place. [Drawn fro m 1C96.pdb.)
Low-iron conditions
T he purif ication of the IRP and the clon in g of its cDNA were source~ of truly remarkable insight into evolution . T he IRP was found to b, approximately 30% identical in amino acid sequence with the citric acid cycle enzyme aconitase from mi toch ondria. F urther an alysis revealed that the IRP is, in fact , an active aconitase enzym e; it is a cytoplasmic aconitase t hat h ad been known for a long tim e, bu t its function was n ot well understood (Figure 31.39). T he iron- sulfur center at the active site of the IRP is rath er unstable, and loss of the iron tri ggers significant changes in protein conform ation. Thus, this protein can serve as an iron- sensing factor. O th er m RNAs, including those taking part in heme syn thesis, have been found to contain I REs. Thus, genes en coding proteins requ ired for iron m etabolism acquired sequences that, when transcribed , p rovided binding sites for the iron- sensing p rotein. An environmental signal the concentration of iron controls the translation of proteins requi red for the m etabolism of this m etal. Thus, mutations in the untranslated region of mRNAs have been selected for beneficial regulation by iron levels.
Summary 31.1
Many DNA-Binding Proteins Recognize Specific DNA Sequences T he regulation of gene expression d epends on the interplay between specific sequences within the genom e and proteins th at bind specifically to these sites. Specific DNA- binding proteins recognize regul atory sites that usually lie adj acent to the genes whose transcription is regul ated by these proteins. M any families of such DNA-binding proteins have been iden tified . In prokaryotes, the proteins of the largest family contain a helix -turn -helix m otif. T he first helix of this motif inserts into the major groove of DNA and makes specific hydrogen -bonding and other contacts with the ed ges of the base pairs. In eukaryotes, important classes of DNA-binding proteins include t he homeodom ains, the basic-leucine zipper (bZip) proteins, and Cys2H is2 zinc-fin ger proteins. Each of these classes of p roteins uses an ex helix to make specific contacts with DNA. Although th e use of ex helices in DNA recognition is m ost common, some p roteins use other structural elements.
31.2 Prokaryotic DNA-Binding Proteins Bind Specifically to Regulatory Sites in Operons In prokaryotes, many genes are cl ustered into operons, wh ich are units of coordinated genetic expression . An operon consists of control sites (an operator and a promoter) and a set of structural genes. In addition,
regulator genes encode proteins that interact with the operator and promoter sites to stimulate or inhibit transcription. The treatment of E. coli with lactose induces an increase in the production of [3-galactosidase and two additional proteins that are encoded in the lactose operon. In the absence oflactose or a similar galactoside ind ucer, the lac repressor protein binds to an operator site on the DNA and blocks transcription. The binding of allolactose, a derivative oflactose, to the lac repressor induces a conformational change that leads to dissociation from DNA. RNA polymerase can then move through the operator to transcribe the lac operon. Some proteins activate transcription by directly contacting RNA polymerase. For example, cyclic AMP, a hunger signal, stimulates the transcription of many catabolic operons by binding to the catabolite activator protein. The binding of the cAMP- CAP complex to a specific site in the promoter region of an inducible catabolic operon enhances the binding of RNA polymerase and the initiation of transcription. 31.3 The Greater Complexity of Eukaryotic Genomes Requires Elaborate Mechanisms for Gene Regulation
Eukaryotic genomes are larger and more complex than those of prokaryotes. Some regulatory mechanisms used in eukaryotes are similar to those used in prokaryotes. In particular, most eukaryotic genes are not expressed unl ess they are activated by the binding of specific proteins, called transcription factors, to sites on the DNA . These specific DNAbinding proteins interact directly or indirectly with RNA polymerases or their associated proteins. Eukaryotic transcription factors are modular: they consist of separate DNA-binding and activation do mains. Activation domains interact with RNA polymerases or their associated factors or with other protein complexes such as mediator. Enhancers are DNA elements that can modulate gene expression from more than 1000 bp away from the start site of transcription. Enhancers are often specific for certain cell types, depending on which DNAbinding proteins are present. E ukaryoti c DNA is tightly bound to basic protein s called histones; the combination is called chromatin. DNA wraps around an octamer of core histones to form a nucleosome, blocking access to many potential DNA binding sites. Changes in chromatin structure playa major role in regulating gene expression. Steroids such as estrogens bind to eukaryotic transcription factors called nuclear hormone receptors. These proteins are capable of binding DNA whether or not ligands are bound . The binding of ligands induces a conformational change that allows the recruitment of additional proteins called coactivators. Among the most important functions of coactivators is to catalyze the additi on of acetyl groups to lysine residues in the tails of histone proteins. Histone acetylation decreases the affinity of the histones for DNA, making additional genes accessible for transcription. In addition, acetylated histones are targets for proteins containing specific binding units called bromodomains. Bromodomains are components of two classes of large complexes : (1 ) chromatin-remodeling engines and (2 ) factors associated with RNA polymerase II. These complexes open up sites on chromatin and initiate transcription. 31.4 Gene Expression Can Be Controlled at Posttranscriptional Levels
Gene expression can also be regulated at the level of translation. In prokaryotes, many operons important in amino acid biosynthesis are regulated by attenuation, a process that depends on the formation of alternative structures in mRNA, one of which favors the termination
917 Summary
918 CHAPTER 31 The Control of Gene Expression
of transcription. Attenuation is mediated by the translation of a leader region of mRNA. A ribosome stalled by the absence of an aminoacyltR A needed to translate the leader mRNA alters the structure of mRNA, allowing RNA polymerase to transcribe the operon beyond the attenuator site. In eukaryotes, genes encoding proteins that transport and store iron are regulated at the translational level. Iron-response elements, structures that are present in certain mRNAs, are bound by an IRE-binding protein when this protein is not binding iron. Whether the expression of a gene is stimulated or inhibited in response to changes in th e iron status of a cell depends on the location of the I RE within the mRNA.
Key Terms heli x-turn - heli x m otif (p . 89 5)
cell type (p . 901)
anabolic st eroid (p . 9 10)
hom eod omain (p . 895)
combinatorial control (p . 9 0 2)
antagonist (p _9 10)
basic-leucine zipper (bZip) protein (p . 895)
enhancer (p .90 2) mediator (p . 9 03)
selective estrogen modulato r (SERM) (p . 910 )
CyszHis 2 zinc-finger domain (p . 895)
histo ne ( p . 903)
histone acetyl transferase (HAT) (p. 91 1:
J3 -galactosidase (p . 896)
chromatin (p . 9 03 )
acetyllysine -binding domain (p . 911)
operon mo d el (p . 89 7)
nucleosome (p . 903)
bromodomain (p . 9 1 1)
repressor (p . 89 7)
nucl eosome core particle (p . 904)
lac repressor (p . 89 7) lac o pera to r (p . 898 )
hypersensitive site (p. 90S)
TATA - box -binding protein associated factor (TAF) (p . 9 11 )
inducer (p . 898)
chro matin immunoprecipitation (ChIP ) (p . 906)
chromatin -remodeling engine (p. 912) histone d eacetylase (p . 9 12)
isopropyl t hiogalactoside (IPTG ) (p . 898)
hy po m ethylation (p . 9 0 7)
attenuatio n (p . 9 13)
C pG is land (p . 90 7)
transferrin ( p _914 )
pur repressor (p . 899)
nuclear h ormone receptor (p . 908)
transferrin receptor (p . 9 14)
corepressor (p . 900)
estrogen response element (ERE ) (p . 908)
ferritin (p . 9 14)
coactivator (p . 909 )
IRE-binding protein (IRP) (p. 915)
catabolite repressio n (p . 900) catabo lite acti vator protein (CAP) (p . 900)
iron- response element (IRE) (p. 9 15)
agoni st (p. 9 10)
Selected Readings Where to Start Pabo, C . 0 ., and Sauer, R. T 1984. Protein- D N A recognition Annu. Rev. IJiocltem. 53 :293- 32 1. Slruhl. K. 1989 . ~I el ix - lurn - hel i x , zinc-finger, and leucine-zipper moti fs for eukaryoti c transcri ptional regulatory proteins . Irends Biochem. Sci. 14:137- 140. Struhl. K. 1999. Fundamentally different logic of gene regulation in eukaryotes and proka ryotes. Ce ll 98 :1- 4. Korzus, E., Torchia, ]" Rose, D . W ., Xu, L. , Kurokawa, R .. Mclnerney, E. M ., Mullen, T. M ., G lass, C. K., and Rosenfeld, M . G . 1998 . Transcription factor-specific requirements for coactivators and their acetyltransferase fun ct.ions. Science 279: 703- 707 . Aalfs, j. D., and Kingston, R. E. 2000. What does "chromatin remodeling" mean? Trends Biochem. Sci. 25 :54 8- 555.
Wolffe, A . 1992 . Chromatin S tructure and Function. Academic Press. Lodish, H ., Berk , A ., M atsudaira, P., Kai ser, C . A ., Krieger, M.. Scott, M . P., Zipursky, S. L. , and D arnell, ] ., 2004. M olecular Cell Biology (5th ed .). W . H . Freeman and Company.
Books Ptashne, M. 2004 . A Genetic Switch: Phage A Revisited (3d ed .). Cold Spring Harbor Laboralory Press. McKnight, S. L., and Yamamoto, K. R. (Eds.). 1992. Transcriptional Regulation (vols. 1 and 2). Cold Spring Harbor Laboratory Press. Larchman , D. S. 2004 . Eukaryotic Tmnscription Factors (4th cd .). Academic Press.
DNA and inducer. Science 271 :1247- 1254. N iu , W ., Kim , Y. , Tau , G ., Heyduk, T, and Ebri ght, R. H. 1996.
Prokaryotic Gene Regulation Balaerr. A ., Mahadevan, L. and Schul ten, K. 2004. Structural basis for cooperalive D NA binding by CAP and lac repressor. Structure 12: 123- 132 . nell , C . E., and Lewis, M. 200 1. The Lac repressor: A second generation of structural and functional studies. Curro Opin. Struct. BioI. 11 :19- 25. Lewis, M .. Chang , G .. Horton, N . c., Kercher. M . A., Pace. H. C.. Schumacher. M . A., Brennan, R. G ., and Lu , P. 1996. Crystal stru cture of th e lactose operon re pressor and its complexes with
Transcription acti vation at class TT C AP -dependent promoters:
Two interactions hetween C AP and RNA polymerase. Cell 87:1 123- 1134. Schultz, S. c., Shields, G . C ., and Steitz, T A . 1991. Crystal struclure of a CAP-D NA complex: The DNA is benl by 90 degrees. Science 253:1001- 1007.
Selected Readings 919 Parkinson, G., Wil son, c., Gunasekera, A ., Ebright, Y. W ., Ebright, R. E., and Berman, H . M . 1996.Structureofthe C AP-DNA complex at 2. 5 A resolution : A complete picture of the protein- 0 NA interface. j. Mol. Bioi. 260 :39 5- 408. Busby,S., and Ebright, R. H . 1999. Transcription activation by catabolite activator protein (CAP ). j. Mol. Bioi. 293: 199- 213. Somers, W. 5., and Phillips, S. E. 1992. C rystal structure of the met repressor-operator complex at 2.8 A resolution reveals DNA recognition by [3 -strands. Nature 359:387- 393 .
Eukaryotic Gene Regulation Green, M . R. 2005. Eukaryotic transcription activation: Right on target . Mol. Cell 18:399- 402. Kornberg, R. D . 2005. Mediator and the mechanism of transcriptional activation. Trends Biochem. Sci. 30:235- 239. Luger, K., Mader, A . W .. Richmond . R. K., Sargent, D . F , and Richmond. 1'. j . 1997. C rystal structure of the nucleosome core particle at 2.8 Aresolution . Nature 389:25 1- 260. Arents, G ., and Moudrianakis, E. N . 1995 . The histone fold : A ubiqui tous architectural motif utilized in DNA compaction and protein dimerization . Proc. Natl. Acad. Sci. U. S. A. 92: 111 70- 111 74. Baxevanis, A . D ., Arents, G., Moudrianakis, E . N. , and Landsman, D . 1995. A variety of DNA-binding and multimeric proteins contain the histone fold motif. Nucleic Acids Res. 23:2 685- 269 1. Clements, A., Rojas, j . R., Trievel, R. C., Wang, L., Berger, S. L. , and Marmorstein, R. 1999. C rystal structure of the histone acetyltransferase domain of the human PCAF transcriptional regulator bound to coenzyme A . EMBO J. 18:3 521 - 3532. Deckert. J ., and Struhl, K. 200 1. Histone acetylation at promoters is differentially affected by specific activators and repressors. Mol. Cell. BioI. 21:272 6 2735. Dutnall . R . N ., Tafrov. S. 1'., Sternglanz . R. . and Ramakrishnan . V. 1998. Structure of the histone acetyltransferase Hatl : A paradigm for the G CN5- related N-acetyltransfera se superfamily. Cell 9 4 : 4 27-4 ~R .
Finnin, M . S., Oonigian , j. R., Cohen, A ., Richon, V. M ., Rifkind, R . A., Marks, P. A., Breslow, R. , and Pavletich, N . P. 1999 . Stru ctures of a histone deacetylase homologue bound to the T SA and SA H A inhibitors. Nature 40 1:188- 193. Finnin. M . S., D onigian, j. R., and Pavletich. N. P. 200 1. Structure of the histone deacetylase SI R2 . Na t. Struct. Bioi. 8:621 - 625. Jacobson, R. H ., Ladurner, A . G ., King. D . S .. and 1Jian, R. 2000. Structure and function of a human TAFII250 double bromodomain module. Science 288: 1422 1425. Rojas, J . R .. Trievel. R . C. Zhou. J., Mo, Y. Li, X., Berger. S. L., Allis, C. D ., and Marmorstein . R . 1999 . Stru cture of Tetrahymena GCN 5 bound to coenzyme A and a histone H 3 peptide. Nature 40 1:93- 98.
Nuclear Hormone Receptors Downes. M ., Verdecia. M . A., Roecker, A . J .. Hughes, R ., Hogenesch, J. B., Kast-W oelbern. H . R., Bowman, M . E .. Ferrer, J . L., Anisfeld. A . M .. Edwards. P. A .. Rosenfeld. J . M ., Alvarez, J. G .. Noel, j. P., Nicolaou. K . C , and Evans. R.M . 20U3 . A chemical, genetic, and structural anaJysis of the nuclear bile acid receptor FXR. Mol. Cell 11 :1079- 109 2. Evans, R. M . 2005 . Th e nuclear receptor superfamily: A Rosetta stone for physiology. Mol . Endocrinn/. 1 9: 14 29- 14 ~R. Xu, W ., Cho, H ., Kadam, S., flanayo, E . M ., Anderson, S., Yates, J . R. , ~d, Emerson, B. M ., and Evans, R. M . 2004. A methylation-mediator complex in hormone signaling. Genes Dev. 18:144- 15 6. Evans, R. M . 1988. The steroid and thyroid hormone receptor super fami ly. Science 240 :889- 895. Yamamoto. K . R. 1985. Steroid receptor regulated transcription of spe cific genes and ge ne networks. Amlll . Rev. Genet. 19:2U9- 252. Tanenbaum, D . M .. W ang. Y., Williams. S. p .. and Sigler. P. B. 1998. S rystallographic comparison of the estrogen and progesterone
receptor 's ligand binding domains. Proc. Nat/. Acad. Sci. U. S . A. 95: 5998- 6003. Schwabe. j. W ., Chapman, L.. Finch, ). 1'., and Rhodes, D. 1993. The crystal structure of the estrogen receptor DNA -binding domain bound to DNA : How receptors discriminate between their response elements . Cell 75:567- 578. Shiau. A . K., Barstad, D ., Loria. P. l-.iJ.. C heng, L., Kushner, P. J ., Agard, D . A .. and Greene, G. L. 1998 . The structural basis of estrogen receptor/ coactivator recognition and the antagonism of this interaction by tamoxifen . Ce ll 95:927- 937 . Collingwood. 1'. N ., Urnov. F. D., and Wolffe, A . P. 1999 . Nuclear receptors: Coactivators, corepressors and chromatin remodeling in the control of transcription . }. Mnl. Endncrino/. 2 ~ :2 55-2Ti .
Chromatin and Chromatin Remodeling Elgin , S. C . 1981. D NAase I-hypersensitive sites of chromatin . Cell 27:4B-41S. Weintraub, H ., Larsen , A ., a.nd Groudine, M . 19R1. a-G lobin -gene switching durin g the development of chicken embryos: Expression and chromosome structure. Ce1l 24:~~~-~44 . Ren, B., Robert, F., W yri ck, j . j., Aparicio, 0., Jennings, E. G ., 5imon, I., Zeitlinger, J ., Schreiber, J., Hannett, N ., Kanin, E., Volkert, T. L., Wilson , C. j., Bell , S. P., and Young. R. A . 2000. Genome-wiJe location and function of DNA -binding proteins. Science 290:2306- 2309 . Goodrich, J. A., and 1 J ian. R. 1994 . TBP -TAF complexes: ~e1ecti vi ty factors for eukaryotic transcription . Curro Opin. Ce ll. Bioi. 6:403 409 . Bird . A . P.. and Wolffe. A . P. 1999. Methylation -induced repression : Belts, braces, and chromatin . Cell 99 :451- 454 . Cairns, fl. R . 199R. Chromatin remodeling machines: Similar motors, ulteri or motives. Trends flin chem. Sci. 23:20- 25. Albright, S. R., and Tjian , R. 2000. TAFs revisited : More data reveal new twists and confirm old ideas. Gene 242: 1- 13. Urnov, F D., and Wolffe, A . P. 2001 . C hromatin remodeling anJ tran scriptional activation : The cast (in order of appearance). Oncogene 20:2991 - 3006. Posttranscriptional Regulation Kolter, R., and Yanofsky, C. 1982. Attenuation in amino acid biosyn · thetic operons. Annu. Rev. Genet. 16: 113- 134. Yanofsky, C. 1981. Attenuation in the control of expression of bacteri al operons. Nature 289:7 51 - 758. Rouault, T. A., Stout, C . D ., Kaptain, S .. Harford, J. 13., and Klausner, R. D . 199 1. Structural relationship between an iron -regulated RNA -binding protein (lRE-BP) and aconitase: Functional impli· cations. Ce ll 64 :881 - 883. Kl ausner. R. 0 .. Rouault, 1'. A ., and Harford , ). B. 1993. Regulati ng the fate of mR NA: The control of cellular iron metaboli sm. Cell 72: 19- 2R. Gruer, M . J., Artymiuk , P. J ., and Guest, J. R. 1997. The aconitase family : Three structural variations on a common theme. Trends Bi()chem. Sci. 22:3- 6. Theil, E. C. 1994. Iron regulatory elements (IREs): A family of mRNA non-coding sequences. Biuchem. }. 304:1 - 11 .
Historical Aspects Lewis, M . 2005 . The lac repressor. C. R. Bioi. 328:52 1-548. Jacob. F., and M onad, j. 1961 . Genetic regulatory mechanisms in the synthesis of proteins. }. Mol . fliol. ~:] 1R-~56 . Ptashne, M ., and Gilbert, W . 1970. Geneti c repressors. Sci. Am. 222(6) :36- 44 . Lwoff, A., and Ullmann, A. (Eds .). 1979. Origins oj Molecular Biology : A Tribute to Jacques Monod. Academic Press. Judson , H . 1996 . The Eighth Day oj Creation : Makers oj the Revolution in Biology. Cold Spring Harbor Laboratory Press.
,
920
CHAPTER 31 The Control of Gene Expression
Problems 1. M issing genes. Predi ct th e effects of del etin g the following regions of D N A : (a) T he gene encoding lac repressor (b) T he lac operator (c) T he gene encoding CAP 2. Minimal concentration. C alculate the concentration of lac repressor, assumin g lhal one molecule is present per cell. A ssume th at each E. coli cell has a volume of 10- 12 cm ] Would you expect the single molecule to be free or bound to D N A '
3. Counting sites. Calcul ate the expected number of times that a given 8-base- pair DNA site should be present in the E. co li genome. A ssume that all four bases are equall y probable. Repeat for a IO- base- pair site and a 12- base- pair site. 4. Charge neutralization. G iven the histone amino acid sequences illustrated below, estimate the charge of a histone oclamer at pH 7. A ssume that histidine residues are uncharged at this pH. How does thi s charge compare with the charge on 150 base pairs o f D NA?
7. A new domain, A protein d omain that recognizes S- methyl · cytosine in the context of double-stranded DNA has been characterized . What role might proteins containing such a do· main play in regulating gene expression ? Where on a double· stranded DNA molecule would you expect such a domain to bind ? 8. Th e same but not the same. The lac repressor and the pur repressor are homologous proteins with very similar three-dimensional structures, yet they have different effects on gene expression. Describe two important ways in whi ch the gene-regulatory properties of these proteins differ.
9. The opposite direction. Some compo unds called anti-inducers bind to repressors such as the lac repressor and inhibit the action of inducers; that is. transcription is repressed and higher concentrations of inducer are required to induce transcription. Propose a mechanism of action for anti-inducers. 10 . Inverted repeats. Suppose that a nearly perfect inverted repeat
is observed in a D N A sequ ence over 20 base pairs. Provide two possible explanations.
Histone H2A MSGRGKQGGKARAKAKTRSSRAGlQFPVGRVHRllRKGNYSERVGAGAPVYlAAVlEYlTAEILELAGNA
Mechanism Problem
ARONKKTRl lPRHl QLAIRNDEElNKllGRVTIAQGGVlPNIQAVllPKKTESHHKAKGK
11 . A cetyltransf erases. Propose a mechanism for the transfer of an acetyl group from acetyl CoA to the amino group of lysine.
Histone H1B MPEPAKSAPAPKKGSKKAVTKAQKKDGKKRKRSRKESYSVYVYKVlKQVHPDTGISSKAMGIMNSFVNOI
FERIAGEASRLAHYNKRSTITSREIQTAVRl LlPGELAKHAV5EGTKAVTKYT55K
Data Interpretation Problem
Histone H3
12. Limited res triction. Th e restriction enzyme Hpall is a
MARTKQTARKSTGGKAPRKQLATKAARKSAPSTGGVKKPHRYRPGTVALREIRRYQKSTELlIRKLPFQR
powerful tool for analyzing D N A methylation . This enzyme cleaves sites of the form 5' -CCGG -3 ' b u t will not cleave such sites if th e DNA is m ethylated on any of the cytosine residues. Genomic DNA from different organi sm s is treated with HpaII and the results are analyzed b y gel electrophoresis (see the adjoining patterns) . Provide an explanation for the observed pattern s.
LVREIAQOFKTDlRFQSAAIGALQEASEAYlVGlFEDTNlCAIHAKRVTIMPKDIQLARRIRGERA
Histone H4 MSGRGKGGKGlGKGGAKRHRKVLRDN IQCITKPAIRRLARRGGVKRISGUYEETRGVLKVFlENV1RDA
VMEHAKRKMAMDVVYAl KRQGRTlYGFGG
5. Chromatin immunoprecipitation. You have used the technique of chromatin immunoprecipitation to isolate DNA fragments containing a D N A -bind ing protein of in terest. Suppose that you wish to know whether a particular known DNA fragment is present in the isolated mixture. How might you detect its presence? How many different fragments would you expect if you used antibodies to the lac repressor to perform a chromatin immunoprecipitation experiment in E. coli ? If you used antibodies to the pur repressor?
Mouse
> 50 kb
6. Nitrogen substitution. Growth of mammalian cells in the presence of 5-azacytidine results in the activation of some normally inactive genes. Propose an explanation . NH2
100 bp
N
N
deoxyribose 5-Azacytidine
H
Drosophila
E. coli
Chapter
Sensory Systems
Color perception requires specific photo receptors. The p hotorecept or rh o dops in (right), which absorbs light in the process of vision, cons ists of the protein opsin and a bound vitamin A derivative, retinal. The amino acids (shown in red) that su rround the retinal determine the color of light that is most efficiently absorbed. Individual lacking a lightabsorb ing photoreceptor for the co lor green will see a colorful fruit stand (left ) as mostly yellows (m iddle). [(Left and middle) From L. T. Sharpe, A. St ockman, H. )agle, and ). Nathans, Opsin genes, cone photopigments, color vision, and color bl indness. In Color Vision: from Genes to Perception, K. Gegenfurtner and L. T. Sharpe, Eds. (Cambrid ge University Press, 1999), pp. 3-51]
ur senses provide us with means for detecting a diverse set of external signals, often with incredible sensitivity and specificity. For example, when fully adapted to a darkened room, our eyes allow us to sense very low levels of light, down to a limit of less than 10 photons. With more light, we are able to distinguish millions of colors. Through our senses of smell and taste, we are able to detect thousands of chemicals in our environment and sort them into categories: pleasant or unpleasant? healthful or toxic? Finally, we can perceive mechanical stimuli in the air and around us through our senses of hearin g and touch. How do our sensory systems work? How are the initial stimuli detected? How are these initial biochemical events transformed into perceptions and experiences? W e have already encountered systems that sense and respond to chemical signals namely, receptors that bind to growth factors and hormones . Our knowledge of these receptors and their associated signaltransduction pathways provides us with concepts and tools for unraveling some of the workings of sensory system s. For example, 7TM receptors (seven-transmembrane receptors, Section 14 .1) play key roles in olfaction, taste, and vision. Ion channels that are sensitive to mechanical stress are essential for hearin g and touch.
Outline 32.1 A Wide Variety of Organic Compounds Are Detected by Olfaction 32.2 Taste Is a Combination of Senses That Function by Different Mechanisms 32.3 Photoreceptor Molecules in the Eye Detect Visible Light 32.4 Hearing Depends on the Speedy Detection of Mechanical Stimuli 32.5 Touch Includes the Sensing of Pressure, Temperature, and Other Factors
92 1
In this chapter, we focus on the five major sensory systems found in human beings and other mammals : olfaction (the sense of smell i.e., the detection of small molecules in the air), taste, or gustation (the detection of selected organic compound s and ions by the tongue), vision (the detection of light), hearing (the detection of sound, or pressure waves in the air), and touch (the detection of changes in pressure, temperature, and other factors by the skin). Each of these primary sensory systems contains specialized sensory neurons that transmit nerve impulses to the central nervous system (Figure 32.1). In the central nervous system, these signals are processed and combined with other information to yield a perception that may trigger a change in behavior. By these means, our senses al low us to detect changes in our environments and to adjust our behavior appropriately.
J
(
Vision
, Taste
32.1 A Wide Variety of Organic Compounds Are Detected by Olfaction Touch
Human beings can detect and distinguish thou sands of different compounds by smell , often w ith considerable sensitivity and specificity. Most odorants are small organic Figure 32.1 Sensory connections to the brain. Sensory nerves compounds with sufficient volatility that they can be carconnec t sensory o rgan s t o t he brain and spinal cord. ried as vapors into the nose. For example, a major component responsible for the smell of almonds is the simple aromatic compound benzaldehyde, whereas the sulfhydryl compound 3methylbutane-1-thiol is a major component of the smell of skunks.
o OH
Benzaldehyde (Almond)
o
H \'"
r---- CH,
H2 C
922
o
.
H,C~
H
CH 2
R-Carvone
S-Carvone
(Spearmint)
(Caraway)
3-Methylbutane-l-thiol (Skunk)
Geraniol
(Rose)
Zingiberene (Cinger)
What properties of these molecules are responsible for their smells' First, the shape of the molecule rather than its other physical properties is crucial. We can most clearly see the importance of shape by comparing molecules such as those responsible for the smells of spearmint and caraway. These compound s are identical in essentially all physical properties such as hydrophobicity because they are exact mirror images of one another. Thus, the smell produced by an odorant depends not on a physical property but on the compound's interaction with a specific binding surface, most likely a protein receptor. Second, some human beings (and other animals) suffer from specific anosmias; that is, they are incapable of smelling specific compounds even though their olfactory systems are otherwise normal. Such anosmias are often inherited . These observations suggest that mutations in individual receptor genes lead to the loss of the ability to detect a small subset of compounds.
To olfactory
bulb
923 32.1 Olfaction
Olfactory bulb Main olfactory epithelium Nasal cavity ---t Volatile - - - - -odorant compound
Sensory --+-'--+ neuron Cilia Mucous lining -t=-__________~
Figure 32.2 The main nasal epithelium . Th is reg ion of the nose. which lies at the top of the nasal cavi t y, contain s approximately 1 million sensory neurons. N erve impulses generated by odorant molecules binding to receptors on the cilia travel from the sensory neurons to th e olfactory bulb.
olfaction Is Mediated by an Enormous Family of Seven-Transmembrane-Helix Receptors
Odorants are detected in a specific region of the nose, called the main olfactory epithelium, that lies at the top of the nasal cavity (Figure 32.2). Approximately 1 million sensory neurons line the surface of this region. Cilia containing the odorant- binding protein receptors project from these neurons into the mucous lining of the nasal cavity. Biochemical studies in the late 1980s examined isolated cilia from rat olfactory epithelium that had been treated with odorants. Exposure to the odorants increased the cellular level of cyclic AMP, and this increase was observed only in the presence of GTP. On the basis of what was known about signal-transduction systems, the participation of cAMP and GTP strongly suggested the involvement of a G protein and, hence, TTM receptors. Indeed, Randall Reed purified and cloned a G-protein ex subunit, termed G(nl[J' which is uniquely expressed in olfactory cilia. The involvement of 7TM receptors suggested a strategy for identifying the olfactory receptors themselves. Complementary DNAs were sought that (1 ) were expressed primarily in the sensory neurons lining the nasal epithelium, (2) encoded members of the 7TM-receptor family, and (3) were present as a large and diverse fam ily to account for the range of odorants . Through the use of these criteria, cDNAs for odorant receptors from rats were identified in 1991 by Richard Axel and Linda Buck.
Y
The odorant receptor (hereafter, OR) family is even larger than expected: more than 1000 OR genes are present in the mouse and the rat, whereas the human genome encodes approximately 350 ORs. In addition, the human genome includes approximately 500 OR pseudogenes con taining mutations that prevent the generation of a fulllength , proper odorant receptor. The OR family is thus one of the largest gene families in human beings. Further analysis of primate OR genes reveals that the fraction of pseudo genes is greater in species more closely related to human beings (Figure 32.3). T hus, we may have a glimpse at the evolutionary loss of acuity in the sense of smell as higher mammals presumably became less dependent on
Figure 32.3 Evolution of odorant receptors. Odorant receptors appear to have lost function t hrough conversion into pseudogenes in the course of pr imate evolution. The percentage of OR genes that appea r to be functional for each species is shown in parentheses.
this sense for survival. For rodents that are highly dependent on their sense of smell, essentially all OR genes encode N functional proteins. The OR proteins are typically 20% identical in sequence with the f3-adrenergic receptor (Section 14.1) and from 30% to 60% identical with one another. Several specific sequence features are present in most or all OR family members (Figure 32.4). The central region, particularly transmembrane helices 4 and 5, is highly variable, suggesting that this region is the site of odorant binding. That site must be different in odorant receptors that bind distinct odorant molecules. What is the relation between OR gene expression and C the individual neuron? Interestingly, each olfactory neuron expresses only a single OR gene, among hundreds available. Figure 32.4 Conserved and variant regions in odorant receptors. Apparently, the precise OR gene expressed is determined Odorant receptors are members of t he 7TM -receptor fa mily. The green cyli nders represent th e seven presumed t ransmembrane largely at random_ After one OR gene is expressed and a helices. Stro ngly conse rve d residues charact erist ic o f th is protein functional OR protein is produced, t he expression of all fam ily are shown in blue, whereas highly va ria ble re sid ues are other OR genes is suppressed by a feedback mechanism shown in red. that remains to be fully elucidated. The binding of an odorant to an OR on the neuronal surface initiates a signal-transd uction cascade that results in an action potential (Figure 32.5). The ligand-bound OR activates G (elf ), the specific G protein mentioned earl ier. G (elf) is initially in its GDP-bound form. When activated, it releases GDP, binds GTP, and releases its associated f3'Y subunits. T he Ct subunit then activates a specifi c adenylate cyclase, increasi ng t he intracellu lar concentration of cAMP. The rise in the intracellular concentration of cAMP activates a nonspecific cation channel that allows calcium and other cations into the cell. The flow of cations through the channel depolarizes the neuronal membrane and initiates an action potential. This action potential, combined with those from other olfactory neurons, leads to the perception of a specific odor. odorants Are Decoded by a Combinatorial Mechanism
An obvious challenge presented to the investigator by the large size of the OR family is to match each OR with the one or m ore odorant molecules to which it binds _ Exciting progress has been made in this regard. rnitiall y, an OR was matched with odorants by overexpressing a single, specific OR gene in rats. This OR responded to straight -chain aldehydes, most favorably to n-octanal and less strongly to n-heptanal and n-hexanal. Moredramatic progress was made by taking advantage of our knowledge of the OR signal-transduction pathway and the power ofPCR (p _140). A section
Odorant
0 ...
Adenylate cyclase
Receptor Figure 32.5 The olfactory signal transduction cascade. The binding o f odorant to the ol factory recept or acti vates a Signaling pathway sim ilar to those init iated in response to th e bind ing of some hormones to th eir receptors. The f inal result is the o pen ing of cAMP-gated ion cha nnels and the init iati o n of an action pot ential.
924
I "\;) GTP GDP
ATP
Na ' Ca 2 +
cAMP-gated ion channel
o
925 32.1 Olfaction OH
carboxylic acids (i ~ 2- 7)
Alcohols (i ~ 4- 8)
o Br •
J
OH
Bromocarboxylic acids (i ~ 3-7)
HO
OH
Dicarboxylic acids (i ~ 4-7)
Figure 32.6 Four series of odorants tested for olfactory-receptor activation. Receptor
of nasal epithelium from a mouse was loaded with the calI 234 5 6 789 III 4 cium-sensitive dye Fura-2 (p . 389). The tissue was then treated with different odorants, one at a time, at a specific concentration. If the odorant had bound to an OR and activated it, that neuron could be detected und er a microscope by the change in fluorescence caused by the influx of calcium that occurs as part of the signal -transduction process. To determ ine which OR was responsible for the response, cDNA was generated from mRNA that had been isolated from single identified neurons. T he cDNA c was then subjected to PCR with the use of primers that are '" o effective in amplifying most or all OR genes . The se'"o quence of the PCR product from each neuron was then determined and analyzed. Using this approach, investigators analyzed the responses of neurons to a series of compounds having varyi.ng chain lengths and terminal functional groups (Figure 32.6) . The results of these experiments appear surprising HOOC-C4 -COOH HOOC- -+-+-+-+-+- - - --t-+----to at first glance (Figure 32.7). importantly, there is not a si mple 1:1 correspondence between odorants and receptors. Almost every odorant activates a number of receptors (usually to different extents) and almost every receptor is Figure 32.7 Patterns of olfactory-receptor activation. Fourteen activated by more than one odorant. Note, however, that different receptors were tested for responsiveness to the each odorant activates a unique combination of receptors. compounds shown in Figure 32.6. A colored box indicates that In principle, this combinatorial mechanism allows even a the receptor at the top responded to the compound at the left. small array of receptors to distinguish a vast number of Darker colors indicate that the receptor was activated at a lower concentration of odorant. odorants. How is the information about wh ich receptors have been activated transm itted to the brain? Recall that each neuron expresses only one OR and that the pattern of expression appears to be largely random. A substantial clue to the connections between receptors and the brain has been provided by the creation of mice that express a gene for an easily detectable colored marker in conjunction with a specific OR gene. Olfactory neurons that express the OR- marker-protein combination were traced to their destination in the brain, a structure called the olfactory bulb (Figure 32 .8). The processes from neurons that express the same OR gene were found to connect to the same location in the olfactory bulb. Moreover, this pattern of neuronal connection was found to be identical in
-
Figure 32.8 Con verging olfactory neurons. This section of the nasa l cavity is stained to reveal processes from sensory neurons expressing the same olfactory receptor. The processes converge to a single location in the olfactory bulb. [From P. Mombaerts, F. Wang, C. Dulac. S. K. Chao. A. Nemes. M . Mendelsohn. J. Edmondson. and R. Axel. Cell
87(1996):675-689.]
all mice examined. Thus, neurons that express specific ORs are linked to spe· cific sites in the brain. This property creates a spatial map of odorant· responsive neuronal activity within the olfactory bulb. Can such a combinatorial mechanism truly distinguish many different odorants? An electronic "nose" that functions by the same principles provides compelling evidence that it can (Figure 32.9). The receptors for the electronic nose are polymers that bind a range of small molecules. Each polymer binds every odorant, but to varying degrees. Importantly, the electrical properties of these polymers change on odorant binding. A set of 32 of these polymer sensors, wired together so that the pattern of responses can be evaluated, is capable of distinguishing individual compounds such as n-pentane and n-hexane as well as complex mixtures such as the odors of fresh and spoiled fruit. Functional Magnetic Resonance Imaging Reveals Regions of the Brain Processing Sensory Information
Figure 32.9 The Cyranose 320. The electronic nose may f ind uses in the food industry. animal husbandry. law enforcement, and medicine. [Courtesy o f Cyrano Sciences.]
Figure 32.10 Brain response to odorants. A functi o nal magneti c resonance image reveal s brain response to odorants. The light spots indicate regio ns of the brain activated by odorants. [Fro m N. Sobel et al..}. Neurophysiol. 83(2000):537- 551 ; courtesy of Dr. Noam SobeL]
Can we extend our understanding of how odorants are perceived to events in the brain? Biochemistry has provided the basis for powerful methods for examining responses within the brain. One method, functional magnetic reso· nance imaging (fMRI), takes advantage of two key observations. The first is that, when a specific part of the brain is active, blood vessels relax to allow more blood flow to the active region. Thus, a more active region of the brain will be richer in oxyhemoglobin. The second observation is that the iron center in hemoglobin undergoes substantial structural changes on binding oxygen (p. 185). These changes are associated with a rearrangement of electrons such that the iron in deoxyhemoglobin acts as a strong magnet, whereas the iron in oxyhemoglobin does not. The difference between the magnetic properties of these two forms of hemoglobin can be used to image brain activity. Nuclear magnetic resonance techniques (p. 98) detect signals that originate primarily from the protons in water molecules but are altered by the magnetic properties of hemoglobin. With the use of appropriate techniques, images can be generated that reveal differences in the relative amounts of deoxy- and oxyhemoglobin and thus the relative activity of various parts of the brain. These noninvasive methods reveal areas of the brain that process sensory information. For example, subjects have been imaged while breathing air that either does or does not contain odorants. When odorants are present, the fMRI technique detects an increase in the level of hemoglobin oxygenation (and, hence, brain activity) in several regions of the brain (Figure 32 .10). Such regions include those in the primary olfactory cortex as well as other regions in which secondary processing of olfactory signals presumably takes place. Further analysis reveals the time course of activation of particular regions and other features. Functional MRI shows tremendous potential for mapping regions and pathways engaged in processing sensory information obtained from all the senses. Thus, a seemingly incidental aspect of the biochemistry of hemoglobin has yielded the basis for observing the brain in action.
32.2
Taste Is a Combination of Senses That Function Different Mechanisms
by
The inability to taste food is a common complaint when nasal congestion reo duces the sense of smell. Thus, smell greatly augments our sense of taste (also known as gustation), and taste is, in many ways, the sister sense to 926
927 -
0'
32,2 Taste
,0
.;/
" -'c
H
H' ~~
HO
OH ..-
HO/ HO
,.'
0
"'\' OH Glucose
(sweel)
+ H] N
OH Na+
Sodium ion (salty)
.H
N
';
0 /..0 C
H3 C/
Ii0
Glutamate (umami)
Quinine
Hydrogen ion
(bitter)
(sour)
Figure 32.11 Examples of tastant molecules, Tastants fall into five groups: sweet, sa lty, umami , bitter, and sour,
olfaction , Nevertheless, the two senses differ from each other in several important ways, First, we are able to sense several classes of compounds by taste that we are unable to detect by smell; salt and sugar have very little odor, yet they are primary stimuli of the gustatory system, Second, whereas we are able to discriminate thousands of odorants, discrimination by taste is much more modest, Five primary tastes are perceived: bitter, sweet, sour, salty, and umami (the taste of glutamate and aspartate from the Japanese word for "deliciousness"), These five tastes serve to classify compounds into potentially nutritive and beneficial (sweet, salty, umami) or potentially harmful or toxic (bitter, sour), Tastants (the molecules sensed by taste) are quite distinct for the different groups (Figure 32 ,1 1), The simplest tastant, the hydrogen ion, is perceived as SOUL Other simple ions, particularly sodium ion, are perceived as salty, The taste called umami is evoked by the amino acids glutamate and aspartate, the former often encountered as the flavor enhancer monosodium glutamate (MSG), In contrast, tastants perceived as sweet and, particularly, bitter are extremely diverse, Many bitter compounds are alkaloids or other plant products of which many are toxic. However, they do not have any common structural elements or other common properties, Carbohydrates such as glucose and sucrose are perceived as sweet, as are other compounds including some simple peptide derivatives, such as aspartame, and even some proteins, These differences in specificity among the five tastes are due to differences in their underlying biochemical mechanisms, The sense of taste is, in fact, a number of independent senses all utilizing the same organ, the tongue, for their expression, Tastants are detected by specialized structures called taste buds, which contain approximately 150 cells, including sensory neurons (Figure 32,12) , Fingerlike projections called microvilli, which are rich in taste receptors, project from one end of each sensory neuron to the surface of the tongue, Nerve fibers at the opposite end of each neuron carry electrical impulses to the brain in response to stimulation by tastants, Structures called taste papil lae contain numerous taste buds,
Sequencing of the Human Genome Led to the Discovery of a Large Family of 7TM Bitter Receptors
Just as in olfaction, a number of clues pointed to the involvement of G proteins and, hence, 7TM receptors in the detection of bitter and sweet tastes, The evidence included the isolation of a specific G -protein ex subunit
Sensory neuron
...- Microvilli
containing receptors
Nerve fiber
Figure 32.12 A taste bud, Each taste bud contains sensory neuro ns that extend microvilli to the surface of the tongue, where they interact with tastants,
(A)
928
(8)
CHAPTER 32 Sensory Systems
Figure 32.13 Expression of gustducin in the tongue. (A) A secti on o f t ongue stained with a flu orescent antibo dy reveals th e positio n o f t he taste buds. (B) The same region stained with an ant ibo dy directed against gustducin reveal s that thi s G pro tein is expressed in t aste buds. [Courtesy of Dr. Charles S. Zuker.)
o HN 5
N H
6-n-Propyl-2-thiouraci I (PROP)
termed gustducin, which is expressed primarily in taste buds (Figure 32.13). How could the 7TM receptors be identified? The ability to detect some compounds depends on specific genetic loci in both human beings and mice. For instance, the ability to taste the bitter compound 6-n-propyl -2thiouracil ( PROP) was mapped to a region on human chromosome 5 by comparing DNA markers of persons who vary in sensitivity to this compound. This observation suggested that thi s region might encode a 7TM receptor that responded to PROP. Approximately 450 kilobases in this region had been sequenced early in the human genome project. This sequence was searched by computer for potential 7TM -receptor genes, and, indeed, one was detected and named T2Rl . Additional database searches detected approximately 30 sequences similar to T2Rl in the human genome. The encoded proteins are between 30 and 70% identical with T2Rl (Figure 32 .1 4). Are these proteins, in fact, bitter receptors? Several lines of evidence suggest that they are. First, their genes are expressed in taste-sensitive cells in fact, in many of the same cells that express gustducin. Second, cells that express individual members of this family respond to specific bitter compounds. For example, cells that express a specific mouse receptor (mT2RS ) responded when exposed specifically to cycloheximide. Third, mice that had been found unresponsive to cycloheximide were found to have point mutations in the gene encoding mT2R5 . Finally, cycloheximide
Figure 32.14 Conserved and variant regions in bitter receptors. The bitter receptors are members o f th e 7TM-receptor family. Stro ngly conserved residues characteri st ic of t his protein family are sho wn in blue, and highly variable residues are shown in red.
specifically stimulates the binding ofGTP analogs to gustducin in the presence ofthe mT2R5 protein (Figure 32 .15). Tmportantly, each taste-receptor cell expresses many different members of the T2R family. This pattern of expression stands in sharp contrast to the pattern of one receptor type per cell that characterizes the olfactory system (Figure 32.16). The difference in expression patterns accounts for the much greater specificity of our perceptions of smells compared with tastes. We are able to distinguish among subtly different odors because each odorant stimulates a unique pattern of neurons. In contrast, many tastants stimulate the same neu rons. Thus, we perceive only "bitter" without t he ability to discriminate cycloheximide from qui nine. OLFACTION
o
c:
::l
o E ..:
TASTE (bitter)
Figure 32.15 Evidence that T2R proteins are bitter taste receptors. Cyclo heximide uniquely stimulates the binding of the GTP analog GTP,,/S to gustducin in the presence of the mT2R protein. [After J. Chandrashekar. K. L. Mueller. M . A. Hoon, E. Adler, L. Feng, W. Guo, C. S. Zuker, and N. J. Ryba. Cell 100(2000):703- 711.]
•• ••• •
Sensory neurons
--
Brain
Sensory neurons
Brain
Figure 32.16 Differing gene expression and connection patterns in olfactory and bitter taste receptors. In olfaction, each neuron expresses a si ngle OR gene. and the neurons expressing the same OR converge to specific sites in the brain. enabling specific perception of different odorants. In gustation. each neuron expresses many bitter receptor genes, and so the identity of the tastant is lost in transmission.
A Heterodimeric 7TM Receptor Responds to Sweet Compounds Most sweet compounds are carbohydrates, energy rich and easil y digestible. Some noncarbohydrate compounds such as saccharin and aspartame also taste sweet. Members of a second family of 7T M receptors are expressed in taste-receptor cells sensitive to sweetness. T he three members of this family, referred to as TIR1, Tl R2, and Tl R3, are distinguished by their large extracellular domains compared with those of the bitter receptors. Studies in knockout mice have revealed that T1 R2 and T1R3 are expressed simultaneously in mice able to taste carbohydrates (Figure 32 .17). Thus, it ap pears t hat T1 R2 and T1 R3 form a specific heterodimeric receptor that is responsible for mediating the response to sugars. This heterodimeric receptor also responds to artificial sweeteners and to sweet-tasting proteins and therefore appears to be the receptor responsible for responses to all sweet tastants . Note thatT1R2 and T1R3 do respond to sweet tastants individually, but only at very high concentrations of tastant. The requirement for an oligomeric 7TM receptor for a fully functional response is surprising, considering our previous understanding of 7TM re ceptors. This discovery has at least two possible explanations. First, the sweet receptor could be a member of a small su bset of the 7TM-receptor family t hat functions well only as oligomers. Alternatively, many 7TM 929
930
.
Tl R2. Tl R3
. .... I .. .'
TlRl . TlR3
CHAPTER 32 Sensory Systems
• .' ' •
.-
• • • • •
"'C
~
•• ••
'"E
0..
,8, -
••
• • •
10
••
.--
Q)
--'"
> .-
..
.' • •
. -.- 6. _____
Q)
'"
'
.' .' •
o
• • •• ••
••••• • • • • • •
.'
,
• ••• ..-- -
::::::::::: . ::::::::::: ___________ 30
100
300
T1 Rl . TlR2 T1Rlonly
1000
[Sucrosel. mM Figure 32.17 Evidence for a heterodimeric sweet receptor. The sensitivity to sweetness of mice with genes for either T1R1 . T1R2, T1R3, or both T1R2 and T1R3 were determined by observing the relative rates at which they licked solutions containing various amount of sucrose. These studies revealed that both T 1R2 and T1R3 were required for a full response to sucrose. Mice with a disrupted T1R1 gene were indistinguishable from wild-type mice in this assay (not shown). [After G. Q . Zhao, Y. Zhang, M . A. Hoon. J. Chandrashekar. I. Erlenbach, N. J. P. Ryba, and C. S. Zuker. Cell 115(2003):255- 266.]
receptors may function as oligomers. but this notion is not clear. because these oligomers contain only one type of 7TM-receptor subunit. Further studies will be required to determine which of these explanations is correct.
Umami. t he Taste of Glutamate and Aspartate. Is Mediated by a Heterod imeric Receptor Related to t he Sweet Recept or The family of receptors responsible for detecting sweetness is also responsible for detecting amino acids. In human beings. only glutamate and aspartate elicit a taste response. Studies similar to those for the sweet receptor revealed that the umami receptor consists ofT1Rl and T1R3. Thus. this receptor has one subunit (T1R3) in common with the sweet receptor but has an additional subunit (T1Rl) that does not participate in the sweet response. This observation is supported by the observation that mice in which the gene for Tl R 1 is disrupted do not respond to aspartate but do respond normally to sweet tastants; mice having disrupted genes for both T1Rl and T1R3 respond poorly to both umami and sweet tastants.
Salt y Tast es Are Detected Primarily by t he Passage of Sodium Ions Through Channels 0
CI ~
H2N
NH2 , , ,•
N
•
N H
"'"
N
+
NH2 Amiloride
•
-NH 2
Salty tastants are not detected by 7TM receptors. Rather. they are detected directly by their passage through ion channels expressed on the surface of cells in the tongue. Evidence for the role of these ion channels comes from examining known properties ofNa + channels characterized in other biological contexts. One class of channels. characterized first for their role in salt reabsorption. are thought to be important in the detection of salty tastes because they are sensitive to the compound amiloride. which mutes the taste of salt and significantly lowers sensory-neuron activation in response to sodium. An amiloride-sensitive Na + channel comprises four subunits that may be either identical or d istinct but in any case are homologous. An individual su bunit ranges in length from 500 to 1000 amino acids and includes two
presumed membrane-spanning helices as well as a large extracellular domain in between them (Figure 32.18). The extracellular region includes two (or, sometimes, three) distinct regions rich in cysteine residues (and, presumably, disulfide bonds). A region just ahead of the second membrane-spanning helix appears to form part of the pore in a manner analogous to the structurally characterized potassium channel (p. 364). The members of the amiloridesensitive Na + -channel family are numerous and diverse in their biological roles. We shall encounter them again in the context of the sense of touch. Sodium ions passing through these channels produce a significant transmembrane current. Amiloride blocks this current, accounting for its effect on taste. However, about 20% of the response to sodium remains even in the presence of amiloride, suggesting that other ion channels also contribute to salt detection.
Sour Tastes Arise from t he Effects of Hydrogen Ions (Acids) on Channels Like salty tastes, sour tastes are detected by direct interactions with ion channels, but the incoming ions are hydrogen ions (in high concentrations) rather than sodium ions. For example, in th e absence of high concentrations of sodium, hydrogen ion flow can induce substantial transmembrane currents through amiloride-sensitive Na + channels. However, hydrogen ions are also sensed by mechanisms other than their direct passage through membranes. Binding by hydrogen ions blocks some potassium ion channels and activates other types of channels. Together, these mechanisms lead to changes in membrane polarization in sensory neurons that produce the sensation of sour taste. We shall consider an additional receptor related to taste, one responsible for the "hot" taste of spicy food, when we examine mechanisms of touch perception.
32.3
Cysteine-ri ch region 2
Cysteine-rich region 1
_ ~
o a.
N
Membrane• spannong helices
c
Figure 32.18 Schematic structure of the amiloride-sensitive sodium channel. Only one of the four subunits that constitute the functional channel is illustrated. The amiloride-sensitive sodium channel belongs to a superfamily having common structural features, including two hydrophobic membrane-spanning regions, intracellular amino and carboxyl term ini; and a large, extracellular region with conserved cysteine-rich domains.
Photoreceptor Molecules in the Eye Detect Visible Light
Vision is based on the absorption of light by photoreceptor cells in the eye. These cells are sensitive to light in a narrow region of the electromagnetic spectrum, the region with wavelengths between 300 and 850 nm (Figure 32.19). Vertebrates have two kinds of photoreceptor cells, called rods and cones because of their distinctive shapes. Cones function in bright light and are responsible for color vision, whereas rods function in dim light but do not perceive color. A human retina contains about 3 million cones and 100 million rods. Remarkably, a rod cell can respond to a single photon, and the brain requires fewer than 10 such responses to register the sensation of a flash of light.
I
I
I
I:!! ~
I
I
I
I
I
I
I
I
10- 10
10- 7 10-"
102
X-rays
Visible light
Radio waves
Wavelength (m) Figure 32.19 The electromagnetic spectrum. Visible light has wavelengths between 300 and 850 nm.
931
932
Rhodopsin, a Specialized 7TM Receptor, Absorbs Visible Light
CHAPTER 32 Sensory Systems
Rod s are slender, elongated structures; th e outer segment is speciali zed for photoreception (Figure 32 .20). It contains a stack of about 1000 discs, whi ch are membrane-enclosed sacs densely packed with photoreceptor molecul es. The photosensitive molecule is often call ed a visual pigment because it is hi ghl y colored owing to its ability to absorb light. T he photoreceptor molecul e in rod s is rhodopsin (Section 14.1), which consists of the protein opsin linked to 77 -cis-retinal , a prosthetic group .
.'
l1 -cis-Retinal
H
==
-
..-I- Discs
Outer segment
Figure 32.20 The rod cell . (Left) Scanning electron m icrograph o f retinal rod cells. (Right) Schematic representati on o f a ro d cel l. [ Pho t ograph courtesy of Dr. Deric Bo wnds.]
~
,
40,000
500
E u
-!;;
30,000
E
.-'u"
it: o u
20,000
'"
g .w c:
10,000 ~
.-
:E
~o""'" o - - :4.1. 50""'0"- - :6,-'00,,----= -..J 700 00=----=Wavelength (nm)
Figure 32.21 Rhodopsin absorption spectrum. Almost all photons wi th wavelengths near 500 nm that st ri ke a rhod opSin mo lecule are absorbed .
Rhodopsin absorbs light very effi cientl y in the middle of the visible spectrum, its absorption being centered on 500 nm , which nicely matches the solar output (Figure 32.2 1). A rhodopsin molecul e will absorb a high percentage of the photons of the correct wavelength that strike it, as indicated by the extinction coefficient of 40 ,000 M - 1cm - I at 500 nm . The extin ction coefficient for rhodopsin is more than an order of magni tude greater th an that 'for tryptophan , the most effi cient absorber in proteins that lack prostheti c groups. Opsin , the protein component of rhod opsin, is a member of the 7TMreceptor family. Indeed, rhodopsin was the first member of this famil y to be purified, its gene was the first to be cloned and sequenced , and its threedimensional structure was the first to be determined. The color of rhodopsin and its responsiveness to light depend on the presence of the light-absorbing group (chromophore) 11-cis-retinal. This compound is a powerful absorber of light because it is a polyene; its six alternating single and double bonds constitute a long, unsaturated electron network. Recall that alternating single and doubl e bonds account for the chromophoric properties of chlorophyll (Section 19 .2). The aldehyde group of II -cis-retinal forms a Schiff base (Figure 32.22) with th e e -amino group ofly sine residue 296, which lies in the center of the seventh transmembrane helix. F ree retinal absorbs maximally at 370 nm, and its unprotonated Schiff-base adduct absorbs at 380 nm, whereas the protonated Schiff base absorbs at 440 nm or longer wave-
Schiff base
Protonated Schiff base
f
.'
\
)
H (l1-cis-Retina l)
~~/~/~'-..---/
~
lysine
Figure 32 .22 Retinal- lysine linkage. Retinal is linked to lysine 296 in opsin by a Schiff-base linkage. In the resting state of rhodopsin, this Schiff base is protonated.
lengths. Thus, the 500-nm absorption maximum for rhodopsin strongly suggests that the Schiff base is protonated; additional interactions with opsin shift the absorption maximum farther toward the red. The positive charge of the protonated Schiff base is compensated by the negative charge of glu tamate 113 located in helix 2; the glutamate residue closely approaches the lysine- retinal linkage in the three-dimensional structure of rhodopsin. Light Absorption Induces a Specific Isomerization of Bound ll-cis-Retinal
How does the absorption oflight by the retinal Schiff base generate a signal? George Wald and his coworkers discovered that light absurptiun results in the isomerization of the ll -cis-retinal group uf rhudopsin to its a ll-trans form (Figure 32.23). This isomerization causes the Schiff-base nitrogen atom to move approximately 5 A, assuming that the cyclohexane ring of the retinal group remains fixed . In essence, the light energy of a photon is converted into atomic mution. The change in atomic positions, like the binding of a ligand to other 7TM receptors, sets in train a series of events that lead to the closing of ion channels and the generation of a nerve impulse. The isomerization of the retinal Schiff base takes place within a few picoseconds of a photon being absorbed . The initial product, termed bathorhodopsin, contains a strained all-trans -retinal group. Within approximately 1 ms, this intermediate is converted through several additional intermediates into metarhodupsin II. In metarhodopsin II, the Schiff base is deprotonated and the opsin protein has undergone significant reorganization . Metarhodopsin II (also referred to as R*) is analogous to the ligand-bound state of 7TM receptors such as the f3 r adrenergic receptor (Section 14.1) and
Light
lys
)
sA l1 -cis-Retinal
AII-trons-retinal
• Figure 32.23 Atomic motion in retinal. The Schiff-base nitrogen atom moves 5 A as a consequence of the light-induced iso merization of ll-cis-retinal to all-trans-ret inal by rotation about the bo nd shown in red.
933
o
\.
)
Ligand-bound 7TM receptor
the odorant and tastant receptors discussed previously (Figure 32.24). Like these receptors, this form of rhodopsin activates a heterotrimeric G protein that propagates the signal. The G protein associated with rhodopsin is called transducin . Metarhodopsin II triggers the exchange of GDP for GTP by the ex subunit of transducin (Figure 32. 25). On the binding ofGTP, the J3-y subunits of transducin are released and the ex subunit switches on a cGMP phosphodiesterase by binding to an inhibitory subunit and removing it. The activated phosphodiesterase is a potent enzyme that rapidly hydrolyzes cGMP to GMP. The reduction in cGMP concentration causes cGMP-gated ion channels to close, leading to the hyperpolarization of the membrane and neuronal signaling. At each step in this process, the initial signal the absorption of a single photon is amplified so that it leads to sufficient membrane
hyperpolarization to result in signaling.
Light-Induced Lowering of the Calcium Level Coordinates Recovery
Light )
Metarhodopsin II Figure 32.24 Analogous 7TM receptors. The conversion of rhodopsin into metarhodopsin II activates a signaltransduction pathway analogously to the activation induced by the binding of other lTM receptors to appropriate ligands.
As we have seen, the visual system responds to changes in light and color within a few milliseconds, quickly enough that we are able to perceive continuous motion at nearly 1000 frames per second. To achieve a rapid response, the signal must also be terminated rapidly and the system must be returned to its initial state. First, activated rhodopsin must be blocked from continuing to activate transducin. Rhodopsin kinase catalyzes the phosphorylation of the carboxyl terminus of R- at multiple serine and threonine residues. AYTestin, an inhibitory protein (p. 388), then binds phosphorylated R ' and prevents additional interaction with transducin. Second, the ex subunit of transducin must be returned to its inactive state to prevent further signaling. Like other G proteins, the ex subunit possesses built-in GTPase activity that hydrolyzes bound GTP to GDP. Hydrolysis takes place in less than a second when transducin is bound to the phosphodiesterase. The GDP form of transducin then leaves the phosphodiesterase and reassociates with the J3-y subunits, and the phosphodiesterase returns to its inactive state. Third, the level of cGMP must be raised to reopen the cGMP-gated ion channels. The action of guanylate cyclase accomplishes this
third step by synthesizing cGMP from GTP. Calcium ion plays an essenti al role in controlling guanylate cyclase because it markedly inhibits the activity of the enzyme. In the dark, Ca2+ as well as Na + enter the rod outer segment through the cGMP-gated channels. Calcium ion influx is balanced by its efflux through an exchanger, a
Light
Phosphodiesterase
Rhodopsin
Transducin
GTP
cGMP-gated ion channel
GDP
GMP
cGMP
Figure 32.25 Visual signal transduction. The light-induced activation of rhodo psin leads to the hydrolysis of cGMP, which in turn leads t o ion-channel cl osing and the in itiati on of an action potential.
934
935
transport system that uses the thermodynamically favorable flow of four 2 Na + ions into the cell and one K + ion out of the cell to extrude one Ca + ion. 2 After illumination, the entry of Ca + through the cGMP-gated channels stops, but its export through the exchanger continues. Thus, the cytoplas2 mic Ca + level drops from 500 nM to SO nM after illumination. This drop markedly stimulates guanylate cyclase, rapidly restoring the concentration of cGMP to reopen the cGMP-gated channels. Activation
32.3 Vision
Recovery
Ion Guanylate [cGM PJ-.l.. ~) channels ~) [Ca2+}J- ~) cyclase ~) [cGMP]t • • activIty closed increased By controlling the rate of cGMP synthesis, Ca2 + levels govern the speed with which the system is restored to its initial state.
Color Vision Is Mediated by Three Cone Receptors That Are Homologs of Rhodopsin Cone cells, like rod cells, contain visual pigments. Like rhodopsin, these photoreceptor proteins are members of the 7TM-receptor family and use II -cis-retinal as their chromophore. In human cone cells, there are three distinct photoreceptor proteins with absorption maxima at 426, 530, and - 560 nm (Figure 32 .2 6). These absorbances correspond to (in fact, define) the blue, green, and red regions of the spectrum. Recall that the absorption maximum for rhodopsin is 500 nm. The amino acid sequences of the cone photoreceptors have been compared with one another and with rhodopsin. The result is striking. Each of the cone photoreceptors is approximately 40% identical in sequence with rhodopsin. Similarly, the blue photoreceptor is 40% identical with each of the green and red photoreceptors. The green and red photoreceptors, however, are > 95 % identical with one another, differing in only 15 of 364 positions (Figure 32. 27).
N
c Figure 32.27 Comparison of the amino acid sequences of the green and red photoreceptors. Open circles correspond to identical residues, whereas colored circles mark residues that are different. The differences in the three black positions are respo nSible for most of the difference in their absorption spectra.
426
530 560
t
300
400
SOO
600
700
800
Wavelength (nm) Figure 32.26 Cone-pigment absorption spectra. The abso rpti o n spectra o f the cone visual pigment responsibl e for color •
•
VISio n .
936 CHAPTER 32
Chicken
Hum"n being
Mo use
Sensory Systems
600
Red Red
550
Green Figure 32 .28 Evolutionary relationships among visual pigments. Visual pigments have evolved by gene duplication along different branches of the animal evolutionary tree. The branch lengths of th e "trees" correspo nd to the percentage of amino acid divergence. [After J. Nathans. Neuron 24(1999):299- 312; by permission of Cell Press. ]
Green Rhodopsin I
Rhodopsin
~
Green Rhodopsin
500
" -"
~
-"
DO
Pinopsin Blue Violet
E
450
-'" ~
~
Blue 400
Blue
350
These observations are sources of insight into photoreceptor evolution. First, the green and red photoreceptors are clear! y products of a recent evolutionary event (Figure 32.28). The green and red pigments appear to have diverged in the primate lineage approximately 35 million years ago. Mammals, such as dogs and mice, that diverged from primates earlier have only two cone photoreceptors, blue and green. They are not sensitive to light as far toward the infrared region as we are, and they do not di scriminate colors as well. In contrast, birds such as chickens have a total of six pigments: rhodopsin, four cone pigments, and a pineal visual pigment called pinopsin. Birds have highly acute color perception. Second, the high level of similarity between the green and red pigments has made it possible to identify the specific amino acid residues that are responsible for spectral tuning. T hree residues (at positions 180, 277, and 285) are responsible for most of the difference between the green and the red pigments. In the green pigment, t hese residues are alanine, phenylalanine, and alanine, respectively; in the red pigment, they are serine, tyrosine, and threonine. A hydroxyl grou p has been added to each am ino acid in the red pigment. The hydroxyl grou ps can interact with the photoexcited state of retinal and lower its energy, leading to a shift toward the lower-energy (red) region of the spectrum. Rearrangements in the Genes for the Green and Red Pigments Lead to "Color Blindness" Homologous recombination
The exchange of DNA segments at equivalent pOSition s between chromosomes wi th
substantial sequence similarity.
The genes for the green and red pigments lie adjacent to each other on the human X chromosome. These genes are more than 98% identical in nucleotide sequence, including introns and untranslated regions as well as the protein-coding region. Regions with such high similarity are very susceptible to unequal homologous recombination. Recombination can take place either between or within transcribed regions of the gene (Figure 32.29). If recombination takes place between transcribed regions, the product chromosomes will differ in the number of pigment genes that they carry. One chromosome will lose a gene and thus may lack the gene for, say, the green pigment; the other chromosome will gain a gene. Consistent with this scenario, approximately 2% of human X chromosomes carry only a single color pigment gene, approx imately 20% carry two, 50% carry three, 20% carry four, and 5% carry five or more. A person lacking the gene for the green pigment will have trouble distinguishing red and green color, characteristic of the most common form of color blindness. Approximately 5% of males have this form of color blindness. Recombination can also take place within the transcription units, resulting in genes that encode hybrids of the green and red photoreceptors. The absorption maximum
(A) Recombination between genes
)
(8) Recombination within genes
Greenlike
)
Redlike hybrid
Figure 32.29 Recombination pathways leading to color blindness. Rearrangements in the course of DNA replication may lead to (A) the loss of visual pigment genes or (B) the formation o f hybrid pigment genes that encode photoreceptors with anomolous absorption spectra. Because the amino acids most important for determining absorption spectra are in the carboxyl- terminal half o f each photoreceptor protein, t he part of the gene that encodes this region most strongly affects the absorption characteristics of hy brid receptors. [After J. Nathans. Neuron 24(1999):299-312; by permission of Cell Press.]
of such a hybrid lies between that of th e red and green pigments. A person with such hybrid genes who also lacks either a functional red or a functional green pigment gene does not discriminate color well.
32.4
Hair cell
Hearing Depends on the Speedy Detection of Mechanical Stimuli
Hearing and touch are based on the detection of m echani cal stimuli. Although the proteins of these senses have not been as well characterized as those of the senses already di scussed, anatomical, physiological, and biophysical studies have elucidated the fundamental processes. A majur clue to the mechanism of hearing is its speed. We hear frequencies ranging from 200 to 20,000 Hz (cycles per second), corresponding to times of 5 to 0.05 ms. Furthermore, our ability to locate sound sources, one of the m ost important funct ions of hearing, depends on the ability to detect the time delay between the arrival of a sound at one ear and its arrival at the other. G iven the separation of our ears and the speed of so und , we must be able to accurately sense time differences of 0.7 m s. In fact, human beings can locate sound sources associated with temporal delays as short as 0.02 ms. T his high time resolution implies that hearing must employ direct transduction mechaIlisms that do not depend on second messengers. Recall that, in vision, for which speed also is important, the signal -transduction processes take place in milliseconds.
Figure 32.30 Hair cells, the sensory neurons crucial for hearing. These speCialized neurons are capped with hairlike projection called stereocilia that are responsib le for detecting very subtle vibrations. [After A. J. Hudspeth. Nature
341(1 989):397- 404.]
Hair Cells Use a Connected Bundle of Stereocilia to Detect Tiny Motions
Sound waves are detected inside th e cochl ea of the inner ear. The cuchlea is a fl uid -filled, membranous sac that is coiled like a snail shell. The primary detection is accomplished by specialized neurons inside the cochlea called hair cells (Figure 32 .30). Each cochlea contains approximately 16,000 hair cell s, and each hair cell contains a hexagonally shaped bundle of20 to 300 hairlike projections called stereocilia (Figure 32 .31). These stereocilia are graded in length across the bundle . Mechanical deflection of the hair bundle, as occurs
Figure 32.31 An electron micrograph of a hair bundle. [Courtesy o f Dr. A. Jacobs and Dr. A. J. Hudspeth.]
937
open channels close, and the membrane hyperpolarizes. Thus, the mechanical motion of the hair bundle is directly converted into current flow across the hair-cell membrane.
939 32.5 Touch
Mechanosensory Channels Have Been Identified in Drosophila and Vertebrates
The search for ion channels that respond to mechanical impulses has been pursued in a variety of organisms. Drosophila have sensory bristles used for detecting small air currents. These bristles respond to mechanical displacement in ways similar to those of hair cells; displacement of a bristle in one direction leads to substantial transmembrane current. Strains of mutant fruit flies that show uncoordinated motion and clumsiness have been examined for their electrophysiological responses to displacement of the sensory bristles. In one set of strains, transmembrane currents were dramatically reduced . The mutated gene in these strains was found to encode a protein of 1619 amino acids, called NompC for no mechanoreceptor potential. The carboxyl-terminal 469 amino acids of NompC resemble a class of ion channel proteins called TRP (transient receptor potential) channels. This region includes six putative transmembrane helices with a porelike region between the fifth and sixth helices. The amino-terminal 1150 amino acids consist almost exclusively of 29 ankyrin repeats (Figure 32.35). Ankyrin repeats are structural motifs consisting of a hairpin loop followed by a helix-tum -helix. Importantly, in other proteins, regions with tandem arrays of these motifs mediate protein- protein interactions, suggesting that these arrays couple the motions of other proteins to the activity of the N ompC channel. Figure 32.35 Ankyrin repeat structure. One ankyrin do main is Recently, a strong candidate for at least one composhown in red in thi s series of four ankyrin repeat s. Notice the nent of the mechanosensory channel involved in hearhairpin loop followed by a helix-turn-helix moti f in the redcolo red ankyrin unit. Ankyri n do mains interact w ith other pro teins, ing has been identified. The protein, TRPA1, is also a pri marily through their loops. [Drawn f ro m lAWC.pdb.] member of the TRP channel family. The sequence of TRPA1 also includes 17 ankyrin repeats. TRPAl is expressed in hair cells, particularly near their tips . Based on these and other studies, it appears very likely that TRPAl represents at least one component of the mechanosensory channel that is central to hearing. Further studies are under way to confirm and extend this exciting discovery.
32.5
Touch Includes the Sensing of Pressure, Temperature, and Other Factors
Like taste, touch is a combination of sensory systems that are expressed in a common organ in this case, the skin. The detection of pressure and the detection of temperature are two key components. Amiloride-sensitive Na + channels, homologous to those of taste, appear to playa role . Other systems are responsible for detecting painful stimuli such as high temperature, acid, or certain specific chemicals. Although our understanding of this sensory system is not as advanced as that of the other sensory systems, recent work has revealed a fascinating relation between pain and taste sensation, a relation well known to anyone who has eaten "spicy" food .
940 CHAPTER 32 Sensory Systems
Stud ies of Capsaicin Reveal a Recept or for Sensing High Temperatures and Other Painfu l Stimuli Our sense of touch is intimately connected with the sensation of pain. Specialized neurons, termed nociceptors, transmit signals from skin to painprocessing centers in the spinal cord and brain in response to the onset of tissue damage. What is the molecular basis for the sensation of pain? An intriguing clue came from the realization that capsaicin, the chemical responsible for the "hot" taste of spicy food, activates nociceptors.
F
o
H
o
3
-;:Y~'-y--/,,- N /' H
capsaicin
N
Figure 32.36 The membrane topo logy deduced for VR1, the capsaiCin receptor. The proposed site of the membrane pore is indicated in red, and the three ankyrin (A) repeats are shown in o range. The active receptor comprises four of these subunits. [After M. J., Caterina, M . A., Schumacher, M . To minaga, A. Rosen, J. D. Levine, and D. Jul ius. Nature 389(1997):816- 824.]
Figure 32.37 Response of the capsaicin receptor to pH and temperature. The abil ity o f thi s receptor to respond to acid and to increased temperature helps detect potentially noxious situations. [A fter M. Tominaga, M. J. Caterina, A. B. Malmberg, T. A. Rosen, H. Gi lbert. K. Skinner, B. E. Raumann, A. I. Basbaum, and D. Julius,
Neuron 21(1998):531- 543.]
Early research suggested that capsaicin would act by opening ion channels that are expressed in nociceptors . Thus, a cell that expresses the capsaicin receptor should take up calcium on treatment with the molecule. This insight led to the isolation of the capsaicin receptor with the use of cDNA from cells expressi ng th is receptor. Such cells had been detected by their fluorescence when loaded with the calcium-sensitive compound Fura-2 and then treated with capsaicin or related molecules. Cells expressing the capsaicin receptor, which is called VRl (for vanilloid receptor 1), respond to capsaicin below a concentration of 1 fJ.M . The deduced 838 -residue sequence of VR1 revealed it to be a member of the TRP channel family (Figure 32 .36). The amino -terminal region ofVR1 includes three ankyrin repeats. C urrents through VR1 are also induced by temperatures above 40 °C and by exposure to dilute acid, with a midpoint for activation at pH 5.4 (Figure 32 .37). Temperatures and acidity in these ranges are associated with infection and cell inj u ry. T he responses to capsaicin, temperature, and acidity are not independent . T he response to heat is greater at lower pH, for example. Thus, VRl acts to integrate several noxious stimuli. We feel these responses as pain and act to prevent the potentially destructive conditions that cause the u npleasant sensation. Mice that do not express VR 1 suggest that this is the case; such mice do not mind food containing high concentrations of capsaicin and are, indeed, less responsive than control mice to normally noxi ous heat. Plants such as chili peppers presumably gained the ability to synthesize capsaicin and other "hot" compounds to protect themselves from being consu med by mammals. Birds, which play the beneficial role of spreading pepper seeds into new territory, do not appear to respond to • • capSalCll1.
c:
-
~
:::J
U
8
7
6
5 pH
4
3
20
30
40
Temperature (0e)
50
W
Because of its ability to simulate VR1, capsaicin is used in pain ~ management for arthritis, neuralgia, and other neuropathies. How can a compound that induces pain assist in its alleviation? Chronic exposure to capsaicin overstimulates pain -transmitting neurons, leading to their desensitization. More Sensory Systems Remain to Be Studied There may exist other subtle senses that are able to detect environmental signals that then influence our behavior. The biochemical basis of th ese senses is now under investigation. One such sense is our ability to respond, often without our awareness, to chemical signals called pheromones, released by other persons. Another is our sense of time, manifested in our daily (circadian) rhythms of activity and restfulness. Daily changes in light exposure strongly influence these rhythms. The foundations for these senses have been uncovered in other organisms; future studies should reveal to what extent these mechanisms apply to human beings as well.
Summary Smell, taste, vision, hearing, and touch are based on signal-transduction pathways activated by signals from the environment. These sensory systems function similarly to the signal-transduction pathways for many hormones. These intercellular signaling pathways appear to have been appropriated and modified to process environmental information.
32.1 A Wide Variety of Organ ic Compounds Are Detected by Olfaction The sense of smell, or olfaction, is remarkable in its specificity; it can, for example, discern stereoisomers of small organic compounds as distinct aromas. The 7TM receptors that detect these odorants operate in conjunction with G (olf), a G protein that activates a cAMP cascade resulting in the opening of an ion channel and the generation of a nerve impulse. An outstanding feature of the olfactory system is its ability to detect a vast array of odorants. Each olfactory neuron expresses only one type of receptor and connects to a particular region of the olfactory bulb. Odors are decoded by a combinatorial mechanism: each odorant activates a number of receptors, each to a different extent, and most re ceptors are activated by more than one odorant. 32.2 Taste Is a Combination of Senses That Function by Different Mechanisms We can detect only five tastes: bitter, sweet, salt, sour, and umami. The transduction pathways that detect taste are, however, diverse. Bitter, sweet, and umami tastants are experienced through 7TM receptors acting through a special G protein called gustducin. Salty and sour tastants act directly through membrane channels . Salty tastants are detected by passage though Na + channels, whereas sour taste re sults from the effects of hydrogen ions on a number of types of channels. The end point is the same in all cases membrane polarization that results in the transmission of a nerve impulse. 32.3 Photoreceptor Molecules in the Eye Detect Visible Light Vision is perhaps the best understood of the senses. Two classes of photoreceptor cells exist: cones, which respond to bright lights and colors, and rods, which respond only to dim light. The photoreceptor in rods is rhodopsin, a 7TM receptor that is a complex of the protein opsin and the chromophore ll-cis-retinal. The absorption of light by
941 Summary
942 CHAPTER 32 Sensory Systems
ll -cis-retinal changes its structure into that of all -trans-retinal , setting in motion a signal-transduction pathway that leads to the breakdown of cGMP, to membrane hyperpolarization, and to a subsequent nerve impulse. Color vision is mediated by three distinct 7TM photoreceptors that employ ll -cis-retinal as a chromophore and absorb light in the blue, green, and red parts of th e spectrum. 32.4 Hearing Depends on the Speedy Detection of Mechanical Stimuli
The immediate receptors for hearing are found in the hair cells of the cochleae, which contain bundles of stereocilia. When the stereocilia move in response to sound waves, cation channels will open or close, depending on the direction of movement. The mechanical motion of the cilia is converted into current flow and then into a nerve impulse. 32.5 Touch Includes the Sensing of Pressure, Temperature, and Other Factors
Touch, detected by the skin , senses pressure, temperature, and pain. Specialized nerve cells called nociceptors transmit signals that are interpreted in the brain as pain. A receptor responsible for the perception of pain has been isolated on the basis of its ability to bind capsaicin , the molecule responsible for the hot taste of spicy food. The capsaicin receptor, also called VRl, functions as a cation channel that initiates a nerve impulse.
Key Terms main olfactory epithelium (p. 923)
G(olf) (p. 923) functional magnetic resonance imaging (fMRJ ) (p . 926) gustducin (p. 926) amiloride-sensitive a + channel (p . 930) rod (p . 93 1) cone (p . 93 1)
rhodopsin (p . 932) opsin (p. 932)
arrestin (p . 934)
retinal (p . 932)
hair cell (p . 937) stereocilium (p . 937)
guanylate cyclase (p. 934)
chromophore (p. 932) transducin (p . 93 4)
tip link (p. 938)
cGMP phosphodiesterase (p . 934) cGMP-gated Ca2 + channel (p . 934) rhodopsi n kinase (p . 934)
nociceptor (p . 940) capsaicin receptor (VR1 receptor) (p. 940)
Selected Readings Where to Start Axel, R. 1995. The molecular logic of sroell . Sci. Am. 273(4): 154- 159. Dulac, C . 2000. The physiology of taste, vintage 2000. CellI 00:607- 61 o. Zhao, G . Q., Zhang. Y., Hoon, M . A., C handrashekar, J., Erlenbach , I., Ryba, . J. P., and Zuker, C. S. 2003. The receptors for mammalian sweet and umami taste. Cell 11 5:2 55 266. Stryer, L. 1996. Vision : From photon to perception . Proc. Na tl. Acad. Sc;. U. S. A. 91 :557- 559. Hudspeth, A. J. 1989 . How the ear's works work. Nature 341 :397-404.
Olfaction Buck, L., and Axel, R.1991. A novel multigene family may encode odorant receptors: A molecular basis for odor recognition. Cell 65:175 187. Malnic, B., Hirono, J., Sato, T ., and Buck, L. B. 1999 . Combinatorial receptor codes for odors. Ce ll 96:713- 723. Mombaerts, P., Wang, F., D ulac, C., C hao, S. K. , Nemes, A., Mendelsohn , M ., Edmondson, J.. and Axel, R. 1996. Visualizing an olfactory sensory map. Cell 87:675 686. Buck, L. 2005 . Unraveling the sense of smell (Nobel lecture). A ngew. Chern. Int. Ed . Eng!. 44 : 6128- 6140. l:lclluscio, L., Gold, G. H. , Nemes, A., and Axel , R. 1998 . Mice defi cient in G(olf) are anosmic. Neuron 20 :69- 81 .
Vosshall , L. l:l., Wong, A . M ., and Axel , R. 2000 . An olfactory sensory map in the fly brain . Cell I 02:147- 159. Lewcock, J. W., and Reed, R. R. 2003. A feedback mechanism regulates monoallelic odorant receptor expression . Proc. Nat l. Acad. Sci. U. S. A101:1069- 1074. Reed , R . R . 2004 . After the holy grail: Establishing a molecu lar mecha· nism for mammalian olfaction . C.1l11 6:329- 336.
Taste Herness, M . S., and G ilbertson , T. A. 1999. Cellular mechanisms of taste transduction . Annu. Rev. Physiol. 61:873 900 . Adler, E ., H oon , M . A., Mueller, K . L., C handrashekar, J.. Ryba, N.J.. and Z uker, C . S, 2000. A novel fami ly of mammalian taste recep· tors. CellI 00:693- 702. Chandrashekar, J., Mueller, K . L. , Hoon , M . A., Adler, E .. Feng, L.. Guo, W., Zuker, C . S., and Ryba, N . j. 2000. T 2 Rs function as bitter taste receptors. Cell 100:703- 711. Mano, I., and Driscoll , M . 1999. DEG / ENaC channels: A touchy suo perfamily that watches its salt. Bioessays 21:568-578. Ilenos, D . J., and Stanton , B. A . 1999 . Functional domains within the degenerin / epithelial sodium channel (Oeg/ ENaC) superfamily of ion channels. j. Physiol. (Lond.) 520(part 3): 631 - 644 .
Problems 943 McLaughlin, S. K., McKinnon, P. j., and Margobkee, K. F. 1992. Gustducin is a taste-cell -specific G protein clusely related to the transducins. Nature 357 :5 63- 569. Nelson, G., Hoon, M. A., Chandrashekar, J., Zhang, y, Ryba, N . j ., and Zuker, C . S. 200 I. Mammalian sweet taste receptors. Cell 106:381- 390.
Vision Strycr, L. 1988. Molecular basis of visual excitation. Co ld Spring Harbor Syrnp. Quant. Bioi . 53: 283- 294 . Wald, G . 1968. The molecular basis of visual excitatiun. Nature 219:800 807 . Ames, J. B., Dizhoor, A. M ., Jkura, M., Palczewski, K., and Stryer, L. 1999. Three-dimensional structure of guanylyl cyclase activating protein -2 , a calcium-sensitive modulator of photoreceptor guanylyl cyclases.}. BioI. Chern. 274:19329- 19337 . athans, j. 1994. In the eye of the beholder: Visual pigments and in herited variation in human vision. Cell 78:357 360. Nathans, ] . 1999. The evolution and physiology of human color vision: Insights from molecular genetic studies of visual pigment!o;, Neuron
24:299- 312. Palczewski, K., Kumasaka, T, Hori, T, Behnke, C. A., Motoshima, H., Fox, 13. A., LeTrong, I. , Teller, D . c., Okada, T , Stenkamp, R. E., Yamamoto, M ., and Miyano, M . 2000. C rystal structure of rhodopsin : A G prote.in -coupled receptor. Science 289 :739- 745. Filipek, S, Teller, D. c., Palczewski , K., and Stemkamp, R. 2003. The crystallographic model of rhodopsin and its use in studies of other
G protein -coupled receptors. Annu. Rev. Biuploys. Biumol. StTUCt. 32:175- 197.
Hearing Hudspeth, A. j . 1997. How hearing happens. Neuron 19 :947- 950 . Pickles,]. 0 ., and Corey, D. P. 1992. Mechanoelectrical transduction by hair cells. Trends Neurosci . 15:2 54- 259. Walker, ]{. G ., Willingham, A. T, and Zuker, C . S. 2000 . A Drosophila mechanosensory transduction channel. Science 287:2229- 2234. ):-Iudspeth, A. ] ., C hoe, Y, Mehta, A. D., and Martin, P. 2000. Putting ion channels to work : Mechanoelectrical transduction, adaptation, and amplification by hair cell s. Proc. Natl. Acad. Sci. U. S. A.
97: 11 765- 11 772.
Touch and Pain Reception Franco-Obregon, A., and Clapham, D. E. 1998. Touch channels sense blood pressure. Neuron 2 1:1224 1226. Caterina, M. j ., Schumacher, M. A., Tominaga, M., Rosen, T A., Levine, J. D., and julius, D. 1997. The capsaicin receptor: A heatactivated ion ehalUlel in the pain pathway. Nature 389 :R1 6-ll24. Tuminaga, M., Caterina, M. ] ., Malmberg, A. B., Rosen, T A., Gilbert, li ., Skinner, K., Raumann, B. E., Basbaum , A. I., and j ulius, D. 1998. T he cloned capsaicin receptor integrates multiple pain -producing stimuli . Neuron 21:531- 543. Caterina , M . j. , and julius, D. 1999. Sense and specificity: A molecular identity for nociceptors. Curro Opin. Neurobiul. 9:525-530 . Clapham , D. E. 2001 . T RP channels as cellular sensors . Nature 426:51 7- 52 4.
Problems 1. Mice and rats. As noted on page 924, one of the first odorant receptors to be matched with its ligand was a rat receptor that responded best to n-octanal. The sequence of the corresponding mouse receptor d iffered from the rat receptor at 15 positions. Surprisingly, the mouse receptor was found to respond best to n heptanal rather than n -octanal. The substitution of isoleucine at position 206 in the mouse for valine at this position in t he rat receptor was found to be important in determining the specificity for n-heptanal. Propose an explanation .
2. Olfactiun in
Unl ike the olfactory ne u rons in the mammali an systems discussed herein, olfactory neurons in the nematode C. elegam express multiple olfactory receptors . In particular, one neuron (called AWA ) expresses receptors for compounds to which the nematode is attracted, whereas a different n euron (called AWB) expresses receptors for com pounds that the nematode avoids . Su ppose that a tTansgenic nematode is gen erated s uch that one of the receptors for an attractant is expressed in AWB rather than A WA . What behavior wou ld you expect in the presence of the corresponding attractant? WOmts.
3. Odorant matching. A mixture of two of the compound s illustrated in Figure 32 .6 is applied to a section of olfactory epithelium . Only receptors 3,5,9, 12, and 13 are activated, according to Figure 32. 7. Identify t he likely compounds in the mixture. 4. Timing . Compare the aspects of taste (bitter, sweet, salty, sour) in regard to their potential for rapid time resolution.
5. Two ears. O ur abili ty to determine the direction from which a sound is coming is partly based on the d ifference in time at
which our two ears detect the sound . Given the speed of sound (350 m s - I) and the separation between our ears (0 .1 5 m ), what difference is expected in the times at which a sound arrives at our two ears? How does this difference compare with the time resolution of th e human hearing system? Would a sensory system that utilized 7TM receptors and G proteins be capable of adequate time resolution?
6. Constitutive mutants . What effect within the olfactory system would yo u expect for a mutant in which adenyl ate cyclase is al ways fully active? What effect within the visual system would you expect for a mutant in which guanylate cyclase is always fully active?
7. Bottle chuice. A widely used method for quantitatively moni toring rodent behavior with regard to taste is the bottle-choice assay. An animal is placed in a cage with two water bottles, one of which contains a potential tastant. After a fixed period of time (24 48 hours) , the amount of water remaining in each bottle is measured. Suppose that much less water remains in the bottle containing the tastant after 48 hours . Do you suspect t he tastant to be sweet or bitter?
8. It's better to be bitter. Som e nontoxic plants taste very bitter to us. Suggest one or m ore explanations.
9. Of mice and men. In human beings, the umami taste is triggered only by glutamate and aspartate. Jn contrast, mice respond to many more amino acids. Design an experiment to test which of the subunits (T1Rl or TIR3 ) determines the specificity of this response. Assume that all desired m ouse strains can be read ily produced .
944
CHA PTER 32 Sensory Syst e ms
Chapter Integration Problem
Mechanism Problem
10 . Energy and inforTrUltion. The transmission of sensory information requires the input of free energy. For each sensory system (olfactio n, gustation, vision, hearing, and touch), identify mechanisms for the input of free energy that allow the transmission of sensory in formation .
11 . Schiff-base Jonnation . Propose a mechanism for the reaction between opsin and 11 -cis -retinal.
Chapter
The Immune System
Antibody
Influenza hemagglutinin
Just as medieval defenders used their weapons and the castle wall s t o defend their city, the immune syst em constantly battles against foreign invaders such as viruses, bacteria, and parasites to defend the organism. Antibody molecules pro vide a key element in the immune system's defensive arsenal. For example, specific antibodies can bind to molecules on the surfaces o f viruses and prevent the viruses from infecting ce lls. Above right, an antibody binds t o o ne subunit on hemagglutinin fro m the surface o f influenza virus. [(Left) The Granger Collecti o n.]
e are constantly exposed to an incredible diversity of bacteria, viruses, and parasites, many of which would flourish in our cells or extracellular fluids were it not for our immune system. How does the immune system protect us? The human body has two lines of defense: an innate immune system that responds rapidly to features present in many pathogens, and an adaptive immune system that responds to specific features present only in a given pathogen. Both the innate and the adaptive immune systems first identify features on disease-causing organisms and then work to eliminate or neutralize those organisms. This chapter focuses on the mechanisms of pathogen identification. The immune system must meet two tremendous challenges in the identification of pathogens: (1) to produce a system of receptors diverse enough to recognize the diversity of potential pathogens and (2) to distinguish invaders and their disease-causing products from the body and its own prod ucts (i.e., self- versus non-self-recognition). To meet these challenges, the innate immune system evolved the ability to recognize structural elements, such as specific glycolipids or forms of nucleic acid, that are well conserved in pathogens but absent in the host organism. The repertoire of such elements is limited, however, and so some pathogens have strategies to escape detection. The adaptive immune system has the remarkable 12 8 ability to produce more than 10 distinct antibodies and more than 10 T-cell receptors (TCRs), each of which presents a different surface with
I Outlin e l 33.1 Antibodies Possess Distinct AntigenBinding and Effector Units 33.2 The Immunoglobulin Fold Consists of a Beta-Sandwich Framework with Hypervariable Loops 33.3 Antibodies Bind Specific Molecules Through Their Hypervariable Loops 33.4 Diversity Is Generated by Gene Rearrangements 33.5 Major-Histocompatibility-Complex Proteins Present Peptide Antigens on Cell Surfaces for Recognition by T-Cell Receptors 33.6 Immune Responses Against Self-Antigens Are Suppressed
945
946 CHAPTER 33 The Immune System
Leucine-rich repeat
Cysteine-rich domain
TRI domain (signal transduction)
Figure 33.1 Toll -like receptor. Each receptor comprises a set of 18 or more leucine-rich repeat sequences, followed by a cysteine-ri ch domain, a single transmembrane helix. and a TIR (Toll- interleukin 1 receptor) domain that functions in signal transduction.
Figure 33.2 Lipopolysaccharide structure. Lipopolysaccharide, a potent activator of t he innate immune system, is found on the surfaces of Gram-negative bacteria. The structure is built around lipid A. a specialized lipid that has four fatty acyl chains linked to two N -acetylglucosamine residues. Lipid A is linked to a polysaccharide chain consisting of a core and a more variable region termed the O -specific chain.
the potential to specifically bind a structure from a foreign organism. In producing this vast range of defensive molecules. however. the adaptive immune system has the potential to create antibodies and T -cells that recognize and attack cells or molecules normall y present in our bodies a situation that can result in autoimmune diseases. This chapter will examine these challenges. focusing first on the structures of proteins that recognize foreign organisms and then on the mechanisms for protecting us from a specific pathogen once it has been recognized. The chapter will closely examine the modular construction of the proteins of the immune system identifying structural motifs and considering how spectacular diversity can arise from modular construction . Innate Immunity Is an Evolutionarily Ancient Defense System
Innate immunity is an evolutionarily ancient defense system found. at least in some form. in all multicellular plants and animals. The genes for its key molecules are expressed without substantial modification. unlike genes for key components of the adaptive immune system. which un dergo significant rearrangement. Through many millions of years of evolution. proteins expressed by these genes have gained the ability to recognize specific features present in most pathogens and yet not respond to materials normally present in the host. The most important and best- understood receptors in the innate immune system are the Toll-like recepturs (TLRs). At least 10 TLRs have been identified in human beings. although only a single such receptor is present in C. elegans, for example. The name "toll-like" is derived from a receptor known as Toll encoded in the Drosophila genome; Toll was first identified in a screen for genes important for Drosuphila development and was subsequently discovered to also playa key role in the innate immune system later in development. The TLRs have a common structure (Figure 33.1 ). Each receptor consists of a large domain built primarily from repeated amino acid sequences termed leucine-rich repeats (LRRs) because each repeat includes six residues that are usually leucine. The human TLRs have from 18 to 27 LRR repeats. These repeats are followed by a sequence forming a single transmembrane hel ix and then by a signaling domain common to the TLRs as well as to a small number of other receptors. This signal ing domain is not a protein kinase but acts as a docking site for other proteins. A protein that docks to a TLR initiates a signal transduction pathway that ultimately leads to the activation of specific transcription factors . Most TLRs are expressed in the cell membrane for the detection of extracellular pathogens such as fungi and bacteria. Other TL Rs are located in the membranes of internal compartments for the detection of intracellular pathogens such as viruses and some bacteria. Each TLR is targeted to a specific molecular characteristic. often called a pathogen-associated molecular pattern (PAMP). found primarily on invading organisms. One particularly important PAMP is lipopolysaccharide (LPS). a specific class of glycolipids found in the cell walls of Gram-negative bacteria such as E. coli (Figure 33.2). LPS is built around a specialized lipid. called lipid A, that contains two linked N-acetylglucosamine residues and four fatty acyl chains. Lipid A is connected to a polysaccharide chain consisting of a core structure and a more variable region referred to as the O-specific chain. LPS is also known as endotoxin. The response of the innate immune system to LPS can be easily demonstrated. Injection of less than
Lipid A
- - il Inner core
Outer core 1 1 --
O-specific chain
947
One repeat unit
The Immune System
Jl strand
~
Leu
Asn
Leu
~
strand
Leu
Leu
(A)
(8)
1 mg of LPS into a human being produces a fever and other signs of inflammation even though no living organisms are introduced . LPS is recognized primarily by TLR-4, whereas other TLRs recognize other classes of PAMP. For example, TLR -S recognizes the protein fla gellin, found in flagellated bacteria, and TLR-3 recognizes double-stranded RNA. Note that, in each case, the target of the TLR is a key component of the pathogen, and so mutations cannot easily block recognition by the TLR and, hence, escape detection by the innate immune system. In some cases, TLRs appear to form heterodimers that either enhance or inhibit PA M P • • recogmtIOn. How do TLRs recognize PAMPs? The leucine-rich repeat domain from human TL R-1 has a remarkable structure (Figure 33.3). Each of its LRR units contributes a single [3 strand to a large parallel [3 sheet that lines the inside of a concave structure. This hooklike structure immediately suggests a model for how TLRs bind PAMPs namely, that the PAMP lies on the inside of the "hook." This model is likely accurate for some TLRs. However, for other TLRs, the PAMP-binding site appears to lie on one side of the structure, and the central hole is blocked by host carbohydrates linked to the structure. Regardless of the details of the interaction, PAMP binding appears to lead to the formation of a specific dimer of the TLR. The cytoplasmic side of this dimer is a signaling domain that initiates the signal-transduction pathway. Because the TLRs and other components of the innate immune system are always expressed, ready to target conserved structures from pathogens, they provide the host organism with a rapid response system to resist attack by pathogens. We now tu rn to the adaptive immune system, which, remarkably, is able to target specific pathogens, even those that it has never encountered in the course of evolution. The Adaptive Immune System Responds by Using the Principles of Evolution
The adaptive immune system comprises two parallel but interrelated systems: humoral and cellular immune responses. In the humoral immune response, soluble proteins called antibodies (immunoglobulins) function as recognition elements that bind to foreign molecules and serve as markers
Figure 33.3 PAMP-recognition unit of the Toll -like receptor. (A) The structure of the leucine-rich repeat (LRR) domain from human TLR-3. Notice that the LRR units come together to form a centra l parallel J3 sheet that curls to form a concave structure. (B) The structure of a single LRR showing the positions of the residues that are generally approximately conserved. Notice that the leucine residues come together to form a hydrophobic core with the single J3 strand along on one side. [Drawn from lZIW.pdb].
Figure 33.4 Immunoglobulin production. An electron micrograph of a plasma cell sho ws the highly develo ped rough endoplasmic reti culum necessary fo r antibody secreti on. [Courtesy o f Lynne Mercer.]
948
signaling foreign invasion (Figure 33.4). Antibodies are secreted by plasma cells, which are derived from B lymphocytes (B cells). A foreign macromolecule that binds selectively to an antibody is called an antigen. In a physiological context, if the binding of the foreign molecule stimulates an immune response, that molecule is called an immunogen. The specific affinity of an antibody is not for the entire macromolecular antigen but for a particular site on the antigen called the epitope or antigenic determinant. In the cellular immune response, cells called cytotoxic T lymphocytes (also commonly called killer T cells) kill cells that have been invaded by a pathogen. Because intracellular pathogens do not leave markings on the exteriors of infected cells, vertebrates have evolved a mechanism to mark the exterior of cells with a sample of the interior contents, both self and foreign. Some of the internal proteins are broken into peptides, which are then bound to a complex of integral membrane proteins encoded by the major histocompatbility complex (MHC). T cells continually scan the bound peptides (pMHCs) to find and kill cells that display foreign motifs on their surfaces. Another class of T cell s called helper T lymphocytes contributes to both the humoral and the cellular immune responses by stimulating the differentiation and proliferation of appropriate B cells and cytotoxic T cells. The celluar immune response is mediated by specific receptors that are expressed on the surfaces of the T cells. The remarkable ability of the immune system to adapt to an essentially limitless set of potential pathogens requires a powerful system for transforming the immune cells and molecules present in our systems in response to the presence of pathogens. This adaptive system operates through the principles of evolution, including reproduction with variation followed by selection of the most well suited members of a population. If the human genome contains, by the latest estimates, only 25,000 8 genes, how can the immune system generate more than 10 different anti12 body proteins and 10 T -cell receptors? The answer is found in a novel mechanism for generating a highly diverse set of genes from a limited set of genetic building blocks. Linking different sets of DNA regions in a combinatorial manner produces many distinct protein -encoding genes that are not present in the genome. A rigorous selection process then leaves for proliferation only cells that synthesize proteins determined to be useful in the immune response. The subsequent reproduction of these cells without additional recombination serves to enrich the cell population with members expressing particular protein species. Critical to the development of the immune response is the selection process, which determines which cells will reproduce. The process comprises several stages. In the early stages of the development of an immune response, cells expressing molecul es that bind tightly to self-molecules are destroyed or silenced, whereas cells expressing molecules that do not bind strongly to self-molecules and that have the potential for binding strongly to foreign molecules are preserved. The appearance of an immunogenic invader at a later time will stimulate cells expressing antibodies or T-cell receptors that bind specifically to elements of that pathogen to reproduce in evolutionary terms, such cells are selected for. Thus, the immune response is based on the selection of cells expressing molecules that are specifically effective against a particular invader; the response evolves from a population with wide-ranging specificities to a more-focused collection of cells and molecules that are well suited to defend the host when confronted with that particular challenge. Not only are antibodies and T -cell receptors a result of genetic diversity and recombination, but antibodies have highly diverse structures as well. Antibodies require many different structural solutions for binding many
949
different antigens, each of which has a different form. T-cell receptors, in contrast, are not structurally diverse, because they have coevolved with the MHC. The docking mode of a T-cell receptor to the peptide bound to MHC is similar for all structures. As a consequence of this coevolution, every T-cell receptor has an inherent reactivity with every MHC. The coevolution ensures that all T -cell receptors can scan all peptide~MHC complexes on all 12 tissues . The genetic diversity of the 10 different T -cell receptors is con centrated in a highly diverse set of residues in the center of the MHC groove. This localized diversity allows the T -cell receptor to recognize the many different foreign peptides bound to the MHC. T -cell receptors must survey many different MHC~peptide complexes with rapid turnover. Therefore, the binding affinities between T -cell receptors and the MHC are weaker than those between antibody and antigen.
33.1
Antibodies Possess Distinct Antigen-Binding and Effector Units
Antibodies are central molecular players in the immune response, and we examine them first. A fruitful approach in studying proteins as large as an tibodies is to split the protein into fragments that retain activity. In 1959, Rodney Porter showed that immunoglobulin G (lgG), the major antibody in serum, can be cleaved into three 50-kd fragments by the limited proteolytic action of papain. Two of these fragments bind antigen. They are called Fah (F stands for fragment, ab for antigen binding). The other fragment, called Fcbecause it crystallizes readily, does not bind antigen, but it has other important biological activities, including the mediation of responses termed effector functions. These functions include the initiation of the complement cascade, a process that leads to the lysis of target cells. Although such effector functions are crucial to the functioning of the immune system, they will not be considered further here. How do these fragments relate to the three-dimensional structure of whole IgG molecules? Immunoglobulin G consists of two kinds of polypep tide chains, a 25-kd light (L) chain and a 50-kd heavy (H) chain (Figure 33. 5). The subunit composition is L 2 H 2 . Each L chain is linked to an H chain by a disulfide bond, and the H chains are linked to each other by at least one disulfide bond. Examination of the amino acid sequences and three-dimensional structures of IgG molecules reveals that each L chain comprises two homologous domains, termed immunoglobulin domains, to be
(8)
(A)
light chain N ~--=,
N""" Heavy chain
~ Figure 33.5 Immunoglobul in G
structure. (A) The threedimensio nal stru cture o f an IgG mo lecule showing the light chains in yellow and the heavy chains in blue. (B) A schematic view of an IgG molecule indi cating the positions of the interchain disulfide bonds. Abbreviations: N, amino terminus; C, carboxyl terminu s. [Drawn from lIGTpdb.]
Interchain disulfide bonds
/,- " C
•
33.1 Antibody Units
950
TABLE 33.1 Properties of immunoglobulin classes
CHAPTER 33 The Immune System Class IgG IgA IgM IgD IgE
Serum concentration (mgml - ') 12
3 1 0.1 0 .001
Mass (kd)
Sedimentation
Light
Heavy
Chain
coefficient(s)
chains
chains
structu re
150 180- 500 950 175 200
7 7. 10, 13 18- 20 7 8
or A K or A..
"Y
K,}"y,}
Kor A
'I'-"
(""' ,)n or (X ,a,~ ("1'-,).; or (X,I',),
K
or X.
&
K 20 2
or
K
or X.
E
K2E2
or A2EZ
K
or
>" 2"17
A28 2
Note: n = 1, 2, or 3. ISM and oligomers of IgA also contai n J chains that connect immunoglobulin mo lecules. IgA in
secretions has an additional component
Papain cleavage
? 3~ , i
2, ~ ,$
Figure 33.6 Immunoglobulin G cleavage. Treatment of intact IgG mo lecules with the protease papain resu lts in the f o rmation of three large fragments: two F,b fragments that retain antigen-bind ing capability and o ne Fe fragment that does not.
Antigen ..........
described in detail in Section 33,2, Each H chain has four immunoglobulin domains. Overall, the molecule adopts a conformation that resembles the letter Y, in which the stem, corresponding to the Fe fragment obtained by cleavage with papain, consists of the two carboxyl -terminal immunoglobulin domains of each H chain and in which the two arms of the Y, corresponding to the two Fab fragments, are formed by the two amino-terminal domains of each H chain and the two amino- terminal domains of each L chain. The linkers between the stem and the two arms consist of extended polypeptide regions within the H chains and are quite flexible . Papain cleaves the H chains on the carboxyl -terminal side of the disulfide bond that links each Land H chain (Figure 33.6). Thus, each Fab consists of an entire L chain and the amino-terminal half of an H chain, whereas Fe consists of the carboxyl -terminal halves of both H chains. Each F:,h contains a single antigen -binding site. Because an intact IgG molecule contains two F:,b components and therefore has two binding sites, it can cross-link multiple antigens (Figure 33.7). Furthermore, the Fe and the two Fab units of the intact IgG are joined by flexible polypeptide regions that allow facile variation in the angle between the Fah units through a wide range (Figure 33.8). This kind of mobility, called segmental flexibility, can enhance the formation of an antibody- antigen complex by enabling both combining sites on an antibody to bind an antigen that possesses multiple binding sites, such as a viral coat composed of repeating identical monomers or a bacterial cell surface. The combining sites at the tips of the F;,b units simply move to match the distance between specific determinants on the antigen. Immunoglobulin G is the antibody present in highest concentration in the serum, but other classes of immunoglobulin also are present (Table 33.1). Each class includes an L chain (either K or A) and a distinct H chain (Figure 33.9). The heavy chains in IgG are called 'Y chains, whereas those in immunoglobulins A, M, D, and E are called 0', f.L , 1>, and E, respectively.
Antigen-binding sites
Hinge
Figure 33.7 Antigen cross-linking. Because IgG molecules include two antigen-binding sites, antibo dies can cross -link multivalent antigens such as vi ral surfaces.
Figure 33.8 Segmental flexibility. The linkages between the Fab and the Fe regi ons of an IgG molecule are flexible, allOWing the two antigen-binding si t es t o adopt a range of orientations with respect to one another. This fle Xi bility allows effective interactions with a multivalent antigen without requiring that the epitopes o n the target be a precise distance apart.
IgA (dimer)
IgG
IgM (pentamer)
IgO
o chain
y chain f
IgE
l::
chain
chain Jl chain
Immunoglobulin M (IgM) is the first class of antibody to appear in the serum after exposure to an antigen. The presence of 10 combining sites enables IgM to bind especially tightly to antigens containing multiple identical epitopes. The strength of an interaction comprising multiple independent binding interactions between partners is termed avidity rather than affinity, which denotes the binding strength of a single combining site. Immunoglobulin A (IgA) is the major class of antibody in external secretions, such as saliva, tears, bronchial mucus, and intestinal mucus . Thus, IgA serves as a first line of defense against bacterial and viral antigens. The role of immunoglobulin D (IgD ) is not yet known. Immunoglobulin E (IgE) is important in conferring protection against parasites, but IgE also participates in allergic reactions. Ig E- antigen complexes form cross-links with receptors on the surfaces of mast cells to trigger a cascade that leads to the release of granules containing pharmacologically active molecules. Histamine, one of the agents released, induces smooth-muscle contraction and stimu lates the secretion of mucus. A comparison of the amino acid sequences of different IgG antibodies from human beings or mice shows that the carboxyl-terminal half of the L chains and the carboxyl-terminal three-quarters of the H chains are very similar in all of the antibodies. Importantly, the amino-terminal domain of each chain is more variable, including three stretches of approximately 7 to 12 amino acids within each chain that are hypervariable, as shown for the H chain in Figure 33.10. The amino-terminal immunglobulin domain of each
Figure 33.9 Classes of immunoglobulin. Each of five cla sses of immunoglobulin has the same light chain (shown in yellow) combined with a different heavy chain b, Ct., fL, &, or E). Disulfide bonds are indicated by green lines. The IgA dimer and the IgM pentamer have a small polypeptide chain in additio n to the light and heavy chains.
150
100
..-
-
.0
."' 50
o o
20
40
60
Residue
80
100
120
Figure 33.10 Immunoglobulin sequence diversity. A plot of sequence variability as a function of position along the sequence of the amino-terminal immuno globulin domain of the H chain of human IgG molecules. Three regions (in red) show remarkably high levels of variability. These hypervariable regions correspond to three loops in the immunoglobulin domain structure. [After R. A. Goldsby, T. J. Kindt, and B. A. Osborne, Kuby Immunology, 4th ed. (w. H. Freeman and Company, 2000), p. 9l.]
951
chain is thus referred to as the variable region, whereas the remaining immunoglobulin domains are much more similar in all antibodies and are referred to as constant regions (Figure 33. 11 ).
33_2
Figure 33.11 Variable and constant regions. Each Land H chain includes one immunoglobulin domain at its amino terminus that is quite variable from one antibo dy to another. These domains are referred to as Vl and VH . The remaining doma ins are more constant from one antibo dy to another and are referred to as constant domains (Cll. CH1. CH2. and CH3).
The Immunoglobulin Fold Consists of a BetaSandwich Framework with Hypervariable Loops
An IgG molecule consists of a total of 12 immunoglobulin domains. These domains have many sequence features in common and adopt a common structure, the immunoglobulin fold (Figure 33.12). Remarkably, this same structural domain is found in many other proteins that play key roles in the immune system and in nonimmune functions . The immunoglobulin fold consists of a pair of f3 sheets, each built of antiparallel f3 strands, that surrou nd a central hydrophobic core. A single disulfide bond bridges the two sheets. Two aspects of this structure are particularly important for its function. First, three loops present at one end of the structure form a potential binding surface. These loops contain the hypervariable sequences present in antibodies and in T -ceLl receptors (see Section 33.3 and p. 963). Variation of the amino acid sequences ofthese loops provides the major mechanism for the generation of the vastly diverse set of antibodies and T-cell receptors expressed by the immune system . These loops are referred to as hypervariable loops or complementarity-determining regions (CDRs). Second, the amino terminus and the carboxyl terminus are at opposite ends of the structure, which allows structural domains to be strung together to form chains, as in the Land H chains of antibodies. Such chains are present in several other key molecules in the immune system. The immunoglobulin fold is one of the most prevalent domains encoded by the human genom e: more than 750 genes encode proteins with at least one immunoglobulin fold recognizable at the level of amino acid sequence. Such domains are also common in other multicellular arumals such as flies and nematodes. However, from inspection of amino acid seq uence alone, immunoglobulin-fold domains do not appear to be present
N terminus
_ - -- Hypervariable loops ------.
Disulfide bond
~ Figure 33.12 Immunoglobulin fold.
An immunoglobulin domain consists of a pair of 13 sheets linked by a disulfide bond and hydrophobic interactions. Notice that three hy pervariable loops lie at one end of the structure. [Drawn from lDQJ.pbd.]
952
C terminus
Front view
Side vie¥'J.·
in yeast or plants, although these organisms possess other structurally similar domains, including the key photosynthetic electron-transport protein plastocyanin in plants (p. 551). Thus, the immunoglobulin -fold family appears to have expanded greatly along evolutionary branches leading to animals particularly, vertebrates.
33.3
953 33.3 Antibody Binding
Antibodies Bind Specific Molecules Through Their Hypervariable Loops
For each class of antibody, the amino-terminal immunoglobin domains of the Land H chains (the variable domains, designated V L and V H) come together at the ends of the arms extending from the structure. The positions of the complementarity -determining regions are striking. These hypervariable sequences, present in three loops of each domain, come together so that all six loops form a single surface at the end of each arm (Figure 33.13). Because virtually any V L can pair with any V H, a very large number of different binding sites can be constructed by their combinatorial association.
~ Figure 33.13 Variable domains. Two
Side view
End-on view
X-ray Analyses Have Revealed How Antibodies Bind Antigens
The results of x-ray crystallographic studies of several hundred large and small antigens bound to F ab molecules have been sources of much insight into the structural basis of antibody specificity. The binding of antigens to antibodies is governed by the same principles that govern the binding of substrates to enzymes. The apposition of complementary shapes results in numerous contacts between amino acids at the binding surfaces of both molecules. Many hydrogen bonds, electrostatic interactions, and van der Waals interactions, reinforced by hydrophobic interactions, combine to give specific and strong binding. A few aspects of antibody binding merit specific attention, inasmuch as they relate directly to the structure of immunoglobulins. The binding site on the antibody has been found to incorporate some or all of the CDRs in the variable domains of the antibody. Small molecules are likely to make contact with fewer CD Rs, with perhaps 15 residues of the antibody participating in the binding interaction. Macromolecules often make more extensive contact, sometimes interacting with all six CDRs and 20 or more
views of the variable domains of the L chai n (yellow) and the H chain (blue); the complementarity-determining regi ons (CDRs) are shown in red. Notice on the left that the six CDRs come together to form a binding surface. The specificity of the surface is determined by the sequences and structures of the CDRs. [Drawn from lDQJ .pdb.]
954 CHAPTER 33 The Immune System
residues of the antibody. Small molecules often bind in a cleft of the antigen· binding region. Macromolecules, such as globular proteins, tend to interact across larger, fairly flat apposed surfaces bearing complementary protru· sions and depressions. The search for an HIV vaccine has recently extended our understanding of antibodies and the way that they bind small molecules. The persistent problem in HJV vaccine design has been the lack of a neutralizing antibody response. 1n other words, most human antibodies do not recognize the HIV virus. A few rare antibodies isolated from asymptomatic, HIV-infected people show the neutralizing response. One of these antibodies, b1 2, gives an example of an antigen -binding surface that is not flat. Instead, b 12 has a very long CD R3100p that forms a "fingerlike" projection that can probe the canyons and valleys on the virus's surface. Another of these rare HIV-reactive antibodies, called 2G 12, also has an unusual form; instead of the normal "Y" shape of the IgG molecule, 2G 12 has its two arms pointing vertically and adjacent to one another. The two Fab "arms" form a tightly packed dimer because their V H domains are swapped . A well -studied case of small-molecule binding is seen in an example of phosphorylcholine bound to Fab. Crystallographic analysis revealed phos· phorylcholine bound to a cavity lined by residues from five CDRs two from the L chain and three from the H chain (Figure 33.14). The positively charged trimethylammonium group of phosphorylcholine is buried inside the wedge-shaped cavity, where it interacts electrostatically with two negatively charged glutamate residues. The negatively charged phosphoryl group of phosphorylcholine binds to the positively charged guanidinium group of an arginine residue at the mouth of the crevice and to a nearby lysine residue. The phosphoryl group is also hydrogen bonded to the hydroxyl group of a tyrosine residue and to the guanidinium group of the arginine side chain. Numerous van der Waals interactions, such as those made by a tryptophan side chain, also stabi li ze this complex.
Asp 197
Phosphorylcholine Trp Hl07
~ Figure 33.14 Binding of a small
antigen. The structure of a complex between an Fab fragment of an antibody and its target- in this case. phosphorylcholine. Residues from t he antibody interact with phosphorylcholine through hydrogen bonding and electrostati c and van der Waals interactions. [Drawn from 2MCP.pdb.]
Asn Hl0l
Tyrll00 Tyr H33
Residues from five CDRs participate in the binding of phosphorylcholine to human Fah . This binding does not significantly change the struc· ture of the antibody, yet induced fit plays a role in the formation of many antibody- antigen complexes. A malleable binding site can accommodate many more kinds ofligands than can a rigid one. Thus, induced fit increases the repertoire of antibody specificities. Large Antigens Bind Antibodies with Numerous Interactions
How do large antigens interact with antibodies? A large collection of antibod· ies raised against hen egg-white lysozyme has been structurally characterized in great detail (Figure 33.15). Each different antibody binds to a distinct
~ Figure 33.15 Antibodies against
lysozyme. (A) The structures of three complexes (i, ii, iii) between F. b fragments (blue and yellow) and hen eggwhite lysozyme (red) shown with lysozyme in the same orientation in each case. The three antibodies recogn ize completely different epitopes on the lysozyme molecule. (B) The F. b fragments from part A (corresponding from left to right to i, ii, and iii) with points of contact highlighted as space-filling models. Notice the different shapes of the antigen-binding sites. [Drawn from 3HFL, lDQJ, and lFDL.pdb.]
(ii)
(iii)
(A)
(8)
surface oflysozyme. Let us examine the interactions in one of these complexes (complex ii in Figure 33.15A) in detail. This antibody binds two polypeptide segments that are widely separated in the primary structure, residues 18 through 27 and 116 through 129 (Figure 33.16). All six CDRs of the antibody make contact with this epitope. The region of contact is quite extensive (about 30 X 20 A). The apposed surfaces are rather flat . The only exception is the side chain of glutamine 121 of lysozyme, which penetrates deeply into the antibody's binding site, where it forms a hydrogen bond with a main -chain carbonyl oxygen atom and is surrounded by three aromatic side chains. The formation of 12 hydrogen bonds and numerous van der Waals interactions contributes to the high affinity (Kd = 20 nM) of this antibody- antigen interaction. Examination of the Fab 955
--.". Figure 33.16 Antibody- protein ' "''t .... ._ . . ,'_ .,' / , .... . . . " - " ' , ' - ' "....... , ... (,
•
• ••
" ''; ' ' '"
.. ,.
.
~.
"; ' , .
• .. , · .... f ... .
"'.~ ' ,~" ~.'
I . .... ... - ..,. . ... . ,. ' . . ' ./.'. ~··' .· ·i I ' ",.-"............ ,~... ·.".' · . .'0'-.'. ........ """ ' 0",, ' J ,"-,,' """ '" \ . .... . . ....., · . . ..,.,..•......;. .. .,_.. , ", ,. .
,,~
. . ... .. . . .. ........ .... ," ................ ,.. · ., .. . ..','. -" ,
~,
.,~
~
'.",.~
'
" .~ ,: .
~'
.
'
..· ....
•••. ,."' A ..... ,,' ,.-" . .. ... , , . , . , . " "' ......... - "
~.'-
'
,t!. '.'• •~. , ,
~
.. .
,,,,", ,
-"
't",,~
~
•
!,o ••' .••• ; .' 0;'...... ,; •• "
,
. . , ''''' ' ''
,- .. ~ . . . :':,': t ." " "" " · .. ,·t .. ·.,· . , .." ••. ' .(' "". ' :'·\· ."of " " I ..... " .(,f> L · ~
:'_ '. t'; .:., .....;:-".•'" ." ,,~' I~";" '{.~.' ,,,'. , .' . , ...· • 1 ...... ··:' .!"",:. . ' . . ' 'I .; ; '/ ''''-' ','" ~ \
..
.. .. ... J . . .... . ' . . . . .. . ..
;. .:",; { ::,~ "~ :!-:;f'.~~J"~~~' ~"'."-
A Motor Protein Consists of an ATPase Core and an Extended Structure
·' 0 ' · ,"-'.} '''1'
~
Figure 34.2 Myosin structure at low resolution. Electron m icrographs o f myosin mo lec ules reveal a two-headed st ructure w it h a long, t hi n tai l. [Courtesy of Dr. Pau la Flicker, Dr. Theo Wa lii man, and Dr. Peter Vi bert .]
978
Eukaryotic cells contain three major families of motor p roteins: myosins, kinesins, and dyneins. A t first glance, these protein families appear to be quite d ifferent from one another. Myosin, first characteri zed on the basis of its role in muscle, moves along fil aments of the protein actin . Muscle myosin consists of two copies each of a heavy chain with a molecular mass of 87 kd, an essential light chain, and a regulatory light chain. The human genome appears to encode more th an 40 distinct myosins; some function in muscle contraction, and others participate in a variety of other processes. Kinesins, which have roles in protein, mR NA, and vesicle transport as well as construction of the mitotic spindle and chromosome segregation, are generally dimers of two polypeptides. The human genome encodes more than 40 kinesins. Dyneins power the m otion of cilia and fl agella, and a general cyto· plasmic d ynein contributes to a variety of moti ons in all cells incl uding vesicle transport and various transport events in mitosis. Dyneins are enormous, with heavy chains of molecular mass greater than 500 kd. T he hu man genome appears to encode approximately 10 d yneins. Comparison of the amino acid sequences of myosins, kinesins, and dyneins did not reveal significant relationships between these protein fam· ilies but, after their three-dim ensional stru ctures were determined, memo bers of the myosin and kinesin families were found to have remarkable similarities. In particular, both myosin and kinesin contain P-loop NTPase cores homologous to those found in G proteins. Sequence analysis of the dynein heavy chain reveals it to be a member of the AM subfamily of P-Ioo p N TPases that we encountered in the context of the 19S proteasome (p. 653). Dynein has six sequences encoding such P -loop N T Pase domains arrayed along its length , although only four actually bind a nu cleotide. T hus, we can d raw on our knowledge of G proteins and other P- Ioop NTPases as we analyze the mechanisms of action of these motor proteins.
Let us first consider the structure of myosin. T he results of electron microscopic studi es of skeletal- muscle m yosin show it to be a two-headed structure linked to a long stalk (Figure 34.2). A s we saw in C hapter 33, limited proteolysis can be a powerful tool in probing the acti vity of large proteins. The treatment of myosin with trypsin and papain results in the formation of four fragments: two 51 fr agments; an 52 fragment, also called heavy
979 Trypsin
51
v. V.OW,," '
",l'''''''M\,
110 ....-_'"
S ,W'l:'f jiii
t_
52
,
•
Light meromyosin (LMM) _ _ _ __ _ __ L
_ _ _ _ _,
Y
Heavy meromyosin (HMM)
Figure 34.3 Myosin dissection. Treatment of muscle myosin with proteases forms stable fragme nts, including subfragments Sl and S2 and light meromyosin. Each Sl fragment inc ludes a head (shown in yellow o r purple) from the heavy chain and one copy of each light chain (shown in blue and o range).
meromyosin (HMM ); and a fragment called light meromyosin (LMM; Figure 34.3). Each S 1 f ragment corresponds to one of the heads from the intact stru cture and includes 850 amino-terminal amino acids from one of the two heavy chains as well as one copy of each of the light chains. Examination of the structure of an Sl fragment at high resolution reveals th e presence of a P-Ioop NTPase-domain core that is the site of ATP binding and hydrolysis (Figure 34.4). Essential light chain Regulatory light chain P-Ioop
~
Actinbinding
Figure 34.4 Myosin structure at high resolution. The stru cture of t he Sl fragment from muscle myosin revea ls the presence of a P-Ioop NTPase domain (shaded in purple). Notice that an a helix that extends from thi s domain is the binding site for the two light chains. [Drawn from 1DFL.pdb.]
Nucleotidebinding site
Extending away from this structure is a long a helix from the heavy chain. This helix is the binding site for the two light chains. The light chains are members of the EF -hand family, simil ar to calmodulin, although most of the EF hands in ligh t chains do not bind metal ions (Figure 34.5) Like calmodulin, these proteins wrap around an a helix, serving to thicken and stiffen it. The remaining fragments of myosin S2 and light meromyosinare largely a helical, forming two -stranded coiled coils created by the
Essential light chain
Regulatory light chain
Calmodulin
Mg2+
-,)",.. Figure 34.5 Myosin light chains. "0 The structures of the essential and regulatory light chains of muscle myosin are compared wi th the structure of calmodulin. Each o f these homologous protei ns binds an a hel ix (not shown) by w rapping around it . [Drawn from 1DFL.pdb and lCM1 .pdb.]
-~ Figure 34.6 Myosin two-stranded
coiled coil. The two Ct helices form left-handed supercoi led structures that sp iral aro und each other. Such stru ctu res are stabilized by hyd rophob ic residues at t he contact points between the t wo hel ices. [Draw n from 2TMA .pdb.]
Nucleotidebinding site
P-Ioop
remaining lengths of the two heavy chains wrapping around each olher (Figure 34.6). These structures, together extending approximately 1700 A, link the myosin heads to other structures . In muscle myosin , several LMM domains come together to form higher-order bundles. Cunventional kinesin (kin esin 1), the first kinesin discovered, has a structure having several features in common with myosin. The dimeric protein has two heads, connected by an extended stru cture. The size of the head domain is approximately one-third of that of myosin. D etermination of the three-dimensional structure of a kinesin frag ment revealed that the head domain also is built around a P- loop NTPase core (Figure 34 .7). The myosin domain is so much larger than that of kinesin because of two large insertions in the myosin domain thal bind to actin filaments. For conventional kinesin, a region of approximately 500 amino acids extends from the head domain . Like the corresponding region in myosin, the extended part of kinesin form s an a -helical coil ed coil. Conventional kinesin also has light chains, but, unlike those of myosin , these light chains bind near the carboxyl terminus of the heavy chain and are thought to link the motor to intracellular cargo. Dynein has a rather different structure. As noted earlier, the dynein heavy chain includes six regions that are homologous to the AAA subfamily of ATPase domains. Although no crystallographic data are yet available, the results of electron microscopic studies and comparison with known structures of ot her AAA ATPases have formed the basis for th e construction of a model of the dynein head str ucture (Figure 34. 8) . T he head domain is appended to a region of approximately 1300 amino acids that forms an extended structure that links dynein units together to form oligomers and interacts with other proteins. ATP Binding and Hydrolysis Induce Changes in the Conformation and Binding Affinity of Moto r Proteins
A key feature of P -Ioop N TPases such as G proteins is that they undergo structural changes ind uced by NTP binding and hydrolysis . Moreover, these structural changes alter their affinities for binding partners. Thus, it is not surprising that the N TPase domains of motor proteins display analogo us res ponses to nucleotide binding. The Sl fragment of myosin from
4
5
~ Figure 34.7 Structure of head
domain of kinesin at high resolution. Not ice that the head domain of kinesin has th e st ructure o f a P-Ioop NTPase core (indicated by purple shading). [Drawn fro m 11 6I.pdb.]
2
6 ;;::--- ATP 1 ~ Figure 34.S Dynein head-domain m ode l. ATP is bo und in the first o f six P-Ioop
NTPase domains (numbered) in this mo del for the head domain of d ynein. The model is based on elect ron micrographs and the stru ctures of other members o f the AAA ATPase family. The precise role o f the six si t es is no t fully understood. [Drawn fro m lHN 5.pdb.]
980
Myosin-ADP- V0 4 1 - complex
Myosi n- AOP co mplex
981 34.1 Molecular-Motor Protein ,
Lever arm
Relay helix -'---- P-Ioop : - . Switch I and switch II
'"1
Figure 34.9 Lever-arm motion. Two forms of the Sl fragment of scallop-muscle ~ myosin. Notice the dramati c conformational changes when the identity of the bound nucleotide changes from ADP-VO,' to ADP or vice versa. including a nearly 90-degree reorientatio n o f the lever arm. [Drawn f rom lDFL.pdb and 1B7T.pdb.]
scallop muscle provides a striking example of the chan ges observed (Figure 34.9 ). The stru cture of the Sl frag ment has been determin ed for Sl bound 3 to a complex fo rmed of A DP and vanadate (V0 4 - ) , whi ch is an analog of ATP, or, more precisely, the ATP-hydrolysis transition state. In the pres 3 ence of the ADP- V0 4 - complex, the long helix that binds the light chains (hereafter referred to as the lever arm ) protrudes outward from the head do3 main. In the presence of ADP without V0 4 - , the lever arm has rotated by • 3 nearly 90 degrees relative to its position in the A DP- V0 4 - complex. How does the identity of the species in the nucl eotide-binding site ca use th is dramatic transition ? Two regions around the nu cleotid ebinding site conform closely to the group in the position Position of of the ", -phosphoryl gro up of AT P and adopt a looser lever arm wh en ADP is bound conformation wh en such a grou p is absent (Figure 34 .10). Thi s co nfo rm ational change all ows a long a helix (termed the relay helix ) to adjust it s position. T he carboxyl-terminal end of the relay helix interacts with structures at the base of the lever arm, and so a change in the position of the relay helix leads to a reorientation of the Position of lever arm . lever arm wh en The binding of AT P significantly decreases the affinADP- VO.'- is bound ity of the m yosin head for actin filamen ts. No structures of myosin- actin complexes have yet been determ ined at Relay helix high resolution , so the mechanistic basis fo r this change P-Ioop remains to be elucidated. H owever, the amin o-termin al end of the relay helix interacts with the domains of myosin Switch II ~ that bind to actin , suggestin g a cl ear pathway for the cou pling of nucleotide binding to changes in actin affinity. I The importance of the changes in actin -binding affinity Figure 34.10 Relay helix. A superp os it ion of key element, in two will be clear later when we examine the role of myosin in fo rms o f scallo p myosi n revea ls th e st ruct ural changes t hat are generating directed motion (Section 34.2). tran smitted by the rel ay helix f rom th e switch I and switch II loops Analogous conformational changes take place in ki to the base o f the lever ann. The sw it ch I and swit ch II loops nesin. The kinesins also have a relay helix that can adopt interact with VO/- in th e posit ion that wo uld be occupied by different configu ratio ns when kin esin binds different nu the 'Y- pho' phory l gro up o f ATP. Th e struct ure o f th e myos in- ADP- V0 4 ' - complex is show n in lighter colors. cleotid es. Kinesin lacks an a -helical lever arm , however.
Kinesin-ATP complex
,
.--'
,,
Relay helix
.-. .. '
, Neck linker ,
Kinesin-ADP complex
., .... ... ........ ' .. ••
•
"
'
•
•• •
P-Ioop Switch I and switch II ~ Figure 34.11 Neck linker. A
comparison of the stru ctu res of a kinesin bound to ADP and bound to an ATP analog. Notice that th e neck linker (orange), whi ch connects the head domain to the remainder of the kinesin molecule. is bound to the head domai n in the presence of t he ATP analog but is free in the presence of ADP on ly. [Drawn from 1161.pdb and 1I5S.pdb.]
Instead, a relatively short segment termed the neck linker changes conformation in response to nucleotide binding (Figure 34.11). The neck linker binds to the head domain of kinesin when ATP is bound but is released when the nucleotide-binding site is vacant or occupied by ADP. Kinesin differs from myosin in that the binding of ATP to kinesin increases the affinity between kinesin and its binding partner, microtubules. Before turning to a discussion of how these properties are used to convert chemical energy into motion, we must consider the properties of the tracks along which these motors move.
34.2
Myosins Move Along Actin Filaments
Myosins, kinesins, and dyneins move by cycling between states with different affinities for the long, polymeric macrom olecules that serve as their tracks. for myosin, the molecular track is a polymeric form of actin, a 42-kd protein that is one of the most abundant proteins in eukaryoti c cells, typi cally accounting for as much as 10% of the total protein . Actin polymers are continually being assembled and disassembled in cells in a highly dynamic manner, accompanied by the hydrolysis of AT P. On the microscopic scale, actin filaments participate in the dynamic reshaping of the cytoskeleton and the cell itself and in other motility mechanisms that do not include myosin. In muscle, myosin and actin together are the key components responsible for muscle contraction.
Muscle Is a Complex of Myosin and Actin Vertebrate muscle that is under voluntary control has a banded (striated) appearance when examined under a light microscope. It consists of multinucl eated cells that are bounded by an electrically excitable plasma membrane. A muscle cell contains many parallel myofibrils, each about 1 j-Lm in diameter. The functional unit, called a sarcomere, typically repeats every 2.3 I-Lm (23, 000 A ) along the fibril axis in relaxed muscle (Figure 34.1 2). A dark A band and a light I band alternate regularly. The central region of the A band, termed the H zone, is less dense that the rest of the band . The I band is bisected by a very dense, narrow Z line. The underlying molecular plan of a sarcomere is revealed by cross sections of a myofibril. These cross sections show the presence of two kinds of intera ctin~ protein filaments. The thick filam ents have diameters of about 15 nm (150 A ) and consist primarily of m yosin . The thin filaments have 982
(A)
983 34.2 Myosin and Actin Si ngle muscle fiber (cell) --.. Nucleus Plasma membrane
Myofibrils
Single myofibril
Sarcomere
-
I band - - -.. , ,- - - - - - A
band ------~,···--- I
-.-.- -H zone---->.
Z line ~
band Z line
~
(8)
•
•
• ::- ..
•
(C)
•
• •
• • • • •• • • • •• • • • • • • • • • • • • • •• • • • •• •• • • • • • • 1
~Im
• • •
•
•• •• •• •• • • • • • • • •• •• •• • •• • • • •••• •• • •
• •
•
• • • •
•
•
•
•
•
• • • • • • • • • • • • • • • • • Thick filaments only
•
• • • • • • • • • • • • • • • • •
• • • • •• • • • • • • • •
• • • • • • • •• •• . •• . •• . • .• ••• • • • • • • •
•
· . .• •
• •
•
• •
Thick and thin filaments
•
•
•
'
•
'. • •
•
• • •• •
Thin filaments only
Figure 34.12 Sarcomere. (A) Structure of muscle cell and myofibril containing sarcomeres. (B) Electron micrograph of a longitudinal section of a skeletal-muscle myofibril, showing a single sa rcomere. (C) Schemati c representations of cross sections correspond to the regions in the micrograph . [Courtesy of Dr. Hugh Huxley.]
diameters of approximately 8 nm (80 A) and consist of actin as well as tropomyosin and the troponin comp lex. Muscle contraction is achieved through the sliding of the thin filaments along the length of the thick filaments, driven by the hydrolysis of ATP (Figure 34.13). To form the thick fi laments, myosin molecules self-assemble into thick bipolar structures with the myosin heads protruding at both ends of a bare region in the center (Figure 34.14A). Approximately 500 head domains line the surface of each thick filament . Each head-rich region associates with two
Figure 34 .13 Sliding-filament model. Muscle contraction depends on the motion of thin filaments (blue) relative to thick filaments (red). [After H. E. Huxley. The mechanism of muscular contraction. Copyright © 1965 by Scientific American, Inc. All rights reserved.]
984 CHAPTER 34
(A) Molecular Motors
(8)
,---- - - -- -- --
Z line
Thin
-
Sarcomere - - - --
Thick filament
-
- - -- -
Z line
Figure 34.14 Thick filament. (A) An electron micro graph of a reco nstituted th ick filament reveals t he presence of myosin head domains at each end and a relatively narrow cen tral region. A schematic view below shows how myosin molecules come together t o form the thick filament. (B) A diagram showing the interaction of thick and thin filaments in skeletal-muscle cont raction. [(A, top) Courtesy of Dr. Hugh Huxley.]
actin filaments, one on each side of the myosin molecules (Figure 34.14B). The interaction of individual myosi n heads with actin units creates the slid· ing force that gives ri se to muscle contraction. Tropomyosin and the troponin complex regul ate this sliding in response to nerve impulses. U nder resting conditions, tropomyosin blocks the inti· mate interaction between myosin and actin. A nerve impulse leads to an in· crease in calcium ion concentration within the muscle cell. A component of 2 the troponin complex senses the increase in Ca -, and, in response, relieves the inhibition of m yosin- actin interactions by tropomyosin. Although myosin was discovered through its role in muscle, other types of myosin play crucial roles in a number of physiological can· texts. Some defects in hearing in both mice and human beings have been linked to mutations in particular myosin homologs that are present in cells of the ear. For example, Usher syndrome in human beings and the shaker mutation in mice have been linked to myosin VIla, expressed in hair cells (Section 32.4). The mutation of this m yosin results in the formation of splayed stereocilia that do not function well. Myosin VIla differs from mus· cle myosin in that its tail region possesses a number of amino acid sequences that correspond to domains known to m ediate specific protein- protein in· teractions . Instead of assembling into fibers as muscle myosin does, myosin VIla functions as a dimer.
985
Actin Is a Polar, Self-Assembling, Dynamic Polymer
34.2 Myosin and Acti n
The structure of the actin monomer was determined to atomic resolution by x-ray crystallography and has been used to interpret the structure of actin filaments, already somewhat understood through electron microscopy studies at lower resolution . Each actin monomer comprises four domains (Figure 34.15 ). These domains come together to surround a bound nu cleotide, either ATP or ADP. The ATP form can be converted into the ADP form by hydrolysis. Nucleotidebinding site
--a.
Figure 34.15 Actin structure. (Left) '
•
3
Wild type
E
::L
0
~
•
OIl
c .." -.-
1
•
Vl
o L-_--'--_----'_ _ - - - ' - - - - - - ' o 1 2 3 4 Number of light-chain binding sites Figure 34.19 Myosin lever-arm length. Examination of the rates of actin movement supported by a set of myosin mutants with different numbers of lightchain binding sites revea led a linear relation; the greater the number o f lightcha in binding sites (and, hence, the longer the lever arm), the fa ster the sliding velocity. [After T. Q . P. Uyeda, P. D. Abramson, and J. A. Spud ich. Proe. Natl.
Acad Sci. U.S.A. 93(1996):4459- 4464.]
The Length of the Lever Arm Determines M ot o r Velocity
A key feature of myosin motors is the role of the lever arm as an amplifier. The lever arm amplifieso small structural changes at the nucleotide-binding site to achieve the 11 O-A movement along the actin filament that takes place in each ATP hydrolysis cycle. A strong prediction of the mechani sm proposed for the movement of myosin along actin is that the length traveled per cycle should depend on the length of this lever arm. Thus. the length of the lever arm should influence the overall rate at which actin moves relative to a collection of myosin heads. This prediction was tested with the use of mutated forms of myosin with lever arms of different lengths. The lever arm in muscle myosin includes binding sites for two light chains (Section 34.1). Thus investigators shortened the lever arm by deleting the sequences that correspond to one or both of these binding sites. They then examined the rates at which acti n fil aments were transported along collections of these mutated myosi ns (Figure 34.19). As predicted. the rate decreased as th e lever arm was shortened. A
988 •
mutated form of myosin with an unusually long lever arm was generated by inserting 23 amino acids corresponding to the binding site for an additional regulatory light chain. Remarkably, this form was found to support actin movement that was Jaster than that oj the wild-type protein. These results strongly support the proposed role of the lever arm in contributing to myosin motor activity.
34.3
Kinesin and Dynein Move Along Microtubules
In add ition to actin, the cytoskel eton includes other components, notably intermediate filaments and mi crotubules. Microtubules serve as tracks for two classes of motor proteins namely, kinesins and dyneins. Kinesins moving along microtubules usually carry cargo such as organelles and vesicles from the center of a cell to its periphery. Dyneins are important in sliding microtubules relative to one other during the beating of cilia and flagella on the surfaces of some eukaryotic cells. Additionally, dynein carries cargos from the cell periphery to the cell center.
W
Some members of the kinesin family are crucial to the transport of ~ organelles and other cargo to nerve endings at the peripheries of neurons. It is not surprising, then, that mutations in th ese kin esins can lead to nervous system disorders. For example, mutations in a kinesin called KlF1B13 can lead to the most common peripheral neuropathy (weakness and pain in the hands and feet ), C harcot-Marie-Tooth disease, which affects 1 in 2500 people. A glutamine-to -Ieucine mutation in the P-Ioop of the motor domain of this kinesin has been found in some affected persons. Knockout mice with a disruption of the orthologous gene have been generated. Mice heterozygous for the disruption show symptoms similar to those observed in human beings; homozygotes die shortly after birth. Mutations in other kinesin genes have been linked to human spastic paraplegia. In these disord ers, defects in kinesin-linked transport may impair nerve func tion directly, and the decrease in the activity of specific neurons may lead to other degenerative processes. Microtubules Are Hollow Cylindrical Polymers Micro tubules are built from two kinds of homologous 50 -kd subunits,
and l3-tubulin, which assemble in a helical array of alternating tubulin types to form the wall of a hollow cylinder (Figure 34.20). Alternatively, a microtubule can be regarded as 13 protofilaments that run parallel to its
0. -
(A)
u -Tubulin
(6)
~-Tubulin
Figure 34.20 Microtubule structure. Schematic views o f t he helical structure o f a microtubule. a-Tubulin is sho wn in dark red and j3-tubulin in light red. (A) Top view. (B) Side v iew.
300
A (30 nm)
989 34.3 Kinesin and Dynein
Figure 34.21 Microtubule arrangement. Electron micrograph of a cross section of a fl agellar axoneme shows nine microtubule doublets su rrounding two Singlet s. [Courtesy of Dr. Joel Rosenbaum.]
long axis. The outer diameter of a microtubule is 30 nm, much larger than that of actin (8 nm). Like actin, microtubules are polar structures. The minus end of a microtubule is anchored near the center of a cell, whereas the plus end extends toward the cell surface. Microtubules are also key components of cilia and flagella present on some eukaryotic cells. For example, sperm propel themselves through the motion of flagella containing microtubules. The microtubules present in these structures adopt a common architecture (Figure 34.21). A bundle of mi crotubules called an axoneme is surrounded by a membrane contiguous with the plasma membrane. The axoneme is composed of a peripheral group of nine microtubule pairs surrounding two singlet microtubules. This reo curring motif is often called a 9 + 2 array. Dynein drives the motion of one member of each outer pair relative to the other, causing the overall structure to bend. Microtubules are important in determining the shapes of cell s and in separating daughter chromosomes in mitosis. They are highly dynamic structures that grow through the addition of Ct- and (3 -tubulin to the ends of existing structures. Like actin, tubulins bind and hydrolyze nucleoside triphosphates, although for tubulin the nucleotide is G TP rather than ATP. The critical concentration for the polymerization of the GTP forms of tubu· lin is lower than that for the GDP forms . Thus, a newly formed microtubule consists primarily ofGTP-tubulins. Through time, the GTP is hydrolyzed to CDP. The GDP-tubulin subunits in the interior length of a microtubule remain stably polymerized, whereas GOP subunits exposed at an end have a strong tendency to dissociate. Marc Kirschner and Tim Mitchison found that some microtubules in a population lengthen while others simultaneously shorten. This property, called dynamic instability, arises from random fluctuations in the number of GTP- or CDP-tubulin subunits at the plus end of the polymer. The dynamic character of microtubules is crucial for processes such as mitosis, which require the assembly and disassembly of elaborate microtu bule- based structures .
a -Tubulin
Minus end
Inner surface
Outer surface
Plus end
J3-Tubulin
The structure of tubulin was determined at high resolution by electron crystallographic methods (Figure 34.22). As expected from their 40% sequence identity, Ct - and (3-tubulin have very similar three-dimensional structures. Further analysis revealed that the tubulins are members of the P -Ioop NTPase family and contain a nucleotide-binding site adjacent to the P-Ioop. Tubulins are present only in eukaryotes, although a prokaryotic homolog has been found. Sequence analysis identified a prokaryotic protein called FtsZ (forjilamen· tous temperature-sensitive mutant Z) that is quite simi· lar to the tubulins. The homology was confirmed when the structure was determined by x-ray crystallography. Interestingly, this protein participates in bacterial cell di· vision, forming ring-shaped structures at the constriction that arises when a cell divides. These observations suggest that tubulins may have evolved from an ancient cell-di vision protein.
~ Figure 34.22 Tubulin. Microtubul es
can be viewed as an assembly o f a -tubulin-l3-tubulin dimers. The structures o f a -tubulin and l3-tubulin are quite similar. Notice t hat each includes a P-Ioo p NTPase doma in (purple shading) and a bound guanine nucl eotide. [Drawn from 1JFF.pdb.]
990
The continual lengthening and shortening of rnicrotubules is essential to their role in cell division. Taxol , a compound isolated from the bark of the Pacific yew tree, was discovered through its ability to interfere with cell proliferation. Taxol binds to microtubules and stabilizes the polymerized form.
o
991
/
34.3 Kinesin and Dynein
---0
o
HO
•• •
~,
HO
o
o
H
0
0 ,=
Taxol
Taxol and its derivatives have been developed as anticancer agents because they preferentially affect rapidly dividing cells, such as those in tumors.
Kinesin Motio n Is Highly Processive Kinesins are motor proteins that move along microtubules . We have seen that myosin moves along actin filaments by a process in which actin is released in each cycle; a myosin head group acting independently dissociates from actin after every power stroke. In contrast, when a kinesin molecule moves along a microtubule, the two head groups of the kinesin molecule operate in tandem: one binds, and then the next one does. A kinesin molecule may take many steps before both head groups are dissociated at the same time. In other words, the motion of kinesin is highly processive. Singlemolecule measurements allow processive motion to be observed (Figure 34.23). A single kinesin molecule will typically take 100 or more steps toward the plus end of a microtubule in a period of seconds before the molecule
-
Bead or vesicle
Kinesin
Plus end Minus end
Microtubule
Glass slide
(A)
100 ~
E 80
c
~ ~
c
:>
• • • • • • • • • • •• • • • • •• •• ••
"
•
•
,.•,
•"
':." ...
,
.
,'... .
" ,J,.:' '
"
,,......' :.. ,•••
," • •
-~.----
• • •
.... · • .. " •• • •
Bacterial Chemotaxis Depends on Reversa l of the Direction of Flagellar Rotation
Many species of bacteria respond to changes in their environments by adjusting their swimming behavior. Examination of the paths taken is highly revealing (Figure 34.30). The bacteria swim in one direction for some length oftime (typically about a second ), tumble briefly, and then set off in a new direction. The tumbling is caused by a brief reversal in the direction of the flagellar motor. When the flagella rotate counterclockwise, the helical filaments form a coherent bundle favored by the intrinsic shape of each fil ament, and the bacterium swims smoothly. When the rotation reverses, the bundle fl ies apart because the screw sense of the helical flagella does not match the direction of rotation (Figure 34.31). Each flagellum then pulls in a different direction and the cell tumbles. In the presence of a gradient of certain substances such as glucose, bacteria swim preferentially toward the direction of the higher concentration of the substance. Such compounds are referred to as chemoattractants. Bacteria also swim preferentially away from potentially harmful com pounds such as phenol , a chemorepellant. The process of moving in specific directions in respon se to environmental cues is called chemotaxis. In the presence of a gradient of a chemoattractant, bacteria swim for longer periods of time without tumbling when moving toward higher concentration s of the chemoattractant. In contrast, they tumble more frequently when moving toward lower concentrations of the chemoattractant. This behavior
•
'
'
..
. •
.' •
• •• • •• • • • • • •
-...
.. " •
.' "
•
·• ·,•," ·....
,
. .t'
•,•
I J
••
.... ,
•
•• . • :.,
• •
• • • • • • • • • •
• • • •
....•...
~'.
•
~"
)· ..
• • •••• •• •
,•
•• • •
.. ,
• • •
• • • •,
••
••
•
•••
, . • • ."
••
.'
. y•
'.'
• •• • •
50
~m
Figure 34.30 Charting a course. This projection of the track of an E. coli bacterium was obtained with a microscope that automatically follow s bacterial motion in three dimensions. The points show the locations of the bacterium at 80-ms intervals. [After H. C. Berg. Nature 254(1975):389-392.]
Figure 34.31 Changing direction. Tumbling is caused by an abrupt reversa l of the flagellar motor, which disperses the flagellar bundle. A second reversal of the motor restores smooth swimmi ng, almost always in a different direction. [Aft er a drawing kindly provided by Dr. Daniel Koshland , Jr.]
995
996 CHAPTER 34
Molecular Motors
Unoccupied
)
Clockwise rotation (tumbling)
)
Attractant
- I~
o
CheY
Counterclockwise rotation (smooth swimming)
Repellant
)
)
Clockwise rotation (tumbling)
Figure 34.32 Chemota xi s signal ing pathway. Receptors in the plasma membrane initiate a signaling pathway leading to the phosphorylation of the CheY protein. Phosphorylated CheY binds to the flagellar motor and favors clockwise rotation. When an attractant binds to the receptor, this pathway is blocked, and counterclockwise f lagellar rotation and, hence, smooth swimming result. When a repellant binds, the pathway is stimulated, leading to an increased concentration of phosphorylated CheY and, hence, more- frequent clockwi se rotation and tumbling.
is reversed for chemorepellants. T he result of these actions is a biased random walk that facilitates net motion toward conditions more favorabl e to the bacterium. Chemotaxis depends on a signaling pathway that terminates at the flagellar motor. The signaling pathway begins with the binding of molecules to receptors in the plasma membrane (Figure 34.32). In their unoccupied forms, these receptors initiate a pathway leading eventually to the phosphorylation of a specific aspartate residue on a soluble protein called Che Y. In its phosphorylated form , C he Y binds to the base on the flagellar motor. When bound to phosphorylated C heY, the fl agellar motor rotates in a clockwise rather than a counterclockwise direction , causing tumbling. The binding of a chemoattractant to a surface receptor blocks the signaling pathway leading to CheY phosphorylation. Phosphorylated CheY spontaneously hydrolyzes and releases its phosphate group in a process accelerated by another protein, CheZ . The concentration of phosphorylated C he Y drops, and the flagella are less likel y to rotate in a clockwise direction. U nder these conditions, bacteria swim smoothly without tumbling. Thus, the reversible rotary flagell ar motor and a phosphorylation-based signaling pathway work together to generate an effective means for responding to environmental conditions. Bacteria sense spatial gradients of chemoattractants by measurements separated in time. A bacterium sets off in a random direction and, if the concentration of the chemoattractant has increased after the bacterium has been swimming for a period of time, the likelihood of tumbling decreases and the bacterium continues in roughly the same direction . If the concentration has decreased, the tumbling frequency increases and the bacterium tests other random directions. The success of this mechanism once again reveals the power of evolutionary problem solving : many possible solutions are tried at random, and those that are beneficial are selected and exploited .
997 Summary 34.1 Most Molecular-Motor Proteins Are Members of the P-Loop NTPase Superfamily
Eukaryotic cells contain three families of molecular-motor proteins: myosins, kinesins, and dyneins. These proteins move along tracks defined by the actin and microtubule cytoskeletons of eukaryotic cells, contributing to cell and organismal movement and to the intracellular transport of proteins, vesicles, and organelles. Despite considerable differences in size and a lack of similarity detectable at the level of amino acid sequence, these proteins are homologous, containing core structures of the P -Ioop NTPase family. The ability of these core structures to change conformations in response to nucleoside triphosphate binding and hydrolysis is key to molecular-motor func tion . Motor proteins consist of motor domains attached to extended structures that serve to amplify the conformational changes in the core domains and to link the core domains to one another or to other structures. 34.2 Myosins Move Along Actin Filaments
The motile structure of muscle consists of a complex of myosin and actin, along with accessory proteins. Actin, a highly abundant 42 -kd protein, polymerizes to form long filaments. Each actin monomer can bind either ATP or ADP. Muscle contraction entails the rapid sliding of thin filaments, based on actin, relative to thick filaments, composed of myosin . A myosin motor domain moves along actin filaments in a cyclic manner: (1) myosin complexed to ADP and Pi binds actin; (2) Pi is released; (3) a conformational change leads to a large motion of a lever arm that extends from the motor domain, moving the actin relative to myosin; (4) ATP replaces ADP, resetting the position of the lever arm and releasing actin; and (5) the hydrolysis of ATP returns the motor domain to its initial state. The length of the lever arm determines the size of the step taken along actin in each cycle. The ability to monitor single molecular-motor proteins has provided key tests for hypotheses concerning motor function. 34.3 Kinesin and Dynein Move Along Microtubules
Kinesin and dynein move along microtubules rather than actin. Microtubules are polymeric structures composed of C/.- and l3 -tubulin, two very similar guanine- nucleotide-binding proteins . Each micro tubul e comprises 13 protofilaments with alternating C/. - and l3 -tubulin subunits. Kinesins move along microtubules by a mechanism quite similar to that used by myosin to move along actin, but with several important differences. First, ATP binding to kinesin favors motordomain binding rather than dissociation. Second, the power stroke is triggered by the binding of ATP rather than the release of Pi. Finally, kinesin motion is processive. The two heads of a kinesin dimer work together, taking turns binding and rel easing the microtubule, and many steps are taken along a microtubule before both heads dissociate. Most kinesins move toward the plus end of microtubules. 34.4 A Rotary Motor Drives Bacterial Motion
Many motile bacteria use rotating flagella to propel themselves. When rotating counterclockwise, multiple flagella on the surface of a bacterium come together to form a bundle that effectively propels the bacterium through solution . When rotating clockwise, the flagella fly apart and the bacterium tumbles . In a homogeneous environment, bacteria
Summary
998 CHAPTER 34 Molecular Motors
swim smoothly for approximately 1 s and then reorient themselves by tumbling. Bacteria swim preferentially toward chemoattractants in a process called chemotaxis. When bacteria are swimming in the direction of an increasing concentration of a chemoattractant, clockwisE flagellar motion predominates and tumbling is suppressed, leading to a biased random walk in the direction of increasing chemoattractant concentration. A proton gradient across the plasma membrane, rather than ATP hydrolysis, powers the flagellar motor. The mechanism for coupling transmembrane proton transport to macromolecular rotation appears to be similar to that used by ATP synthase.
Key Terms myosi n (p. 978) kinesin (p. 978)
sarcomere (p. 982) tropomyosin (p. 983)
tubulin (p. 990) dynamic instability (p. 990)
dynein (p . 978) SI fragment (p. 979)
troponin complex (p. 983) G -actin (p . 985)
flagellin (p. 993) MotA- MotB pair (p . 994)
conventional kinesin (p. 980)
F -actin (p. 985)
FliG (p. 994)
lever arm (p . 981) relay helix (p. 981)
critical concentration (p. 986)
chemoattractant (p . 995) chemorepellant (p . 995)
neck linker (p. 982 ) actin (p. 982 )
optical trap (p . 986) power stroke (p . 987) microtubul e (p. 989)
chemotaxis (p . 995) Che Y (p . 996)
myofibril (p. 982 )
Selected Reading Where to Start Vale, R. D. 2003. The molecular motor toolbox for intracellular trans port. Cell 11 2:467-4RO. Vale, R. D ., and M illigan, R. A . 2000 . The way th ings move: Looking under the hood of molecular motor proteins. Science 288: 88- 95. Vale, R. D. 1996. Switches, latches, and amplifiers: Common themes of G proteins and molecular motors. f. Cell Bioi. 135:291 - 302. Mehta, A D, Rief. M ., Spudich, J. A, Smith , D. A. , and Simmons, R. M. 1999. Single-molecule biomechanics with optical methods. Science 283: 1689 1695. Schuster, S. C., and Khan, S. I 994.The bacteriaillagellar motor. Annu. Rev. Biophys. Biomol. Struct. 23:509 539.
Books !-Iuwanl, ]. 200 1. M echanics of Motor Proteins and the Cytosketon.
Sinauer. Squire, J. M. 1986. Muscle Design, Diversity, and Disease. Benjamin Cummings. Pollack, G . H ., and Sugi, I-I. (Eds. ). 1984. Contractile Mechanism., in Muscle. Plenum.
Myosin and Actin Fischer , S., Windshugel, B., Horak, D ., H olmes, K. C., and Smith, j. C. 2005. Structural mechanism of the recovery stroke in the myosin molecular motor . Proc. Natl. Acad. Sci . US.A 102:6873--6878. Holmes, K. C., Angert, L, Kull, F J ., Jah n, W., and Schroder, R. R. 2003. E lectron cryo- microscopy shows how strong binding of myosin to actin releases nucleotide. Nature 425:423- 427. H olmes, K. C, Schroder, R. R., Sweeney, H. L., and Houdusse, A 2004. The structure of the ri gor complex and its impli cations for the power stroke. Philos. Trans. R. Soc. Lond. B BioI. Sci. 359: 1819 1828. Purcell , T J ., Morris, C, Spudich, J . A., and Sweeney, I-l . L. 2002. Role of the lever arm in the processive stepping of myosin V. Proc. Na tl. Acad. Sci . US.A. 99: 141 59- 14164.
Purcell, T.]., Sweeney, H . L., and Spudich, J. A 2005. A force-dependent state controls the coordination of processive myosin V. Proc. Nat/. Acad. Sci. U.S.A. 102: 13R73- 13878. Holmes, K . C . 1997. The swinging lever-arm hypothesis of muscle can· traction. Curro Bioi. 7:RI12- RI1 8. Berg, J. S., Powell, B. C ., and C heney, R. E. 2001. A millennial myosin cen sus. Mol. BioI. Cell 12:780- 794. Houdusse, A., Kalabokis, V. N., Himmel, D. , Szent-Gyorgyi, A. G., and Cohen , C. 1999. Atomic structure of scallop myosin subfrag. ment SI complexed with MgADP: A novel conformation of the myosin head . Cell 97:459-470. H oudusse, A., Szent-Gyorgyi, A. G., and Cohen, C. 2000. Three con· fo rmational states of scallop myosin S I. Proc. Na tl. Acad. Sci. U.S.A 97: 11238- 11 243 . Uyeda, T. Q., Abramson, P. D. , and Spudich, J. A 1996. The nL'Ck re· gion of the ,myosin motor domain acts as a lever arm to generate movement . Proc. Natl. Acad. Sci. US.A 93:4459-4464. Mehta, A. D. , R ock, R. S., R ief, M., Spudich , J A ., Mooseker, M. S , and C heney, R. E . 1999. Myosin-Vis a processive actin· based motor. Nature 400:590- 593. Otterbein, L. R., Graceffa, P., and Dominguez, R. 2001 . The crystal stru cture of uncomplexed actin in the ADP state. Science 293:708-7 11. Holmes, K. C., Popp, D., Gebhard, W., and Kabsch, W . 1990. Atomic model of the actin filament. Na ture 347:44- 49. Sclhutt, C . E., Myslik, J. C , Rozycki, M. D., Gooneseker., N. C., and Lindberg, U 1993. The structure of crystalline profilin-f1 -actin. Nat ure 365:81 0- 816. van den Ent, E, Amos, L. A ., and Lowe, J . 2001. Prokaryotic origin of the actin cytoskeleton . Nature 413 :39- 44 . Schutt, C. E. , and Lindberg, U 1998. Muscle contraction as a Markov process l: Energetics of th e process. Acta Physiol. Seand. 163:307- 323.
Problems 9 9 9 Rief. M ., Rock, R. S., M ehta, A. D ., Mooseker, M. S., C heney, R. E., and Spudich, J. A. 2000 . Myosin -V stepping kinetics: A molecular model for processivity. Proc. Na tl . Acad. Sci. U.S.A. 97:9482- 9486. Friedman, T B., Sellers, J. R., and Avraharn, K. B. 1999 . Uncon ventional myosins and the genetics of hearing loss. Am. f. Med. Genet. 89:147- 157.
Kinesin, Dynein, and Microtubules Yildiz, A., Tomishige, M., Vale, R. D, and Selvin , P. R . 2004 . Ki nesin walks hand-over-hand . Science 303:676-678. Rogers, G . C ., Rogers, S. L. , Schwimmer, T A., Ems-McClung, S. C., Walczak, C. E., Vale, R. D ., Scholey, J. M ., and Sharp, D . J. 2004. Two mitotic kinesins cooperate to drive sister chromatid separation during anaphase. Nature 427: 364-370 . Vale, R. D ., and Fletterick , R. J. 1997 . The design plan ofkinesin motors. Annu. Rev. Cell. Dev. BioI. 13:745- 777. Kull, F. J., Sablin, E. P., Lau, R. , Fletterick, R. J., and Vale, R. O . 1996. Crystal structure of the kinesin motor domain reveals a structural similarity to myosin. N ature 380:550- 555. Kikkawa, M., Sablin, E. P., Okada, Y., Yajima, H ., Fletterick, R. J., and Hira kawa, N. 2001. Switch -based mechanism of kinesin motors. Nature 41 1 :439-445. Wade, R. H ., and Kozielski, F. 2000 . Structural links to kinesin directionality and movement. Nat. Struct. Bioi. 7:456 460. Yun, M ., Zhang, X., Park, C. G ., Park, H . W ., and E ndow, S. A. 2001. A structural pathway for activation of the kinesin motor ATPase. EMB O f. 20 :2611 - 2618. Kozielski, F., De Boni s, S., Burmeister, W . P., Cohen -Addad, C., and Wade, R . H . 1999. The crystal structure of the minus-end-directed microtubule motor protein ned reveals variable climer conformations. S tructure Fold Des. 7:1407- 141 6. Lowe, J., Li, H ., Downing, K. H ., and Nogales, E. 2001. Refined structureofo.l3 -tubulin at3.5 A resolution.}. Mol . BioI. 313: 1045 1057 . Nogales, E., Downing, K. H ., Amos, L. A., and Lowe, J. 1998. Tubulin and FtsZ form a distinct family of GTPases. Nat. Struct. Bioi. 5:451-458. Zhao, C., Takita, J., Tanaka, Y., Setou, M ., Nakagawa, T , Takeda, S., Yang, H . W ., Terada, S., Nakata, T, Takei, Y., Saito, M ., T suji, S., Hayashi, Y., and Hirokawa, N. 2001 . C harcot -Marie-Tooth disease
type 2A caused by mutation in a microtubule motor KII'IBI3. Cell 105:587-597. Asai, D . J ., and Koonce, M . P. 2001 . 'fhe dynein heavy chain : Structure, mechanics and evolution . Trends Cell Bioi. II : 196- 202 . Mocz, G., and G ibbons, I. R. 2001. Model for the motor component of dynein heavy chain based on homology to the AAA family of oligomeric ATPases. Structure 9:93-103.
Bacterial Motion and Chemotaxis Sowa, Y, Rowe, A. D. , Leake, M . C., Yakushi , T., Homma, M. , Ishijima, A., and Berry, R. M . 2005. Direct observation of steps in rotation of the bacterial flagellar motor. Na ture 437:916-919. Berg, H . C. 2000. Constraints on models for the flagellar rotary motor. Philos. Trans. R. Soc. Lond. B Bio/. Sci. 355: 491 - 501. DeRosier, D . J. 1998. The turn of the screw : The bacterial flagellar motor. Cel/9 3: 17- 20. Ryu, W . S., Berry, R. M. , and Ucrg, H . C. 2000. Torque-generatin g uni ts of the fl agellar motor of Escherichia coli have a high duty ratio. Nature 403: 444-447 . Lloyd , S. A., Whitby, F. G ., Blair, D . F., and Hill , C. P. 1999. Stnlcture of the C -terminal domain of FliG, a component of the rotor in the bacterial flagellar motor. Nature 400:472-475. Purcell, E . M . 1977. Life at low Reynolds number. Am. j. Physiol. 45:3- 11. Macnab, R. M ., and Parkinson , J. S. 1991. Genetic anal ysis of the bacterial flagellum . Trends Genet. 7: 196- 200.
Historical Aspects Huxley, H. E. 1965. The mechanism of muscular contraction. Sci. Am. 213(6):1 8- 27. Summers, K. E., and Gibbons,!. R. 1971. ATP-induced sliding of tubules in trypsin-treated flagella of sea-urchin sperm . Proc. Natl. A cad. Sci. U.S.A. 68 :3092 3096. Macnab, R. M ., and Koshland, D . E., Jr. 1972. The gradient-sensing mechanism in bacterial chemotaxis. Proc. Nat!. A cad. Sci. US.A. 69 :2509 25 12. Taylor, E. W . 2001. 1999 E. R. Wi lwn lecture: The cell as molecular machine. Mol. Bioi. Cel/1 2:25 1- 254.
Problems I. Diverse motors. Ske letal muscle, e ukaryotic cilia, and bacte rial flagella use diffe rent strategies for the conversion of free e n ergy into coherent m o tio n . Compare and contrast these m o tility system s with resp ect to (a ) the free-en e rgy source and (b) the number of essential com pon e nts and their ide nti ty.
2. You call that slow? At maximum speed , a kinesin m olecule moves at a rate of 6400 A p e r second . G iven the dimensions of the motor region of a kinesin dimer of approximately SO A, calculate its sp eed in "body length s" per second . To what speed does this b ody -len gth sp eed correspond for an automobile 10 feet long?
3. Heavy lifting. A single myosin motor domain can gene rate a force of approximately 4 picon ewton s (4 pN). H ow many times its "body weight" can a myosin motor domain lift? Note that 1 newton = 0 .22 pounds (100 gm s). Assume a molecu lar mass of 100 kd for the motor domain .
4. Rigor mortis. Why does the body stiffen after d eath ?
5. Now you see it, now you don 't. U nder certain stable con cen tration condition s, actin m on o m ers in the ir ATP form will p o ly -
m erize to form fi laments that disperse again into free actin monomers over time. Explai n .
6. Helicases as motors. Heli eases suc h as P c rA (p . 797) can use single-stranded DNA as trac ks. rn each cycle, the helicase moves one base in the 3' ~5' directio n . Given that PcrA can hyd rolyze A TP at a rate of SO mol ecules per second in the pres ence of a single -stranded DNA template, calcul ate the velocity of the helicase in m icrometers p er second . H ow does this velocity compare with that of kinesin ?
7. New moves. When bacte ria su ch as E. coli a re starved to a sufficient extent, they become n onmotile. H owever, when su ch bacteria are placed in an acidic solution, they resume sw imming . Explain . S. llauling a load. Con sider the action of a single kinesin m o lec u le in m oving a vesicle along a microtubul e track . The force required to drag a sphe rical particle of radius a at a velocity v in a m edium having a v iscosity 7) is
F = 6'IT7)av
1 000
CHAPTER 34 Molecular Motors
Suppose thata2-~m diameter bead is carried ata velocity of 0.6 ~m s - I inan aqueous medium ('1/ = 0.0 1 poise = 0.0 1 gcm - I S- I).
The rate of ATP hydrolysis by myosin has been examined as a fun ction of ATP concentration, as shown in graph A .
(al What is the magnitude of the force exerted by the kinesin molecule? Exp ress the value in dynes (1 dyne = 1 g cm 5- 2 ). (b 1 How much work is performed in 1 s? Express the value in ergs (1 erg = 1 dyne em). (c) A kinesin motor hydrolyzes approximately 80 m olecules of ATP per second . What is the energy associated with the hydrol ysis of this much ATP in ergs? Compare this value with the actual work performed.
- '"
9. Un usual strides. A p ublication describes a kinesin molecule
'"
that is claimed to move along mi crotubules with a step size of 6 nm. You are skeptical. Why? 10. The sound oj one hand clapping. K I F1A is a motor protein that moves toward the plus end of microtubules as a monomer. KIFl A has on ly a sin gle motor domain . What add itional structural elements wou ld you expect to find in the KIF1A structure?
14 12
.'"
'" 0 '1
'"
10
>-c: ..c: ._
8
'">-
6
>-~
~ "O~
0- 0
!;;: E 0
-''""
~
•
•
• •
• •
•
a. 4 2
a
50
100
[ATP],
(A)
150
200
~M
(al Estimate t he valu es of keat and KM for ATP. With the use of optical-trap measurements, the motion of si ngle myosin V dimers could be followed, as shown in graph B.
Mechanism Problem
11. Backward rotation. O n the basis of the proposed structure in Figure :H.30 for the bacterial flagellar motor, suggest a pathway for transmembrane proton flow when the flagellar motor is rotating clockwise rather than counterclockwise.
400 350
E ..s
-
300
c:
Chapter Integration Problem
12. Smooth muscle. Smooth muscle, in contrast with skeletal muscle, is not regulated by a tropom yosin- troponin mechanism. I nstead, vertebrate smooth-muscle contraction is controlled by the degree of phosphorylation of its light chains. Phosphorylation in duces contraction, and dephosphorylation leads to relaxation . Like that of skeletal muscle, smooth-muscle contraction is tri ggered by an increase in the cytoplasmic calcium ion level. Propose a mechanism for this action of calcium ion on the basis of your knowledge of other signal-transduction processes.
'" '" Ci. '"
E 250 u
.-Cl'"
200
150 100
(8)
o
0 .2
0.4
0 .6
O.B
1
Time (5)
[Based on M. Rief, R. S. Rock, A. D. Mehta, M. s. Mooseker, R. E. Cheney, and J. A. Spudich. Proc. Natl. Acad. Sci. u.s.A. 97(2000):9482- 9486.]
Data Interpretation Problem
13. Myosin V An abundant myosin -family member, myosin V is isolated from brain tissue. T hi s myosin has a number of unusual properties. First, on the basis of its amino acid sequence, each heavy chain has six tandem binding sites for calmodulin -like li ght chains . Second , it forms dimers but n ot higher -order oligomers. Finally, unlike almost all other myosin-family mem bers, myosin V is highly processive.
(b ) Estimate the step size for myosin V. The rate of ADP release from myosin V is found to be approximately 13 molecul es s - I. . (cl Combine the observations abou t the amino acid sequence of myosin, the observed step size, and the kinetics results to propose a mechanism for the processive motion of myosin V.
Chapter
Drug Development COOH
o
Many drugs are based on natural products. Aspi rin (above) is a chemical derivative of a compound isolated from willow bark (near left). Extracts of willow bark had been long known to have medicinal properties. The active compo und was isolated, modified, and, beginning in 1899, packaged for consumers (far left). [For left: Used with permission of Bayer Corporation. Near left: Image Ideas/ Picture Quest.]
he development of drugs represents one of the most important interfaces between biochemistry and medicine. In most cases, drugs act by binding to specific receptors or enzymes and inhibiting, or otherwise modulating, their activities. Thu s, knowledge of th ese molecules and the pathways in which they participate is crucial to drug development. An effective drug is much more than a potent modulator of its target, however. Drugs must be readily administered to patients, preferably as small tablets taken orally, and must survive within the body long enough to reach their targets . Furthermore, to prevent unwanted physiological effects, drugs must not modulate the properties of biomolecules other than the target molecules. These requirements tremendously limit the number of compounds that have the potential to be clinically useful drugs. Drugs have been discovered by two, fundamentally opposite, approaches (Figure 35.1). The first approach identifies a substance that has a desirable physiological consequence when administered to a human being, to an appropriate animal, or to cells. Such substances can be discovered by serendipity, by the fractionation of plants or other materials known to have medicinal properties, or by screening natural products or other "libraries" of compounds. In this approach, a biological effect is known before the molecular target is identified . The mode of action of the substance is only later
Outline 35.1 The Development of Drugs Presents Huge Challenges 35.2 Drug Candidates Can Be Discovered by Serendipity, Screening, or Design 35.3 The Analysis of Genomes Holds Great Promise for Drug Discovery 35.4 The Development of Drugs Proceeds Through Several Stages
1001
1002
(A)
CHAPTER 35 Drug Development Compound
)
Molecular target
)
Physiological effect
Molecular target
----------~
(8) Compound
Physiological effect
)
Figure 35.1 Two paths to drug discovery. (A) A compound is discovered t o have a desirable physiolo gical effect . The molecular target can be identified in a separate step as needed. (B) A mo lecular target is selected f irst . Drug candidates that bind to the target are identified and then examined for their physiological effects.
-
Pharmacology The science that deals with the discovery. chemistry. composition, identification. biologi cal and physio logical effect s, uses, and manufacture of drugs.
.
-
identified after substantial additional work. The second approach begins with a known molecular target. Compounds are sought, either by screening or by designing molecules with desired properties, that bind to the target molecule and modulate its properties. Once such compounds are available, scientists can explore their effects on appropriate cells or organisms. Many unexpected results may be encountered in this process as the complexity of biological systems reveals itself. In this chapter, we explore the science of pharmacology. We examine a number of case hi stories that illustrate drug development including many of its concepts, methods, and challenges. We then see how the concepts and tools from genomics are influencing approaches to drug development. We conclude the chapter with a summary of the stages along the way to developing a drug.
35.1
The Development of Drugs Presents Huge Challenges
Many compounds have significant effects when taken into the body, but only a very small fraction of them have the potential to be useful drugs. A foreign compound, not adapted to its role in the cell through long evolution, must have a range of special properties to function effectively without causing serious harm. We next review some of the challenges faced by drug developers.
1.0
-
c
.- -
o~
-",
Drug Candidates Must Be Potent Modulators of Their Targets
~
:::l
+
r o_
~ci 0.5 ro-
c~
0;:::::'
. - ...J
~
u:
es
I I I I
i/ I
[Ligand] = Kd
0 ---""---- - - - -- [Ligand] Figure 35.2 Ligand binding. The titration of a recepto r, R, w ith a ligand. L. results in t he forma t ion of th e compl ex RL. In uncompl icated cases, the binding reacti o n f ollows a simple saturatio n curve. Half o f the receptors are bound to ligand wh en the ligand concentrat ion equals the dissoc iati on constant, Kd , fo r the RL complex.
Most drugs bind to specific proteins, usually receptors or enzymes, within the body. To be effective, a drug needs to bind a sufficient number of its target proteins when taken at a reasonable dose. O ne factor in determining drug effectiveness is the strength of binding, often governed by the principles of binding, related to the Michaelis-Menten model introduced in Chapter 8. A molecul e that binds to some target molecule is often referred to. as a ligand. A ligand-binding curve is shown in Figure 35.2 . Ligand molecules occupy progressively more target binding sites as ligand concentration increases until essentially all of the available sites are occupied. The tendency of a ligand to bind to its target is measured by the dissociation constant, Kd , defined by the expression •
Kd = [R][L]/[RL]
where [R) is the concentration of the receptor, [L) is the concentration of the ligand, and [RL) is the concentration of the receptor- ligand complex. The dissociation constant is a measure of the strength of the interaction between the drug candidate and the target; the lower the value, the stronger the interaction. The concentration of free ligand at which one-half of the binding sites are occupied equals the dissociation constant, as long as the concentration of binding sites is substantiall y less than the dissociation constant. Many complicating factors are present under physiological conditions. Many drug targets also bind ligands normally present in tissues; these ligands and the drug candidate compete for binding sites on the target. We en countered this situation when we considered competitive inhibitors in Chapter 8. Suppose that the drug target is an enzyme and the drug candi date is a competitive inhibitor. The concentration of the drug candidate necessary to inhibit the enzyme effectively will depend on the physiological concentration.of the enzyme's normal substrate (Figure 35.3). The higher the concentration of the endogenous substrate, the hi gher the concentration of drug candidate needed to inhibit the enzyme to a given extent. This effect of substrate concentration is expressed by the apparent dissociation constant, KdPP The apparent dissociation constant is given by the expression
where [S) is the concentration of substrate and KM is the Michaelis constant for the substrate. Note that, for an enzyme inhibitor, the dissociation con stant, K d , is often referred to as the inhibition constant, K i . In many cases, more complicated bio[ogical assays (rather than direct enzyme or binding assays) are used to examine the potency of drug candidates. For example, the fraction of bacteria killed might indicate the potency of a potential antibiotic. In these cases, values such as EC so are used. EC so is the concentration of drug candidate required to elicit 50% of the maximal biological response (Figure 35.4). Similarly, EC 90 is the concentration required to achieve 90% of the maximal response. In the example of an antibiotic, EC 90 would be the concentration required to kill 90% of bacteria exposed to the drug. For inhibitors, the corresponding terms IC so and IC 90 are often used to describe the concentrations of the inhibitor required to reduce a re sponse to 50% or 90% of its value in the absence of inhibitor, respectively. These values are measures of the potency of a drug candidate in modu lating the activity of the desired biological target. To prevent unwanted effects, often called side effects, ideal drug candidates should not bind biomolecules other than the target to any appreciable extent. Developing such a drug can be quite challenging, particularly if the drug target is a member of a large family of evolutionarily related proteins. The degree of specificity can be described in terms of the ratio of the Kd values for the binding of the drug candidate to any other molecules to the Kd value for the binding of the drug candidate to the desired target. Drugs Must Have Suitable Properties to Reach Their Targets
Thus far, we have focused on the ability of molecules to act on specific target molecules. However, an effective drug must also have other characteristics. Tt must be easily administered and must reach its target at sufficient concen tration to be effective. A drug molecule encounters a variety of obstacles on its way to its target, related to its absorption, distribution, metabolism, and excretion after it has entered the body. These processes are interrelated to one another as summarized in Figure 35.5. Taken together, a drug's ease of absorption, distribution, metaboli sm, and excretion are often referred to as ADME (pronounced "add-me") properties.
1.0
No substrate
c
-'" --'"'"
.-0
Low substrate
~
::J
0.5
-
Higher substrate
'"C0
I I I
.-
U
:
'" ~
u..
[Ligand] = K~PP
:/
0
[Ligand]
•
Figure 35.3 Inhibitors compete with substrates for binding sites. These binding curves give results for an inhibitor binding to a target enzyme in the absence of substrate and in the presence of increasing concentrations of substrate.
~
~
~
100 90
-- -------------------- I I I I
'"'"c
o0..
'"~
-:g .-M -oo
.-eD
I
50
I
-
I I
:
[Ligand] : [Ligand] = EC so : = Ee go
:/
:/
o --~----~~---------[Ligand)
,
Figure 35.4 Effective concentration s. The concentrati on of a ligand required t o elicit a biological response can be quantified in terms of EC sQ, the concentration required to give 50% of the maximum response, and EC90 , the concentration required to give 90% o f the maximum response.
1003
1004
Target compartment
CHAPTER 35 Drug Development
Other compartments Bound
Bound
1
Free
Free
DISTRIBUTION Bloodstream ABSORPTION
Figure 35.s Absorption, distribution, m etabolism, and excretion (ADM E), The concentration of a com pound at its target site (yellow) is affected by the extent s and rates of absorption, dist ribution, metabolism, and excretion.
Free ,
>
Bound
EXCRETION
Metabolites METABOLI SM Transformation
Administration and Absorption. Ideally, a drug can be taken orally as a small tablet. An orally administered active compound must be able to survive the acidic conditions in the gut and then be absorbed through the intestinal epithelium. Thus, the compound must be able to pass through cell membranes at an appreciable rate. Larger molecules such as proteins cannot be administered orally, because they often cannot survive the acidic conditions in the stomach and, if they do, are not readily absorbed. Even many small molecules are not absorbed well, because, for example, if they are too polar they do not pass through cell membranes readily. The ability to be absorbed is often quantified in terms of the oral bioavailability. This quan tity is defined as the ratio of the peak concentration of a compound given orally to the peak concentration of the same dose injected directly into the bloodstream. Bioavailability can vary considerably from species to species so results from animal studies may be difficult to translate to human beings. Despite this variability, some useful generalizations have been made. One powerful set is Lipinski's rules. Lipinski's rules tell us that poor absorption is likely when
H
Two hydrogen0 bond donors
H
N' H
Four hydrogenbond acceptors
H
Molecular weight = 285
log(P) = 1.27 Figure 35.6 Lipinski's rules applied to morphine. Morphine satisfies all of Lipinski's rules and has an oral bioavailability in human beings of 33%.
1.
the molecular weight is greater than 500 .
2.
the number of hydrogen-bond donors is greater than 5.
3.
the number of hydrogen-bond acceptors is greater than 10.
4.
the partition coefficient [measured as 10g(P )] is greater than S.
The partition coefficient is a way to measure the tendency of a molecule to dissolve in membranes, which correlates with its ability to dissolve in organic solvents. It is determined by allowing a compound to equilibrate between water and an organic phase, n-octanol. The 10g(P) value is defined as logl o of the ratio of the concentration of a compound in n-octanol to the concentration of the compound in water. For example, if the concentration of the compound in the n-octanol phase is 100 times that in the aqueous phase, then 10g(P ) is 2. Morphine, for example, satisfies all of Lipinski's rul es and has moderate bioavailability (Figure 35.6). A drug that violates one or more of these rules may still have satisfactory bioavailability. Nonetheless, these rules serve as guiding principles for evaluating new drug candidates.
1005 35.1 Drug Development Challenges
~ Figure 35.7 Structure of
the drug carrier human serum albumin . Seven hydrophobic molecules (in red) are shown bound to the molecule. [Drawn from 1BKE.pdb.]
Distribution. Compo unds taken up by intestinal epithelial cells can pass into the bloodstream. However, hydrophobic compounds and many others do not freely dissolve in the bloodstream. These compounds bind to proteins, such as albumin (Figure 35.7), that are abundant in the blood serum and by this means are carried everywhere that the bloodstream goes. When a compound has reached the bloodstream, it is distributed to difrerent fluids and tissues, which are often referred to as compartments. Some compounds are highly concentrated in their target compartments, either by binding to the target molecules themselves or by other mechanisms. Other compounds are distributed more widely (Figure 35.8). An effective drug will reach the target compartment in sufficient quantity; the concentration of the compound in the target compartment is reduced whenever the compound is distributed into other compartments. Some target compartments are particularly hard to reach . Many compounds are excluded from the central nervous system by the blood brain
F
F Fluconazole
Figure 35.8 Distribution of the drug fluconazole. O nce taken in, compounds distribute themselves to various organs within the body. The distribution of the antifunga l agent f luconazole has been monit ored thro ugh t he use of positron emission tomography (PET) scanning. These images were taken of a healthy human volunteer 90 minutes after 1 injection of a dose of 5 mg kg - of flu conazole containing trace amounts of flu conazole labeled with the positronem itt ing isotope 1BF. [From A. J. Fisch man et al.. Antimicrob. Agents Chemother. 37(1993): 1270-1277.]
•
1006 CHAPTER 35 Drug Development
barrier, the tight junctions between endothelial cells that line blood vessels within the brain and spinal cord.
Figure 35.9 P450 conversion of ibuprofen. Cytochrome P450 isozymes, primarily in the liver, catalyze xenobiotic metabolic reactio ns such as hydroxylation. The rea ctio n introduces an oxygen atom derived from molecular oxygen.
Metabolism and Excretion. A final challenge to a potential drug molecule is to evade the body's defenses against foreign compounds. Such compounds (often called xenobiotic compounds) are often released from the body in the urine or stool, often after having been metabolized somehowdegraded or modified to aid in excretion. This drug metabolism poses a considerable th.reat to drug effectiveness because the concentration of the desired compound decreases as it is metabolized. Thus, a rapidly metabolized compound must be administered more frequently or at higher doses. Two of the most common pathways in xenobiotic metabolism are oxidation and conjugation. Oxidation reactions can aid excretion in at least two ways: by increasing water solubility, and thus ease of transport, and by introducing functional groups that participate in subsequent metabolic steps. These reactions are often promoted by cytochrome P450 enzymes in the liver (p. 750). T he human genome encodes more than 50 different P450 isozymes, many of which participate in xenobiotic metabolism. A typical reaction catalyzed by a P450 isozyme is the hydroxylation of ibuprofen (Figure 35.9).
NADPH + H+ + 0 , +
H
COOH - - - +) NADP+ + H 20
-.........
+
HO COOH
Ibuprofen
Conjugation is the addition of particular groups to the xenobiotic compound, Common groups added are glutathione (p. 586), glucuronic acid, and sulfate (Figure 35.10). The addition often increases water solubility and provides labels that can be recognized to target excretion, Examples of conjugation include the addit ion of glutathione to the anticancer drug cyclophosphamide, the addition of glucuronidate to the analgesic morphine, and the addition of a sulfate group to the hair-growth stimulator minoxidil. CI
0
COO
II / N
o ...--- P"
S NH
0
H -
HN ~
~
0
COO
H2N CH 3
I
HO OH
0
NH
N H
'" '" ,
NH3+
0 -0
H OOC
N N
N
/
"'::- s
0 / , \• 0
HN
HO
H
Cyclophosphamide-glutathione conjugate
Morphine glucuronidate
Minoxidil sulfate
Interestingly, the sulfation of minox idil produces a compound that is more active in stimulating hair growth than is the unmodified compound . Thus, the metabolic products of a drug, though usually less active than the drug, can sometimes be more active, Note that an oxidation reaction often precedes conjugation because the oxidation reaction can generate hydroxyl and other groups to which groups such as glucuronic acid can be added, The oxidation reactions of xenobiotic compounds are often referred to as phase I transformations, and the conjugation reactions are referred to as phase II transformations, These reactions take
SR
SH
o •
'.
H
0
H
,
OOC
H
,
.1 \
H
o
H '" N "-../COO
•
Figure 35.23 The effect of anti-HIV drug development. Deat h rat es fro m HIV infection (A IDS) revea l th e tremendous effect o f HIV protease inhi bit ors and th ei r use in combinat ion w ith inhibito rs o f HIV reve rse t ranscript ase, These are death rates from the lead ing causes of death among persons 24 to 44 years o ld in the Un ited States, [From Centers fo r Di sease Contro L]
fr 0.
30
g
25
o
~-
20
- - Heart disease
---- --- -- -- --- -- - ---
---- - --- ~
~--,.~_ _ _- - - - - - ; - - -_ _
~
'"
0. 15
------
-5'"
------ - ------- ---- ----
'" 10
'"
C
5
-------------------
-------- ---------
- - - Suicide - - Homicide - - - Chronic liver disease - - Cerebrovascular diseases - - - Diabetes
------- - - -------------- - -----------o '--- --'--'---'--"----'---'-- --:::';:::--'-:-; :::- -;:;! 1988
1990
1992
1994
1996
1998
2000
treat AIDS with much more encouraging results than had been obtained previously (Figure 35 ,23), Aspirin targets the cyclooxygenase site in prostaglandin H2 synthase, as discussed earlier. Animal studies suggested that mammals contain not one but two distinct cyclooxygenase enzymes, both of which are targeted by aspirin, The more recently discovered enzyme, cyclooxygenase 2 (COX2), is expressed primarily as part of the inflammatory response, whereas cyclooxygenase 1 (COX1) is expressed more generally, These observations suggested that a cyclooxygenase inhibitor that was specific for COX2 might be able to reduce inflammation in conditions such as arthritis without producing the gastric and other side effects associated with aspirin, The amino acid sequences of COXl and COX2 were deduced from cDNA cloning studies, These sequences are more than 60% identical, clearly indicating that the enzymes have the same overall structure, Nevertheless, there are some differences in the residues around the aspirin-binding site, X -ray crystallography revealed that an extension of the binding pocket was present in COX2, but absent in COX 1 , This structural difference suggested a strategy for constructing COX2-specific inhibitors namely, to synthesize compounds that had a protuberance that would fit into the pocket in the COX2 enzyme, Such compounds were designed and synthesized and then further refined to produce effective drugs familiar as Celebrex and Vioxx (Figure 35 ,24), Vioxx was subsequently withdrawn from the market because some individuals experienced adverse events, These effects appear to be due to the inhibition of COX2, the intended target, Thus, although the development of these drugs is a triumph for structure-based drug design, these outcomes highlight the fact that the inhibition of important enzymes can lead to complex physiological responses,
o
o Figure 35,24 COX2-specific inhibitors, These co mpounds have protuberances (shown in red) t hat fit into a pocket in the COX2 isozyme but steri cally clash with the COXl isozyme,
/,/
o Celecoxib (Celebrex)
Rofecoxib (Vioxx)
"\
0
35.3
1017 35.3 The Promise of Genome Analysis
The Analysis of Genomes Holds Great Promise for Drug Discovery
The completion of the sequencing of the human and other genomes is a potentially powerful driving force for the development of new drugs . Genomic sequencing and analysis projects have vastly increased our knowledge of the proteins encoded by the human genome. This new source of knowledge may greatly accelerate early stages of the drug -development process or even allow drugs to be tailored to the individual patient. Potential Targets Can Be Identified in the Human Proteome
•
The human genome encodes approximately 25 ,000 proteins, not countin g the variation produced by alternative mRNA splicing and posttranslational modifications. Many of these proteins are potential drug targets, in particular those that are enzymes or receptors and have significant biological effects when activated or inhibited . Several large protein families are particularly ri ch sources of targets. For example, the human genome includes genes for more than 500 protein kinases that can be recognized by comparing the deduced am ino acid sequences. One of them, Bcr-Abl kinase, is known to contribute to leukemias and is the target of the drug imatinib mesylate (G leevec; p . 401) . Some of t he other protein kinases undoubtedly play central roles in particular cancers as well. Similarly, the human genome encodes approximately 800 7TM receptors (p. 383) of which approximately 350 are odorant receptors . Many of the remaining 7TM receptors are potential drug targets. Some of them are already targets for drugs, such as the ~-b l ocker atenolol, which targets the j3-adrenergic receptor, and the antiulcer medication ranitidine (Zantac). The latter compound is an antagonist of the histamine H2 receptor, a 7TM receptor that participates in the control of gastric acid secretion .
o
N H H
OH
H N NH2
o
N0 2 Atenolol
Ranitidine
Novel proteins that are not part oflarge families already supplying drug targets can be more readi ly identified through the use of genomic information. T here are a number of ways to identify proteins that could serve as targets of dru g-development programs . O ne way is to look for changes in expression patterns, protein localization , or posttranslational modifications in cells from disease-afflicted organisms. Another is to perform studies of tissues or cell types in which particular genes are expressed. Analysis of the human genome should increase the number of actively pursued drug targets by a factor of an estimated two or more.
1018 CHAPTER 35 Drug Development
Animal Models Can Be Developed to Test the Validity of Potential Drug Targets The genomes of a number of model organisms have now been sequenced. The most important of these genomes for drug development is that of the mouse. Remarkably, the mouse and human genomes are approximately 85% identical in sequence, and more than 98% of all human genes have recognizable mouse counterparts. Mouse studies provide drug developers with a powerful tool the ability to disrupt ("knock out") specific genes in the mouse (p. 155). If disruption of a gene has a desirable effect, then the product of this gene is a promising drug target. The utility of this approach has been demonstrated retrospectively. For example, disruption of the gene for the ex subunit of the H+ -K+ ATPase, the key protein for secreting acid into the stomach, produces mice with less acid in their stomachs. The stomach pH of such mice is 6.9 in circumstances that produce a stomach pH of 3.2 in their wild-type counterparts. This protein is the target of the drugs omeprazole (Prilosec) and lansoprazole (Prevacid and Takepron), used for treating gastric-esophageal reflux disease. H
N
§
H3C~
0
N
o
II
\
0
H3C
' ~
H
CH 3
CH,
N
~./
§ N
o
II
H3C
\ ~
N Omeprazole
0\ CFJ
\
N
;)
Lansoprazole
Several large-scale efforts are underway to generate hundreds or thousands of mouse strains, each having a different gene disrupted. The phenotypes of these mice are a good indication of whether the protein encoded by a disrupted gene is a promising drug target. This approach allows drug developers to evaluate potential targets without any preconceived notions regarding physiological function.
Potential Targets Can Be Identified in the Genomes of Pathogens Human proteins are not the only important drug targets. Drugs such as penicillin and HIV protease inhibitors act by targeting proteins within a pathogen. The genomes of hundreds of pathogens have now been sequenced, and these genome sequences can be mined for potential targets. New antibiotics are needed to combat bacteria that are resistant to many existing antibiotics. One approach seeks proteins essential for cell survival that are conserved in a wide range of bacteria. Drugs that inactivate such proteins are expected to be broad-spectrum antibiotics, useful for treating infections from any of a range of different bacteria. One such protein is peptide deformylase, the enzyme that removes formyl groups that are present at the amino termini of bacterial proteins immediately after translation (p. 871). Alternatively, a drug may be needed against a specific pathogen. A recent example of such a pathogen is the organism responsible for severe acute respiratory syndrome (SARS). Within one month of the recognition of this emerging disease, investigators had isolated the virus that causes the syndrome, and, within weeks, its 29,751- base genome had been completely sequenced. This sequence revealed the presence of a gene encoding a viral protease, known to be essential for viral replication from studies of other members of the coronavirus family to which the SARS virus belongs. Drug developers are already at work seeking specific inhibitors of this protease (Figure 35.25).
1018 CHAPTER 35 Drug Development
Ani ma l Models Can Be Developed to Test the Val idity of Potential Drug Targets The genomes of a number of model organisms have now been sequenced. The most important of these genom es for drug development is that of the mouse. Remarkably, the mouse and human genomes are approximately 85% identical in sequence, and more than 98% of all human genes have recognizable mouse counterparts. Mouse studies provide drug developers with a powerful tool the ability to disrupt ("knock out" ) specific genes in the mouse (p . 155). If disruption of a gene has a desirable effect, then the product of this gene is a promising drug target . The utility of this approach has been demonstrated retrospectively. For example, disruption of the gene for the Cl subunit ofthe H + -K + ATPase, the key protein for secreting acid into th e stomach , produces mi ce with less acid in their stomachs. The stomach pH of such mice is 6.9 in circumstances that produce a stomach pH of 3.2 in their wild-type counterparts. This protein is the target of the drugs omeprazole (Prilosec) and lansoprazole (Prevacid and Takepron), used for treating gastric-esophageal reflux disease. H
N
II
H, C ~
0
o
I; 5
0
H,C
N
H
CH,
CH,
N
~
./
II
o
H, C
CF,
N
N
Ome pral ole
0\
I; 5
N
Lansopralole
Several large-scale efforts are underway to generate hundreds or thousands of mouse strains, each having a different gene disrupted . The phenotypes of these mice are a good indication of whether the protein encoded by a disrupted gene is a promising drug target. This approach allows drug developers to evaluate potential targets without any preconceived notions regarding physiological fu nction.
Potential Targets Can Be Identified in the Genomes of Pathogens Human proteins are not the only important drug targets. Drugs such as penicillin and H IV protease inhibitors act by targeting proteins within a pathogen . T he genomes of hundreds of pathogens have now been seq uenced, and these genom e sequences can be mined for potential targets. New antibiotics are needed to combat bacteria that are resistant to many existing antibiotics. One approach seeks proteins essential for cell survival that are con served in a wide range of bacteria. Drugs that inactivate such proteins are expected to be broad-spectrum antibiotics, useful for treating infections from any of a range of different bacteria. One such protein is peptide deformylase, the enzyme that removes formyl groups that are present at the amino termini of bacterial proteins immediately after translation (p . 871 ). Alternatively, a drug may be needed against a specific pathogen . A recent example of such a pathogen is the organism responsible for severe acute respiratory syndrome (SARS). Within one month of the recognition of this emerging disease, investigators had isolated the virus that causes the syndrome, and, within weeks, its 29,751 - base genome had been completely seq uenced. This sequence revealed the presence of a gene encoding a viral protease, known to be essential for viral replication from studies of other members of the coronavirus family to which the SARS virus belongs. Drug developers are already at work seeking specific inhibitors of this protease (Figure 35. 25).
1019 35.3 The Prom ise of Genom e Analysis
~ Figure 35.25 Emerging drug target. The structure of a protease from the coronavirus
that causes SARS (severe acute respiratory syndrome) is shown bound to an inhibitor. This structure was determined less than a year after the identification of the virus. [Drawn from lP9S.bdb.]
Genetic Differences Influence Individual Responses to Drugs
Many drugs are not effective in everyone, often because of genetic differences between people. Nonresponding persons may have slight differences in either a drug's target molecule or proteins taking part in drug transport and metabolism. The goal of the emerging fields of pharmacogenetics and pharmacogenomics is to design drugs that either act more consistently from person to person or are tailored to individuals with particular genotypes. Drugs such as metoprolol that target the [31 -adrenergic receptor are popular treatments for hypertension. H
0
/ H,C
f
0
\
OH
H N H
CH, CH,
Metoprolol
But some people do not respond well. Two variants of the gene coding for the [31 -adrenergic receptor are common in the American population . The most common allele has serine in position 49 and arginine in position 389. In some persons, however, glycine replaces one or the other of these residues. In studies, participants with two copies of the most common allele responded well to metoprolol: their daytime diastolic blood pressure was reduced by 14.7 :t: 2.9 mm Hg on average. In contrast, participants with one variant allele showed a smaller reduction in blood pressure, and the drug had no significant effect on participants with two variant alleles (Figure 35.26). These observations suggest the potential utility of genotyping individuals at these positions. One could then predict whether or not treatment with metoprolol or other [3-blockers is likely to be effective. Given the importance of ADME and toxicity properties in determining drug efficacy, it is not surprising that variations in proteins participating in drug transport and metabolism can alter a drug's effectiveness. An important example is the use of thiopurine drugs such as 6-thioguanine, 6mercaptopurine, and azothioprine to treat diseases including leukemia, immune d isorders, and inflammatory bowel disease.
"be I
i5E
.2E ..0
....
~
'"
:.=c: 0:.=
o -2
-
-4 -
-6
I-
~ ~
-8 .."..0 - 10 .5 E - 12 l00- - 14 Ic: '" ..c: :O - 16 u~ - 18
'"
'" e '" -
0..
SRISR SRI GR SRISG GRISG
Figure 35.26 Phenotype-genotype correlation. Average changes in diastolic blood pressure o n treatment with metoprolol. Persons with two copies of the most common (S49R389) allele showed significant decreases in blood pressure. Those with one variant allele (GR or SG) showed more modest decreases. and those with two variant alleles (GR /SG ) showed no decrease. [From J. A. Johnson et al.. Clin. Pharmacal. Ther. 74(2003):
44- 52.]
1020 CHAPTER 35
/
N0 2
Drug Development
SH
SH
5
H N
H
H2N 6-Thioguanine
N
H N
j
j
N
N
6-Mercaptopurine
Azathioprine
A minority of patients who are treated with these drugs show signs of toxicity at doses that are well tolerated by most patients . These differences between patients are due to rare variations in the gene encoding the xenobioticmetabolizing enzyme thiopurine methyl transferase, which adds a methyl group to sulfur atoms. SH H ____ N
;;
+ S-adenosylmethionine
Thiopurine methyltransferase
,-~~===='
H N
+ S-adenosylhomocysteine + H+
N 6-Mercaptopurine
The variant enzyme is less stable. Patients with these variant enzymes can build up toxic levels of the drugs if appropriate care is not taken. Thus, genetic variability in an enzyme participating in drug metabolism plays a large role in determining the variation in the tolerance of different persons to particular drug levels. Many other drug-metabolism enzymes and drugtransport proteins have been implicated in controlling individual reactions to specific drugs. The identification of the genetic factors will allow a deeper understanding of why some drugs work well in some persons but poorly in others. In the future, doctors may examine a patient's genes to help plan drug-therapy programs.
35.4
The Development of Drugs Proceeds Through Several Stages
In the United States, the FDA requires that drug candidates be demonstrated to be effective and safe before they may be used in human beings on a large scale. This requirement is particularly true for drug candidates that are to be taken by people who are relatively healthy. More side effects are acceptable for drug candidates intended to treat significantly ill patients such as those with serious forms of cancer, where there are clear, unfavorable consequences for not having an effective treatment.
Clinical Trials Are Time Consuming and Expensive Clinical trials test the effectiveness and potential side effects of a candidate drug before it is approved by the FDA for general use. These trials proceed in at least three phases (Figure 35.27). In phase 1, a small number (usually from 10 to 100) of healthy volunteers take the drug for an initial study of safety. These volunteers are given a range of doses and are monitored for signs of toxicity. The efficacy of the drug candidate is not specifically evaluated .
phase 1
Phase 2
1021
Phase 3
Preclinical drug discovery
Clinical use Safety
Safety Efficacy Dosage
35.4 Stages of Drug Development
•• •
Safety Efficacy Side effects
Figure 35.27 Clinical-trial phases. Clinical trials proceed in phases examining safety and efficacy in increasi ngly large groups.
In phase 2, the effi cacy of the drug candidate is tested in a small number of persons who might benefit from the drug. Further data regarding the drug's safety are obtained. Such trials are often controlled and double-blinded. In a controlled study, subj ects are divided randomly into two groups. Subjects in the treatment group are given the treatment under investigation. Subjects in the control group are given either a placebo that is, a treatment such as sugar pills known to not have intrinsic value or the best standard treatment avai lable, if withholding treatment altogether would be unethical. [n a doubleblinded study, neither the subj ects nor the researchers know which subjects are in the treatment group and which are in the control group. A double- blinded study prevents bias in the course of the trial. When the trial has been completed, the assignments of the subjects into treatment and control groups are unsealed and the results for the two groups are compared. A variety of doses are often investigated in phase 2 trials to determine which doses appear to be free of serious side effects and which doses appear to be effective. One should not underestimate the power of the placebo effect that is, the tendency to perceive impro vem ent in a subject who believes that he or she is receiving a potentially beneficial treatment. In a study of arthroscopic surgical treatment for knee pain, for exampl e, subj ects who were led to be lieve that they had received surgery through th e use of videotapes and other means showed the sam e level of improvement, on average, as subject s who were actually operated on. In phase 3, similar studi es are performed on a larger population . This phase is intended to more firmly establish the efficacy of the drug candidate and to d etect side effects that may develop in a small percentage of the subjects who receive treatment. T housands of subj ects may participate in a typical phase 3 study. C linical trials can be extremely costly. Hundred s or thousands of patients must be recruited and monitored for the duration of th e trial. Many physicians, nurses, clinical pharmacologists, statisticians, and others participate in the d esign and execution of the trial. Costs can run from tens of millions to hundred s of millions of dollars . Extensive record s must be kept, including documentation of any adverse reactions. These data are compiled and submitted to th e FDA. The full cost of developing a drug is currently estimated to be from $400 million to $800 million. Even aft er a drug has been approved and is in use, difficulties can arise. As mentioned earlier, rofecoxib (Vioxx), for example, was withdrawn from the market after significant cardiac side effects were d etected in additional clinical trials. Such events highlight the necessity for users of any drug to balance beneficial effects against potential risks.
The Evolution of Drug Resistance Can Limit the Utility of Drugs for Infectious Agents and Cancer Many d rugs are used for long periods of time without any loss of effective ness. However, in some cases, particularly for the treatment of infectious di seases or of cancer, drug treatments that were initially effective beco me
less effective. In other words, the disease becomes resistant to the drug therapy. Why does this occur? Infectious diseases and cancer have a common feature namely, that an affected person contains many cells (or viruses) that can mutate and reproduce. These conditions are necessary for evolution to take place. Thus, an individual microorganism or cancer cell may by chance have a genetic variation that makes it more suitable for growth and reproduction in the presence of the drug than is the population of microorganisms or cancer cells at large. These microorganisms or cells are more fit than others in their popu lation, and they will tend to take over the population. As the selective pressure due to the dru g is continually applied, the population of microorganisms or cancer cells will tend to become more and more resistant to the presence of the drug . Note that resista nce can develop by a number of mechanisms. The HIV protease inhibitors discussed earlier provide an important example of the evolution of drug resistance. Retroviruses are very well suited to this sort of evolution because reverse transcriptase carries out replication without a proofreading mechanism. In a genome of approximately 9750 bases, each possible single point mutation is estimated to appear in a virus particle more than 1000 times per day in each infected person. Many multiple mutations also occur. Most of these mutations either have no effect or are detrimental to the virus. However, a few of the mutant virus particles encode proteases that are less susceptible to inhibition by the drug. In the presence of an HIV protease inhibitor, these virus particl es will tend to replicate more effectively than the population at large. Over time, the less susceptible viruses will come to dominate the population and the virus population will become resistant to the drug. Pathogens may become resistant to antibiotics by completely different mechanisms. Some pathogens contain enzymes that inactivate or degrade specific antibiotics. For example, many organisms are resistant to [3 -lactams such as penici llin because they contain [3-lactamase enzymes. These enzymes hydrolyze the [3-lactam ring and rend er the drugs inactive.
1022 CHAPTER 35 Drug Development
o
o R-
R-
-'(
H
o
.~ s
HN ,
HN'r_ ~ S -N~
H ~
+ H2 0
·····""' CH
-
o
3
fj-l actama se >
0=
- 214, 213f general ac id -base, 242 in metabo lic regulation, 428 met"1 ion , 207, 207t, 242 in carbon dioxide hydrol ysis, 255- 256,255f- 257f in DNA cleavage, 262-2 63, 264- 265 in N MP kinase-catalyzed phosphoryl group transfer, 268- 269, 269 f M ichaeli s constant ( K M) for, 218- 221 in peptide bond cleavage, 246-248. 247f in phosphoryl-gro up transfer, 267 270 rate of, 218- 221. See also En zyme kinetics ; Reaction rates reaction eq uilibrium and, 2 10-2 11 reaction rate acceleration and , 206, 206t. 2I O- 213,2 13f by RN A , 848 850 in sel ecti vt: binding of tran sition state, 211 - 212. 212f. 2 14, 232 in seq uen t ial reactions, 223-22 4 site-detected mutagenesis and, 250- 25 1, 250 f Catalytic antibodies, production of, 232 , 232f Ca talytic groups, 214 Catalytic RNA, 848 85 1, 869 Catalytic strategies, 24 1- 272 of carboni c anhydrases, 24 1, 25 4- 259 covalent, in chymotrypsin , 243 248 of nucleotide monophosphate kinases, 241 ,267- 270 overview of, 24 1 242 of restriction endonucleases, 24 1, 259- 266 of serine proteases, 241, 243 254 Catalytic triads, 245- 251 in carboxypept idase II , 250, 250f in chymotrypsin, 245 248,249f in elastase, 248- 249 , 249[ site-detected mutagenesis and , 250- 25 1, 250f in subtilisin , 24Y, 249[ in trypsin . 24R- 249, 249f
Catalytica ll y perfect enzymes, 22 1. 222- 223. 440 Cataracts, 45 1, 452 CCA terminus, of tR NA , 860, 861. 861 f C D1, 904- 9fio. 9fi5f CD4 , 967 CD8, 964- 965, 964 f cDNA (compl ementary DNA ). 152- 154. 1 53 £. 154f eD NA library, 153 C D P, hydrolysis of, 413 C OP -diacylglyce rol. 734 . 734 CO P-ethanolam ine, syn thesis of, 735- 736 C D Rs (complementa ri ty-determining regions), 952, 952f. 953- 954 Cech , Thomas, 822, 849 Celecoxih. l 016. 1016 Cell cycle, 803, 803f Cell -med iated immunity, 96 1 C:ell -to-cell ion chann els. 3n- 174. 373f, 374f C eilul ar energy. See Energy Cel lular immun e response, 94R
Cellul ar respiration, 476, 477 f, 569 f, 570. See also Respir atory chain definition of, S03b in photosynthesis, 569 £. 570 reg ul ation of, 530- 535 Cellulase, 3 12 Cellulose , 31 2 Centrifugatio n band , 77 , 77f density -gradient equ ilibrium . 113 114. 11 3f,l 14f di fferential , 67- 68, 68f gradi ent, 77. 77f ho mogenate in , 67 , 68f sedimentati on coefficients in , 70- 77, 76f, 76t supernata nt in, 67 , 68f zonal , 77, 77f Cerami de, 737 sphingolipids from, 736 737,737f Cerebroside, .131, 331 synthesis of, 737, 737 Cetuximab, 40 1 CF ,- CPl1 complex, 554 cG MP stru ct.ure of, 383 in vision, 934- 935 , 934 f cG MP -ga ted C:a2+ chann el, in vision, 914 cG MP phosphodiesterase, in vision , 934 C hain , E rnest, 1009 C hain -termin ated frag ments, in DNA sequencing, 138 C hair form, 308, 308f C hangeux, Jean -Pi erre, 189 C hannels ion . See Ion channels water, 374 - 375 C:harcot -Mari e-Tooth di sease, 989 C hargaff, Erwin , 11 2 C harge separation, photoind uced, 545, 545f C harged tRN A , 862 , 862f
Index
Chemical modification reaction , 244 C hemical protons, 51 7f Chemical reactions. See Reaction(s) Chemical shi fts, in NM R spectroscopy, 99 , 99f, 100f Chemiosmotic hypothesis, 52 1 522 , 52 lf, 522 f Chemoattractants, 995 Chemorepellants, 995 Chemotaxis, 995- 996 , 996f Chemotherapy, cancer, resistance in , 1022 1023 Chemotrophs, 4 10 e heY, 996 C hIP (chromatin immunoprecipitation), 906 C hirality,27 of amino acids, 28, 28f, 686-687 Chloramphenicol, 884, 884t Chlorobium Lhiosul!a Luphlium, 560, 560t Chlorophyll a, 544, 544- 548, 544[, 545f in photosystem n, 549, 549 f C hlorophyll b, 558, 558, 558f C hloroplasts, 541, 542- 544 , 54 2f ATP synthesis in , 553- 557, 554f evolution of, 543 544 genome of, .044 starch in , 573 structure of, 543 , 543 f, 585 f C hlorpromazine, 10lD discovery of, 1010 mechanism of action of, 10 10- 10 II , 1011 f C holecalciferol, 754, 754 C holecysto kinin , 775 C holera, 401- 402 C holesterol, 33 1, 331 " bad ," 745 bil e salts from , 748- 749 elevated levels of, 732, 745, 747 748, 747f "good ," 745, 747 labeling of, 739 f in lipid membrane, 344- 345 in low-density lipo proteins, 346 metabolic fates of, 746 metabolism of, 745 748 pro perties of, 739 receptor -mediated endocytosis and, 346, 346f steroid hormones fro m, 749- 75 4 transport of, 743- 744 , 745 C holesterol synthesis, 736 748, 739- 748 condensation mechani , m in , 74 1, 741 f hepatic, 742, 744f isopentenyl pyrophosphate in , 740 mevalonate in, 739 rate of, 742 regulation of, 742 748 site of, 744, 744f squalene in , 739, 740- 742 stages of, 739 sterol regulato ry element binding protein in , 742- 743, 743f C holine, in phospholipids, 330
C hondroitin 6-sulfate, 313, 313 C horismatc, in aJnino acid synthesis, 693- 694 , 694f C hromatin , 903- 906, 903f D N A packing in, 905 in gene regul ation, 905- 906 remodelin g of, 905- 906, 910- 91 2, 912f structure of, 903- 904, 903f transcription factors and, 907- 908 C hromatin immunoprecipitation (ChIP), 906 C hromatin -remodeling engine, 912, 9 12f C hromatography affinity, 70, 70f, 75, 75f gel -filtratio n, 69 , 69f, 75, 75f high-pressure liquid , 71, 71£ ion -exchange, 69 70, 69f, 75, 75t in amino acid identification, 78, 78f C hromogen.ic substrate, 244 C hromophores, 932 C hromosomes hacterial artificial, 145- 146 yeast, 90 1, 90lf yeast artificial , 145- 146, 146f C hroni c myel ogenous leukemia, treatment of, 401 C hylomicrons, 620, 620f, 744, 744t (;hymotrypsin , 175, 176, 243- 248 active sites of, 175, 170f, 246 calalYlic triad in, 24 5- 248 cova lent catalysis in , 243- 248 acyl-enzyme intermediate in, 245, 247f telrahedral intermediate in, 246- 247 , 247f as two-stage process , 244 245,245f, 247 f homologs of, 248- 249, 249f inhibition of, 56f, 229 230, 230f in peptide bond cleavage, 247f serine residue of, 243- 244, 244f specificity of, 244f, 2 4 ~, 248f structure of, 244, 245 , 246, 248, 249f substrate preferences of, 222 , 222t trypsin and, 248, 249f C hymotrypsin inhibitor, structure of, 56f C hymotrypsinogen , 245- 246, 289- 290 C ilia cochlear, 937- 939 , 937f, 938[ microtuhul es in , 990 C iprofl oxacin , 792 ,792 C ircadian rh ythms, 941 C irce effect, 223, 223b C ircular DNA , 11 5 11 6, 11 5f, 788 789, 788f C irrhosis, 778 C is- acting elements, 823 C is configuration, of peptide bonds, 18, 38f C ilrate in fatty acid metabolism, 638 639,639f, M I ,M 1f isomeri zation of, in citric acid cycle , 484, 484f Citrate synthase, in citric acid cycle, 482- 484, 483f
09
C itric acid cycle, 475 498 acety l coenzyme A in . 475 , 478- 480, 482- 484, 492- 491 , 03 1,6.14 aconitase in. 484 ATP in , 476, 490 , 492- 493, 492 f, 53 1,511t in cellular respiration, 477 citrate isomeri zation in , 484 , 484 r citrate synthase in , 482- 484, 4R1 f citryl coenzyme A in , 4~ 3 4~4 , 4~4 electron -transport chain in, 476, 490 enol in termediate in , 483 enzyme compl exes in , 490 evolution of, 495 function of, 476- 477 glycolysis and, 477 481, 477f intermediates in , [rom amino acid
degradation, 666- 672 isocitrate dehyd rogenase in, 484 485, 492,492 f isocitra te in, 484- 485, 485 f a -ketoglutarate dehydrogenase complex in ,477 , 485, 492,492f a -ketoglutarate in , 485, 485 f, 61i8 ketone bod ies in, 773, 773 f malate in, 488 in mitochond ria, 476, 476f net reaction of, 488 nucleoside diphosphokinase in , 486 overview of, 475- 477 oxa loacetate in, 476, 476f, 477 , 482, 483 , 483f, 487 488, 492 493,631 oxalosuccinate in , 485, 485f production of b iosynthetic in termedi ates in , 493- 495 pyru vate carboxy lase in, 491- 494 pyru vate dehydrogenase compl ex in , 477 481, 477f, 477t, 480 f, 48 lf pyru vate dehyd roge nase in, 478 rate of, 53 2, 532f reactions of, 488 490, 489f, 489t regulation of, 490- 493, 532, 532f, 763 stoichiometry of, 488- 490, 489f, 489t substrate channeling in, 490 succinate dehyd rogenase in, 487- 488 succinyl coenzyme A in , 485- 487. 486[, 492 succin yl coenzyme A synthetase in , 486- 487, 486f C itrull ine, 662 , 662, 665 C itrullinema, 674t C itryl coenzyme A, in citric acid cycle, 483 484, 484 C lamp loaders, 799 C lass I MH C protei ns, 961- 96 5, 962f, 968. See also Major histocompatibili ty com plex pro te ins
C lass II MHC proteins, 966-969, 966f C lass switching, 960 961 , 960f C lathrin , 746, 746f Cl eavage D NA. See D NA, cleavage of protein, 80- 82, 80r, 8 1f C leland notation , 22 3, 224
010
INDEX
C lelanu , W . Wallace, 22:> C linical trials, 1020 1021, 1021f C lones, D NA, 152- 154 C loning, 86 plasmid vectors in, 142- 144, 144f C lotting, 293 , 296 297 extrinsic pathway of, 293 , 293f impaired , 296 , 297 in hemophili a, 296 intrinsic pathway of, 293, 293f regulation of, 296- 297 zymogen acti vation in, 293 297 C lotting [actors, 296- 297 C MP (cytidine monophosphate), 735 Coacti vators, 909, 909 f, 910 912 Coagulation. See Clotting Coat proteins, 883 Coated pits, 746 , 746f Cobalamin (vitamin ti d , 423t in ami no acid synthesis, 628- 630, 628f, 629 f, 69 1 692 as coenzyme, 628- 630, 628 f, 629f, 691 - 692 in fatty acid metabolism , 627, 630 slructure of, 628, 628 Cobratoxin, 370 Cochlear hair cells, 937 939, 937f, 938f Coding strand, 825 Codons, 19, 108, 123 anticodons and, 873- 874. See also Anticodons definition of, 123 in genetic code, 125, 125t initiation, 870 in translation, 8.;9, 873- 87 6, 87Sf Coenzyme(s), 207, 207 t vitamin, 423t Coenzy me A, 422, 423 , 423t as acyl group carrier, 422 ADP units in , 429, 429 f in fatty acid metabolism, 1\22 Coenzyme BIZ, 628- 630, 628f, 629f CoenzymeQ (ubiquinone), 509, 5 10, 510f in fatty acid metabolism , 624 Cognate DNA , 260 cleavage of, 264 266 Cohen , Stan ley, 142 Cohesive-end method, 143. 143f Coiled-coil proteins, 45, 45f Collagen, 289 amino acid sequences of, 45- 46, 46f ascorbate and, 779 in ci:lrtilage l .1 1:1
helix of, 45- 46 , 46f Collagenase, 289 Color blindness, 936- 937 Color vision, 931, 935- 937 . See also Vision in animals, 936, 936f defective, 936- 937 evolution of, 936, 936f Combinatorial association, antibody diversity and, 958 Combinatorial chemistry, in evolution studies, 178 179
in drug development, 1013. See also Drug development Combinatorial control, 902 Committed step , 454, 697 Compactin, 101 2, 1012 Com parative genomics, 151, 15 If Compartments, drug target, 1005, 1005f Competitive inhibition, 225 228,225f, 226f, 228 [ Complement cascade, 949 Complementarity -determining regions (CDRs), 952 , 952f, 953- 954 Complementary DNA , 152-154, 153f, 154f Complementary single-stranded ends, 143 Computer uatabases, for amino acids, 65 ,
17 1,1 72f Concentration gradient, 353 in ATP synthesis, 41 8-419 , 4191', 420 Concerted mechanism, in substrate binding, 281 Concerteu (MWC) mouel of allosteric enzyme kinetics, 282 , 282 f of hemoglobin oxygen binding, 1~9- 100, 189f, 200- 201, 20 1f Cones, 931, 935- 936, 935f Congenital erythropoietic porphyria, 704- 705 Congestive heart failure, digitalis for , 357 Conjugation, in drug metabolism, 1006- 1008 Connexin, 374 Connexon, 374, 374f Consensus sequences, 122b, 122f, 286 in phosphorylation, 286 in promoters, 825, 825f in splicing, 128, 128f, 843, 8431' Conservative substitutions, 168 Constant (C) genes, 956 in class switching, 960- 961 Constant regions, 952, 952£ Constants. See also specific constants acidity, A2 mathematical , Al physical, Al Continuous genes , 127, 128 Controlled termination of replication , 13S 139, 138£ Cooley anemia, 196 Cooperati ve binding, 187- 188 , 188f, 189f, 2ilO 281 Cooperative transition, in protein foldin g, 55 C oproporphyrinogen III, 703, 703 704 Cord ycepin, 842 Core promoter, 825 Corepressors, 900 Corey, Robert, 40 C:ori , Carl , 434 Cori cycle, 468, 468[, 661, 767, 768f Cori disease, 6 12t Cori , Gerty, 434, 611 Coronary artery disease. See Atherosclerosis
Corrin ring, 628, 628f Cort icosteroids. See alsu Steroid hormones
synthesis of, 752 Corticosterone, 753 Cortisol, synthesis of, 749, 749f, 752, 753 Coryneba.cterium diphtheriae, 885 Cotransporters, 360- 361, 360f Coulomb's law, 7- R Covalent bonds, 7. See also Bonds cleavage of, 14 Covalent catalysis, 242, 243- 248 acyl-enzyme intermediate in, 245, 247f chymotrypsin and, 243 248 tetrahedral intermediate in, 246-247 , 247f as two -stage process, 244 245, 245f, 247[ Covalent modification, of proteins, 57- 58, 57f,283 285, 284t , 762 mechani sms of, 284t. See also Phosphorylation COX2 inhibitors, 1016 development of, 101 6 CpG, methylation of, 907 C pG islands, 907 Crassulacean acid metabolism, 577, 577[ C re recombinase, 813- 814, 814 C reatine kinase, 223- 224 , 907 in sequential reactions, 223- 224, 224f Creatine phosphate, 416 during exercise, 416, 41 7f, 775, 775t phosphoryl-transfer potential of, 416, 416t Creutzfeldt -Jakob disease, 53 54,54f C rick, hancis, " 111,124,874- 87 5 Cristae, 503, 504f C ritical concentration, 986 Crixivan (indinivar), development of, 1015- 101 6,10I5f C ross-links, 806- 807, 807f C rotonyl ACP, 636, 636t, 637 Crown gall , 157- 158, 157f C RP (cAMP response protein), 900- 901 , 900f C rys tallography, X-ray, 96- 98, 961:"98f of enzyme-substrate complexes, 213, 213f time-resolved , 213, 213[ CTD (carboxyl-terminal domain), 834, 837- 838, 846, 846f (;'1'1'. See Cytidine triphosphate (CT!') C yanide, 533 Cyanobacteria, 544, 544£ Cyanogen bromide, in protein cleavage, 80, Ror, 81t
Cyclic adenosine monophosphate. See cAMP C:yel ic hemiacetals, 307 Cycl ic photophosphorylation, 555 , 556- 557, 556[ eyelin B, degradation of, 649 Cycl in, ubiquitination of, 284, 284t Cyclin -dependent protein kinases, 803
Index Cyclin destruction boxes, 652 Cyclins, 803 Cycloheximide, RR 4, 884t in taste, 928- 929 Cyclooxygenase 1, 1016, 1016 Cyclooxygenase 2, 1016 Cyclooxygenase inhibitors, development of,1016 Cyclophosphamide-glutathione conj ugate, 1006, 1006 Cyclosporin, 959 , 959 Cys, His, zinc-finger domains, R95- 896, 896f Cyst-tRNA, 873- 874 , 874 Cystathionine, 693, 693 Cysteine molecular models or, 23 f pyru vate formati o n from, 667, 667f structure of. 31, 31f synthesis of. 689 , 693 Cysteine proteases, in peptide bond cleavage, 251, 25 1- 252, 252f Cystine, 36, 36f Cytidine, 109 synthesis of. 713 Cytidine diphosphodiacylglycerol (CDPdiacylglycerol), 734, 734 Cytidine monophosphate (CMP), 735 Cytidine triphosphate (C TP), 734 ATCase inhibition by, 27i, 277[, 281- 282, 282f hydrol ysis of. 413 in pyridine synthesis, 2/i, 277f, 281- 282, 282f structure of, 276, 277 synthesis or, 713- 714 Cytochrome definition of, 512 in photosynthetic reaction center, 547- 548 , 548f Cytochrome bs, 64 2 643, 643f Cytochrome bi complex, 55 1, 551f location of, 559, 5S9f Cytochrome c in apoptosis, 535 evolution of, 520, 520f in oxidative phosphorylation, 509, 509f, 509t Cytochrome c oxidase, 509, 509f, 509t, 512- 513,51Sf Cytochrome P450, 751 - 752 , 7S 1f in drug metaboli sm, 1006 Cytochrome P4 50 monooxygenases, 750 Cytochrome reductase, 509, 509f, 509t, 512- 5U,5Uf Cytoglobin, 197- 198 Cytokines, 967, 96Sf Cy toplasm fatty acid synth esis in, 63 4 glycolysis in, 476 Cytosine, 4, 4, 109, 109 deamination of, 806, 809 Cytotoxic T cells, 948, 964 965,967 , 967 f. See also T cell (s)
D amino acids, 27, 27 f o genes, 956- 957 in antibody switching, 960- 961 D-isomers, 304- 305, 305r, 30M o stereoisomers. of monosaccharides, 304- 305, 305f. 306f DAG . See Diacylglycerol (DAG ) Dalton, 35 Dark reaction s, of photosynthesis, 541, 542,565- 577. See also Calvin cycle; Photosynthesis Databases, of amino acid sequences, 65, 171 , I 72f Dawkins , Richard, 56 DCC (dicyclohexylcarbodiimide), 91,91 Deamination, 806, 806[, 809 in amino acid degradation, 656- 660 Decarboxylation, 463 in citric acid cycle, 478, 485 in fatty acid synthesis, 636 in gluconeogenesis, 462- 463 in pentose phosphate pathway, S77 Degenerative arthritis, 313 Dehydrati on, in amino acid degradation, 660 Dehydroascorbic acid, 779, 779 7-Dehydrocholesterol , 754, 754 Dehydrogenases, NAD+ binding sites in, 448 449, 449f 3-Dehydroquinate, in amino acid synthesis, 693, 694 3-Dehydroshikimate, 694 Deletions, production of, 147 Denatured proteins, 51, 51f Density -gradient equilibrium sedimentation, 113- 114, l1:1f, 114f Deoxyadenos ine, 109, 842 5' -Deoxyadenosyl radical , 628- 629, 629f 5' -Deoxyadenosylcobalamin, 628, 628- 629 Deoxyadenylate, 110 3 -Deoxyarabinoheptulosanate 7 -phosphatase, in amino acid synthesis, 693 , 694 Deoxycycline, 22 7 Deoxycytidine, 109 Deoxycytidylate, 11 0 Deoxyguanosine, 109 Deoxyguanosine J -monophosphate (3' -dGMP), 110, 110 Deoxyguanylate, 110 Deoxymyoglobin , 184, 185 . See a.lso Myoglobin Deoxyribonucleic acid. See DNA Deoxyribonucleoside J' -phosphoramidites, in DNA synthesis, 139, 139, 139f Deoxyribonucleoside triphosphate, in replication, 795, 795f D eoxyribonucleotide synthesis, 718- 723 deoxyuridylate in, 720 dihydrofolate reductase in , 72 1 regulation of, 724- 725, 724f ribonucleotide reductase in, 718, 718- 720, 718f, 719, 724- 72 5, 724f t hymidylate in, 720- 721, 72 1f
011
Deoxyribose, 108, 108 Dephosphory lation, 285- 286 (- )Deprenyl, 230, 230 Dermatan sulfate, 313, 313 1-Desamino -8-D -argininc vasopressin, 90 , 91 D esaturase, 642- 643, 64J f Designer genes, 148, 14 8f Desmolase, 752 a -Dextrinase, 434 DHAP. See Dihydroxyacetone phosphate (DHAP) DHU loop, of tRNA, 860, 860f Diabetes insipidus, 90 Diabetes mellitus, 773- 774 as autoimmune di sease, 971 glucose homeostasis in, 773 774 insulin in, 773- 774 ketosis in , 631, 633- 634, 633f, 773, 774 type 1,773- 774 type 2, 774 obesity and, 775 Diacarboxylate carrier, 530, 530 f Diacylglycerol (DAG ), 388, 620 in phospholipid synthesis, 734 - 735, 734f, 735f in signal transduction , 388- 389, 389f synthesis of, 733 DiacylglyceroI3 -phosphate, 329, 329 in membrane lipid synthesis, 733 Diagonal electrophoresis, 82, 82f Dialysis , in protein purification, 69, 69f Dianabol, 910 Diastereoisomers, 305, 30sf Diazotrophic microorganisms, 681 5,5 -Dibromo -4,4' -dichloro -indigo, 896 Dickerson , Richard , 786 Dicoumarol, 295, 295 Dicyclohexylcarbodiimide (DCC), 91 , 91,92f Dideoxy method, 138- 139, 138f 2,4- Dienoyl CoA red uctase, 626, 627 Diet, 20- 21, 21f. See also specific nutrients low-phenylalanine, 674 spicy food in, capsaicin in, 940- 941, 940f starved-fed cycle and , 770- 772. See also Starvation Dietar y fiber, 312 Differential centrifugation, 67 68, 68f Diffusion active, 353 faci litated, 351, 353 lipid lateral, 342- 345, 34 2[' 343f transverse, 343 simple, 352 D igestion, 419, 650, 650f. See also Amino acid degradation chymotrypsin in, 243 248. See also C hymotrypsin enzy mes in, 243- 248, 289- 292 , 289f, 289t, 650, 650f starved-fed cycle and, 770- 772
012
INDEX
Digitalis, a ' -K ' pump inhibition by, 357 Digitoxigenin . 357, 357 Diglyceride acyltransferase, 733 Dihydrobiopterin, 671,671 Dihydroceramide. in sphingolipid synth esis. 736, 737 1.25 -Dihydrocholecalci ferol. 754, 754 Dihydrofolate. in deoxyribonucleotide synthesis, 720- 721. 721 Dihydrofolate reductase, 67 1, 67 1f in deoxyribonucleotide synthesis, 72 1 Dihydrolipoyl dehydrogenase, in citric acid cycle, 477t, 479 , 480f Dihydrolipoyl transacetylase, in citric acid cycle. 477t. 479 Dihydroorotate. 71 2, 712 Dih ydropteridine reductase, 671 , 671f Di hydrosphingosine. in sphin golipid synthesis, 736, 737 Vihydrotestosterone (VHT), 754 Dihydrouridine (UH 2 ) . 860 Dihydroxyacetone, 304, 304, 305 structure of, 306f in transaldolase reacti on . 582, 582f Dihydroxyacetone phosphate (DHAP), 310, 3 1Of, 438, 458 in Calvin cycle. 570 , 570f. 571 in fructose metaboli sm, 449 , 449f in gluconeogenesis, 438, 459 f in glycolysis, 220. 436f. 438- 439 . 438f. 440[, 449. 458, 439f isomerizati on to glyceraldehyde 3-phosphate. 210. 210, 43 8 439. 440f Dihydroxycholesterol, 752 , 752 Dii sopropylphosphonuoridate (DlPF), enzyme inhibition by, 229 , 229 f 2,2- Dimercaptopropanol (13AL), 495, 495f Dim erizati on arm , 396 Dimers, 49 6-Vimethyladenine, 832 Dimethylallyl pyrophosphate, 740, 740- 741, 741f Dimethylbenzimidazole, 628 N, N- Dimethylpropa rgylamine, 230. 231 2, 4-Dinitrophenol (DN P). 334, 534 Dintzis, Howard. 869 Dioxygenases. 672 Dipalmitoyl phosphatidylcholine deficiency, 738 o [PF (diisoprophylphosphonuoridate). enzyme inhibition by, 229, 229 D iphosphatid ylglycerol, 330, 330 synth esis of. 7JS Dipolar ions, 27- 28, 27f Disaccharides, 3 10- 315. See also Carbohyd rates abbreviations for , 316b structure of, 3 10, 3 1Of Discontinuous (split) genes. 127- 129. 12U, 129f evolutionary advantages of, 129 Diseases and disorders albinism , 674t
alcaptonuria, 672- 6 7J alcohol -related, 778- 779 amjno acid seq uences and , 37 Andersen disease. 612t anemia . 316 anthrax, 792 anticipation in , 805 argininosuccinase deficiency, 665 , 665 f arsenite poisoning, 494 495,495f atherosclerosis. See Atherosclerosis autoimmun e, 971 beriberi. 494 bleeding di sorders, 296, 29 7 can cer. See Cancer carbamoyl phosphate synthetase deficiency, 665, 665f cardiovascular disease, 693, 732. 745 . 747- 748 . See also Atherosclerosis carnitine deficiency, 624 cataracts, 451. 45 2 C harcot -Marie-Tooth disease, 989 cholera, 401 - 402 citru llinemia .674t congenital disorders of glycosylation, 318- 3 19 congestive heart failure . 3.17 Cooley anemia, 196 coronary artery disease, 732, 745, 747- 748, 747f. See also Atherosclerosis deafness , 984 diabetes in sipidus . 90 diabetes mellitus. See Diabetes mellitus diagnosis of, polymerase chain reaction in , 141 - 142 diptheria , 885 drug-resistant, 102 1- 1023 dwarfism . 1.15 emphysema, 292 environmental factors in, 20 fami lial hypercholesterolemia . 7.12. 747- 748 G6PD deficiency, 586 587 galactosemia, 45 1 gene therapy for, 158- 159 genetic variations and. 20 gigant ism . 15 5 glycogen storage diseases, 611 - 612, 6 12t gout, 726 heart disease, 311\- 3 19, 693 hemolytic anemia, 586- 58 7 hemo philia, 296 HIV infection . See Hum an immunodeficiency virus infection homocystinuria, 674t Huntington disease, 805 hyperl ysinemia, 674t I-cell disease, 31R- 319 inborn erro rs of metabolism, 672- 674, 674t infant respiratory distress syndrome, 738 lactose intol erance, 451 L eber hereditary o ptic neuropathy, 534
Lesch -Nyhan syndrome, 726- 727 Li -Fraumeni syndrome, 8 10 malaria, SR7 mapl e syrup urine disease, 673 mercury poisoning, 494 49 5 misfolded proteins in , 53- 53 mitochondrial , 534- 335 mucopolysaccharidoses, 3 13 multidrug resistance in, 358 multipl e myeloma. R6 neurological. protein misfolding in, 53- 54 • 54f ornithine transcarbamoylase deficiency. 665 osteoarthritis, 313 osteomalacia. 735 Parkinson's disease, 230, 653 phenylketonuria, 650, 673- 674 phosphatase deficiency, 492 porphyrias, 704 70S predi sposition to, 20 prion . 53- 54. 54f protein aggregates in . 53- 55 retinitis pigmentosa, 847 rickets. 754- 755 scurv y, 57 58, 779 severe combined immunodefi ciency, 159 sickle-cell anemia, 194- 196, 194f 196f spina bifida, 727 splicing defects and . R47 . 1\4R. R4R t steatorrhea. 620 Tay -Sachs disease, 738- 739 thala ssemia , 196, 197 tyrosi nemia, 674t urea cycle defects, 664- 665 Usher syndrome, 9R4 vitamin 0 deficiency, 754- 755 W ernicke -Korsakoff sy nd ro me, 778 whoopin g cough , 401- 402 Zellwegger syndrome, 630 Dismutation, 318- 519, 5 19f Dissociation constant ( Ke) apparent. 1003 fo r enzyme-substrate complex, 22 1 for ligand binding, 1002- 1003, 1002f, 1003f Distal histidine, 186, 186 Distributive enzymes, 798b Di sulfide honds, 35- 3(" 3M cleavage of, SO locatio n of, determination of, 82 , 82f reduction of. R1. il l f D iuron , 560. 560 Divergent evolution, 175 Diversity (D) genes, 957- 95R in class swi tching. 960- 961 DNA A-form, 7il4- 785, 787, 787t ancient, amplification and sequencing of, 142 , 178, 178f annealing of, 115 anti sense strand of. 825 13-form, 784 78 5, 787. 787t
Index backbone of, 1ORf, 109 bases in, 4, 4, 4f, 5, 5- 6, 109, 109. See also Bases/ base pairs in chromatin , 903- 90(" 903f, 905f circular, 115- 116, 11 Sf, 788- 789 , 788f cleavage of in cognate vs, non cognate DNA, 263- 266 , 264f in -line displacement of, 261 m agnesium in, 262- 263, 263f, 264- 265 mechanisms of, 260- 262 methylation in , 260, 260f, 265- 266 phosphodiester bridge hydrolysis in, 260- 262 , 260f phosphorothioates in , 262, 262f restriction enzymes in , 136, 259- 266 restriction -modification systems in, 260, 2('Of sites of, 136, 136f, 259- 260, 263- 266. See also Recogn ition sites stereochemi stry of, 261 - 262, 261 f cloned ,152- 155 coding strand of, 825 cognate, 260 cleavage of, 263- 266 complementarity with mRt'lA, 121- 122, 122 f complementa ry, 152- 154, 153f. 154f condensed, 789 cross- links in, 806- 807, 80bf damage to causes of, 804 807 repair of, 807- 810. See also DNA • repaIr denaturation of, in acid -base reactions, 15- 16, 15f di rectionality of, 110 double helix of,S 17, 6, 6f, 26[, 107, Ill - lIS . See a lso Doubl e helix evolution of, molecu lar studies of, 178 179, 179f functions of, 18, 19- 20 hybridi zatio n of, lI S hype rsensitive sites in, 905 junk, 20 lagging strand of, 79(" 796f leading strand of, 796 , 796f length of, 110 linker, 143, 143f, 904 linking number of, supercoiling and , 788f, 789 maj or groove in , 785- 786, 786f methylation of, 692 , 692f, 907 in amino acid synthesis, 691 - 69 2, ('9 1f, ('n f in cleavage, 260 , 260f, 265 266 minor groove in, 785- 786, 786f, 795, 795f mitochondrial, 504- 505 genetic code of, 126- 127, 127t sequencin g of, 149 noncoding , 150 in nucleosome, 905
operator, 894f overview of, 4- 6, 783- 784 packing of, 905 palindromic, 136 phosphodiester bridges of, 108, 108, 109 hydrolysis of, 260-262 polari ty of, 110 primer strand of, 117- 11 8, 140 , 793 promoter sites in, 122, 122f, 823 in bacteria, 823, 824 propeller twist in, 786, 780[ properties of. 4- 6 in protein encoding, 18- 19 recombinant. See Recombinant DNA relaxed, 11 5f, 116, 788 , 789, 789f renaturation of, 11 J rewinding of, in transcription, 829, 829f sense strand of, 825 size of, 110- 111 stem -loop motif in , 11 Of sticky ends of, 143, 143f structure of, 4 6,4[- 6[,108 ,10 8- 111 , 110r, 784 - 79 2 local variations in, 786- 787 sugar -phosphate units of, 4, 4f sugar puckers in , 785 , 7R5f sugars in, 108- 109, 108f supercoiled, 115 116, 11 Sf, 788- 792 . See also Supercoiled DNA synthesis of, 5- 6, 6f, Ill , 113 114, 117- 118, 117f, 11 8r. See also Replication recombinant methods of, 139- 144. See also Recombinant DI\:A technology telomeric, 803- 804, 803f, 804f template strand of, 117- 118, 1I8f in replication , 117, 11 8f, 793 in transcription, 12 1- 122, 121f, 122t topoisomerases and , 790, 790- 792, 791, 792f topoisomers of, 789 , 789f unwinding of, 789- 792, 827, 827f in transcription , 827- 829, 827f, 828f Watson-Crick model of, 5, 111- 11 2, 11 2f, 784, 786 . See also Double helix X-ray diffraction patterns of, 111 , 11lf Z -form , 787, 787f, 787t DNA amplification, polymerase chain reaction in , 140- 142, 140f- 142f DNA -binding domains, 902 in eukaryotes, 902 in prokaryotes, 895- 896, 895f, 902 . See also DNA -binding proteins DNA-binding proteins, 893- 901. See also Transcription factors basic- leucine zipper in , 895, 89,f in eukaryotes, 89 5- 896, 895f, 89bf homeodomains in, 895, 895 f match with regu latory site, 893- 894, 894f methionine repressor, 89 5, 89 5f in prokaryotes , 893- 895, 894f, 896- 901
D13
transcription inhibition by, 897- 900 zinc-fin ger domains in, 895- 896, 895f DNA -binding sites chrom atin and, 905- 906 evolution of, 900 hypersensitive, 905 DNA blots, 137, 137f DNA fin gerprint, 13(, DNA fr ag ments am plification of, 140 142 joining of, 142- 143, 143f production of, 135- 136 separation and visualization of, 136-'137 DNA gyrase, 79 2 DNA ligase, 143, 796, 796f, 809 DNA linker, 143, 143f DNA mismatch repair, 808, 80Sf. See also DNA repair DNA photolyase, 808 DNA polymerase(s), 117- 118, 117f, 793- 795 , 798- 802 bacterial , 798- 80 I, 802t classification of, 794 deoxyribonucleoside triphosphate binding by, 795, 795f error-prone, 802t, 804- 805 eukaryotic, 802- 803, 802t Klenow fragment of, 793 794, 793f in leading / lagging strand synthesis, 799- 801, 799f, 800f metal ions of, 794, 794f primer for , 793, 793b, 795, 795f in proofreading, 807, 80 7f reaction mechanism of, 794 , 794f specificity of, 207, 794 - 795 structure of, 793, 793- 794 types of, 802t DNA polymerase lX , 802, 80 2t DNA polymerase 8, 802, R0 2t DNA polymerase I, 801 DNA polymerase 11, 802t, 804- 805 DNA polymerase TIl , 798 , 798, 799- 800 sliding clamp unit of, 798- 799, 79 8f, 801 DNA polymerase HI holoenzyme, 799- 800, 799[' 800f, 801 DNA polymerase fl, 802, 802t, 804 805 DNA polymerase switching, 802 D1'A probes, S3 , 137, 139- 140 generation of, 139, 146- 14 7 solid - phase approach in , 139- 140, 139f for genomic library, 146 147, 147f DNA recombination, 81 2- 814 definition of, 81 2 functions of, 812 Holliday junctions in, 8 13- 8 14, 8 13f initiation of, 81 2- 813 mechanisms of, 813- 814 , 81 3f, 814f RecA in, 8 12 8 13,81 3f recombinases in , 813- 814 DNA recombination synapse, 814 DNA repair, 118, 784 , 784f, 804- 8 12 base-excision, 808 defective, in cancer, 810
014
INDEX
DNA repair (co ntinued) direct, 80S double-strand,809 enzyme complexes in, 808 , 808f glycolases in, 808, S09 ligase in , 796, 809 mi smatch , 808, 808f nonhomologous end join ing in, R09 nucleotide -excision, 808- 809, S09f proofreading in , S07 single-strand, 807- 809 tumor-suppressor genes in . 810 uracil DNA glycolase in . 809, 809f DNA replication, 5- 6, 6[, 11 3- 114,783, 784[, 793-804 in bacteria, 798- 801 base complementarity in, 794- 795, 794f, 795f cell cycle and, 803, 803f clamp loaders in, 799 controlled termination , 1.1R- 1.19, 138f coordinated processes in, 798- 804 cross-linkage in, 806 807, 807f definition of, 111 directionality of, 110, 11 8. 796. 799 DNA polymerase III holoenzyme in, 799- 800, 799f, 800f, 801 DNA polymerases in. 117- 118, 117f, 793- 794 , 793 795, 802- 803, 802 t. See also DNA polymerase(s) DNA probes in, 140 DnaA in, 801, 80lf in E. coli, 798- 801 errors in, 804- 805 repair of, 804 - 8 12. See also 0 1 A •
repaIr
in eukaryotes, 802- 803 helicases in, 115,797, 797- 79R, 797f, 798, 799 initiation of. 795, 80 1 803 in bacteria, 80 I, 80 If in eukaryotes, R02- R03 sites of, 80 1- 803 lagging strand in, 796, 796f synthesis of, 796, 796f, 799- 801, 799f leading strand in, 796 , 796f synthesis of, 796, 796[, 799, 799f licensing factors in, 802 ligase in, 796, 796f Okazaki fragments in, 796, 796f, 800 origin of, 801, 80lf ori gin of replication complexes in, 802 prepriming complex in, 801 primer in , 117- 118, 140. 793 , 793b, 795, 795f processivity in, 798- 799, 798f proofreading in, 807, R07f rate of, 798- 799 recombinant DNA technology in, 140. See also Recombin ant DNA technology replication fork in, 796 , 796[, 799- 801, 799[' 800f
RNA polymerase in, 795, 795f semiconservative, 113- 114, 114f sites of in bacteria, 801, 80lf in eukaryotes, 802 803 sliding DNA clamp in , 798- 799, 798f specificity of, 794- 795 , 794f, 7Y5f strand joining in, 796, 796f strand separation in, 114- 115, 115f, 797- 798, 797f telomeres in, 803 804, 803f, 804f template in, 117, llRf, 793 trom bone model of, 800, 800f DNA sequencing, 138- 139, 13Sf in amino acid sequencing, 83- 84 , S3f chain -termination m ethod in, 138, 138f fluorescence detection in, 138- 139, 13Sf in forensics, 142, 142f for Neanderthal s, 17S, 17Sf San ger dideoxy method in, 138- 139, 13Sf DNA transfer. See also Recombinant 0 lA technology by electroporation, 158, 15Sf gene guns for, 15S by microinjection, 153, 153f, 155 vectors for , 142- 145, 144f, 153- 154 DNA vectors, 142- 145, 144f, 145f DnaA, asse mbly of, 801, SOlf Dolichol phosphate, 317, 317 Don1ains DNA -binding, R95- S96, 896£, 902 H omeodomains, 895, 895f immunoglobulin , 949- 950 of living organisms, 3, 3f protein, 49, 49f exon encodingo[, 128-129, 129f transcription factor, 902 Dopamine. 1010 Double-displacement reactions, 224 Double helix, 5, 5f, 2M. 107, 111- 115 A , 784- 780, 787, 787t B. 784- 785, 787, 787t base pairing in,S, Sf, 10, 10f, 111- 113, 112, 112t. See also Bases/base • palrs discovery of, 5, 111 disruption of, in acid -base reactions, l S 16,lSf formation of, 6, 6f electrostatic interactions in, 10 heat released in, 12- 14, 13f hydrogen bonds in, 10 hydrophobic interactions in, 10 van der Waals forces in, 10 hydrogen bonds in,S , Sf, 10, 112, 116f left- handed, in Z -DNA , 787 , 787t melt ing of, 114 115, 115f, 797, 797f in replication, 11 3- 11 4 unwinding of, 789 , 790 supercoiling and, 789, 790 topoisomerases in, 790- 79 2,
791£, 7nf in transcription, S27, 827f Z , 785 f, 787, 787t
Doubl e-reciprocal plots, 220, 220f, 227- 228,22Sf Dreyer, William, 956 Driving force, 519- 520 , 519f
Drosophila melanogaster alternative spl icing in , 848 sensory bristles in, 939 Toll receptor in, 946 Drug(s). See also specific drugs absorption of, 1003- 1004, 1004f ADME properties of, 1003- 1008, 1004f agonist, 910 antagonist, 910 distribution of, 1005 1006, 1005f excretion of, 1006- '1008 immune-modulating, 959- 960 m etabolism of. 1006 1008 cytochrome P 450 in, 752 receptors for, 910,91 Of resistance to, 1021- 1023 • •• • response to, genetIc van atlOns In, 1019- 1020 routes of ad ministration for, 1004, I004f side effects of, 1003 genetic variations in , 1019- 1020 therapeutic index of, 1008 Drug development, 1001 - 1024 animal testing in , 1008- 1009 candidate drugs in abso rption 0['1003- 1004, 1004f ADME properties of, 1003- 1008, 1004f distribution of, 1005- 1006, 100Sf effective concentrations of, 1003- 1004,1003f essential characteristics of, 1002- 1004 ligand bi nding and, 1002- 1003. I002f metabolism and excretion of, 1006- 1008 number of, 1013- 1014 oral bioavailability of, 1004, 1004f potency of, 1002 1003 ro utes of administration for, 1004, 1004f side effects of, 1003, 1008- 1009 target compartments of, 1005, 100Sf therapeutic index of, 1008 clinical trials in , 1020- 1021, 102lf combinatorial chemistry in, 101 3 drug resistance and,l 021 - 1023 dual pathways for , 1001 - 1002, 1002f genetic variations and. 1019- 1020 genomics in, 101 7- 1020 hi gh -throughput screening in, 1013 screening libraries in , 10 11- 1014, 1014f serendipitous observation in , 1009- 1011 7TM receptors in, 384, 1017 split- pool synthesis in, lOU, 1014f stages of, 1020- 1023 structure-based. 1014 1016,1015[' 1016f Dwarfism, 155 Dynamic instability, 990
Index Oynein, ~78 ATP binding to, 980, 980f structure of, 9S0, 9S0f
E. coli. See Escherichia coli E site, ribosomal, 871- 872, 872f, 873 E' 0 (oxidation-reduction potential ), 506 508, 507f Ear, hair cells of, 937-