Lehninger Principles of Biochemistry

  • 72 943 2
  • Like this paper and download? You can publish your own PDF file online for free in a few minutes! Sign Up

Lehninger Principles of Biochemistry

LEHNINGER PRINCIPLES OF BIOCHEMISTRY FIFTH EDITION David L. Nelson Professor of Biochemistry University of Wisconsin

8,969 5,128 143MB

Pages 1294 Page size 609.36 x 787.92 pts Year 2008

Report DMCA / Copyright

DOWNLOAD FILE

Recommend Papers

File loading please wait...
Citation preview

LEHNINGER

PRINCIPLES OF BIOCHEMISTRY FIFTH

EDITION

David L. Nelson

Professor of Biochemistry University of Wisconsin-Madison

Michael M. Cox

Professor of Biochemistry University of Wisconsin-Madison

II

Publisher: Executive Editor: Senior Developmental Editor: Associate Director of Marketing: Marketing Director: Senior Media Editor: Managing Editor: Project Editor: Photo Editor: Photo Researcher:

SARA TENNEY KATHERINE AHR RANDI ROSSIGNOL DEBBIE CLARE JOHN BRITCH PATRICK SHRINER PHILIP McCAFFREY ELIZABETH GELLER BIANCA MOSCATELLI DENA BETZ

Text and Cover Designer:

VICKI TOMASELLI

Page Makeup:

MARSHA COHEN

Illustration Coordinator:

SUSAN TIMMINS

Illustrations: Molecular Graphics: Production Coordinator: Composition: Manufacturing:

H. ADAM STEINBERG; NE TWORK GRAPHICS H. ADAM STEINBERG; JEAN-YVES SGRO PAUL W. ROHLOFF APTARA, INC. RR DONNELLEY

On the cover: RNA polymerase II from yeast, bound to DNA and in the act of transcribing it into RNA. Image created by H. Adam Steinberg using PDB ID 116H as modified by Seth Darst.

Library of Congress Control Number: 2007941224 ISBN-13: 978-0-7167-7108-1 ISBN-10: 0-7167-7108-X

©2008 by W. H. Freeman and Company

All rights reserved

Printed in the United States of America First printing

W. H. Freeman and Company 41 Madison Avenue

New York, NY 10010 Houndmills, Basingstoke RG21 6XS, England www.whfreeman.com

To Our Teachers Paul R. Burton Albert Finholt William P Jencks Eugene P Kennedy Homer Knoss Arthur Kornberg

I. Robert Lehman Earl K Nelson David E. Sheppard Harold B. White

• About the. Authors David L. Nelson,

born in Fairmont, Minnesota, re­

ceived his BS in Chemistry and Biology from St. Olaf College in

1 964

and earned his PhD in Biochemistry at

Stanford Medical School under Arthur Kornberg. He was a postdoctoral fellow at the Harvard Medical School with Eugene

P. Kennedy, who was one of Albert

Lehninger's first graduate students. Nelson joined the

1 971 1 982. He

faculty of the University of Wisconsin-Madison in and became a full professor of biochemistry in

is the Director of the Center for Biology Education at the University of Wisconsin-Madison. Nelson's research has focused on the signal trans­ ductions that regulate ciliary motion and exocytosis in the protozoan

Paramecium.

T he enzymes of signal

transductions, including a variety of protein kinases, are primary targets of study. His research group has used enzyme purification, immunological techniques, elec­ tron microscopy, genetics, molecular biology, and elec­ trophysiology to study these processes.

David L. Nelson and Michael M. Cox

Dave Nelson has a distinguished record as a lecturer and research supervisor. For

36

years he has taught an

intensive survey of biochemistry for advanced biochem­

tions. At Stanford, he began work on the enzymes in­

istry undergraduates in the life sciences. He has also

volved in genetic recombination. The work focused par­

taught a survey of biochemistry for nursing students,

ticularly on the RecA protein, designing purification and

and graduate courses on membrane structure and func­

assay methods that are still in use, and illuminating the

tion and on molecular neurobiology. He has sponsored

process of DNA branch migration. Exploration of the en­

numerous PhD, MS, and undergraduate honors theses,

zymes of genetic recombination has remained the cen­

and has received awards for his outstanding teaching,

tral theme of his research.

including

the

Dreyfus

Teacher-Scholar Award,

the

Mike Cox has coordinated a large and active re­

Atwood Distinguished Professorship, and the Unterkofler

search team at Wisconsin, investigating the enzymology,

Excellence in Teaching Award from the University of Wisconsin System. In

1991-1992

he was a visiting profes­

sor of chemistry and biology at Spelman College. His

topology, and energetics of genetic recombination. A primary

focus

has

been

the

mechanism

of

RecA

protein-mediated DNA strand exchange, the role of ATP

second love is history, and in his dotage he has begun to

in the RecA system, and the regulation of recombina­

teach the history of biochemistry to undergraduates and

tional DNA repair. Part of the research program now

to collect antique scientific instruments.

focuses on organisms that exhibit an especially robust

Michael M. Cox

capacity for DNA repair, such as Deinococcus was born in Wilmington, Delaware.

In his first biochemistry course, Lehninger's

istry

Biochem­

rans,

radiodu­

and the applications of those repair systems to

biotechnology. For the past

24 years he has taught

(with

was a major influence in refocusing his fascination

Dave Nelson) the survey of biochemistry to undergradu­

with biology and inspiring him to pursue a career in bio­

ates and has lectured in graduate courses on DNA struc­

chemistry. A fter graduating from the University of

ture and topology, protein-DNA interactions, and the

Delaware in

1 974,

Cox went to Brandeis University to do

biochemistry of recombination. A more recent project

Stanford in

1 979

for postdoctoral study with I. Robert

sional responsibility for first-year graduate students. He

his doctoral work with William P. Jencks, and then to

has been the organization of a new course on profes­

Lehman. He moved to the University of Wisconsin­

has received awards for both his teaching and his

1 983, and biochemistry in 1 992.

became a full professor of

research, including the Dreyfus Teacher-Scholar Award

Cox's doctoral research was on general acid and

hobbies include gardening, wine collecting, and assisting

Madison in

base catalysis as a model for enzyme-catalyzed reac-

and the

1 989

Eli Lilly Award in Biological Chemistry. His

in the design of laboratory buildings.

I A Note on the Nature of Science I

n this twenty-first century, a typical science education often leaves the philosophical underpinnings of sci­ ence unstated, or relies on oversimplified definitions. As you contemplate a career in science, it may be useful to consider once again the terms science, scientist, and scientific method. Science is both a way of thinking about the natural world and the sum of the information and theory that re­ sult from such thinking. The power and success of sci­ ence flow directly from its reliance on ideas that can be tested: information on natural phenomena that can be observed, measured, and reproduced and theories that have predictive value. The progress of science rests on a foundational assumption that is often unstated but cru­ cial to the enterprise: that the laws governing forces and phenomena existing in the universe are not subject to change. The Nobel laureate Jacques Monod referred to this underlying assumption as the "postulate of objectiv­ ity." The natural world can therefore be understood by applying a process of inquiry-the scientific method. Science could not succeed in a universe that played tricks on us. Other than the postulate of objectivity, sci­ ence makes no inviolate assumptions about the natural world. A useful scientific idea is one that (1) has been or can be reproducibly substantiated and (2) can be used to accurately predict new phenomena. Scientific ideas take many forms. The terms that sci­ entists use to describe these forms have meanings quite different from those applied by nonscientists. A hypoth­ esis is an idea or assumption that provides a reasonable and testable explanation for one or more observations, but it may lack extensive experimental substantiation. A scientific theory is much more than a hunch. It is an idea that has been substantiated to some extent and provides an explanation for a body of experimental ob­ servations. A theory can be tested and built upon and is thus a basis for further advance and innovation. When a scientific theory has been repeatedly tested and vali­ dated on many fronts, it can be accepted as a fact. In one important sense, what constitutes science or a scientific idea is defined by whether or not it is pub­ lished in the scientific literature after peer review by other working scientists. About 1 6,000 peer-reviewed scientific journals worldwide publish some 1 . 4 million articles each year, a continuing rich harvest of informa­ tion that is the birthright of every human being. Scientists are individuals who rigorously apply the scientific method to understand the natural world. Merely having an advanced degree in a scientific disci­ pline does not make one a scientist, nor does the lack of such a degree prevent one from making important sci­ entific contributions. A scientist must be willing to chal­ lenge any idea when new findings demand it. The ideas that a scientist accepts must be based on measurable,

reproducible observations, and the scientist must report these observations with complete honesty. The scientific method is actually a collection of paths, all of which may lead to scientific discovery. In the hypothesis and experiment path, a scientist poses a hy­ pothesis, then subjects it to experimental test. Many of the processes that biochemists work w ith every day were discovered in this manner. The DNA structure elucidated by James Watson and Francis Crick led to the hypothesis that base pairing is the basis for information transfer in polynucleotide synthesis. This hypothesis helped inspire the discovery of DNA and RNA polymerases. Watson and Crick produced their DNA structure through a process of model building and calcula­ tion. No actual experiments were involved, although the model building and calculations used data col­ lected by other scientists. Many adventurous scientists have applied the process of exploration and observa­ tion as a path to discovery. Historical voyages of dis­ covery (Charles Darwin's 1 831 voyage on H . M . S . Beagle among them) helped t o map the planet, catalog its living occupants, and change the way we view the world. Modern scientists follow a similar path when they explore the ocean depths or launch probes to other planets . An analog of hypothesis and experiment is hypothesis and deduction. Crick reasoned that there must be an adaptor molecule that facilitated translation of the information in messenger RNA into protein. This adaptor hypothesis led to the discovery of transfer RNA by Mahlon Hoagland and Paul Zamecnik. Not all paths to discovery involve planning. Serendip­ ity often plays a role. The discovery of penicillin by Alexander Fleming in 1 928, and of RNA catalysts by Thomas Cech in the early 1 980s, were both chance discov­ eries, albeit by scientists well prepared to exploit them. Inspiration can also lead to important advances. The poly­ merase chain reaction (PCR), now a central part of biotech­ nology, was developed by Kary Mullis after a flash of inspiration during a road trip in northern California in 1 983. These many paths to scientific discovery can seem quite different, but they have some important things in common. They are focused on the natural world. They rely on reproducible observation and/or experi­ ment. All of the ideas, insights, and experimental facts that arise from these endeavors can be tested and reproduced by scientists anywhere in the world. All can be used by other scientists to build new hypotheses and make new discoveries. All lead to information that is properly included in the realm of science. Understand­ ing our universe requires hard work. At the same time, no human endeavor is more exciting and potentially re­ warding than trying, and occasionally succeeding, to un­ derstand some part of the natural world.

[vii]

T

he first edition of Principles of Biochemistry, written by Albert Lehninger twenty-five years ago, has served as the starting point and the model for our four subsequent editions. Over that quarter-century, the world of biochem­ istry has changed enormously. TWenty-five years ago, not a single genome had been sequenced, not a single membrane protein had been solved by crystallography, and not a sin­ gle knockout mouse existed. Ribozymes had just been dis­ covered, PCR technology introduced, and archaea recognized as members of a kingdom separate from bac­ teria. Now, new genomic sequences are announced weekly, new protein structures even more frequently, and re­ searchers have engineered thousands of different knock­ out mice, with enormous promise for advances in basic biochemistry, physiology, and medicine. This fifth edition contains the photographs of 31 Nobel laureates who have received their prizes for Chemistry or for Physiology or Med­ icine since that first edition of Principles ofBiochemistry. One major challenge of each edition has been to re­ flect the torrent of new information without making the book overwhelming for students having their first en­ counter with biochemistry. This has required much care­ ful sifting aimed at emphasizing principles while still conveying the excitement of current research and its promise for the future. The cover of this new edition ex­ emplifies this excitement and promise: in the x-ray struc­ ture of RNA polymerase, we see DNA, RNA, and protein in their informational roles, in atomic dimensions, caught in the central act of information transfer.

We are at the threshold of a new molecular physiol­ ogy in which processes such as membrane excitation, secretion, hormone action, vision, gustation, olfaction, respiration, muscle contraction, and cell movements will be explicable in molecular terms and will become acces­ sible to genetic dissection and pharmacological manipu­ lation. Knowledge of the molecular structures of the highly organized membrane complexes of oxidative phosphorylation and photophosphorylation, for exam­ ple, will certainly bring deepened insight into those processes, so central to life. (These developments make us wish we were young again, just beginning our careers in biochemical research and teaching. Our book is not the only thing that has acquired a touch of silver over the years!) In the past two decades, we have striven always to maintain the qualities that made the original Lehninger text a classic-clear writing, careful explanations of diffi­ cult concepts, and communicating to students the ways in which biochemistry is understood and practiced today. We have written together for twenty years and taught to­ gether for almost twenty-five. Our thousands of students at the University of Wisconsin-Madison over those years have been an endless source of ideas about how to pres­ ent biochemistry more clearly; they have enlightened and inspired us. We hope that this twenty-fifth anniversary edition will enlighten and inspire current students of bio­ chemistry everywhere, and perhaps lead some of them to love biochemistry as we do.

Major Recent Ad vances in Biochemistry Every chapter has been thoroughly revised and up­ dated to include the most important advances in bio­ chemistry including: •









• •

by plants, and of bird feather pigments derived from colored lipids in plant foods (Chapter 1 0) •

Concepts of proteomes and proteomics, introduced earlier in the book (Chapter 1) New discussion of amyloid diseases in the context of protein folding (Chapter 4)



New section on pharmaceuticals developed from an understanding of enzyme mechanism, using penicillin and HN protease inhibitors as examples (Chapter 6)



New discussion of sugar analogs as drugs that target viral neuraminidase (Chapter 7)



New material on green fluorescent protein (Chapter 9) New section on lipidomics (Chapter 1 0) ew descriptions of volatile lipids used as signals

[viii-



Expanded and updated section on lipid rafts and caveolae to include new material on membrane curvature and the proteins that influence it, and introducing amphitropic proteins and annular lipids (Chapter 11) New section on the emerging role of ribulose 5-phosphate as a central regulator of glycolysis and gluconeogenesis (Chapter 1 5) New Box 16-1, Moonlighting Enzymes: Proteins with More Than One Job New section on the role of transcription factors (PPARs) in regulation of lipid catabolism (Chapter 17) Revised and updated section on fatty acid synthase, including new structural information on FAS I (Chapter 2 1)

Preface









Updated coverage of the nitrogen cycle, including new Box 22-1, Unusual Life Styles of the Obscure but Abundant, discussing anammox bacteria (Chapter 22)

Wh••l

New Box 24-2, Epigenetics, Nucleosome Structure, and Histone Variants describing the role of histone modification and FIGURE 2 1 -3 The structure of fatty acid synthase type I systems. nucleosome deposition in the transmission of • New information on the roles of RNA epigenetic information in heredity in protein biosynthesis New information on the initiation of replication (Chapter 27) and the dynamics at the replication fork, • New section on riboswitches introducing AAA+ ATPases and their functions (Chapter 28) in replication and other aspects of DNA metabolism (Chapter 25) • New Box 28-1, Of Fins, Wings, Beaks, and Things, New section on the expanded understanding of the roles of RNA in cells (Chapter 26)

An appreciation of biochemistry often requires an understanding of how bio­ chemical information is obtained. Some of the new methods or updates described in this edition are:















describing the connections between evolution and development

(a)

Biochemical Methods



[ ix J

FIGURE9-12

cation.

The use of tagged proteins in protein purifi­ (a) Glu­

The use of a GST tag is illustrated.

tathione-5-transferase (GST) is a small enzyme (depicted

Circular dichroism (Chapter 4) Measurement of glycated hemoglobin as an indicator of average blood glucose concentration, over days, in persons with diabetes (Chapter 7) Use of MALDI-MS in determination of oligosaccharide structure (Chapter 7) Forensic DNA analysis, a major update covering modem STR analysis (Chap­ ter 9)

here by the purple icon) that binds glutathione (a gluta­

Gene for fusion protein

� V -:c. .:e

.c

Express fusion protein in a cell

mate residue to which a Cys-Giy dipeptide is attached at the carboxyl carbon of the Glu side chain, hence the ab­ breviation GSH).

(b)

The GST tag is fused to the car­

boxyl

of

the

terminus

target

protein by genetic

engineering The tagged protein is expressed in host cells, and is present in the crude extract when the cells are lysed. The extract is subjected to chromatography on a column containing a medium with immobilized glutathione. The GST-tagged protein binds to the glu­ tathione, retarding its migration through the column, while the other proteins wash through rapidly. The tagged protein is subsequently eluted from the column with a solution containing elevated salt concentration or free glutathione

More on microarrays (Chapter 9) Use of tags for protein analysis and purification (Chapter 9) PET combined with CT scans to pinpoint cancer (Chapter 14)

Elute fusion protein

FIGURE 9-12

Chromatin immunoprecipitation and ChiP-chip experiments (Chapter 24)



Development of bacterial strains with altered ge netic codes, for site-specific insertion of novel amino acids into proteins (Chapter 27)

x

'

Preface

Med ically Relevant Examples ..

This icon is used throughout the book to denote material of special medical interest. As teachers, our goal is for students to learn biochemistry and to understand its relevance to a healthier life and a healthier planet. We have included many new exam­ ples that relate biochemistry to medicine and to health issues in general. Some of the medical applications new to this edition are: •





• •

The role of polyunsaturated fatty acids and trans fatty acids in cardiovascular disease (Chapter 10) G protein-coupled receptors (GCPRs) and the range of diseases for which drugs targeted to GPCRs are being used or developed (Chapter 12) G proteins, the regulation of GTPase activity, and the medical consequences of defective G protein function (Chapter 12), including new Box 12-2, G Proteins: Binary Switches in Health and Disease













Box 12-5, Development of Protein Kinase Inhibitors for Cancer Treatment

Box 15-3, Genetic Mutations That Lead to Rare Forms of Diabetes Mutations in citric acid cycle enzymes that lead to cancer (Chapter 16) Pernicious anemia and associated problems in strict vegetarians (Chapter 18) Updated information on cyclooxygenase inhibitors (pain relievers Vioxx, Celebrex, Bextra) (Chapter 21) HMG-CoA reductase (Chapter 21) and Box 21-3, The Lipid Hypothesis and the Development of Statins Box 24-1, Curing Disease by Inhibiting Topoisomerases, describing the use of topoisomerase inhibitors in the treatment of bacterial infections and cancer, including material on ciprofioxacin (the antibiotic effective for anthrax)

Box 14--1, High Rate of Glycolysis in Tumors Suggests Targets for Chemotherapy and Facilitates Diagnosis

Special Theme: Und erstand ing Metabolism through Obesity and Diabetes Adipose tis,.ue

Obesity and its medical consequences-cardiovascu­ lar disease and diabetes-are fast becoming epidemic in the industrialized world, and we include new mate­ rial on the biochemical connections between obesity and health throughout this edition. Our focus on dia­ betes provides an integrating theme throughout the chapters on metabolism and its control, and this will, we hope, inspire some students to find solutions for this disease. Some of the sections and boxes that highlight the interplay of metabolism, obesity, and diabetes are: •







• • •

Fatty acid oxidation Starvation response

FnnJ' acid oxidat.ion

Untreated Diabetes Produces Life-Threatening Aci dosis (Chapter 2) Box 7-1, Blood Glucose Measurements in the Diagnosis and Treatment of Diabetes, introducing hemoglobin glycation and AGEs and their role in the pathology of advanced diabetes Box 11-2, Defective Glucose and Water Transport in Two Forms of Diabetes Glucose Uptake Is Deficient in Type 1 Diabetes Mel litus (Chapter 14) Ketone Bodies Are Overproduced in Diabetes and during Starvation (Chapter 17) Some Mutations in Mitochondrial Genomes Cause Disease (Chapter 19) Diabetes Can Result from Defects in the Mitochon dria of Pancreatic f3 Cells (Chapter 19)

Fat synthesis and storage

Fa� synt.heais

and storage Fatty acid Adipokine production Thermogenesis

lneulin

serU!Ibvity

Fatty acid oxidation

TbB?DlOR€lncsis

Muscle

FIGURE 23-42 •







Adipose Tissue Generates Glycerol 3-phosphate by Glyceroneogenesis (Chapter 21) Diabetes Mellitus Arises from Defects in Insulin Production or Action (Chapter 23) Section 23.4, Obesity and the Regulation of Body Mass, discusses the role of adiponectin and insulin sensitivity and type 2 diabetes Section 23.5, Obesity, the Metabolic Syndrome, and Type 2 Diabetes, includes a discussion of managing type 2 diabetes with exercise, diet, and medication

Preface

Ad vances in Teaching Biochemistry

-WORKED EXAMPLE 11-3

Revising this textbook is never just an updating exercise. At least as much time is spent reexamining how the core topics of biochemistry are presented. We have revised each chapter with an eye to helping students learn and master the fimdamentals of biochemistry. Students encountering biochemistry for the first time often have difficulty with two key aspects of the course: approaching quan­ titative problems and drawing on what they learned in organic chemistry to help them understand biochemistry. Those same students must also learn a com­ plex language, with conventions that are often unstated. We have made some major changes in the book to help students cope with all these challenges: new problem-solving tools, a focus on organic chemistry foundations, and highlighted key conventions.

Calculate the maximum

..

i

J

Energetics of Pumping bySymport

[glucosel;n [glucoselout

. ratio that can be

achieved by the plasma membrane Na+-glucose sym­

porter of an epithelial cell, when [Na +ltn is 12 mM,

[Na+Jout is 145 mM, the membrane potential is -50 mV (inside negative), and the temperature is 37 oc

Solution: Using Equation 11-4 (p 396), we can calcu­

late the energy inherent in an electrochemical Na+

gradient�that is, the cost of moving one Na + ion up this gradient:

t>G,



[Na] ' "" + ZJ t>..p 1Nal1"

RT In

We then substitute standard values for R, T, and :J, and

the given values for [Na+) (expressed as molar concen­

+1 for Z (because Na+ has a positive

trations),

charge), and 0.050 V for t>..p. Note that the membrane potential is -50 mV (inside negative), so the change in

potential when an ion moves from inside to outside is 50 mV.

New Problem-Solving Tools •





t>G,

New in-text Worked Examples help students improve their quantitative problem-solving skills, taking them through some of the most difficult equations.







11.2kJ/mol

dient and into the cell for each glucose carried in by symport, the energy available to pump 1 mol of glucose

is 2 x 11.2 kJ/mol

�Gt

[glucose1m

RT In

[glucoselout

T, gives

[glucose]m

=

dGt R,T

[glucoselou< [glucoselin

=

=

22.4kJ/mol =

(8.315 J/mol· KX310 K)

=

S,Gg

e8 69

5.94 X !o"

WORKED EXAMPLE 1 1 -3

Chemical logic is reinforced in the discussions of central metabolic pathways.

NAD•

Glyceraldehyde 3-phosphate

s-

dehydrogenase

9H20PO�­ HCOH I

H/?�o

\,a?

1 c,

Glyceraldehyde a-phosphate

\ 1

s-

Formation of enzyme­ substrate complex, The active-site Cys has a reduced pK,. (5.5 instead of 8) when NAD+ is bound, and is in the more reactive, thiolate form

Cy•

®

l

A covalent

thiohemiacetal linkage fonns between the substrate and the _g­ group of the Cys residue.

7H20PO�­ \HCOH H.i.6-0-

NAD�

yll,OJ'!Y," uCou

·�

@

1lfl11

In this edition, many of the conventions that are so necessary for understanding each biochemical topic and the biochemical literature are broken out of the text and highlighted. These Key Conventions FIGURE 1 4-7 include clear statements of many assumptions and conventions that students are often expected to assimilate without being told (for example, peptide sequences are written from amino­ to carboxyl-terminal end, left to right; nucleotide sequences are written from 5' to 3' end, left to right).

=

Rearranging, then substituting the values of !>.G,, R, and

New Section 1 3.2, Chemical logic and common biochemical reactions, discusses the common biochemical reaction types that underlie all metabolic reactions.

Key Conventions

22,4 kJ/mol We can now calculate

by this pump (from Equation 1 1-3, p 396):

[glucoselout

NAD•

=

the concentration ratio of glucose that can be achieved

New Data Analysis Problems (one at the end of each chapter), con tributed by Brian White of the University of Massachusetts-Boston, en courage students to synthesize what they have learned and apply their knowledge to the interpretation of data from the literature.

In the presentation of reaction mechanisms, we consistently use a set of conventions introduced and explained in detail with the first enzyme mechanism encountered (chymotrypsin, pp. 208-209). Some of the new problems focus on chemical mechanisms and reinforce mechanistic themes.

1_2 X 10_2

Na + gradient that is available to pump glucose. Given

More than 100 new end-of-chapter problems give students further opportunity to practice what they have learned.

Mechanism figures feature step-by-step descriptions to help students understand the reaction process.

1.45 X 10-1

+ 1(96,500 JN · rnol )(0. 050 V)

that two Na + ions pass down their electrochemical gra­

Focus on Organic Chemistry Foundations



(8.315 J/mol· K)(310 K)ln

This l:lGt is the potential energy per mole of Na + in the

In





9H20PO�- ? H9 0Hjo - - -OH r



cV -o J

Cys

l

The covalent th:i�ter linkage between the substrate and enzyme undergoes phoepborol.ysis (attack by P1) releasing the second product, 1,3·bisphosphoglycerate.

AD @ J·J + o�71 __ ----�� _

NADH

The NADH product leaves the active site and is replaced by another molecule ofNAD+.

KEY CONVENTION:

I

s Cy•

® NADH

l

The enzyme·substrate intermediate is oxidized by the NAD+ hound to the active site.

7H20PorHCOH I C=O

� I

Cy•

When an amino acid sequence of a

peptide, polypeptide, or protein is displayed, the amino­ terminal end is placed on the left, the carboxyl-terminal end on the right, The sequence is read left to right, be­ ginning with the amino-terminal end. •

:\II

Preface

Media and Supplements A full package of media resources and supplements pro­ vides instructors and students with innovative tools to support a variety of teaching and learning approaches. All these resources are fully integrated with the style and goals of the fifth edition textbook. eBook This online version of the textbook combines the contents of the printed book, electronic study tools, and a full complement of student media specifically created to support the text. The eBook also provides useful material for instructors. •





1-4292-1911-4), fully optimized for maximl.UU visibil­ ity in the lecture hall. •







eBook study tools include instant navigation to any section or page of the book, bookmarks, highlighting, note-taking, instant search for any term, pop-up key­ term definitions, and a spoken glossary. The text-specific student media, fully integrated throughout the eBook, include animated enzyme mechanisms, animated biochemical techniques, problem-solving videos, molecular structure tutorials in Jmol, Protein Data Bank IDs in Jmol, liv­ ing graphs, and online quizzes (each described un der "Additional Student Media" below). Instructor features include the ability to add notes or files to any page and to share these notes with students. Notes may include text, Web links, animations, or photos. Instructors can also assign the entire text or a custom version of the eBook.



The 150 most popular images in the textbook are available in an Overhead Transparency Set (ISBN

Living Graphs illustrate key equations from the textbook, showing the graphic results of changing parameters. A comprehensive Test Bank in PDF and editable Word formats includes 150 multiple-choice and short-answer problems per chapter, rated by level of difficulty.

Students are provided with media designed to enhance their understanding of biochemical principles and im­ prove their problem-solving ability. All student media, along with the PDB Structures and Living Graphs, are also in the eBook, and many are available on the book Web site ( www. whfreeman. com/lehninger5e). The student media include: •

New Problem-Solving Videos, created by Scott Ensign of Utah State University provide 24/7 online problem-solving help to students. Through a two-part approach, each 10-minute video covers a key textbook problem repre­ senting a topic that students traditionally struggle to master. Dr. Ensign first describes a proven problem­ solving strategy and then applies the strategy to the problem at hand in clear, concise steps. Students can easily pause, rewind, and review any steps as they wish until they firmly grasp not just the solution but also the reasoning behind it. Working through the problems in this way is designed to make students better and more confident at applying key strategies as they solve other textbook and exam problems.

Instructors are provided with a comprehensive set of teaching tools, each developed to support the text, lecture presentations, and individual teaching styles. All instructor media are available for download on the book Web site (www.whfreeman.com/lehninger5e) and on the Instructor Resource CD/DVD (ISBN 1-4292-1912-2). These media tools include: Fully optimized JPEG files of every figure, photo, and table in the text, with enhanced color, higher resolution, and enlarged fonts. The files have been reviewed by course instructors and tested in a large lecture hall to ensure maximl.UU clarity and visibility. The JPEGs are also offered in separate files and in PowerPoint® format for each chapter.

A list of Protein Data Bank IDs for the structures in the text is provided, arranged by figure nl.UUber. A new feature in this edition is an index to all struc­ tures in the Jmol interactive Web browser applet.

Additional Student Media

Additional Instructor Media



Animated Enzyme Mechanisms and Animated Biochemical Techniques are available in Flash files and preloaded into PowerPoint, in both PC and Macintosh formats, for lecture presentation. (See list of animation topics on the inside front cover.)



Student versions of the Animated Enzyme Mechanisms and Animated Biochemical Techniques help students understand key mechanisms and techniques at their own pace. For a complete list of animation topics, see the inside front cover.

Preface � :

tltill.....



Blochomlslry In 30 • Prlnclplos ol Blochemostry Protein Architecture

[xiii]

Discussion Questions: provided for

each section; designed for individual review, study groups, or classroom discussion

Tertiary Structuf'! of L..arge Globular Proteins

1. lntrodualon ·T�tl:rudrolrftfi'-'"""""*�Oioldlk

�till.llo"oof!N-�-�IQ�ob:1 Q) ..., 0 0...

12 8

JA A

4 0

� � � 0

60

120

180

240

300

360

Torsion angle (degrees)

FIGURE 1 --22

Complementary fit between a macromolecule and a

F I G U R E 1 -2 1 Conformations. Many conformations of ethane are

small molecule. A segment of RNA from a regulatory region, known as

poss i b l e because of freedom of rotation arou nd the C-C bond . I n

TAR, of the human immu nodeficiency vi rus genome (gray) with a

the ball-and-stick model, when the front carbon atom (as vi ewed by

bound argi n i namide molecule (colored); the argininamide is used to

the reader) with its three attached hydrogens is rotated relative to the

represent an amino acid residue of a protein that binds to the TAR re­

rear carbon atom, the potential energy of the molecule rises to a

gion. Argininamide fits i nto a pocket on the RNA surface and is held i n

max i m u m in the fully ecl ipsed conformation (torsion angle 0°, 1 2 0°,

this orientation b y several noncovalent interactions with t h e RNA. This

etc.), then fal l s to a m i n i m u m in the fu l l y staggered conformation

representation of the RNA molecule i s produced with software that can

(torsion angle 60°, 1 80°, etc. ) . Because the energy d ifferences are

calcu late the shape of the outer su rface of a macromolecule, defined

small enough to a l l ow rapid i n terconversion of the two forms ( m i l ­

either by the van der Waa ls rad i i of a l l the atoms in the molecule or by

l i ons o f ti mes per second), the ec l i psed a n d staggered forms cannot

the "solvent exclusion volu me," the volume a water molecule cannot

be separately isolated.

penetrate.

1 .3

FIGURE 1 -23

Physical Fou n dations

1 CJ

J

Stereoisomers have different

effects in humans. (a) Two stereoisomers of carvone: (R)-carvone (isolated from spearmint oil)

has the characteristic

fragrance of

spearmi nt; (5)-carvone (from caraway seed oil) smells l i ke caraway. (b) Aspartame, the ar­ tificial sweetener sold under the trade name N utraSweet, is easily distinguishable by taste receptors from its bitter-tasting stereoisomer, although the two differ only in the configura­

(a)

tion at one of the two chiral carbon atoms. +NH3

-ooc



c --

H H N

'cH/ 'c/ 2

II

0

H

(c) The antidepressant medication citalopram

0

-?-

(trade name Celexa), a selective serotonin re­

c p'c/ 'ocHa

rH�

the therapeutic effect. A stereochemically pure preparation of (5)-citalopram (escitalo­

c

HC

,__ / ""

II

HC

.o

CH

I

CH

'c P'

(b)

pram oxalate) is sold under the trade name Lexapro. As you might predict, the effective dose of Lexapro is one-half the effective dose of Celexa.

H

L-Aspartyl-L-phenylalanine methyl ester (aspartame) (sweet)

uptake inhibitor, is a racemic mixture of these two steroisomers, but only (5)-citalopram has

L-Aspartyl-n-phenylalanine methyl ester (bitter)

F

(S)-Citalopram

(c) •

(R)-Citalopram

A nearly universal set of several hundred small molecules is found in living cells; the interconversions

Physical Foundations

1 .3

of these molecules in the central metabolic

Living cells and organisms must perform work to stay

pathways have been conserved in evolution.

alive and to reproduce themselves. The synthetic reac­

Proteins and nucleic acids are linear polymers of simple monomeric subunits; their sequences contain the information that gives each molecule its three­ dimensional structure and its biological functions. Molecular configuration can be changed only by breaking covalent bonds. For a carbon atom with four different substituents (a chiral carbon) , the substituent groups can be arranged in two different ways, generating stereoisomers with distinct properties. Only one stereoisomer is biologically active . Molecular conformation is the position of atoms in space that can be changed by rotation about single bonds, without breaking covalent bonds. Interactions between biological molecules are

tions

that

occur within

cells,

like

the

synthetic

processes in any factory, require the input of energy. Energy is also consumed in the motion of a bacterium or an Olympic sprinter, in the flashing of a firefly or the electrical discharge of an eel. And the storage and ex­ pression of information require energy, without which structures rich in information inevitably become disor­ dered and meaningless. In the course of evolution, cells have developed highly efficient mechanisms for coupling the energy obtained from sunlight or fuels to the many energy­ consuming processes they must carry out. One goal of biochemistry is to understand, in quantitative and chemical terms, the means by which energy is ex­ tracted, channeled, and consumed in living cells. We can

almost invariably stereospecific: they require a

consider cellular energy conversions-like all other

precise complementary match between the

energy conversions-in the context of the laws of ther­

interacting molecules.

modynamics.

20 ]

T h e Foundations of Biochem istry

Living Organisms Exist in a Dynamic Steady State, Never at Equ i librium with Their S u rrou n dings

The molecules and ions contained within a living organ­ ism differ in kind and in concentration from those in the organism's surroundings. A paramecium in a pond, a shark in the ocean, a bacterium in the soil, an apple tree in an orchard-all are different in composition from their surroundings and, once they have reached matu­ rity, maintain a more or less constant composition in the face of constantly changing surroundings. Although the characteristic composition of an or­ ganism changes little through time, the population of molecules within the organism is far from static. Small molecules, macromolecules, and supramolecular com­ plexes are continuously synthesized and broken down in chemical reactions that involve a constant flux of mass and energy through the system. The hemoglobin mole­ cules carrying oxygen from your lungs to your brain at this moment were synthesized within the past month; by next month they will have been degraded and en­ tirely replaced by new hemoglobin molecules. The glu­ cose you ingested with your most recent meal is now circulating in your bloodstream; before the day is over these particular glucose molecules will have been con­ verted into something else-carbon dioxide or fat, per­ haps-and will have been replaced with a fresh supply of glucose, so that your blood glucose concentration is more or less constant over the whole day. The amounts of hemoglobin and glucose in the blood remain nearly constant because the rate of synthesis or intake of each just balances the rate of its breakdown, consumption, or conversion into some other product. The constancy of concentration is the result of a dynamic steady state, a steady state that is far from equilibrium. Maintaining this steady state requires the constant investment of en­ ergy; when a cell can no longer generate energy, it dies and begins to decay toward equilibrium with its sur­ roundings. We consider below exactly what is meant by "steady state" and "equilibrium. "

the environment and extract energy by oxidizing them (see Box 1-3, Case 2) ; or (2) they absorb energy from sunlight. The first law of thermodynamics describes the prin­ ciple of the conservation of energy: in any physical or chemical change, the total amount of energy in the universe remains constant, although the form of the energy may change. Cells are consummate transduc­ ers of energy, capable of interconverting chemical, elec­ tromagnetic, mechanical, and osmotic energy with great efficiency (Fig. 1-24) .



Potential energy •

Sunlight

(a) Chemical transformations within cells Energy transductions accomplish work

1

Cellular work: • chemical synthesis • mechanical work • osmotic and electrical gradients • light production • genetic information transfer

(b) Heat

(c) Increased randomness (entropy) in the surroundings Metabolism produces compounds simpler than the initial fuel molecules: C02, NH3, H20, HPOi-

(d) Decreased randomness (entropy) in the system

Organisms Transform Energy a n d Matter from

Simple compounds polymerize to form information-rich macromolecules: DNA, RNA, proteins

Their S urroundings

For chemical reactions occurring in solution, we can de­ fine a system as all the constituent reactants and prod­ ucts, the solvent that contains them, and the immediate atmosphere-in short, everything within a defined re­ gion of space. The system and its surroundings together constitute the universe. If the system exchanges nei­ ther matter nor energy with its surroundings, it is said to be isolated. If the system exchanges energy but not matter with its surroundings, it is a closed system; if it exchanges both energy and matter with its surround­ ings, it is an open system. A living organism is an open system; it exchanges both matter and energy with its surroundings. Organ­ isms derive energy from their surroundings in two ways: (1) they take up chemical fuels (such as glucose) from

Nutrients in environment (complex molecules such as sugars, fats)

(e) FIGURE 1 -24 Some energy interconversions in living organisms. During metabol i c energy transductions, the randomness of the system plus surroundi ngs (expressed quantitatively as entropy) i ncreases as the potential energy of complex nutrient molecules decreases. (a) Living organisms extract energy from their surroundi ngs; (b) convert some of it into useful forms of energy to produce work; (c) return some energy to the surroundings as heat; and (d) release end-product molecules that are less well organized than the starting fuel, increasing the en­ tropy of the u n iverse. One effect of all these transformations i s (e) i n­ creased order (decreased randomness) in the system in the form of complex macromolecules. We return to a quantitative treatment of en­ tropy in Chapter 1 3 .

1 .3

Physica l F o u ndations

21

J

E ntro py: The Adva nta g es of B e i n g O l so rga w�Zed The term "entropy," which literally means " a change within," was first used in 1 85 1 by Rudolf Clausius, one of the formulators of the second law of thermodynamics. A rigorous quantitative definition of entropy involves sta­ tistical and probability considerations. However, its na­ ture can be illustrated qualitatively by three simple examples, each demonstrating one aspect of entropy. The key descriptors of entropy are randomness and disorder, manifested in different ways. Case

1: The Teakettle and the Randomization of Heat

We know that steam generated from boiling water can do useful work. But suppose we turn off the burner under a teakettle full of water at 100 oc (the "system") in the kitchen (the "surroundings") and allow the teakettle to cool. As it cools, no work is done, but heat passes from the teakettle to the surroundings, raising the temperature of the surroundings (the kitchen) by an infinitesimally small amount until complete equilibrium is attained. At this point all parts of the teakettle and the kitchen are at pre­ cisely the same temperature. The free energy that was once concentrated in the teakettle of hot water at 100 °C, potentially capable of doing work, has disappeared. Its equivalent in heat energy is still present in the teakettle + kitchen (i.e., the "universe") but has become completely randomized throughout. This energy is no longer avail­ able to do work because there is no temperature differen­ tial within the kitchen. Moreover, the increase in entropy of the kitchen (the surroundings) is irreversible. We know from everyday experience that heat never spontaneously passes back from the kitchen into the teakettle to raise the temperature of the water to 1 00 oc again.

The atoms contained in 1 molecule of glucose plus 6 molecules of oxygen, a total of 7 molecules, are more randomly dispersed by the oxidation reaction and are now present in a total of 12 molecules (6C02 + 6H20) . Whenever a chemical reaction results in an increase in the number of molecules-or when a solid substance is converted into liquid or gaseous products, which al­ low more freedom of molecular movement than solids­ molecular disorder, and thus entropy, increases. Case 3: Infonnation and Entropy

The following short passage from Julius Caesar, Act IV, Scene 3, is spoken by Brutus, when he realizes that he must face Mark Antony's army. It is an information-rich nonrandom arrangement of 125 letters of the English alphabet: There is a tide in the affairs of men, Which, taken at the flood, leads o n to fortune; Omitted, all the voyage of their

life

Is bou11d in shallows and in miseries.

In addition to what this passage says overtly, it has many hidden meanings. It not only reflects a complex se­ quence of events in the play, it also echoes the play's ideas on conflict, ambition, and the demands of leader­ ship. Permeated with Shakespeare's understanding of human nature, it is very rich in information. However, if the 125 letters making up this quotation were allowed to fall into a completely random, chaotic pattern, as shown in the following box, they would have no meaning whatsoever.

Case 2: The Oxidation of Glucose

Entropy is a state not only of energy but of matter. Aer­ obic (heterotrophic) organisms extract free energy from glucose obtained from their surroundings by oxidizing the glucose with 02, also obtained from the surround­ ings . The end products of this oxidative metabolism, C02 and H20, are returned to the surroundings. In this process the surroundings undergo an increase in en­ tropy, whereas the organism itself remains in a steady state and undergoes no change in its internal order. Al­ though some entropy arises from the dissipation of heat, entropy also arises from another kind of disorder, illus­ trated by the equation for the oxidation of glucose: C5H 1 206

+

602 � 6C02

+

6H20

We can represent this schematically as 7 molecules

• •



12 molecules

.A

In this form the 125 letters contain little or no informa­ tion, but they are very rich in entropy. Such considera­ tions have led to the conclusion that information is a form of energy; information has been called "negative entropy. " In fact, the branch of mathematics called in­ formation theory, which is basic to the programming logic of computers, is closely related to thermodynamic theory. Living organisms are highly ordered, nonrandom structures, immensely rich in information and thus entropy-poor.

22

The Fou ndations of Biochemistry

The Flow of Electrons Provides Energy fo r Organisms

energy changes during chemical reactions, showed

Nearly all living organisms derive their energy, directly

that the

free-energy content, G,

or indirectly, from the radiant energy of sunlight. The

release of

C02 and

enthalpy, H,

quantities:

light-driven splitting of water during photosynthesis releases its electrons for the reduction of

of any closed system

can be defined in terms of three re­

flecting the number and kinds

the

of bonds; entropy,

02 into the atmosphere:

S;

and the

T (in

temperature,

absolute

Kelvin). The definition of free

light

energy is

\.

6C02 + 6H20 � C6H1206 + 602 (light-driven reduction of C02)

G

=

H - TS.

When a

chemical reaction occurs at con­ stant temperature, the

energy change, 4.G,

free­

is deter­

mined by the enthalpy change,

Nonphotosynthetic cells and organisms obtain the en­ ergy they need by oxidizing the energy-rich products of

). W i l l i a rd G i bbs,

ll.H,

photosynthesis, then passing the electrons thus ac­

1 83 9-1903

numbers of chemical bonds and

quired to atmospheric

02 to form water, C02, and other

end products, which are recycled in the environment:

C6H1206

+

02



6C02

+

6H20

noncovalent interactions broken and formed, and the entropy change,

ll.S,

+ energy

D.G

Thus autotrophs and heterotrophs participate in global

02 and C02, driven ultimately by sunlight, mak­

ing these two large groups of organisms interdependent. Virtually all energy transductions in cells can be traced a "downhill" flow from higher to lower electrochemical potential; as such, this is formally analogous to the flow

All these oxidation­

of electrons in a battery-driven electric circuit.

reduction reactions:

one reactant is oxidized (loses

electrons) as another is reduced (gains electrons).

=

D.H- TD.S

ll.H is negative for a reaction that ll.S is positive for a reaction that in­

where, by definition, releases heat, and

creases the system's randomness. •

to this flow of electrons from one molecule to another, in

reactions involved in electron flow are

describing the change in the sys­

tem's randomness:

(energy-yielding oxidation of glucose)

cycles of

reflecting the kinds and

A process tends to occur spontaneously only if ll.G is

negative

(if free energy is released in the process). Yet

cell function depends largely on molecules, such as pro­

teins and nucleic acids, for which the free energy of for­ mation is positive: the molecules are less stable and more highly ordered than a mixture of their monomeric com­ ponents. To carry out these thermodynamically unfavor­

Creating a nd Maintaining Order Requires Wo rk a nd Energy

able, energy-requiring

(endergonic)

reactions, cells

couple them to other reactions that liberate free energy

As we've noted, DNA, RNA, and proteins are informa­

(exergonic reactions),

tional macromolecules; the precise sequence of their

ergonic: the sum of the free-energy changes is negative.

so that the overall process is ex­

monomeric subunits contains information, just as the

The usual source of free energy in coupled biologi­

letters in this sentence do. In addition to using chemical

cal reactions is the energy released by breakage of phos­

energy to form the covalent bonds between these sub­

phoanhydride

units, the cell must invest energy to order the subunits

triphosphate (ATP;

bonds

such

in their correct sequence. It is extremely improbable

phate (GTP). Here, each

that amino acids in a mixture would spontaneously con­

group:

dense into a single type of protein, with a unique se­ quence. This would represent increased order in a

Amino acids � protein

population of molecules; but according to the second

ATP�AMP +

the total en­ tropy of the universe is continually increasing. To ward ever-greater disorder in the universe:

bring about the synthesis of macromolecules from their monomeric units, free energy must be supplied to the system (in this case, the cell).

K E Y CO N V E N T I O N : The randomness or disorder of the components of a chemical system is expressed as

tropy, S

(Box

en­

1-3) . Any change in randomness of the ll.S, which by

system is expressed as entropy change,

convention has a positive value when randomness in­ creases.

J.

Willard Gibbs, who developed the theory of

@---®

[or ATP� ADP +

law of thermodynamics, the tendency in nature is to­

as

Fig. 1-25)

®l

®

those

in

adenosine

and guanosine triphos­

represents a phosphoryl

D.G1 is positive (endergonic) D.G2 is negative (exergonic)

When these reactions are coupled, the sum of

ll.G2

ll.G1

and

is negative-the overall process is exergonic. By

this coupling strategy, cells are able to synthesize and maintain the information-rich polymers essential to life.

Energy Coupling Links Reactions in Biology The central issue in

bioenergetics

(the study of energy

transformations in living systems) is the means by which energy from fuel metabolism or light capture is coupled to a cell's energy-requiring reactions. In thinking about

1.3 Physical Foundations

-

� � � a-

I

o-

I

I

N--c

�� 4

0-

HC

o- -o- -o- - o-

0

\

HHH OR



ll

C

NH.,-

A

�N�

FIGURE 1-15 Adenosine triphosphate (ATP) provides energy. Here, each® represents a phosphoryl group. The removal of the term i n a l phosphoryl group

I

(shaded p i n k) of ATP, by breakage of a phosphoanhy­

CH

dride bond to generate adenosine d i phosphate (ADP) and i norganic phosphate ion (HPo�-), is highly ex­ ergon ic, and this reaction is coupled to many ender­ gon i c reactions in the cel l (as in the example i n

OH

®-®-®- Adenosine (Adenosine triphosphate, ATP) o1

! 23 I

Fig. 1 -26b). ATP a l so provides energy for many cel l u ­ lar processes by undergoing c leavage that releases the two term inal phosphates as inorganic pyrophos­

-o-P -OH II

+

0

phate (H 2 P2 0 �-), often abbreviated PP;.

fP\.---IP\� \.:__/Adenosine (Adenosine diphosphate, ADP)

Inorganic phosphate (P;) OH 1

o-

II

II

I

-o-P-0-P-OH 0

0

+

®-Adenosine (Adenosine monophosphate,AMP)

Inorganic pyrophosphate (PP;)

energy coupling, it is useful to consider a simple me­ chanical example, as shown in Figure l-2tia. An object at the top of an inclined plane has a certain amount of po­ tential energy as a result of its elevation. It tends to slide down the plane, losing its potential energy of position as it approaches the ground. When an appropriate string­ and-pulley device couples the falling object to another, smaller object, the spontaneous downward motion of the larger can lift the smaller, accomplishing a certain amount of work. The amount of energy available to do work is the free-energy change, Ji.G; this is always somewhat less than the theoretical amount of energy re­ leased, because some energy is dissipated as the heat of friction. The greater the elevation of the larger object, the greater the energy released (LlG) as the object slides downward and the greater the amount of work that can be accomplished. The larger object can lift the smaller only because, at the outset, the larger object was jar from its equilibrium position: it had at some earlier point been elevated above the ground, in a process that itself required the input of energy. How does this apply in chemical reactions? In closed systems, chemical reactions proceed spontaFIGURE 1-26 Energy coupling in mechanical and chemical processes.

neously until equilibrium is reached. When a system is at equilibrium, the rate of product formation exactly equals the rate at which product is converted to reac­ tant. Thus there is no net change in the concentration of reactants and products. The energy change as the sys­ tem moves from its initial state to equilibrium, with no changes in temperature or pressure, is given by the free­ energy change, LlG. The magnitude of LlG depends on the particular chemical reaction and on how jar from

(a) Mechanical example t.GO

Loss of potential energy of position

Work

done

Exergonic•

• Endergonic

(b) Chemical example Reaction

can do mechani cal work. The potential energy made ava i l able by spontaneous downward motion, an exergonic process (pink), can be coupled to the endergonic upward movement of another object (blue). (b) I n reaction 1 , the formation of glucose 6-phosphate from gl ucose and i norgan i c phosphate (P,) yields a product of higher energy than the

2:

ATP-7ADP + P;

(a) The downward motion of an object releases potential energy that

Reaction

Reaction 3: Qlucoae + ATP -7 glw!ose 6-pbD!!pbBI.e .- ADP

1:

Glucose + Pi � glucose 6-phosphate

two reactants. For this endergonic reaction, 6.C is positive. In reaction 2 , the exergonic breakdown o f adenosine tri phosphate (ATP) has a large, negative free-energy change (6.C2). The third reaction is the sum of re­ actions 1 and 2, and the free-energy change, ac3, is the arithmetic

sum of 6.C 1 and 6.C2• Because 6.C3 is negative, the overa l l reaction is exergonic and proceeds spontaneously.

Reaction coordinate

24

The Foundations of Biochemistry

equilibrium the system is initially. Each compound involved in a chemical reaction contains a certain amount of potential energy, related to the kind and num­ ber of its bonds. In reactions that occur spontaneously, the products have less free energy than the reactants, thus the reaction releases free energy, which is then available to do work. Such reactions are exergonic; the decline in free energy from reactants to products is ex­ pressed as a negative value. Endergonic reactions re­ quire an input of energy, and their aG values are positive . As in mechanical processes, only part ofthe en­ ergy released in exergonic chemical reactions can be used to accomplish work. In living systems some energy is dissipated as heat or lost to increasing entropy. In biological organisms, just as in the mechanical example in Figure l-26a, an exergonic reaction can be coupled to an endergonic reaction to drive otherwise unfavorable reactions. Figure l-26b (a type of graph called a reaction coordinate diagram) illustrates this principle for the conversion of glucose to glucose 6-phosphate , the first step in the pathway for oxida­ tion of glucose. The simplest way to produce glucose 6-phosphate would be: Reaction

1:

Glucose

+ Pi �glucose 6-phosphate (endergonic; D.G1 is positive)

(Here, Pi is an abbreviation for inorganic phosphate, HPO� -. Don't be concerned about the structure of these compounds now; we describe them in detail later in the book.) This reaction does not occur spontaneously; aG1 is positive. A second, very exergonic reaction can occur in all cells: Reaction 2:

ATP�ADP + P; (exergonic; D.G2 is negative)

These two chemical reactions share a common interme­ diate, Pi, which is consumed in reaction 1 and produced in reaction 2. The two reactions can therefore be cou­ pled in the form of a third reaction, which we can write as the sum of reactions 1 and 2, with the common inter­ mediate, Pi> omitted from both sides of the equation: Reaction

3:

Glucose + ATP �

glucose 6-phosphate + ADP

Because more energy is released in reaction 2 than is consumed in reaction 1 , the free-energy change for re­ action 3, aG3, is negative, and the synthesis of glucose 6-phosphate can therefore occur by reaction 3. The coupling of exergonic and endergonic reactions through a shared intermediate is central to the energy exchanges in living systems. As we shall see, reactions that break down ATP (such as reaction 2 in Fig. 1-26b) release energy that drives many endergonic processes in cells. ATP breakdown in cells is exergonic because all living cells maintain a concentration of ATP jar above its equilibrium concentration. It is this disequi­ librium that allows ATP to serve as the major carrier of chemical energy in all cells.

Keq and ...\Go Are Measures of a Reaction's Tendency to

Pro ceed Spontaneously

The tendency of a chemical reaction to go to completion can be expressed as an equilibrium constant. For the re­ action in which a moles of A react with b moles of B to give c moles of C and d moles of D, aA +

bB



cC

+ dD

the equilibrium constant, Keq, is given by

Kq e

[C];q [D]�q =

-:--

-

[A]� [B]�q

where [A]eq is the concentration of A, [B]eq the concen­ tration of B, and so on, when the system has reached equilibrium. A large value of Keq means the reaction tends to proceed until the reactants are almost com­ pletely converted into the products. Gibbs showed that aG (the actual free-energy change) for any chemical reaction is a function of the standard free-energy change, .1G0-a constant that is characteristic of each specific reaction-and a term that expresses the initial concentrations of reactants and products: D.G

=

D.Go + RTln

[C] f [D] f [Ali [B] f

(1-1)

where [Ah is the initial concentration of A, and so forth; R is the gas constant; and Tis the absolute temperature. aG is a measure of the distance of a system from its equilibrium position. When a reaction has reached equi­ librium, no driving force remains and it can do no work: aG 0. For this special case, [AL = [A]eq, and so on, for all reactants and products, and =

[C] f [Dl f [A]f [El f

[CJ;q [D]�q [AJ!q [B]�q

Substituting 0 for aG and Keq for [ C]f [D Jf/[A Jf [B]� in Equation 1-1 , we obtain the relationship D.Go

=

- RTln

Keq

from which we see that aGo is simply a second way (be­ sides Keq) of expressing the driving force on a reaction. Because Keq is experimentally measurable, we have a way of determining aGo, the thermodynamic constant characteristic of each reaction. The units of aGo and aG are joules per mole (or calories per mole) . When Keq > > 1 , aGo is large and neg­ ative; when Keq < < 1 , aGo is large and positive. From a table of experimentally determined values of either Keq or aGo, we can see at a glance which reactions tend to go to completion and which do not. One caution about the interpretation of aGo: ther­ modynamic constants such as this show where the final equilibrium for a reaction lies but tell us nothing about how fast that equilibrium will be achieved. The rates of

1.3 Physical Foundations

reactions are governed by the parameters of kinetics, a topic we consider in detail in Chapter 6.

Activation barrier (transition state, *)

Enzymes Promote Sequences of Chemical Reactions All biological macromolecules are much less thermody­ namically stable than their monomeric subunits, yet they are kinetically stable: their uncatalyzed break­ down occurs so slowly (over years rather than seconds) that, on a time scale that matters for the organism, these molecules are stable. Virtually every chemical re­ action in a cell occurs at a significant rate only because of the presence of enzymes-biocatalysts that, like all other catalysts, greatly enhance the rate of specific chemical reactions without being consumed in the process. The path from reactant(s) to product(s) almost in­ variably involves an energy barrier, called the activation barrier (Fig. 1-27) , that must be surmounted for any re­ action to proceed. The breaking of existing bonds and formation of new ones generally requires, first, a distor­ tion of the existing bonds to create a transition state of higher free energy than either reactant or product. The highest point in the reaction coordinate diagram repre­ sents the transition state, and the difference in energy between the reactant in its ground state and in its transi­ tion state is the activation energy, dG*. An enzyme catalyzes a reaction by providing a more comfortable fit for the transition state: a surface that complements the transition state in stereochemistry, polarity, and charge. The binding of enzyme to the transition state is exer­ gonic, and the energy released by this binding reduces the activation energy for the reaction and greatly in­ creases the reaction rate. A further contribution to catalysis occurs when two or more reactants bind to the enzyme's surface close to each other and with stereospecific orientations that fa­ vor the reaction. This increases by orders of magnitude the probability of productive collisions between reac­ tants. As a result of these factors and several others, dis­ cussed in Chapter 6, enzyme-catalyzed reactions commonly proceed at rates greater than 1 012 times faster than the uncatalyzed reactions. (That is a million million times faster!) Cellular catalysts are, with a few notable excep­ tions, proteins. (Some RNA molecules have enzymatic activity, as discussed in Chapters 26 and 27.) Again with a few exceptions, each enzyme catalyzes a specific reac­ tion, and each reaction in a cell is catalyzed by a differ­ ent enzyme. Thousands of different enzymes are therefore required by each cell. The multiplicity of en­ zymes, their specificity (the ability to discriminate be­ tween reactants) , and their susceptibility to regulation give cells the capacity to lower activation barriers selec­ tively. This selectivity is crucial for the effective regula­ tion of cellular processes. By allowing specific reactions to proceed at significant rates at particular times, en­ zymes determine how matter and energy are channeled into cellular activities.

-------

-

l

AG�.t

____

I

I

'

L

25

-

G!neat ----

Products (B)

AG

Reaction coordinate (A � B) FIGURE 1-27 Energy changes during a chemical reaction. An activa­ tion barrier, representing the transition state (see Chapter 6), must be overcome in the conversion of reactants (A) into products (B), even though the products are more stable than the reactants, as i ndicated by a la rge, negative free-energy change

(AG). The energy required to over­ (AG*). Enzymes

come the activation barrier is the activation energy

catalyze reactions by lowering the activation barrier. They bind the transition-state i ntermediates tightly, and the bin d i ng energy of this in­

AG*uncat (blue AG\a, (red curve). (Note that activation energy is not rel ated to free-energy change, AG.)

teraction effectively reduces the activation energy from cu rve) to

The thousands of enzyme-catalyzed chemical reac­ tions in cells are functionally organized into many se­ quences of consecutive reactions, called pathways, in which the product of one reaction becomes the reactant in the next. Some pathways degrade organic nutrients into simple end products in order to extract chemical energy and convert it into a form useful to the cell; to­ gether these degradative, free-energy-yielding reactions are designated catabolism. The energy released by catabolic reactions drives the synthesis of ATP. As a re­ sult, the cellular concentration of ATP is far above its equilibrium concentration, so that D.G for ATP break­ down is large and negative. Similarly, metabolism results in the production of the reduced electron carriers NADH and NADPH, both of which can donate electrons in processes that generate ATP or drive reductive steps in biosynthetic pathways . Other pathways start with small precursor mole­ cules and convert them to progressively larger and more complex molecules, including proteins and nucleic acids. Such synthetic pathways, which invariably re­ quire the input of energy, are collectively designated an­ abolism. The overall network of enzyme-catalyzed pathways constitutes cellular metabolism. ATP (and the energetically equivalent nucleoside triphosphates cytidine triphosphate (CTP) , uridine triphosphate (UTP), and guanosine triphosphate (GTP)) is the connecting link between the catabolic and anabolic components of this network (shown schematically in Fig. 1-28) . The pathways of enzyme-catalyzed reac­ tions that act on the main constituents of cells­ proteins, fats, sugars, and nucleic acids-are virtually identical in all living organisms.

2b

The Foundations of Biochem istry

produced in a quantity appropriate to the current re­

Stored nutrients

Other cellular work

quirements of the cell.

Ingested foods

Complex biomolecules

synthesis of the amino acid isoleucine, a constituent of

Solar photons

Mechanical work

Consider the pathway in

E. coli that leads to the

proteins. The pathway has five steps catalyzed by five different enzymes (A through F represent the interme­ diates in the pathway):

Osmotic work

�------------------------,

-1 > [5] and the [5] term in the denom­

inator of the Michaelis-Menten equation {Eqn 6-9) becomes i nsignificant.

V0 = Vmax [5]/Km and V0 exhibits a l i near de­ [5], as observed here. At high [5], where [5] >> Km, the Km

The equation simplifies to pendence on

term in the denomi nator of the Michael is-Menten equation becomes in­ significant and the equation simpl ifies to V0 the p lateau observed at high

= Vm,.; this i s consistent with

[5] . The Michaelis-Menten equation is there­

fore consistent with the observed dependence of V0 on IS], and the shape of the curve is defined by the terms VmaxfKm at low

BOX 6-1

[S] and Vmax at high [5].

It is important to distinguish between the Michaelis­ Menten equation and the specific kinetic mechanism on which it was originally based. The equation describes the kinetic behavior of a great many enzymes, and all en­ zymes that exhibit a hyperbolic dependence of V0 on [S] are said to follow Michaelis-Menten kinetics. The practical rule that Km = [S] when V0 = % Vmax (Eqn 6-23) holds for all enzymes that follow Michaelis­ Menten kinetics. (The most important exceptions to Michaelis-Menten kinetics are the regulatory enzymes, discussed in Section 6.5.) However, the Michaelis­ Menten equation does not depend on the relatively sim­ ple two-step reaction mechanism proposed by Michaelis

Tra n sformat i o n s of t h e M l c h a e l is-Menten Eq uati o n : The D o u b l e - Reciprocal Plot

The Michaelis-Menten equation �

_

o -

Vmax [S] Km + [S]

can be algebraically transformed into equations that are more useful in plotting experimental data. One common transformation is derived simply by taking the recipro­ cal of both sides of the Michaelis-Menten equation: 1

Vo

Km + [Sl Vmax [S]

Separating the components of the numerator on the right side of the equation gives 1

-

=

Vo

Km Vmax [S]

+

called a Lineweaver-Burk plot, has the great advantage of allowing a more accurate determination of Vmax' which can only be approximated from a simple plot of V0 versus [S] (see Fig. 6-12) . Other transformations of the Michaelis-Menten equation have been derived, each with some particular advantage in analyzing enzyme kinetic data. (See Prob­ lem 14 at the end of this chapter.) The double-reciprocal plot of enzyme reaction rates is very useful in distinguishing between certain types of enzymatic reaction mechanisms (see Fig. 6-1 4) and in analyzing enzyme inhibition (see Box 6-2).

[S] Vmax [S]

which simplifies to 1

Vo

This form of the Michaelis-Menten equation is called the Lineweaver-Burk equation. For enzymes obeying the Michaelis-Menten relationship, a plot of 1/V0 versus 1/[S] (the "double reciprocal" of the V0 versus [S] plot we have been using to this point) yields a straight line (Fig. 1 ) . This line has a slope of Km!Vmax. an intercept of 1/Vmax on the l!V0 axis, and an intercept of 1/Km on the 1/[S] axis. The double-reciprocal presentation, also

1

vm

P

"'

H.

For

example, the two electron pairs making up a C = 0 (carbonyl) bond are not shared equally; the carbon is relatively electron­ deficient as the oxygen draws away the electrons. Many reactions involve an electron-rich atom (a nucleophile) reacting with an

pocket

\

"

_.,..... N --..._

D l�

When substrate binds, the side chain of the residue adjacent to the peptide bond to be cleaved nestles in a hydrophobic pocket on the enzyme, positioning the peptide bond for attack.

Ser195

Gly193

electron (as in a free radical reaction) , a singleheaded (fishhook-type) arrow is used

H

'. I I

n

1 1 0 -{ Ser195

A covalent bond consists of a shared important to the reaction mechanism

C-CH-NH-M,,

Substrate (a polypeptide)

HO-

Product 2

Enzyme-product 2 complex

-�-�

Diffusion of the second product from the active site regenerates free enzyme.

H O-{Ser195

electron-deficient atom (an electrophile ) . Some common nucleophiles and electrophiles in biochemistry are shown at right. In general, a reaction mechanism is initiated at an unshared electron pair of a nucleophile. In mechanism diagrams, the base of the electron-pushing arrow originates near the electron-pair dots, and the head of the arrow points directly at the electro­ philic center being attacked. Where the unshared electron pair confers a formal negative charge on the nucleophile, the negative charge symbol itself can represent the unshared electron pair

Nucleophiles -a-

Negatively charged

anism, the nucleophilic electron pair in the ES complex between steps and is provided by the oxygen of the Ser1 95 hydroxyl

unprotonated hydroxyl

®

group. This electron pair

(2

of the

8 valence

electrons of the

hydroxyl oxygen) provides the base of the curved arrow. The electrophilic center under attack is the carbonyl carbon of the peptide bond to be cleaved. The C, 0, and N atoms have a max­ imum of 8 valence electrons, and

H has a maximum of 2. These

atoms are occasionally found in unstable states with less than their maximum allotment of electrons, but C, 0, and N cannot have more than 8. Thus, when the electron pair from chymo­ trypsin's Ser1 95 attacks the substrate's carbonyl carbon, an electron pair is displaced from the carbon valence shell (you cannot have

5 bonds to

carbon!) . These electrons move toward

the more electronegative carbonyl oxygen. The oxygen has

8

valence electrons both before and after this chemical process, but the number shared with the carbon is reduced from 4 to

2,

and

the carbonyl oxygen acquires a negative charge. In the next step, the electron pair conferring the negative charge on the oxygen moves back to re-form a bond with carbon and reestablish the carbonyl linkage. Again, an electron pair must be displaced from the carbon, and t his time it is the electron pair shared with the amino group of the peptide linkage. This breaks the peptide bond. The remaining steps follow a similar pattern.

:R -e-

,.....

and serves as the base of the arrow. In the chymotrypsin mech­

CD

Electrophiles

oxygen (as in an group or an ionized carboxylic acid)

- s­

sulfhydryl

carbonyl group (the more electronegative oxygen of the carbonyl away from the carbon)

r:R 'c=N-

-c

I

Carbanion

Carbon atom of a

group pulls electrons

Negatively charged

I

ll )

0

/

,.....

-N1

Uncharged amine group

h fiNyN :) Imidazole

IT-o-

Pronated imine group (activated for nucleophilic attack at the carbon by protonation of the imine)

T

:R - 0-P = O

I J

a-

Phosphorus of a phosphate group

,.....

Hydroxide ion

I

H

Proton

6.4

Interaction of Serl95 and Hi 57 generate a strongly nucleophilic alko:dde ion on Ser l9S; he ion attacks the peptide carbonyl group, forming a tetrahedral acylES complex enzyme. This i accom­ panied by formation of a hort-lived negative charge on the carbonyl oxygen of the H O _f Ser '-"' '?' sub trate. which l ' l l . II C-CH-NH-M. is stabilized by , formation of a covalent acyl-enzyme intermediate is

coupled to cleavage of the peptide bond. In the deacylation phase (steps

8

to

[209]

Instability of the negative charge on the substrate carbonyl oxygen leads to collapse of the tetrahedral inter­ mediate; re-formation of a double bond with carbon displaces the bond between carbon and the amino group of the peptide linkage, breaking the peptide bond. The amino leaving group is protonated by His57, facil itating its displacement.

chymotrypsin. The reaction has two phases. In the acylation phase

(steps

Examples of Enzymatic Reactions

\A

Product 1 l C l l NJ I J J )

HI

), deacylation regenerates the free enzyme; this is es­

sentially the reverse of the acylation phase, with water m i rroring, i n re­ verse, the role of the amine component of the substrate. Chymotrypsin Mechanism

Short-lived intermediate* (deacylation)

Acyl-enzyme intermediate

H-Q/� / y

Acyl-enzyme intermediate

An incoming water

Collapse of the tetrahedral intermediate form. the second proc;luct, a carboXylate anion, and c:lisplaces Serl95.

*The tetrahedral i ntermediate in the chymotrypsin reaction pathway, and the second tetrahedral i ntermediate that forms l ater, are sometimes referred to as transition states, which can lead to confusion. An inter­ mediate is any chemical species wi th a fin ite l ifetime, "finite" being de­ fined as longer than the time required for a molecular vibration (-1 o - 1 3 seconds). A transition state i s simply the maxi m um-energy species formed on the reaction coordinate and does not have a finite l ifetime. The tetrahedral intermediates formed i n the chymotrypsin reaction closely resemble, both energetically and structura l ly, the transition states leadi ng to their formation and breakdown. However, the inter­ mediate represents a committed stage of completed bond formation,

molecule is deprotonated by general ba e catalysis. generating a strongly nucleophilic hydroxide ion. Attack of hydroxide on the ester linkage of the acylenzyme generates a second tetrahedral intermediate, with oxygen in the oxyanion hole again taking on a negative charge.

whereas the transition state is part of the process of reaction. In the case of chymotrypsin, given the close relationship between the intermediate and the actual transition state the distinction between them is routinely g lossed over. Furthermore, the i nteraction of the negatively charged oxygen with the amide nitrogens in the oxyanion hole, often referred to as transition-state stabilization, also serves to stabilize the intermediate in this case. Not a l l i ntermedi ates are so short-lived that they resemble transition states. The chymotrypsin acyl-enzyme i ntermediate is much more stable and more readily detected and studied, and it is never con­ fused with a transition state.

[21 o]

Enzymes

Evidence for Enzyme-Transition State Complementarity

-- ..�

The transition state of a reaction is difficult to study be­ cause it is so short-lived. To understand enzymatic catalysis, however, we must understand what occurs during this fleeting moment in the course of a reaction. Complementarity between an enzyme and the transition state is virtually a requirement for catalysis , because the energy hill upon which the transition state sits is what the enzyme must lower if catalysis is to occur. How can we obtain evidence for enzyme-transition state comple­ mentarity? Fortunately, we have a variety of ap­ proaches, old and new, to address this problem, each providing compelling evidence in support of this general principle of enzyme action.

Structure-Activity Correlations If enzymes are complementary to reaction transition states, then some functional groups in both the sub­ strate and the enzyme must interact preferentially in the transition state rather than in the ES complex. Changing these groups should have little effect on for­ mation of the ES complex and hence should not affect kinetic parameters (the dissociation constant, Kct; or sometimes Km, if Kct Km ) that reflect the E + S � E S equilibrium. Changing these same groups should have a large effect on the overall rate (kcat or kcat 1Km) of the re­ action, however, because the bound substrate lacks po­ tential binding interactions needed to lower the activation energy. An excellent example of this effect is seen in the kinetics associated with a series of related substrates for the enzyme chymotrypsin (Fig. 1 ) . Chymotrypsin normally catalyzes the hydrolysis of peptide bonds next to aromatic amino acids. The substrates shown in =

Substrate A

Substrate B

Substrate C

II

C2 C2 C2 I

2

0

0

Transition-State Analogs Even though transition states cannot be observed di­ rectly, chemists can often predict the approximate structure of a transition state based on accumulated knowledge about reaction mechanisms. The transition state is by definition transient and so unstable that di­ rect measurement of the binding interaction between this species and the enzyme is impossible. In some cases, however, stable molecules can be designed that resemble transition states. These are called transition-

heat (s- ')

Km ( mM)

0 . 14

15

0.06

II

H3 -C-NH-CH- -NH2

0

Figure 1 are convenient smaller models for the natural substrates (long polypeptides and proteins) . The ad­ ditional chemical groups added in each substrate (A to B to C) are shaded. As the table shows, the interaction between the enzyme and these added functional groups has a minimal effect on Km (taken here as a re­ flection of Kct) but a large, positive effect on kcat and kcat1Km. This is what we would expect if the interac­ tion contributed largely to stabilization of the transi­ tion state. The results also demonstrate that the rate of a reaction can be affected greatly by enzyme-sub­ strate interactions that are physically remote from the covalent bonds that are altered in the enzyme-cat­ alyzed reaction. Chymotrypsin is described in more detail in the text. A complementary experimental approach is to modify the enzyme, eliminating certain enzyme-sub­ strate interactions by replacing specific amino acid residues through site-directed mutagenesis (see Fig. 9-1 1 ) . Results from such experiments again demon­ strate the importance of binding energy in stabilizing the transition state .

0

II I 2 II II CHa- -NH- H- -NH-cH2- -NH2

H 1 2 � � ? 3 ? CH3 -C-NH -CH-C-NH-CH-LNH2

31

kcat1Km (M- 1 $ 1 ) 2

10

FIGURE 1 Effects of smal l structural changes in the substrate 2.8

25

114

on

k i netic

parameters

chymotrypsin-catalyzed hydrolysis.

for

amide

6.4 Examples of Enzymatic Reactions

_ . ... .

:..

.



.

.

:

.

-

-

-

,

.

•.

[21 1]

.. ·.

state analogs . In principle, they should bind to an enzyme more tightly than does the substrate in the ES complex, because they should fit the active site better (that is, form a greater number of weak interactions) than the substrate itself. The idea of transition-state analogs was suggested by Pauling in the 1 940s, and it has been explored using a number of enzymes. These experiments have the limitation that a transition-state analog cannot perfectly mimic a transition state. Some analogs, however, bind an enzyme 1 0 2 to 1 06 times more tightly than does the normal substrate, providing good evidence that enzyme active sites are indeed complementary to transition states. The same princi­ ple is used in the pharmaceutical industry to design new drugs. The powerful anti-HIV drugs called pro­ tease inhibitors were designed in part as tight-binding transition-state analogs directed at the active site of HIV protease.

Catalytic antibodies generally do not approach the catalytic efficiency of enzymes, but medical and indus­ trial uses for them are nevertheless emerging. For ex­ ample, catalytic antibodies designed to degrade cocaine are being investigated as a potential aid in the treatment of cocaine addiction.

Ester hydrolysis

- m-r

{,

R � _, o, 2 R

�")

Several

� Products

Catalytic Antibodies If a transition-state analog can be designed for the reac­ tion S --7 P then an antibody that binds tightly to this analog might be expected to catalyze S --7 P. Antibodies (immunoglobulins; see Fig. 5-2 1 ) are key components of the immune response. When a transition-state analog is used as a protein-bound epitope to stimulate the pro­ duction of antibodies , the antibodies that bind it are po­ tential catalysts of the corresponding reaction. This use of "catalytic antibodies," first suggested by William P. Jencks in 1 969, has become practical with the develop­ ment of laboratory techniques to produce quantities of identical antibodies that bind one specific antigen (mon­ oclonal antibodies, p. 1 73) . Pioneering work in the laboratories of Richard Lerner and Peter Schultz has resulted in the isolation of a number of monoclonal antibodies that catalyze the hy­ drolysis of esters or carbonates (Fig. 2) . In these reac­ tions, the attack by water (OH-) on the carbonyl carbon produces a tetrahedral transition state in which a partial negative charge has developed on the carbonyl oxygen. Phosphonate ester compounds mimic the structure and charge distribution of this transition state in ester hy­ drolysis , making them good transition-state analogs; phosphate ester compounds are used for carbonate hy­ drolysis reactions. Antibodies that bind the phospho­ nate or phosphate compound tightly have been found to accelerate the corresponding ester or carbonate hydrol­ ysis reaction by factors of 1 03 to 1 04. Structural analyses of a few of these catalytic antibodies have shown that some catalytic amino acid side chains are arranged such that they could interact with the substrate in the transition state.

Transition state

1 98-0 R, I, ,.....- ' p li Os -

R2

Analog (phosphonate ester)

Several

� Products

Transition state

H H-N H

Analog (phosphate ester)

FIGURE 2 The expected transition states for ester or carbonate hydroly­ sis reactions. Phosphonate ester and phosphate ester compounds, re­ spectively, make good transition-state analogs for these reactions.

[21 2]

Enzymes

Hexoki nase Undergoes I nduced F it on Substrate B i nd i ng Yeast hexokinase CMr 107,862) is a bisubstrate enzyme that catalyzes the reversible reaction

H

OH

H

OH

Glucose 6-phosphate

,8-D-Glucose

ATP and ADP always bind to enzymes as a complex with the metal ion Mg2 + . The hydroxyl at C-6 of glucose (to which the y-phos­ phoryl of ATP is transferred in the hexokinase reaction) is similar in chemical reactivity to water, and water freely enters the enzyme active site. Yet hexokinase favors the reaction with glucose by a factor of 1 06 . The enzyme can discriminate between glucose and water because of a conformational change in the enzyme when the correct substrates binds (Fig. 6-22). Hexokinase thus provides a good example of induced fit. When glucose is not present, the enzyme is in an inactive conformation with the active-site amino acid side chains out of position for reaction. When glucose (but not water) and Mg ATP bind, the binding energy derived from this interaction induces a conformational change in hexokinase to the catalytically active form. This model has been reinforced by kinetic studies. The five-carbon sugar xylose, stereochemically similar to glucose but one carbon shorter, binds to hexokinase •

but in a position where it cannot be phosphorylated. Nevertheless, addition of xylose to the reaction mixture increases the rate of ATP hydrolysis. Evidently, the binding of xylose is sufficient to induce a change in hex­ okinase to its active conformation, and the enzyme is thereby "tricked" into phosphorylating water. The hex­ okinase reaction also illustrates that enzyme specificity is not always a simple matter of binding one compound but not another. In the case of hexokinase, specificity is observed not in the formation of the ES complex but in the relative rates of subsequent catalytic steps. Water is not excluded from the active site, but reaction rates increase greatly in the presence of the functional phosphoryl group acceptor (glucose) . H "- -f'o 0

o " -f' c I H-C-OH H

I

H-C-OH I

I

HO-C-H

HO-C-H

I

I

H-C-OH

H-C-OH I CH20H

I

H-C-OH I CH20H

Xylose

Glucose

Induced fit is only one aspect of the catalytic mech­ anism of hexokinase-like chymotrypsin, hexokinase uses several catalytic strategies. For example, the active-site amino acid residues (those brought into posi­ tion by the conformational change that follows substrate binding) participate in general acid-base catalysis and transition-state stabilization.

(b)

(a) FIGURE 6-22 Induced fit in hexokinase. (a) Hexokinase has a U-shaped

formational change induced by binding of o-gl ucose (red) (derived from

structure (PDB ID 2YHX). (b) The ends pinch toward each other in a con-

PDB ID

1 H KG and PDB ID 1 GLKl.

6.4 Examples of Enzymatic Reactions

'

I

o 'o ,./ � I Mg2� '-.. / -o I Enolase .. H-N-H

proton by general base catalysis. Two Mgll• ion stabilize U1e resulting enolic

a

H

C-?- I -H

I Lys345

elimination of the -OH group by

Lys:l45 abstracts a

po2-

Mg2 +

I

OH

HO

intermediate.

o H .- o _./ "I I Mg2�.. C=C-C-H

0

\/

/

·-...

-o ·

H-N +-H Lys345

I

Glu211

I

Glu211 facilitates

ro�-

Mg��-

general acid

catalysis.

I

\

OH

0 ,.HO '- ,f'

HOH

po2-

l

o

3

H I / C - C=C ' ,f' H 0

-o

'

c

I

Glu211 Enolic intermediate

(a) 2-Phosphoglycerate bound to enzyme

[21 3]

Phosphoenolpyruvate

(b) MECHANISM FIGURE 6-23 Two-step reaction catalyzed by enolase.

2 2 in relation to the Mg + ions, Lys345 , and G l u 1 1 in the enolase active site.

(a) The mechanism by which enolase converts 2-phosphoglycerate (2-

N itrogen is shown in blue, phosphorus in orange; hydrogen atoms are

PGA) to phosphoenolpyruvate. The carboxyl group of 2-PGA is coordi­

not shown (PDB ID l ONE).

nated by two magnesium ions at the active site. (b) The substrate, 2-PGA,

The Enolase Reaction Mechanism Bequ i n•s Metal ions

Another glycolytic enzyme , enolase, catalyzes the re­ versible dehydration of 2-phosphoglycerate to phos­ phoenolpyruvate: o o/ �c o "::

I

II

H-C-0-P -0 -

1

HO-CH2

I

o-

2-Phosphoglycerate

o o� /

I

0

II

a-

c

II

C-0-P-o - + H20 CH2

I

Phosphoenolpyruvate

Yeast enolase CMr 93,3 1 6) is a dimer with 436 amino acid residues per subunit. The enolase reaction illustrates one type of metal ion catalysis and pro­ vides an additional example of general acid-base catalysis and transition-state stabilization. The reac­ tion occurs in two steps ( F ig. f)-2:3 a ) . First, Lys3 45

acts as a general base catalyst, abstracting a proton from C-2 of 2-phosphoglycerate; then Glu2 1 1 acts as a general acid catalyst, donating a proton to the -OH leaving group. The proton at C-2 of 2-phosphoglycer­ ate is not very acidic and thus is not readily removed.

However, in the enzyme active site, 2-phosphoglycer­ ate undergoes strong ionic interactions with two bound Mg2 + ions (Fig. 6-23b) , making the C-2 proton more acidic (lowering the pKa) and easier to abstract. Hydrogen bonding to other active-site amino acid residues also contributes to the overall mechanism. The various interactions effectively stabilize both the enolate intermediate and the transition state preced­ ing its formation. Lysozyme Uses Two Successive N ucleophilic Displacement Reactions

Lysozyme is a natural antibacterial agent found in tears and egg whites. The hen egg white lysozyme CMr 14,296) is a monomer with 129 amino acid residues. This was the first enzyme to have its three-dimensional structure de­ termined, by David Phillips and colleagues in 1 965. The structure revealed four stabilizing disulfide bonds and a cleft containing the active site ( Fig. 6-24a) . More than five decades of investigations have provided a de­ tailed picture of the structure and activity of the enzyme, and an interesting story of how biochemical science progresses.

[214=

Enzymes

RO

I 0 I

=

CH3CHCoo-

NAc/AcN

OR

=

:y

-NH-C-CH3

II 0

to

GlcNAc

c

residues in enzyme binding site

Hydrogen bonds

NAc

I

I

/

I

�,

I

I

1

/

0

RO

FIGURE 6-24 Hen egg white lysozyme and the reaction it catalyzes. (a) Ribbon d iagram of the enzyme with the active-site residues Glu 35 and 2 Asp5 shown as blue stick structures and bound substrate shown in red (PDB ID 1 LZE). (b) Reaction catalyzed by hen egg white lysozyme. A seg­ ment of a peptidoglycan polymer is shown, with the lysozyme binding sites A through F shaded. The glycosidic C-0 bond between sugar residues bound to sites D and E is cleaved, as indicated by the red arrow.

(b)

The hydrolytic reaction is shown in the inset, with the fate of the oxygen in the H2 0 traced in red. Mur2Ac is N-acetylmuramic acid; GlcNAc, N­ acetylgl ucosamine. RO- represents a lactyl (lactic acid) group; -NAc

9 I

and AcN-, an N-acetyl group (see key).

The substrate of lysozyme is peptidoglycan, a carbohydrate found in many bacterial cell walls (see Fig. 20-3 1 ) . Lysozyme cleaves the (,8 1 �4) glycosidic G-O bond (see p. 243) between the two types of sugar residue in the molecule, N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine (GlcNAc) , often referred to as NAM and NAG, respectively, in the re­ search literature on enzymology (Fig. 6-24b). Six residues of the alternating Mur2Ac and GlcNAc in peptidoglycan bind in the active site, in binding sites labeled A through F. Model building has shown that the lactyl side chain of Mur2Ac cannot be accommo­ dated in sites C and E , restricting Mur2Ac binding to sites B, D, and F. Only one of the bound glycosidic bonds is cleaved, that between a Mur2Ac residue in site D and a GlcNAc residue in site E. The key cat­ alytic amino acid residues in the active site are Glu3 5 and Asp 5 2 ( Fig. 6-2 5a) . The reaction is a nucle­ ophilic substitution, with -OH from water replacing the GlcNAc at C-1 of Mur2Ac. With the active site residues identified and a detailed structure of the enzyme available, the path to under­ standing the reaction mechanism seemed open in the 1 960s. However, definitive evidence for a particular mechanism eluded investigators for nearly four decades.

There are two chemically reasonable mechanisms that could generate the observed product of lysozyme-medi­ ated cleavage of the glycosidic bond. Phillips and col­ leagues proposed a dissociative (SN1-type) mechanism (Fig. 6-25a, left) , in which the GlcNAc initially dissoci­ ates in step CD to leave behind a glycosyl cation (a car­ bocation) intermediate. In this mechanism, the departing GlcNAc is protonated by general acid catalysis by Glu35, located in a hydrophobic pocket that gives its carboxyl group an unusually high pKa. The carbocation is stabilized by resonance involving the adjacent ring oxygen, as well as by electrostatic interaction with the negative charge on the nearby Asp52 . In step ®, water attacks at C-1 of Mur2Ac to yield the product. The alternative mechanism (Fig. 6-25a, right) involves two consecutive direct­ displacement (SN2-type) steps. In step Q), Asp52 attacks C-1 of Mur2Ac to displace the GlcNAc. As in the first mechanism, Glu35 acts as a general acid to protonate the departing GlcNAc. In step ®, water attacks at C-1 of Mur2Ac to displace the Asp52 and generate product. The Phillips mechanism (SN 1), was widely accepted for more than three decades. However, some controversy persisted and tests continued. The scientific method sometimes advances an issue slowly, and a truly insightful experiment can be difficult to design. Some early

6.4 Examples of Enzymatic Reactions

[21 5]

Peptidoglycan binds in the active site of lysozyme

�1 mechanism 3 GJu 5 A rearrangement produces a glycosyl carbocation. General acid catalysis by GJu52 protonates the displaced GlcNAc oxygen and facilitates its departure.

0)_0 q

Asp52 acts as a covalent catalyst, directly displacing the GlcNAc via an SN2 mechanism. GJu3 5 protonates the GlcNAc to facilitate

r-t!� J Mur2�C"O cl �- GlcNAc ¥/I '--f'\..i?H --r H20H

·

..

-o

H

AcN

H

i' � �

T

-o

Lysozyme

o

H

Asp52

H

CD

TO

"\. c /

CH 2 0



OH

H

.

First product

35 Glu

)_0_

NAc

-f/?

H

AeN

3 Glu 5

-0

AO_

-f/l inler��£c 0 0

Saquinavir

FIGURE 6-30 HIV protease inhibitors. The hydroxyl group (red) acts as a transition-state analog, m i m icking the oxygen of the tetrahedral inter­ mediate. The adjacent benzyl group (bl ue) helps to properly position the drug in the active site.

[220]

Enzymes

S U M M A RY 6 . 4 •

regulatory proteins. Others are activated when peptide

Exa m p l es of Enzy matic Reacti ons

segments are removed by proteolytic cleavage; unlike ef­ fector-mediated regulation, regulation by proteolytic

Chymotrypsin is a serine protease with a

cleavage is irreversible. Important examples of both

well-understood mechanism, featuring general

mechanisms are found in physiological processes such as

acid-base catalysis , covalent catalysis, and

digestion, blood clotting, hormone action, and vision.

transition -state stabilization. •

Cell growth and survival depend on efficient use of resources, and this efficiency is made p o ssible by reg­

Hexokinase provides an excellent example of induced fit as a means of using substrate binding energy.



The enolase reaction proceeds via metal ion catalysis.



Lysozyme makes use of covalent catalysis and



ulatory enzymes . No single rule governs the occur­ rence of different types of regulation in different systems. To a degree, allosteric (noncovalent) regula­ tion may permit fine-tuning of metabolic pathways that are required continuously but at different levels

general acid catalysis as it promotes two successive

of activity as cellular conditions change. Regulation by

nucleophilic displacement reactions.

covalent modification may be all or none-usually the

Understanding enzyme mechanism allows the

case with proteolytic cleavage-or it may allow for

development of drugs to inhibit enzyme action.

subtle changes in activity. Several types of regulation may occur in a single regulatory enzyme. The remain­ der of this chapter is devoted to a discussion of these

6.5 Regulatory Enzymes

methods of enzyme regulation.

In cellular metabolism, groups of enzymes work together

Allosteric Enzymes Undergo Conformational Changes i n

in sequential pathways to carry out a given metabolic process, such as the multireaction breakdown of glucose

Response t o Modulator Binding 5,

to lactate or the multireaction synthesis of an amino acid

A s w e saw i n Chapter

from simpler precursors. In such enzyme systems, the

ing "other shapes" or conformations induced by the bind­

allosteric proteins are those hav­

reaction product of one enzyme becomes the substrate

ing of modulators. The same concept applies to certain

of the next.

regulatory enzymes, as conformational changes induced

Most of the enzymes in each metabolic pathway fol­

by one or more modulators interconvert more-active and

low the kinetic patterns we have already described. Each

less-active forms of the enzyme. The modulators for al­

pathway, however, includes one or more enzymes that

losteric enzymes may be inhibitory or stimulatory. Often

have a greater effect on the rate of the overall sequence .

the modulator is the substrate itself; regulatory enzymes

exhibit increased or de­

for which substrate and modulator are identical are called

creased catalytic activity in response to certain signals.

homotropic. The effect is similar to that of 02 binding to

Adjustments in the rate of reactions catalyzed by regula­

hemoglobin (Chapter

tory enzymes, and therefore in the rate of entire metabolic

strate, in the case of enzymes-causes conformational

sequences, allow the cell to meet changing needs for en­

changes that affect the subsequent activity of other sites

These

regulatory enzymes

5) :

binding of the ligand-or sub­

ergy and for biomolecules required in growth and repair.

on the protein. When the modulator is a molecule other

In most multienzyme systems, the first enzyme of

than the substrate, the enzyme is said to be heterotropic.

the sequence is a regulatory enzyme. This is an excel­

Note that allosteric modulators should not be confused

lent place to regulate a pathway, because catalysis of

with uncompetitive and mixed inhibitors. Although the

even the first few reactions of a sequence that leads to

latter bind at a second site on the enzyme, they do not

an unneeded product diverts energy and metabolites

necessarily mediate conformational changes between ac­

from more important processes. Other enzymes in the

tive and inactive forms, and the kinetic effects are distinct.

sequence may play subtler roles in modulating the flux through a pathway, as described in Chapter

15.

The activities o f regulatory enzymes are modulated in a variety of ways .

Allosteric enzymes

function

through reversible, noncovalent binding of regulatory compounds called

effectors,

allosteric modulators

or

The properties of allosteric enzymes are significantly different from those of simple nonregulatory enzymes.

allosteric

Some of the differences are structural. In addition to active sites, allosteric enzymes generally have one or more regu­ latory, or allosteric, sites for binding the modulator

6-31 ).

Just

as

an

enzyme's active site is

(Fig.

specific

which are generally small metabolites or

for its substrate, each regulatory site is specific for its mod­

co­

ulator. Enzymes with several modulators generally have

cofactors. Other enzymes are regulated by reversible

valent modification.

Both classes of regulatory en­

zymes tend to be multisubunit proteins, and in some

different specific binding sites for each. In homotropic en­ zymes, the active site and regulatory site are the same.

cases the regulatory site(s) and the active site are on sep­

Allosteric enzymes are generally larger and more

arate subunits. Metabolic systems have at least two other

complex than nonallosteric enzymes. Most have two or

mechanisms of enzyme regulation. Some enzymes are

more subunits . Aspartate transcarbamoylas e , which

stimulated or inhibited when they are bound by separate

catalyzes an early reaction in the biosynthesis of pyrim-

6.5

� Substrate

8 Positive modulator Less-active enzyme

Regu latory Enzymes

[221]

idine nucleotides (see Fig. 22-36) , has 12 polypeptide chains organized into catalytic and regulatory subunits. Figure 6-32 shows the quaternary structure of this enzyme, deduced from x-ray analysis. In Many Pathways, Regulated Steps Are Catalyzed by

� IRI c

1l

R

A l losteric Enzymes

M•��ru.,neym,

I"'""'

enzyme-substrate complex

FIGURE 6-31 Subunit interactions in an allosteric enzyme, and inter­ actions with inhibitors and activators. In many al losteric enzymes the

substrate binding site and the modu lator binding site(s) are on different subun its, the catalytic (C) and regu latory (R) subun its, respectively. B i nding of the positive (sti m u l atory) modulator (M) to its specific site on the regulatory subunit is communi cated to the cata lytic subunit subunit active and capable of bi nding the substrate (5) with higher through a conformational change. This change renders the cata lytic

affi n i ty. On dissociation of the modulator from the regulatory subunit, the enzyme reverts to its i nactive or less active form.

In some multienzyme systems, the regulatory enzymes are specifically inhibited by the end product of the pathway whenever the concentration of the end product exceeds the cell's requirements. When the regulatory enzyme re­ action is slowed, subsequent enzymes may operate at dif­ ferent rates as their substrate pools are depleted. The rate of production of the pathway's end product is thereby brought into balance with the cell's needs. This type of regulation is called feedback inhibition. Buildup of the end product ultimately slows the entire pathway. One of the first known examples of allosteric feed­ back inhibition was the bacterial enzyme system that cat­ alyzes the conversion of L-threonine to L-isoleucine in five steps (Fig. 6-33) . In this system, the first enzyme, threonine dehydratase, is inhibited by isoleucine, the product of the last reaction of the series. This is an ex­ ample of heterotropic allosteric inhibition. Isoleucine is quite specific as an inhibitor. No other intermediate in this sequence inhibits threonine dehydratase, nor is any other enzyme in the sequence inhibited by isoleucine. Isoleucine binds not to the active site but to another spe­ cific site on the enzyme molecule, the regulatory site.

+

coo­ I

H3N-C-H I

H-C-OH

L-Threonine

I

CH3 threonine

dchydrata�e

B

FIGURE 6-33 Feedback inhibi­ tion. The conversion of L-th reo­

n i ne to L-isoleucine is catalyzed by a sequence of five enzymes (E 1 to E5). Threonine dehydratase ( E 1 )

FIGURE 6-32 Two views of the regulatory enzyme aspartate transcar­

is specifical l y i n h i bited a l losteri­

bamoylase. (Derived from PDB ID 2AT2 .) This allosteric regulatory en­

cally by L-isoleucine, the end

zyme has two stacked catalytic c l usters, each with th ree catalytic

product of the sequence, but not

polypeptide chains (in shades of blue and purple), and three regulatory low). The regulatory clusters form the poi nts of a triangle surrounding the cata lytic subun its. B i nding sites for allosteric modu lators are on the regulatory subunits. Modulator b i nding produces large changes i n en­

by any of the four i ntermedi ates

coo­

cl usters, each with two regulatory polypeptide cha i ns (in red and yel­ +

(A to D). Feedback inhibition is

I

H3N-C-H �--

I

H-C-CH3 I

zyme conformation and activity. The role of this enzyme i n nucleotide

CH2

synthesis, and details of its regulation, are di scussed i n Chapter 2 2 .

CH3

I

ind icated by the dashed feedback L-Isoleucine

l i ne and the ® symbol at the threon i ne dehydratase reaction arrow, a device used throughout this book.

222

Enzymes

This binding is noncovalent and readily reversible; if the isoleucine concentration decreases, the rate of threonine dehydration increases. Thus threonine dehydratase ac­ tivity responds rapidly and reversibly to fluctuations in the cellular concentration of isoleucine. As we shall see in Part II of this book, the patterns of regulation in many other metabolic pathways are much more complex. The Kinetic Properties of Allosteric Enzymes Diverge from

Ko.s

Michae!is-Menten Behavior

Allosteric enzymes show relationships between V0 and [S] that differ from Michaelis-Menten kinetics. They do exhibit saturation with the substrate when [S] is suffi­ ciently high, but for some allosteric enzymes, plots of V0 versus [S] (Fig. 6-:3-1) produce a sigmoid saturation curve, rather than the hyperbolic curve typical of non­ regulatory enzymes. On the sigmoid saturation curve we can find a value of [S] at which V0 is half-maximal, but we cannot refer to it with the designation Km, because the enzyme does not follow the hyperbolic Michaelis­ Menten relationship. Instead, the symbol [S]0.5 or K0.5 is often used to represent the substrate concentration giv­ ing half-maximal velocity of the reaction catalyzed by an allosteric enzyme (Fig. 6-34). Sigmoid kinetic behavior generally reflects coopera­ tive interactions between protein subunits. In other words, changes in the structure of one subunit are trans­ lated into structural changes in adjacent subunits, an ef­ fect mediated by noncovalent interactions at the interface between subunits. The principles are particularly well il­ lustrated by a nonenzyme: 02 binding to hemoglobin. Sig­ moid kinetic behavior is explained by the concerted and sequential models for subunit interactions (see Fig. 5-15). Homotropic allosteric enzymes generally are multi­ subunit proteins and, as noted earlier, the same binding site on each subunit functions as both the active site and the regulatory site. Most commonly, the substrate acts as a positive modulator (an activator), because the sub­ units act cooperatively: the binding of one molecule of substrate to one binding site alters the enzyme's confor­ mation and enhances the binding of subsequent sub­ strate molecules. This accounts for the sigmoid rather than hyperbolic change in V0 with increasing [S]. One characteristic of sigmoid kinetics is that small changes in the concentration of a modulator can be associated with large changes in activity. As is evident in Figure 6-34a, a relatively small increase in [S] in the steep part of the curve causes a comparatively large increase in V0. For heterotropic allosteric enzymes, those whose modulators are metabolites other than the normal sub­ strate, it is difficult to generalize about the shape of the substrate-saturation curve. An activator may cause the curve to become more nearly hyperbolic, with a decrease in K0.5 but no change in Vmax' resulting in an increased reaction velocity at a fixed substrate concentration (V0 is higher for any value of [S]; Fig. 6-34b, upper curve). Other heterotropic allosteric enzymes respond to an

[S ) (mM) (a)

K!"s Ko.s

Ko8s

[S] (mM) (b)

Vuuuc

------------------------·

Kos

[S) (mM)

(c) FIGURE 6-34 Substrate-activity curves for representative allosteric enzymes. Three examples of complex responses of al losteric enzymes to their modulators. (a) The sigmoid curve of a homotropi c enzyme, i n which the substrate also serves a s a positive (stimulatory) modulator, o r activator. Note the resemblance to the oxygen-saturation curve o f he­ moglobin (see Fig. 5-1 2).

(b) The effects of a positive modul ator (+ ) and

a negative modulator ( - ) on an al losteric enzyme i n which K05 is al­

tered without a change i n Vmax· The central curve shows the substrate­ activity relationship without a modul ator.

(c)

A less common type of

modulation, in which Vmax is altered and K0 5 is nearly constant.

activator by an increase in Vmax with little change in K0.5 (Fig. 6-34c). A negative modulator (an inhibitor) may produce a more sigmoid substrate-saturation curve, with an increase in K0.5 (Fig. 6-34b, lower curve). Het­ erotropic allosteric enzymes therefore show different kinds of responses in their substrate-activity curves, because some have inhibitory modulators, some have activating modulators, and some have both.

6.5 Regu latory Enzymes

Some Enzymes Are Regulated by Reversible Covalent Modification

In another important class of regulatory enzymes, activ­ ity is modulated by covalent modification of one or more of the amino acid residues in the enzyme molecule. Over 500 different types of covalent modification have been found in proteins. Common modifying groups include phosphoryl, acetyl, adenylyl, uridylyl, methyl, amide, carboxyl, myristoyl, palmitoyl, prenyl, hydroxyl, sulfate, and adenosine diphosphate ribosyl groups (Fig. 6-35). There are even entire proteins that are used as special­ ized modifying groups, including ubiquitin and sumo. These varied groups are generally linked to and re­ moved from a regulated enzyme by separate enzymes. When an amino acid residue in an enzyme is modified, a novel amino acid with altered properties has effectively been introduced into the enzyme. Introduction of a charge can alter the local properties of the enzyme and induce a change in conformation. Introduction of a hydrophobic group can trigger association with a mem­ brane. The changes are often substantial and can be critical to the function of the altered enzyme. The variety of enzyme modifications is too great to cover in detail, but some examples can be offered. An example of an enzyme regulated by methylation is the methyl-accepting chemotaxis protein of bacteria. This protein is part of a system that permits a bacterium to swim toward an attractant (such as a sugar) in solution and away from repellent chemicals. The methylating agent is S-adenosylmethionine (adoMet) (see Fig. 18-18). Acetylation is a common modification, with approximately 80% of the soluble proteins in eukaryotes, including many enzymes, acetylated at their amino termini. Ubiquitin is added to proteins as a tag that predestines them for proteolytic degradation (see Fig. 27-47). Ubiquitination can also have a regulatory function. Sumo is found attached to many eukaryotic nuclear proteins with roles in the regulation of tran­ scription, chromatin structure, and DNA repair. ADP-ribosylation is an especially interesting reac­ tion, observed in a number of proteins; the ADP-ribose is derived from nicotinamide adenine dinucleotide (NAD) (see Fig. 8-38). This type of modification occurs for the bacterial enzyme dini.trogenase reductase, resulting in regulation of the important process of biological nitrogen fixation. Diphtheria toxin and cholera toxin are enzymes that catalyze the ADP-ribosylation (and inactivation) of key cellular enzymes or proteins. Phosphorylation is probably the most important type of regulatory modification. It is estimated that one­ third of all proteins in a eukaryotic cell are phosphory­ lated, and one or (often) many phosphorylation events are part of virtually every regulatory process. Some pro­ teins have only one phosphorylated residue, others have several, and a few have dozens of sites for phosphoryla­ tion. This mode of covalent modification is central to a large number of regulatory pathways, and we therefore

L223]

Covalent modification (target residues) Phosphorylation

(Tyr, Ser, Thr, His) 0

1)

ATP ADP

\,

II

1

Eu-P-oo-

Adenylylation

\, 1 ' Enz � 6-

(Tyr)

Enz

ATP PPi

0

-

/0

-O- CH2

H

H

H

0 --�-=--=/----)) Enz-�-CHs

Acetylation

(Lys, a-amino (amino terminus))

Enz

Acetyl-CoA

HS-CoA

Myristoylation

(a-amino (amino terminus))

� /

0 Enz-�-(CH2l12-CHs

Myristoyl-CoA HS-CoA Enz

Ubiquitination

(Lys)

� �c'-

�o

HS-

·

0

& tGa II �c-s�

--��--�

o-

®- �-s-e

-

activation

0

� /

Activated ubiquitin I·nz

1

HS-

Activated ubiquitin

� >

Enz-NH

� ��

0

A DP-ribosylation

(Arg, Gin, Cys, diphthamide-a modified His)

� /

NAD Em:

nicotinamide

----__=:: ,__....:::: ..., :...._ ____ -)

OH

Methylation

(Glu) S-adenosyl- S-adenosyl­ methionine homocysteine

Enz --�--=,__�/"'----�> Em-CHa FIGURE 6-35 Some enzyme modification reactions.

OH

[224]

Enzymes

discuss it in some detail. It will be discussed at length in Chapter 12. All of these modifications will be encountered again in this text. Phosphoryl Groups Affect the Structure a nd Catalytic Activity of Enzymes

The attachment of phosphoryl groups to specific amino acid residues of a protein is catalyzed by pro­ tein kinases; removal of phosphoryl groups is cat­ alyzed by protein phosphatases. The addition of a phosphoryl group to a Ser, Thr, or Tyr residue intro­ duces a bulky, charged group into a region that was only moderately polar. The oxygen atoms of a phos­ phoryl group can hydrogen-bond with one or several groups in a protein, commonly the amide groups of the peptide backbone at the start of an a helix or the charged guanidinium group of an Arg residue. The two negative charges on a phosphorylated side chain can also repel neighboring negatively charged (Asp or Glu) residues. When the modified side chain is located in a region of an enzyme critical to its three-dimen­ sional structure, phosphorylation can have dramatic effects on enzyme conformation and thus on substrate binding and catalysis. An important example of enzyme regulation by phosphorylation is seen in glycogen phosphorylase CMr 94,500) of muscle and liver (Chapter 15), which cat­ alyzes the reaction

more active phosphorylase a and the less active phospho­ rylase b (Fig. 6-36). Phosphorylase a has two subunits, each with a specific Ser residue that is phosphorylated at its hydroxyl group. These serine phosphate residues are required for maximal activity of the enzyme. The phos­ phoryl groups can be hydrolytically removed by a separate enzyme called phosphorylase phosphatase: Phosphorylase (more active)

a

+ 2H20



phosphorylase b + 2Pi (less active)

In this reaction, phosphorylase a is converted to phospho­ rylase b by the cleavage of two serine phosphate covalent bonds, one on each subunit of glycogen phosphorylase. Phosphorylase b can in turn be reactivated-cova­ lently transformed back into active phosphorylase a­ by another enzyme, phosphorylase kinase, which catalyzes the transfer of phosphoryl groups from ATP to the hydroxyl groups of the two specific Ser residues in phosphorylase b: 2ATP + phosphorylase b (less active)



2ADP + phosphorylase a (more active)

The glucose !-phosphate so formed can be used for ATP synthesis in muscle or converted to free glucose in the liver. Glycogen phosphorylase occurs in two forms: the

The breakdown of glycogen in skeletal muscles and the liver is regulated by variations in the ratio of the two forms of glycogen phosphorylase. The a and b forms dif­ fer in their secondary, tertiary, and quaternary struc­ tures; the active site undergoes changes in structure and, consequently, changes in catalytic activity as the two forms are interconverted. The regulation of glycogen phosphorylase by phos­ phorylation illustrates the effects on both structure and catalytic activity of adding a phosphoryl group. In the unphosphorylated state, each subunit of this enzyme is folded so as to bring the 20 residues at its amino termi­ nus, including a number of basic residues, into a region containing several acidic amino acids; this produces an

FIGURE 6-36 Regulation of muscle glycogen phosphorylase activity by multiple mechanisms. The activity of glycogen phosphorylase in muscle

other tissues, and activates the enzyme adenylyl cyclase. G l u cagon

(Glucose)n +Pi� (glucose)n -l +glucose 1-phosphate Glycogen Shortened glycogen chain

and epinephrine. Epinephrine binds to its receptor in muscle and some

is subjected to a m u lti level system of regulation, involving covalent

plays a simi lar role, binding to receptors in the l iver. This leads to the syn­

modification (phosphorylation), allosteric regulation, and a regulatory

thesis of high levels of the modified nucleotide cycl i c AMP (cAMP; see

cascade sensitive to hormonal status that acts on the enzymes involved

p. 298), activating the enzyme cAMP-dependent protein kinase (also

in phosphorylation and dephosphorylation. In the more active form of

called protei n ki nase A or PKA). PKA phosphorylates several target pro­

the enzyme, phosphorylase a, specific Ser residues, one on each sub­

teins, among them phosphorylase ki nase and phosphoprotein phos­

unit, are phosphorylated. Phosphorylase a is converted to the less active

phatase inhibitor 1 (PPI-1 ) . The phosphorylated phosphorylase kinase is

phosphorylase b by enzymatic loss of these phosphoryl groups, pro­

activated and in turn phosphorylates and activates glycogen phosphory­

moted by phosphoprotein phosphatase 1 (PP1 ). Phosphorylase b can be

lase. At the same time, the phosphorylated PPI-1 interacts with and in­

reconverted (reactivated) to phosphorylase a by the action of phospho­

h i bits PP1 . PPI-1 also keeps itself active (phosphorylated) by inhi biting

rylase kinase. The activity of both forms of the enzyme is a l losterically

phosphoprotein phosphatase 28 (PP2B), the enzyme that dephosphory­

regulated by an activator (AMP) and by inhibitors (gl ucose &-phosphate

l ates (i nactivates) it. In this way, the equ i l ibrium between the a and b

and ATP) that bind to separate sites on the enzyme. The activities of

forms of glycogen phosphorylase is shifted decisively toward the more

phosphorylase kinase and PP1 are also regulated via a short pathway that responds to the hormones gl ucagon and epi nephrine. When blood

active glycogen phosphorylase a. Note that the two forms of phosphory­ 2 l ase ki nase are both activated to a degree by Ca + ion (not shown). This

sugar levels are low, the pancreas and adrenal glands secrete gl ucagon

pathway is discussed i n more detai l i n Chapters 1 4, 1 5, and 23.

6.5 Regulatory Enzymes

electrostatic interaction that stabilizes the conformation. 1 Phosphorylation of Ser 4 interferes with this interaction, forcing the amino-terminal domain out of the acidic envi­ ronment and into a conformation that allows interaction between the ® -Ser and several Arg side chains. In this conformation, the enzyme is much more active. Phosphorylation of an enzyme can affect catalysis in another way: by altering substrate-binding affinity. For example, when isocitrate dehydrogenase (an enzyme of the citric acid cycle; Chapter 16) is phosphorylated, elec­ trostatic repulsion by the phosphoryl group inhibits the binding of citrate (a tricarboxylic acid) at the active site. M u ltiple Phosphorylations Allow Exquisite Regulatory Control

The Ser, Thr, or Tyr residues that are phosphorylated in regulated proteins occur within common structural mo­ tifs, called consensus sequences, that are recognized by specific protein kinases (Table 6-10). Some kinases are basophilic, preferring to phosphorylate a residue having basic neighbors; others have different substrate prefer-

ences, such as for a residue near a Pro residue. Amino acid sequence is not the only important factor in deter­ mining whether a given residue will be phosphorylated, however. Protein folding brings together residues that are distant in the primary sequence; the resulting three­ dimensional structure can determine whether a protein kinase has access to a given residue and can recognize it as a substrate. Another factor influencing the substrate specificity of certain protein kinases is the proximity of other phosphorylated residues. Regulation by phosphorylation is often complicated. Some proteins have consensus sequences recognized by several different protein kinases, each of which can phosphorylate the protein and alter its enzymatic activ­ ity. In some cases, phosphorylation is hierarchical: a cer­ tain residue can be phosphorylated only if a neighboring residue has already been phosphorylated. For example, glycogen synthase, the enzyme that catalyzes the con­ densation of glucose monomers to form glycogen (Chapter 15), is inactivated by phosphorylation of spe­ cific Ser residues and is also modulated by at least four other protein kinases that phosphorylate four other

OH

Glucagon ---71'[cAMPJ

---

@ �- - - Insulin t. "("ICY - --

7

-.............. , .....

Glucose 6-phosphate - - -7® ATP - - -7® AMP - - -7@

td

OH

OH

',

'

'

'

'

'

\

Glucose ® � - - - 6-phosphate ® � - - - ATP @�-- - AM P

\

_

AT P

..... _ ....

,.-"

.,"

.;

"

/

/

/

I

\ I

I \ \ I I I I I I I I I I

Pho�phorylase b

ADP

[22s]

I

[226]

Enzy mes

TA B L E 6-10

* Consensus sequence and phosphorylated residue

Protein kinase Protein kinase A

-x-R-[RK]-x-[ST]-B-

Protein kinase G

-x-R-[RK]-x-[ST]-x-

Protein kinase C

-[RK](2)-x-[ST]-B-[RK](2)-

Protein kinase B 2+ Ca /calmodulin kinase I 2+ Ca /calmodulin kinase II

-x-R-x-[ST]-x-K-

Myosin light chain kinase (smooth muscle)

-K(2)-R-x(2)-S-x-B(2)-

Phosphorylase b kinase

-K-R-K-Q-I-S-V-R-

Extracellular signal-regulated kinase (ERK)

-P-x-[ST]-P(2)-

Cyclin-dependent protein kinase (cdc2)

-x-[ST]-P-x-[KR]-

Casein kinase I

-[SpTp]-x(2)-[ST]-B

13-Adrenergic receptor kinase

-x-[ST]-x(2)-[ED]-x-

Rhodopsin kinase

-x(2)-[ST]-E (n)-

Insulin receptor kinase

-x-E (3)-Y-M (4)-K(2)-S-R-G-D- l-M-T-M-Q-I-

Epidermal growth factor (EGF) receptor kinase

G-K(3)-L-P-A-T-G-D-1-M-N-M-S-P-V-G-D-E(4)-}-P-E-L-V-

-B-x-R-x(2)-[ST]-x(3) -B-B-x-[RK]-x(2)-[ST]-x(2)-

Casein kinase II

t

-[DE](n)-[ST]-x(3)

Sources: Pinna, L.A. & Ruzzene, M.H. (1996) How do protein kinases recognize their substrates? Biochim. Biophys. Acta 1314, 191-225; Kemp, B. E. & Pearson, R. B. (1990) Protein kinase recognition sequence motifs. Trends Biochem. Sci.15, 342-346; Kennelly, P.J. & Krebs, E.G. ( 1991) Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. J. Bioi. Chern. 266, 15,555-15,558. * Shown here are deduced consensus sequences (in roman type) and actual sequences from known substrates (italic). The Ser (S), Thr (T). orTyr (Y) residue that undergoes phosphory· lation is in red; all amino acid residues are shown as their one-letter abbreviations (see Table 3- 1). x represents any amino acid. B. any hydrophobic amino acid. Sp, Tp, and Yp are Ser,

Thr, and Tyr residues that must already be phosphorylated lor the kinase to recognize the site. trhe best target site has two amino acid residues separating the phosphorylated and target Ser/ Thr residues; target sites with one or three intervening residues function at a reduced level.

Phosphorylation sites on 2 glyco gen _j_ synthase HaN

Kinase Protein kinase A Protein kinase G Protein kinase C CaZ+ /calmodulin kinase Phosphorylase b kinase Casein kinase I Casein kinase II Glyc ogen synthase kinase 3 Glycogen synthase kinase 4

3 r--� ABC

·-·

1 n AB

--�__,_ 1 1 ...J._ _ I _�_I-'-I__I _L_ _._ I

Phosphorylation sites l A, lB, 2, 4

4

5

Degree of synthase inactivation +

l A, B l , 2

+

l A

+

l B, 2 2

At least nine 5

3 A, 3B, 3 C

coo-

+ +

+ + + +

0

sites in the enzyme (Fig. 6-37). The enzyme is not a substrate for glycogen synthase kinase 3, for example, ufl.til one site has been phosphorylated by casein kinase II. Some phosphorylations inhibit glycogen synthase more than others, and some combinations of phosphory­ lations are cumulative. These multiple regulatory phos­ phorylations provide the potential for extremely subtle modulation of enzyme activity. To serve as an effective regulatory mechanism, phosphorylation must be reversible. In general, phos­ phoryl groups are added and removed by different en­ zymes, and the processes can therefore be separately regulated. Cells contain a family of phosphoprotein phosphatases that hydrolyze specific ®-Ser, ®- Thr, and ® -Tyr esters, releasing Pi. The phosphoprotein phosphatases we know of thus far act only on a subset of phosphoproteins, but they show less substrate specificity than protein kinases.

+ + +

Some Enzymes and Other Proteins Are Regulated by 2

+

FIGURE 6-37 Multiple regulatory phosphorylations. The enzyme glyco­ gen synthase has at least n i ne separate sites in five designated regions susceptible to phosphorylation by one of the cel l ular protein kinases. Thus, regu lation of this enzyme is a matter not of binary (on/off) switch­ ing but of finely tuned modulation of activity over a wide range i n response t o a variety o f signals.

Proteolytic Cleavage of a n Enzyme Precursor

For some enzymes, an inactive precursor called a zymo­ gen is cleaved to form the active enzyme. Many prote­ olytic enzymes (proteases) of the stomach and pancreas are regulated in this way. Chymotrypsin and trypsin are initially synthesized as chymotrypsinogen and trypsino­ gen (Fig. 6-38). Specific cleavage causes conforma­ tional changes that expose the enzyme active site.

6.5 Regu latory Enzymes

Chymotrypsinogen (inactive)

1

245

Trypsinogen (inactive) 1

6

7 I

l• l�Val-(Asp)4-Lys ·nli'I'O[W]H ida�. .;..>

:E .;..>

How can this information be used to develop a specific proce­

u

=< � j- �

N

m�o"

H

I R-i.b o· e-r' l structure in RNA. (a) Three­

r� )=1

N /

FIGURE 8-25 Three-dimensional

2

0

H

Adenine

(c)

]

Ri. bo sc .....,

N

V

NH2

N Adenine

Ribozymes, or RNA enzymes, catalyze a variety of reactions, prima­

dimensional structure of phenylalanine tRNA of yeast (PDB ID l TRA).

rily in RNA metabol ism and protein synthesis. The complex three­

Some unusual base-pairing patterns found in this tRNA are shown. Note

dimensional structures of these RNAs reflect the complexity inherent

also the involvement of the oxygen of a ribose phosphodiester bond i n

in catalysis, as described for protein enzymes in Chapter 6. (c) A seg­

one hydrogen-bonding arrangement, and a ribose 2 '-hydroxyl group in

ment of m RNA known as an intron, from the c i l iated protozoan

another (both in red). (b) A hammerhead ribozyme (so named because

Tetrahymena thermophila (derived from PDB ID 1 GRZ). This i ntron (a

the secondary structure at the active site looks like the head of a ham­

ribozyme) catalyzes its own excision from between exons i n an m R NA

mer), derived from certain plant viruses (derived from PDB ID 1 MME).

protein enzymes, depend on their three-dimensional structures (Fig. 8 - 25 ) . The analysis of RNA structure and the relationship between structure and function is an emerging field of inquiry that has many of the same complexities as the analysis of protein structure. The importance of under­ standing RNA structure grows as we become increas­ ingly aware of the large number of functional roles for RNA molecules.

strand (discussed in Chapter 26).

S U M M A RY 8 . 2 •

N uc l e i c Acid Structu re

Many lines of evidence show that DNA bears genetic information. In particular, the Avery-MacLeod-McCarty experiment showed that DNA isolated from one bacterial strain can enter and transform the cells of another strain, endowing it with some of the inheritable characteristics of the donor. The Hershey-Chase experiment showed that

8 . 3 N u cleic Acid C h e m i stry

the DNA of a bacterial virus, but not its protein coat, carries the genetic message for replication of the virus in a host cell. •





Putting together the available data, Watson and Crick postulated that native DNA consists of two antiparallel chains in a right-handed double-helical arrangement. Complementary base pairs, A=T and G-C , are formed by hydrogen bonding within the helix. The base pairs are stacked perpendicular to the long axis of the double helix, 3.4 A apart, with 1 0 . 5 base pairs per turn. DNA can exist in several structural forms. Two variations of the Watson-Crick form, or B-DNA, are A- and Z-DNA. Some sequence-dependent structural variations cause bends in the DNA molecule. DNA strands with appropriate sequences can form hairpin/ cruciform structures or triplex or tetraplex DNA. Messenger RNA transfers genetic information from DNA to ribosomes for protein synthesis. Transfer RNA and ribosomal RNA are also involved in protein synthesis. RNA can be structurally complex; single RNA strands can fold into hairpins, double-stranded regions, or complex loops.

8.3 Nucleic Acid Chemistry

[287]

unwinding of the double helix to form two single strands, completely separate from each other along the entire length or part of the length (partial denaturation) of the molecule. No covalent bonds in the DNA are broken (Fig. 8-26) . Renaturation of a DNA molecule is a rapid one-step process, as long as a double-helical segment of a dozen or more residues still unites the two strands. When the temperature or pH is returned to the range in which most organisms live, the unwound segments of the two strands spontaneously rewind, or anneal, to yield the intact duplex (Fig. 8-26) . However, if the two strands are completely separated, renaturation occurs in two steps. In the first, relatively slow step, the two strands "find" each other by random collisions and form a short segment of complementary double helix. The second step is much faster: the remaining unpaired bases successively come into register as base pairs, and the two strands "zipper" themselves together to form the double helix. The close interaction between stacked bases in a nucleic acid has the effect of decreasing its absorption of UV light relative to that of a solution with the same concentration of free nucleotides, and the absorption is decreased further when two complementary nucleic acid strands are paired. This is called the hypochromic effect. Denaturation of a double-stranded nucleic acid

The role of DNA as a repository of genetic information depends in part on its inherent stability. The chemical transformations that do occur are generally very slow in the absence of an enzyme catalyst. The long-term stor­ age of information without alteration is so important to a cell, however, that even very slow reactions that alter DNA structure can be physiologically significant. Processes such as carcinogenesis and aging may be inti­ mately linked to slowly accumulating, irreversible alter­ ations of DNA. Other, nondestructive alterations also occur and are essential to function, such as the strand separation that must precede DNA replication or tran­ scription. In addition to providing insights into physio­ logical processes, our understanding of nucleic acid chemistry has given us a powerful array of technologies that have applications in molecular biology, medicine, and forensic science . We now examine the chemical properties of DNA and some of these technologies.

Double-helical DNA Denaturation

Double-Helical DNA and RNA Can Be Denatured Solutions of carefully isolated, native DNA are highly viscous at pH 7.0 and room temperature (25 °C) . When such a solution is subjected to extremes of pH or to tem­ peratures above 80 oc, its viscosity decreases sharply, indicating that the DNA has undergone a physical change. Just as heat and extremes of pH denature glob­ ular proteins , they also cause denaturation, or melting, of double-helical DNA. Disruption of the hydrogen bonds between paired bases and of base stacking causes

Separated strands of DNA in random coils

FIGURE 8-26 Reversible denaturation and annealing (renaturation) of

DNA.

[2ss]

N u cleotides a n d N u cl e i c Acids

produces the opposite result: an increase in absorp­ tion called the hyperchromic effect. The transition from double-stranded DNA to the single-stranded, de­ natured form can thus be detected by monitoring UV absorption at 260 nm. Viral or bacterial DNA molecules in solution dena­ ture when they are heated slowly ( Fig. 8-27). Each species of DNA has a characteristic denaturation tem­ perature, or melting point Ctm; formally, the temperature at which half the DNA is present as separated single strands) : the higher its content of G=C base pairs, the higher the melting point of the DNA. This is because G=C base pairs , with three hydrogen bonds, require more heat energy to dissociate than A=T base pairs . Thus the melting point of a DNA molecule, determined under fixed conditions of pH and ionic strength, can yield an estimate of its base composition. If denaturation conditions are carefully controlled, regions that are rich

3 JLffi FIGURE 8-28 Partially denatured DNA. This DNA was partially dena­ tured, then fixed to prevent renaturation during sample preparation . The shadowi ng method used to visual ize the DNA in this electron mi­ crograph i ncreases its di ameter approximately fivefold and obliterates most deta i l s of the helix. However, length measurements can be ob­ tained, and single-stranded regions are read ily distinguishable from double-stranded regions. The arrows point to some single-stranded bubbles where denaturation has occurred. The regions that denature are highly reproducible and are rich in A=T base pa irs.

75

(a)

100 00 Q) :9 ...,

0 Q)

80 Temperature ("

in A= T base pairs will specifically denature while most of the DNA remains double-stranded. Such denatured regions (called bubbles) can be visualized with electron microscopy ( Fig. 8-28). Note that in the strand sepa­ ration of DNA that occurs in vivo during processes such as DNA replication and transcription, the sites where these processes are initiated are often rich in A=T base pairs, as we shall see. Duplexes of two RNA strands or one RNA strand and one DNA strand (RNA-DNA hybrids) can also be denatured. Notably, RNA duplexes are more stable than DNA duplexes. At neutral pH, denaturation of a double­ helical RNA often requires temperatures 20 oc or more higher than those required for denaturation of a DNA molecule with a comparable sequence. The stability of an RNA-DNA hybrid is generally intermediate between that of RNA and that of DNA. The physical basis for these differences in thermal stability is not known.

85

80

g� 60 Ol ...,

'0 40 � B

0 + 0

N ucleic Acids from Different Species Can Form Hybrids

20

110

(b) FIGURE 8-27 Heat denaturation of DNA. (a) The denaturation, or melti ng, curves of two DNA specimens. The temperature at the m i d­

point of the transition (tml is the melting point; it depends on pH and ionic strength and on the size and base composition of the D NA. (b)

Relationship between tm and the G + C content of a D NA.

The ability of two complementary DNA strands to pair with one another can be used to detect similar DNA sequences in two different species or within the gen­ ome of a single species. If duplex DNAs isolated from human cells and from mouse cells are completely de­ natured by heating, then mixed and kept at about 25 oc below their tm for many hours, much of the DNA will anneal. The rate of DNA annealing is affected by tem­ perature, the length and concentration of the DNA frag­ ments being annealed, the concentration of salts in the reaction mixture, and properties of the sequence itself

8 . 3 N u c l e i c Acid C h e m i stry

(e.g., complexity and G C content) . Temperature is especially important. If the temperature is too low, short sequences with coincidental similarity from dis­ tant, heterologous parts of the DNA molecules will an­ neal unproductively and interfere with the more general alignment of complementary DNA strands. Temperatures that are too high will favor denaturation. Most of the reannealing occurs between complemen­ tary mouse DNA strands to form mouse duplex DNA; similarly, most human DNA strands anneal with com­ plementary human DNA strands . However, some strands of the mouse DNA will associate with human DNA strands to yield hybrid duplexes, in which seg­ ments of a mouse DNA strand form base-paired regions with segments of a human DNA strand (Fig. 8-2 9 ) . This reflects a common evolutionary heritage; different organisms generally have many proteins and RNAs with similar functions and, often, similar structures . In many cases, the DNAs encoding these proteins and RNAs have similar sequences. The closer the evolutionary re­ lationship between two species, the more extensively their DNAs will hybridize . For example, human DNA hybridizes much more extensively with mouse DNA than with DNA from yeast. The hybridization of DNA strands from different sources forms the basis for a powerful set of techniques

Sample 1

Mix and cool

Sample 2 FIGURE 8-29

DNA

hybridization.

Two D NA samples to be compared

are completely denatured by heat ing_ When the two solutions are mixed and slowly cooled, DNA strands of each sample associate with thei r normal complementary partner and anneal to form d u plexes. If the two DNAs have sign ificant sequence simi larity, they also tend to form partial duplexes or hybrids with each other: the greater the sequence simi larity between the two DNAs, the greater the number of hybrids formed . Hybrid formation can be measured in several ways. One of the DNAs is usua l l y labeled with a radioactive isotope to sim­ pl ify the measurements.

[2s9]

essential to the practice of modern molecular genetics. A specific DNA sequence or gene can be detected in the presence of many other sequences if one already has an appropriate complementary DNA strand (usually la­ beled in some way) to hybridize with it (Chapter 9) . The complementary DNA can be from a different species or from the same species, or it can be synthesized chemi­ cally in the laboratory using techniques described later in this chapter. Hybridization techniques can be varied to detect a specific RNA rather than DNA. The isolation and identification of specific genes and RNAs rely on these hybridization techniques. Applications of this technology make possible the identification of an indi­ vidual on the basis of a single hair left at the scene of a crime or the prediction of the onset of a disease decades before symptoms appear (see Box 9 - 1 ) . N ucleotides a n d N ucleic Acids Undergo Nonenzymatic Transformations

Purines and pyrimidines , along with the nu­ cleotides of which they are a part, undergo spontaneous alterations in their covalent structure . The rate of these reactions is generally very slow , but they are physiologically significant because of the cell's very low tolerance for alterations in its genetic infor­ mation. Alterations in DNA structure that produce per­ manent changes in the genetic information encoded therein are called mutations, and much evidence sug­ gests an intimate link between the accumulation of mutations in an individual organism and the processes of aging and carcinogenesis. Several nucleotide bases undergo spontaneous loss of their exocyclic amino groups (deamination) (Fig. 8-30a) . For example, under typical cellular conditions, deamination of cytosine (in DNA) to uracil occurs in about one of every 1 0 7 cytidine residues in 24 hours. This corresponds to about 1 00 spontaneous events per day, on average, in a mammalian cell. Deami­ nation of adenine and guanine occurs at about 1/1 OOth this rate. The slow cytosine deamination reaction seems in­ nocuous enough, but is almost certainly the reason why DNA contains thymine rather than uracil. The product of cytosine deamination (uracil) is readily recognized as foreign in DNA and is removed by a repair system (Chapter 25) . If DNA normally contained uracil, recog­ nition of uracils resulting from cytosine deamination would be more difficult, and unrepaired uracils would lead to permanent sequence changes as they were paired with adenines during replication. Cytosine deam­ ination would gradually lead to a decrease in G = C base pairs and an increase in A=U base pairs in the DNA of all cells. Over the millennia, cytosine deamination could eliminate G=C base pairs and the genetic code that de­ pends on them. E stablishing thymine as one of the four bases in DNA may well have been one of the crucial

�290 I

N u c l eotides a n d N u c l e i c Acids

3

� N

O

I

N

I



O



O



I

N

O



H2N

G uanine

N '

I

I

H

HN

:r )

l,N

-

I

'1'J= N) N

H

Apurinic residue

N

0

0

Guanine

N

Hypoxanthine

Adenine

:r A

0 I

N

0

I

HN

0

Guanosine residue (in DNAl

Thymine

NH2

0

�CH,



HN

5-Methylcytosine

t,-): )

I

N

Uracil

Cytosine

N5cH,





HN

0

I

Xanthine

(a) Deamination

(b) Depurination FIGURE 8-30 Some well-characterized nonenzymatic reactions of nucleotides. (a) Deamination reactions . On ly the base is shown. (b) Depurination, in which a purine is lost by hydrolysis of the N-{3glycosyl bond. Loss of pyrimidines via a s i m i l a r reaction occurs, but much more slowly. The resulting lesion, i n wh ich the deoxyribose is present but the base is not, is cal led an abasic site or an AP site (apu rinic site or, rarely, apyri m i d i n i c site). The deoxyribose rema i n ing after depurination is readily converted from the {3-furanose to the alde­ hyde form (see Fig. 8-3 ). Further nonenzymatic reactions are i l l us­ trated in Figures 8-3 1 and 8-32 .

turning points in evolution, making the long-term stor­ age of genetic information possible. Another important reaction in deoxyribonucleotides is the hydrolysis of the N-{3-glycosyl bond between the base and the pentose, to create a DNA lesion called an AP (apurinic, apyrimidinic) site or abasic site (Fig. 8-30b) . This occurs at a higher rate for purines than for pyrimidines. As many as one in 105 purines (10,000 per mammalian cell) are lost from DNA every 24 hours un­ der typical cellular conditions. Depurination of ribonu­ cleotides and RNA is much slower and generally is not considered physiologically significant. In the test tube, loss of purines can be accelerated by dilute acid. Incubation of DNA at pH 3 causes selective removal of the purine bases, resulting in a derivative called apurinic acid. Other reactions are promoted by radiation. UV light induces the condensation of two ethylene groups to form a cyclobutane ring. In the cell, the same reaction between adjacent pyrimidine bases in nucleic acids forms cyclobutane pyrimidine dimers. This happens most frequently between adjacent thymidine residues

on the same DNA strand (Fig. 8-3 1 ). A second type of pyrimidine dimer, called a 6-4 photoproduct, is also formed during UV irradiation. Ionizing radiation (x rays and gamma rays) can cause ring opening and fragmen­ tation of bases as well as breaks in the covalent back­ bone of nucleic acids. Virtually all forms of life are exposed to energy-rich radiation capable of causing chemical changes in DNA. Near-UV radiation (with wavelengths of 200 to 400 nm) , which makes up a significant portion of the solar spec­ trum, is known to cause pyrimidine dimer formation and other chemical changes in the DNA of bacteria and of human skin cells. We are subject to a constant field of ionizing radiation in the form of cosmic rays, which can penetrate deep into the earth, as well as radiation emit­ ted from radioactive elements, such as radium, pluto­ nium , uranium, radon, 14 C , and 3H. X rays used in medical and dental examinations and in radiation ther­ apy of cancer and other diseases are another form of ionizing radiation. It is estimated that UV and ionizing radiations are responsible for about 10% of all DNA damage caused by environmental agents.

8.3 N u cl e i c Acid C h e m istry

[291]

H 0� / c-- J ./ '--...

N -...... H

.,.... C=O

C=C

'

/

CHa

Adjacent thymines

light

Killk[ p 0� ....... /

H

T

......

�C-OH

"

CH3 (b)

(a) FIGURE 8-31 Formation of pyrimidine dimers induced by UV light.

(a)

A

7-

6-4 Photoproduct

Cyclobutane thymine dimer

T A

One type of reaction (on the left) results in the formation of a cy­

clobutyl ring i nvolving C-5 and C-6 of adjacent pyri midine residues.

with a l i nkage between C-6 of one pyrim i d i ne and C-4 of its neighbor.

(b)

Formation of a cyclobutane pyrim i d i ne d i mer i ntroduces a bend or

kink i nto the DNA.

An alternative reaction (on the right) results i n a 6-4 photoproduct,

DNA also may be damaged by reactive chemicals in­ troduced into the environment as products of industrial activity. Such products may not be injurious per se but may be metabolized by cells into forms that are. There are two prominent classes of such agents (Fig. 8-32) : (1) deaminating agents, particularly nitrous acid (HN02) or compounds that can be metabolized to nitrous acid or nitrites, and (2) alkylating agents. Nitrous acid, formed from organic precursors such as nitrosamines and from nitrite and nitrate

salts, is a potent accelerator of the deamination of bases. Bisulfite has similar effects . Both agents are used as preservatives in processed foods to prevent the growth of toxic bacteria. They do not seem to in­ crease cancer risks significantly when used in this way, perhaps because they are used in small amounts and make only a minor contribution to the overall levels of DNA damage. (The potential health risk from food spoilage if these preservatives were not used is much greater.)

FIGURE 8-32 Chemical agents that cause

DNA damage. (a) which

promotes

CH3

Precursors of n i trous acid, deamination

reactions.

CHa ' N-N=O / CHa Dimethylnitrosamine

(b) A l kylating agents. methionine

NaN02 Sodium nitrite

NaN03 Sodium nitrate

Rl ' N-N=O / Rz Nitrosamine (a) Nitrous acid precursors

adenosine

S-Adenosylmethionine

" o,8-:f'o

/ � 0 0 / CHa Dimethylsulfate

CH2 -CH2 - Cl / H3C -N , CH2 -CH2 -Cl Nitrogen mustard

(b) Alkylating agents

[292]

N u cleotides a n d N u cl e i c Acids

Alkylating agents can alter certain bases of DNA. For example, the highly reactive chemical dimethylsul­ fate (Fig. 8-32b) can methylate a guanine to yield 06methylguanine, which cannot base-pair with cytosine.

Guanine tautomers

6 0 -Methylguanine

Many similar reactions are brought about by alkylating agents normally present in cells, such as S-adenosyl­ methionine. The most important source of mutagenic alterations in DNA is oxidative damage. Excited-oxygen species such as hydrogen peroxide, hydroxyl radicals, and su­ peroxide radicals arise during irradiation or as a byprod­ uct of aerobic metabolism. Of these species, the hydroxyl radicals are responsible for most oxidative DNA damage. Cells have an elaborate defense system to destroy reac­ tive oxygen species, including enzymes such as catalase and superoxide dismutase that convert reactive oxygen species to harmless products. A fraction of these oxi­ dants inevitably escape cellular defenses however and damage to DNA occurs through any of a large , co�plex group of reactions ranging from oxidation of deoxyribose and base moieties to strand breaks. Accurate estimates for the extent of this damage are not yet available, but every day the DNA of each human cell is subjected to thousands of damaging oxidative reactions. This is merely a sampling of the best-understood re­ actions that damage DNA. Many carcinogenic compounds in food, water, or air exert their cancer-causing effects by modifying bases in DNA. Nevertheless, the integrity of DNA as a polymer is better maintained than that of either RNA or protein, because DNA is the only macromolecule that has the benefit of biochemical repair systems. These repair processes (described in Chapter 25) greatly lessen the impact of damage to DNA. • Some Bases of DNA Are Methylated

Certain nucleotide bases in DNA molecules are enzymatically methylated. Adenine and cytosine are methylated more often than guanine and thymine . Methylation is generally confined to certain sequences or regions of a DNA molecule. In some cases the function of methylation is well understood; in others the function re­ mains unclear. All known DNA methylases use S-adeno­ sylmethionine as a methyl group donor (Fig. 8-32b) .

E. coli has two prominent methylation systems. One serves as part of a defense mechanism that helps the cell to distinguish its DNA from foreign DNA by mark­ ing its own DNA with methyl groups and destroying (foreign) DNA without the methyl groups (this is known as a restriction-modification system; see p . 305) . The other system methylates adenosine residues within the sequence (5')GATC (3 ') to N6-methyladenosine (Fig. 8-5a) . This is mediated by the Dam (DNA adenine methylation) methylase, a component of a system that repairs mismatched base pairs formed occasionally during DNA replication (see Fig. 25-22) . In eukaryotic cells, about 5% of cytidine residues in DNA are methylated to 5-methylcytidine (Fig. 8-5a) . Methylation is most common at CpG sequences, produc­ ing methyl-CpG symmetrically on both strands of the DNA. The extent of methylation of CpG sequences varies by molecular region in large eukaryotic DNA molecules. The Sequences of long DNA Strands Can Be Determined

In its capacity as a repository of information, a DNA mol­ ecule's most important property is its nucleotide se­ quence. Until the late 1 970s, determining the sequence of a nucleic acid containing even five or ten nucleotides was very laborious. The development of two new tech­ niques in 1977, one by Alan Maxam and Walter Gilbert and the other by Frederick Sanger, made possible the sequencing of larger DNA molecules with an ease unimagined just a few years before . The techniques de­ pend on an improved understanding of nucleotide chemistry and DNA metabolism, and on electrophoretic . methods for separating DNA strands differing in size by only one nucleotide. Electrophoresis of DNA is similar to that of proteins (see Fig. 3-18) . Polyacrylamide is often used as the gel matrix in work with short DNA molecules (up to a few hundred nucleotides) ; agarose is generally used for longer pieces of DNA. In both Sanger and Maxam-Gilbert sequencing, the general principle is to reduce the DNA to four sets of la­ beled fragments. The reaction producing each set is base-specific, so the lengths of the fragments corre­ spond to positions in the DNA sequence where a certain base occurs. For example, for an oligonucleotide with the sequence pAATCGACT, labeled at the 5 ' end (the left end) , a reaction that breaks the DNA after each C residue will generate two labeled fragments : a four­ nucleotide and a seven-nucleotide fragment; a reaction that breaks the DNA after each G will produce only one labeled, five-nucleotide fragment. Because the frag­ ments are radioactively labeled at their 5 ' ends, only the fragment to the 5 ' side of the break is visualized. The fragment sizes correspond to the relative positions of C and G residues in the sequence . When the sets of frag­ ments corresponding to each of the four bases are elec­ trophoretically separated side by side, they produce a ladder of bands from which the sequence can be read directly (Fig. 8-3 3 ) . We illustrate only the Sanger

[29 3J

8 . 3 N u cl e i c Acid C h e m i stry

p

FIGURE 8-33 DNA sequencing by the Sanger method. This method makes use of the mechanism of DNA synthesis by DNA polymerases

p

�;

Primer strand

I GI CI CI

dATP

p

dGTP

(a)

DNA polymerases requ i re both a primer (a short

ol igonuc leotide strand), to which nucleotides are added, and a tem­

OH

OH OH

T

(Chapter 25).

plate strand to guide selection of each new nucleotide. In cells, the 3 ' ­ hydroxyl group o f the pri mer reacts with an incoming deoxyn ucleoside triphosphate (dNTP) to form a new phosphodi ester bond.

(b)

The

Sanger sequencing procedure uses dideoxynucleoside triphosphate

A

(ddNTP) analogs to i nterrupt DNA synthesis. (The Sanger method is also

G

known as the dideoxy method.) When a ddNTP is inserted in place of a dNTP, strand elongation is halted after the analog is added, because it lacks the 3 '-hydroxyl group needed for the next step.

Template strand

(c) The DNA to be

sequenced is used as the template strand, and a short pri mer, radioac­ tively or fluorescently labeled, is annealed to it. By addition of small amounts of a single ddNTP, for example ddCTP, to an otherwise nor­

(a)

mal reaction system, the synthesized strands w i l l be prematurely ter­ mi nated at some locations where dC norma l l y occurs. G iven the excess of dCTP over ddCTP, the chance that the analog w i l l be incor­

ooo1 I I - o-P-0-P-0-P-0-CH 2 II

II

0

porated whenever a dC is to be added is smal l . However, ddCTP is

II

0

present i n sufficient amounts to ensure that each new strand has a high

0

probab i l ity of acquiring at least one ddC at some point during synthe­ sis. The result is a solution contain ing a mixture of labeled fragments,

ddNTP analog

(b)

H

each ending with a C residue. Each C residue in the sequence gener­

H

ates a set of fragments of a particular length, such that the different­ sized fragments, separated by electrophoresis, reveal the location of C residues. This procedure is repeated separately for each of the four ddNTPs, and the sequence can be read directly from an autorad i­

5'

3'

ogram of the gel. Because shorter DNA fragments migrate faster, the

Primer

fragments near the bottom of the gel represent the nucleotide positions closest to the primer (the 5' end), and the sequence is read (in the 5 ' --..

3 ' direction) from bottom to top. Note that the sequence obtained is

Template

that of the strand complementary to the strand being analyzed.

+

dCTP, dGTP, dATP, dTTP

! ��

+ ddATP

--GATTCGAGCTGddA --GATTCGddA �ddA

..

------

+ ddCTP

+ ddGTP

--GATTCGAGddC -- GATTddC

+ ddTTP

--GATTCGAGCTddG --GATTCGAddG

J rr'--..--:::::-::: :- --= =�

--GATT dd

T

--GATTCGAGCddT --GATddT �AddT

-- d

-

A 12 11 10 9 8 7 6 5 4 3 2

(c)

c

G

T

__ __

3'

A

G T

c

G A G

c T T

A G

Autoradiogram of electrophoresis gel

Sequence of complementary strand

J

_

294

N u cleotides and N u c l e i c A c i d s

method, because it has proved to be technically easier and is in more widespread use. It requires the enzymatic synthesis of a DNA strand complementary to the strand under analysis, using a radioactively labeled "primer" and dideoxynucleotides. DNA sequencing is now automated by a variation of Sanger's sequencing method in which the dideoxynu­ cleotides used for each reaction are labeled with a dif­ ferently colored fluorescent tag (Fig. S-34) . With this technology, researchers can sequence DNA molecules containing thousands of nucleotides in a few hours. The entire genomes of more than a thousand organisms have now been sequenced in this way (see Table 1-2) , and many very large DNA-sequencing projects have been completed or are in progress. For example, in the Human Genome Project, researchers have sequenced all 3.2 bil­ lion base pairs of the DNA in a human cell (Chapter 9) .

Primer

1

3, / Template of '""' w�-=/ unknown sequence

-- c

I Dideoxy Sequencing of DNA

1

The Chemical Synthesis of DNA Has Been Automated

DoMt�

. ._,__,

Also important in nucleic acid chemistry is the rapid and accurate synthesis of short oligonucleotides of known sequence. The methods were pioneered by H . Gobind Khorana and his colleagues in the 1 970s. Re­ finements by Robert Letsinger and Marvin Caruthers led to the chemistry now in widest use, called the phos­ phoramidite method ( Fig. S -3 5 ) . The synthesis is car­ ried out with the growing strand attached to a solid support, using principles similar to those used by Mer­ rifield for peptide synthesis (see Fig. 3-29) , and is read­ ily automated. The efficiency of each addition step is very high, allowing the routine synthesis of polymers containing 70 or 80 nucleotides and, in some laborato­ ries , much longer strands. The availability of relatively inexpensive DNA polymers with predesigned sequences is having a powerful impact on all areas of biochemistry (Chapter 9) .

Dye-labeled segments of DNA, copied from template with unknown sequence

. ,- e

· �"-�

Dye-labeled segments applied to a capillary gel and subjected to electrophoresis

D A migration

Laser beam Laser FIGURE 8-34 Strategy for automating DNA sequencing reactions. Each d ideoxynucleotide used in the Sanger method can be l i n ked to a fluorescent molecule that gives a l l the fragments terminating in that nucleotide a particular color. A l l four labeled ddNTPs are added to a si ngle tube. The resulting colored DNA fragments are then separated by size in a si ngle electrophoretic gel contained in a cap i l lary tube (a refinement of gel electrophoresis that allows for faster separations). A l l fragments o f a given length m igrate through the cap i l lary gel i n a sin­ gle peak, and the color associated with each peak is detected using a laser beam. The DNA sequence is read by determi n ing the sequence of colors in the peaks as they pass the detector. This information is fed di­ rectly to a computer, which determi nes the sequence.

20

I

J_

4

30

�!

J

II /I

II 1 1

lJ'

11

GG C C T G T T T G A T G G T G G T 1' C C G A A A T C _1

Computer-generated result after bands migrate past detector

[295]

8.3 N u c l e i c Acid C h e m i stry

Nucleoside protected at 5' hydroxyl

Nucleotide activat.!d at 3' position

ucleoside attached to ilica support

Cyanoetbyl protecting group

H

Diisopropylamino activating group



0

®

H

Protecting group removed

®

1

R

Next nucleotide added (CH3 )2CH-N-CH(CH3 )2 H Diisopropylamine byproduct

H

0 1

R

0

Oxidation to form triester

Repeat steps ® to 8) until all residues are added

5'

@ Remove protecting groups from bases @ Remove cyanoethyl groups from phosphates (!) Cleave chain from silica support 3'

Oligonucleotide chain

� 0

FIGURE 8-35 Chemical synthesis of DNA by the phosphoramidite method. Automated DNA synthesis is conceptually similar to the syn­ thesis of polypeptides on a solid support. The oligonucleotide is built up

H

on the sol id support (silica), one nucleotide at a time, in a repeated se­ ries of chemical reactions with suitably protected nucleotide precursors.

CD The first

nucleoside (which w i l l be the 3 ' end) is attached to the

and the third position is occupied by a readily displaced diisopropyl­

si lica support at the 3 ' hydroxyl (through a l i nking group, R) and is pro­

amino group. Reaction with the i mmob i l ized nucleotide forms a 5 ' , 3 '

@, the

tected at the 5 ' hydroxyl with an acid-labile di methoxytrityl group

l i n kage, and the diisopropylamino group is eliminated. In step

(DMT). The reactive groups on a l l bases are also chemically protected.

phosphite l i n kage is oxidized with iodine to produce a phosphotriester

0 The protecting DMT group is removed by washing the column with

0) The next nucleotide has a reactive phospho­

acid (the DMT group is colored, so this reaction can be fol l owed spec­ trophotometrical ly).

l i n kage. Reactions

0 through @ are repeated until a l l nucleotides are ® and ® the rema i n i ng protecting groups on

added. At each step, excess nucleotide is removed before addition of the next nucleotide. In steps

0 the

ramidite at its 3' position: a trivalent phosphite (as opposed to the more

the bases and the phosphates are removed, and in

oxidized pentavalent phosphate normally present in nucleic acids) with

cleotide is separated from the solid support and purified. The chemical

ol igonu­

one l i n ked oxygen replaced by an amino group or substituted amine. In

synthesis of RNA is somewhat more compl icated because of the need to

the common variant shown, one of the phosphoramidite oxygens is

protect the 2' hydroxyl of ribose without adversely affecting the reactiv­

bonded to the deoxyribose, the other is protected by a cyanoethyl group,

ity of the 3 ' hydroxyl .

296 I � J '

N u c l e otides a n d N u c l e i c Acids

S U M M A RY 8 . 3 •







o-

Nucle i c A c i d C hem istry

Native DNA undergoes reversible unwinding and separation of strands (melting) on heating or at extremes of pH. DNAs rich in G C pairs have higher melting points than DNAs rich in A=T pairs .

oI

oI

0

0

"'

f3

y

1

II

II

II

- o -P-O -P- O -P-O -CH2 0

Denatured single-stranded DNAs from two species can form a hybrid duplex, the degree of hybridization depending on the extent of sequence similarity. Hybridization is the basis for important techniques used to study and isolate specific genes and RNAs.

OH NMP NDP

NTP

DNA is a relatively stable polymer. Spontaneous reactions such as deamination of certain bases, hydrolysis of base-sugar N-glycosyl bonds, radiation-induced formation of pyrimidine dimers, and oxidative damage occur at very low rates , yet are important because of a cell's very low tolerance for changes in genetic materiaL

Abbreviations of ribonucleoside 5 ' -phosphates

DNA sequences can be determined and DNA polymers synthesized with simple, automated protocols involving chemical and enzymatic methods.

Base

Mono-

Di-

Tri-

Adenine

AMP

ADP

ATP

Guanine

GMP

GDP

GTP

Cytosine

CMP

CDP

CTP

Uracil

UMP

UDP

UTP

Abbreviations of deoxyribonucleoside 5 '-phosphates

8.4 Other Fu n ctions of N ucleotides In addition to their roles as the subunits of nucleic acids, nucleotides have a variety of other functions in every cell: as energy carriers, components of enzyme cofac­ tors, and chemical messengers. Nucleotides Carry Chemical Energy in Cells

The phosphate group covalently linked at the 5' hydroxyl of a ribonucleotide may have one or two additional phosphates attached. The resulting mole­ cules are referred to as nucleoside mono-, di-, and triphosphates ( Fig. 8-:l{j ) . Starting from the ribose, the three phosphates are generally labeled a, {3, and y. Hydrolysis of nucleoside triphosphates provides the chemical energy to drive many cellular reactions. Adenosine 5' -triphosphate, ATP, is by far the most widely used for this purpose, but UTP, GTP, and CTP are also used in some reactions. Nucleoside triphosphates also serve as the activated precursors of DNA and RNA synthesis, as described in Chapters 25 and 26. The energy released by hydrolysis of ATP and the other nucleoside triphosphates is accounted for by the structure of the triphosphate group . The bond between the ribose and the a phosphate is an ester linkage. The a , {3 and {3,y linkages are phosphoanhydrides (Fig. 8-:3 7 ) . Hydrolysis of the ester linkage yields about 14 kJ/mol under standard conditions , whereas hydroly­ sis of each anhydride bond yields about 30 kJ/moL ATP hydrolysis often plays an important thermodynamic role in biosynthesis. When coupled to a reaction with a posi­ tive free-energy change , ATP hydrolysis shifts the equi­ librium of the overall process to favor product formation

OH

Base

Mono-

Di-

Tri-

Adenine

dAMP

dADP

dATP

Guanine

dGMP

dGDP

dGTP

Cytosine

dCMP

dCDP

dCTP

Thymine

dTMP

dTDP

dTTP

FIGURE 8-36 Nucleoside phosphates. General structure of the nucle­ oside 5 '-mono-, di-, and triphosphates (NMPs, N DPs, and NTPs) and their standard abbreviations. In the deoxyribonucleoside phosphates (dNMPs, dNDPs, and dNTPs), the pentose is 2 '-deoxy-D-ribose.

I

l o

I

o-

o-

II

II

I

Ester

II

-o-P- 0 -P-0 -P-0- CH2 01 0 10 _J Anhydride L_ Anhydride _ _

ATP

II

II

H 3 C -C-O-C-CH3 0

0

Acetic anhydride, a carboxylic acid anhydride

OH

OH

II

H3C -C-O -CH3 0 Methyl acetate, a carboxylic acid ester

FIGURE 8-37 The phosphate ester and phosphoanhydride bonds of ATP. Hydrolysis of an anhydride bond yields more energy than hy­ drolysis of the ester. A carboxylic acid anhydride and carboxylic acid ester are shown for comparison .

8.4

(recall the relationship between equilibrium constant and free-energy change described by Eqn 6-3 on p. 1 88) .

Enzyme Cofactors

A variety of enzyme cofactors serving a wide range of chemical functions include adenosine as part of their structure (Fig. 8-38). They are unrelated structurally except for the presence of adenosine. In none of these cofactors does the adenosine portion participate di­ rectly in the primary function, but removal of adenosine generally results in a drastic reduction of cofactor activ­ ities. For example, removal of the adenine nucleotide (3 ' -phosphoadenosine diphosphate) from acetoacetyl­ GoA, the coenzyme A derivative of acetoacetate, re­ duces its reactivity as a substrate for f3-ketoacyl-CoA

I

H I

H CHa I

I

_ _ _ _ _

,8-Mercaptoethylamine

H

Pantothenic acid

FIGURE 8-38 Some coenzymes containing adenosine. The adenosine portion is shaded in l ight red. Coenzyme A (CoA) functions in acyl group transfer reactions; the acyl group (such as the acetyl or ace­

Coenzyme A

0

Another coenzyme incorporating adenosine is 5 '-deoxyadenosylcobal­

HaC � N 0

amin, the active form of vitam in 81 2 (see Box 1 7-2), which participates in i ntramolecular group transfers between adjacent carbons.

0 II

0 -- CH2

I I I

O=P-O0



O

C i::9m N N J

Ha C id

I

H

H

OH OH

0= -o0-- CH2

O

NH2 N �N

All, then Render > Stereographic > Cross-eyed or Wall­ eyed. You will see two images of the DNA molecule. Sit with your nose approximately 1 0 inches from the monitor and fo­ cus on the tip of your nose (cross-eyed) or the opposite edges of the screen (wall-eyed ) . In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three-dimen­ sional. (Note that only one of the two authors can make this work.)

Data Analysis Problem 1 7 . Chargaff's Studies of DNA Structure The chapter section "DNA Is a Double Helix that Stores Genetic Informa­ tion" includes a summary of the main findings of Erwin Char­ gaff and his coworkers, listed as four conclusions ("Chargaff's rules"; p. 278) . In this problem, you will examine the data Chargaff collected in support of these conclusions. In one paper, Chargaff (1950) described his analytical methods and some early results. Briefly, he treated DNA

samples with acid to remove the bases, separated the bases by paper chromatography, and measured the amount of each base with UV spectroscopy. His results are shown in the three tables below. The molar ratio is the ratio of the number of moles of each base in the sample to the number of moles of phosphate in the sample-this gives the fraction of the total number of bases represented by each particular base. The recovery is the sum of all four bases (the sum of the molar ratios) ; full recovery of all bases in the DNA would give a recovery of 1 .0.

Molar ratios in ox DNA

Base Adenine Guanine Cytosine Thymine Recovery

Thymus

Spleen

Liver

Prep. 1 Prep. 2 Prep. 3

Prep. 1 Prep. 2

Prep. 1

0.26 0.21 0.16 0.25

0.88

0.28 0.24 0.18 0.24

0.88

0.84

0. 94

0. 94

0.26 0.20

0.26 0.21 0. 1 7 0.24

0.25 0.20 0.15 0.24

0.30 0.22 0. 1 7 0.25

Molar ratios in human DNA Sperm

Base Adenine Guanine Cytosine Thymine Recovery

Prep. 1 Prep. 2 0 .29 0 . 18 0.18 0.3 1

0.96

0.27 0.17 0.18 0.30

0.92

Thymus

Liver

Prep. 1

Normal Carcinoma

0.28 0.19 0.16 0.28

0.27 0.18 0.15 0.27

0.27 0.19

0.87

0. 91

Molar ratios in DNA of microorganisms Avian tubercle bacilli

Yeast Base Adenine Guanine Cytosine Thymine Recovery

Prep. 1

Prep. 2

Prep. 1

0.24 0. 14 0.13 0.25

0.30 0. 18 0.15 0.29

0.12 0.28 0.26 0.11

0. 76

0. 92

0. 77

(a) Based on these data, Chargaff concluded that "no dif­ ferences in composition have so far been found in DNA from different tissues of the same species." This corresponds to conclusion 2 in this chapter. However, a skeptic looking at the data above might say, "They certainly look different to me!" If you were Chargaff, how would you use the data to convince the skeptic to change her mind? (b) The base composition of DNA from normal and can­ cerous liver cells (hepatocarcinoma) was not distinguishably different. Would you expect Chargaff's technique to be capable of detecting a difference between the DNA of normal and can­ cerous cells? Explain your reasoning. As you might expect, Chargaff's data were not completely convincing. He went on to improve his techniques, as described

[3o2]

N u cleotides a n d N u cleic Acids

in a later paper (Chargaff, 195 1 ) , in which he reported molar

tetranucleotide polymer (AGCT)n and therefore not capable of

ratios of bases in DNA from a variety of organisms:

containing sequence information. Although the data presented above show that DNA cannot be simply a tetranucleotide-if so,

Source

A:G

Ox

T:C

A:T

G:C

Purine:pyrimidine

Salmon

1 .43 1 .04 1 . 00 1 . 56 1 . 75 1 .00 1 .0 0 1 .45 1 .29 1 .06 0.91 1 .43 1 .4 3 1 . 02 1 . 02

Wheat

1 .22

1 . 18

1 .00

0.97

0.99

Yeast

1 .67

1 .92

1 .03

1 .20

1 .0

1 .29

Hwnan Hen

1.1 1 .0 0.99 1 .02

Haemophilus injiuenzae type c

E. coli K- 1 2

Serratia marcescens Bacillus schatz

still possible that the DNA from different organisms was a slightly

more complex, but still monotonous, repeating sequence. To address this issue, Chargaff took DNA from wheat germ and treated it with the enzyme deoxyribonuclease for different time intervals. At each time interval, some of the DNA was converted to small fragments; the remaining, larger fragments he called the "core." In the table below, the " 1 9% core" corresponds to the larger fragments left behind when 8 1 % of the DNA was degraded; the "8% core" corresponds to

1 . 74

1 .54

1 . 07

0.91

1 .0

1 .05

0 .95

1 .09

0.99

1 .0

0.4

0.4

1 .09

1 .08

1.1

Adenine

0.27

0.33

0. 7

0.7

0.95

0.86

0.9

Guanine

0.22

0.20

0.20

0.7

0.6

1 .12

0.89

1 .0

Cytosine

0.22

0.14

Thymine

0.98

0.16 0.26

Avian tubercle bacillus

all samples would have molar ratios of 0.25 for each base-it was

(c) According to Chargaff, as stated in conclusion 1 in this

the larger fragments left after 92% degradation.

Base

Recovery

chapter, "The base composition of DNA generally varies from

Intact DNA

0.27

19%

Core

0.95

8%

Core

0 . 35

0.92 0.23

one species to another." Provide an argument, based on the data presented so far, that supports this conclusion. (d) According to conclusion 4, "In all cellular DNAs, re­ gardless of the species . . . A + G

=

T + C . " Provide an argu­

ment, based on the data presented so far, that supports this conclusion. Part of Chargaffs intent was to disprove the "tetranucleotide hypothesis"; this was the idea that DNA was a monotonous

(e) How would you use these data to argue that wheat germ DNA is not a monotonous repeating sequence? References Chargaff, E. (1950) Chemical specificity of nucleic acids and mecha­ nism of their enzymic degradation. Experientia 6, 201-209. Chargaff, E. (1951) Structure and function of nucleic acids as cell

constituents. Fed Proc. 10, 654-659.

Of a l l the natura l systems, l iving matter is the one which, in the face of great transformations, p reserves i nscribed i n its

o rga n i zati o n the

largest amount of its own past h i story. -Emile Zuckerkandl and L inus Pauling

article in journal of Theoreti cal B iology, 7 965

DNA-Based I nformation Technologies 9.1

9.2 9.3

9.4

DNA Cloning: The Basics

From Genes to Genomes

3 04

315

From Genomes to Proteomes

324

Genome Alteration s and New Products of Biotech nology

330

e now turn t o a technology that is fundamental to the advance of modern biological sciences, defining present and future biochemical fron­ tiers and illustrating many important principles of bio­ chemistry. Elucidation of the laws governing enzymatic catalysis , macromolecular structure, cellular metabo­ lism, and information pathways allows research to be di­ rected at increasingly complex biochemical processes. Cell division, immunity, embryogenesis, vision, taste, oncogenesis , cognition-all are orchestrated in an elab­ orate symphony of molecular and macromolecular interactions that we are now beginning to understand with increasing clarity. The real implications of the bio­ chemical j ourney begun in the nineteenth century are found in the ever-increasing power to ana­ lyze and alter living systems. To understand a complex biological process, a biochemist isolates and studies the individual components in vitro, then pieces together the parts to get a coherent picture of the overall process. A major source of molecular insights is the cell's own information archive , its DNA. The sheer size of chromosomes, however, pre­ sents an enormous challenge: how does one Pau l Berg find and study a particular gene among the

tens of thousands of genes nested in the billions of base pairs of a mammalian genome? Solutions began to emerge in the 1970s. Decades of advances by thousands of scientists working in genetics , biochemistry, cell biology, and physical chemistry came together in the laboratories of Paul Berg, Herbert Boyer, and Stanley Cohen to yield techniques for locating, isolating, preparing, and studying small segments of DNA derived from much larger chromosomes. Techniques for DNA cloning . paved the way to the m9dern fields of genomics and' proteomics, the study of genes and proteins on the scale of whole cells and organisms. These new methods are transforming basic research, agriculture, medicine, ecology, forensics, and many other fields, while occa­ sionally presenting society with difficult choices and ethical dilemmas. We begin this chapter with an outline of the funda­ mental biochemical principles of the now-classic disci­ pline of DNA cloning. Next, we illustrate the range of applications and the potential of a range of newer tech­ nologies, with a broad emphasis on modern advances in genomics and proteomics .

Herbert Boyer

Stanley N. Cohen

i

303

J

l 3 04J

D N A-Ba sed I nfo rmation Te chnologies

9.1 DNA Cloning: The Basics A clone is an identical copy. This term originally applied to cells of a single type, isolated and allowed to repro­ duce to create a population of identical cells. DNA cloning involves separating a specific gene or DNA seg­ ment from a larger chromosome, attaching it to a small molecule of carrier DNA, and then replicating this mod­ ified DNA thousands or millions of times through both an increase in host cell number and the creation of mul­ tiple copies of the cloned DNA in each cell. The result is selective amplification of a particular gene or DNA seg­ ment. Cloning of DNA from any organism entails five general procedures: 1.

Cutting DNA at precise locations. Sequence­ specific endonucleases (restriction endonucleases) provide the necessary molecular scissors.

2. Selecting a small molecule of DNA capable of self-replication. These DNAs are called cloning vectors (a vector is a delivery agent) . They are typically plasmids or viral DNAs. 3. Joining two DNA fragments covalently. The enzyme DNA ligase links the cloning vector and DNA to be cloned. Composite DNA molecules comprising covalently linked segments from two or more sources are called recombinant DNAs. 4.

Moving recombinant DNA from the test tube to a host cell that will provide the enzymatic machinery for DNA replication.

5.

Selecting or identifying host cells that contain recombinant DNA .

The methods used to accomplish these and related tasks are collectively referred to as recombinant DNA tech­ nology or, more informally, genetic engineering. Much of our initial discussion will focus on DNA cloning in the bacterium Escherichia coli, the first or­ ganism used for recombinant DNA work and still the most common host cell. E. coli has many advantages: its DNA metabolism (like many other of its biochemical processes) is well understood; many naturally occurring cloning vectors associated with E. coli, such as plasmids and bacteriophages (bacterial viruses; also called phages) , are well characterized; and techniques are available for moving DNA expeditiously from one bacte­ rial cell to another. The principles discussed here are broadly applicable to DNA cloning in other organisms, a topic discussed more fully later in the chapter. Restriction Endonucleases and DNA ligase Yield Recombinant DNA

Particularly important to recombinant DNA technology is a set of enzymes (Table 9-1 ) made available through decades of research on nucleic acid metabolism. Two classes of enzymes lie at the heart of the classic approach to generating and propagating a recombinant DNA mole­ cule (Fig. 9-1 ) . First, restriction endonucleases

Cloning vector (plasmid)

©

!

G) Cloning vector is cleaved wilh restriction endonuclea e.

� 1®

Eukaryotic chromosome

DNA fragment of interest is obtained by cleaving chromosome with a restriction endonuclease.

are ligated J.;' ) @ Fragments the prepared cloning .-.

1"·"•"' '� '

to

vector.

H Recombinant � vector

1@

l@

DNA is introduced. into the host cell.

Propagation cloning produces many copies of recombinant DNA.

FIGURE 9-1 Schematic illustration of DNA cloning. A cloning vector and eukaryotic chromosomes are separately cleaved with the same re­ striction endonuclease. The fragments to be cloned are then l igated to the cloning vector. The resulting recombinant DNA (only one recom­ binant vector is shown here) is i ntroduced i nto a host cell where it can be propagated (cloned). Note that this drawing is not to scale: the size

of the E. coli chromosome relative to that of a typical cloning vector (such as a plasmid) is much greater than depicted here.

(also called restriction enzymes) recognize and cleave DNA at specific sequences (recognition sequences or re­ striction sites) to generate a set of smaller fragments. Second, the DNA fragment to be cloned is joined to a suitable cloning vector by using DNA ligases to link the DNA molecules together. The recombinant vector is then introduced into a host cell, which amplifies the fragment in the course of many generations of cell division. Restriction endonucleases are found in a wide range of bacterial species. Werner Arber discovered in the early 1 960s that their biological function is to recognize and cleave foreign DNA (the DNA of an infecting virus,

9 . 1 D N A Cloning: The B a s ics

TA B L E 9-1

Enzyme(s)

[3os]

Some Enzymes Used in Recombinant DNA Tecbnolagy

--� ------------------�

Function

Type II restriction endonucleases

Cleave DNAs at specific base sequences

DNA ligase

Joins two DNA molecules or fragments

DNA polymerase I (E. coli)

Fills gaps in duplexes by stepwise addition of nucleotides to 3' ends

Reverse transcriptase

Makes a DNA copy of an RNA molecule

Polynucleotide kinase

Adds a phosphate to the 5' -OH end of a polynucleotide to label it or permit ligation

Terminal transferase

Adds homopolymer tails to the 3' OH ends of a linear duplex

Exonuclease III

Removes nucleotide residues from the 3' ends of a DNA strand

Bacteriophage A exonuclease

Removes nucleotides from the 5' ends of a duplex to expose single-stranded 3' ends

-

Alkaline phosphatase

Removes terminal phosphates from either the 5' or 3' end (or both)

for example) ; such DNA is said to be restricted. In the host cell's DNA, the sequence that would be recognized by its own restriction endonuclease is protected from di­ gestion by methylation of the DNA, catalyzed by a spe­ cific DNA methylase. The restriction endonuclease and the corresponding methylase are sometimes referred to as a restriction-modification system. There are three types of restriction endonucleases, designated I, II, and III. Types I and III are generally large, multisubunit complexes containing both the en­ donuclease and methylase activities. Type I restriction endonucleases cleave DNA at random sites that can be more than 1 ,000 base pairs (bp) from the recognition sequence. Type III restriction endonucleases cleave the DNA about 25 bp from the recognition sequence. Both TA B L E 9-2 BamHJ

Clal

types move along the DNA in a reaction that requires the energy of ATP. Type II restriction endonucleases, first isolated by Hamilton Smith in 1 970, are simpler, re­ quire no ATP, and cleave the DNA within the recognition sequence itself. The extraordinary utility of this group of restriction endonucleases was demonstrated by Daniel Nathans, who first used them to develop novel methods for mapping and analyzing genes and genomes. Thousands of restriction endonucleases have been discovered in different bacterial species, and more than 1 00 different DNA sequences are recognized by one or more of these enzymes. The recognition sequences are usually 4 to 6 bp long and palindromic (see Fig. 8-1 8) . Table 9-2 lists sequences recognized by a few type II restriction endonucleases.

Recognition Sequences for Some Type II Restriction Endonudeases t

*

(5') G G A T C C (3') CCTAGG

*

t

*

i

(5') A T C G A T (3') TAGCTA

*

i

t *

EcoRI

(5') G A A T T C (3') CTTAAG

EcoRV

(5') G A T A T C (3 ') CTATAG

Haem

(5') G G C C (3') CCGG

*

t

t*

*t

i

i

t

HindIII

(5') A A G C T T (3') TTCGAA

NotI

(5') G C G G C C G C (3 ') CGCCGGCG

Pstl

(5') C T G C A G (3 ') GACGTC

Pvuii

(5') C A G C T G (3') GTCGAC

Tth l l l l

(5') G A C N N N G T C (3 ') CTGNNNCAG

i

t

* t

i

*

t

i

Arrows indicate the phosphodiester bonds cleaved by each restriction endonuclease. Asterisks indicate bases that are methylated by the corresponding methylase (where known). N denotes any base. Note that the name of each enzyme consists of a three-letter abbreviation (in italics) of the bacterial species from which it is derived, sometimes followed by a strain designation and Roman numerals to distinguish different restriction endonucleases isolated from the same bacterial species. Thus BamHI is the first (I) restriction endonuclease characterized from Bacillus amyloliquefaciens, strain H.

i

t

i

l_ 3 06]

D N A- Based I n fo rmation Tec h n o l o g ies

Some restriction endonucleases make staggered cuts on the two DNA strands, leaving two to four nu­ cleotides of one strand unpaired at each resulting end. These unpaired strands are referred to as sticky ends ( Fig. 9-2 a) , because they can base-pair with each other or with complementary sticky ends of other DNA fragments. Other restriction endonucleases cleave both strands of DNA at the opposing phosphodiester bonds, leaving no unpaired bases on the ends, often called blunt ends (Fig. 9-2b) . The average size of the DNA fragments produced by cleaving genomic DNA with a restriction endonuclease depends on the frequency with which a particular re­ striction site occurs in the DNA molecule; this in turn depends largely on the size of the recognition sequence. Recognition

Cleavage site

_· L _

/ sequences _/

In a DNA molecule with a random sequence in which all four nucleotides were equally abundant, a 6 bp se­ quence recognized by a restriction endonuclease such as BamHI would occur on average once every 46 (4,096) bp, assuming the DNA had a 50% G=C content. En­ zymes that recognize a 4 bp sequence would produce smaller DNA fragments from a random-sequence DNA molecule; a recognition sequence of this size would be 4 expected to occur about once every 4 (256) bp. In nat­ ural DNA molecules, particular recognition sequences tend to occur less frequently than this because nu­ cleotide sequences in DNA are not random and the four nucleotides are not equally abundant. In laboratory ex­ periments, the average size of the fragments produced by restriction endonuclease cleavage of a large DNA Cleavage site

+

Chromosomal - - - G G T' G � b-.J'_T_C . A G C T T C G C A T T A G C A G : C T G T A G C - - DNA

1

j

1 i

- - - C C A � T T A A;QJ T C G A A G C G T A A T C G T C I G A C , A T C G - - -

- - - G G T Gi - - - C C A -iC T T A� A·

1.-( •;-; ( l�l('lJiJJl l'lHionuvk;L-.:l J-" -, 1 ' 1

�T T C J A G C T T C G C A T T A G C A G m r c G A A G C G T AA T C G T C

1'1"1/ "

!"('�[!'!!. JU!)

-.. exonuclease and terminal trans­ ferase (Table 9-1) . The fragments to be joined were given complementary homopolymeric tails. Peter Lobban and Dale Kaiser used this method in 1971 in the first ex­ periments to join naturally occurring DNA fragments. Similar methods were used soon after in the laboratory of Paul Berg to join DNA segments from simian virus 40 (SV40) to DNA derived from bacteriophage >-.. , thereby creating the first recombinant DNA molecule with DNA segments from different species.

[3o7]

Plasmids Plasmids are circular DNA molecules that replicate separately from the host chromosome. Natu­ rally occurring bacterial plasmids range in size from 5,000 to 400,000 bp. They can be introduced into bacte­ rial cells by a process called transformation. The cells (generally E. coli) and plasmid DNA are incubated to­ gether at 0 oc in a calcium chloride solution, then sub­ jected to a shock by rapidly shifting the temperature to 37 to 43 °C. For reasons not well understood, some of the cells treated in this way take up the plasmid DNA. Some species of bacteria, such as Acinetobacter baylyi, are naturally competent for DNA uptake and do not re­ quire the calcium chloride treatment. In an alternative method, cells incubated with the plasmid DNA are sub­ j ected to a high-voltage pulse. This approach, called electroporation, transiently renders the bacterial membrane permeable to large molecules. Regardless of the approach, few cells actually take up the plasmid DNA, so a method is needed to select those that do. The usual strategy is to use a plasmid that includes a gene that the host cell requires for growth under specific conditions, such as a gene that confers resistance to an antibiotic. Only cells transformed by the recombinant plasmid can grow in the presence of that antibiotic, making any cell that contains the plasmid "selectable" under those growth conditions. Such a gene is called a selectable marker. Investigators have developed many different plas­ mid vectors suitable for cloning by modifying naturally occurring plasmids . The now classic E. coli plasmid pBR322 offers a good example of the features useful in a cloning vector (Fig. 9-3 ) .

EcoRI H1

Tetracycline resistance (tetR) pBR322

(4,36lbp)

Cloning Vectors Al low Amplification of Inserted DNA Segments

The principles that govern the delivery of recombinant DNA in clonable form to a host cell, and its subsequent amplification in the host, are well illustrated by consid­ ering three popular cloning vectors commonly used in experiments with E. coli-plasmids, bacteriophages, and bacterial artificial chromosomes-and a vector used to clone large DNA segments in yeast.

Origin of replication

(ori)

Puuii

FIGURE 9-3 The constructed E. coli plasmid pBR322. Note the location of some i mportant restriction s ites-for Psti, EcoRI, BamHI,

Sail, and Pvui i; ampicil l i n- and tetracycl i ne-resistance genes; and the

repl ication origin (ori). Constructed in 1 977, this was one of the early

plasm ids designed expressly for cloning in £. coli.

[3 os]

D N A - Based I n fo rmation Tec h n o l ogies

U

Q

Important pBR322 features include: amp

o 6''0 °

1 �o c

Q)

pBR322 i cleaved at the ampicillin­ resistance element by Pst l .

®

')

V

Foreign DNA is ligated to cleaved pBR322. Where ligatwn is successful, the ampicillin-resistance element is disrupted. The tetracycline-resistance element remains intact.

oro o

®

1 . An origin of replication, ori, a sequence where replication is initiated by cellular enzymes (Chapter 25) . This sequence is required to propagate the plasmid and maintain it at a level of 1 0 to 20 copies per cell.

pBR322 plasmid

R

I' I , t n n. nd I O U Jt.:u I

n

:



Fo ign D A

ll ,\ l .

og 1

cells are transformed, then transformation grown on agar plates containing of E. coli cells tetracycline to select for those that have taken up plasmid. Ho t D Au--""=--

E. coli

1 @

selection

of

All colonies have plasmids

Agar containing tetracycline (control)

3.

Several unique recognition sequences (Pstl, EcoRI, BamHI, Sall, Pvull) that are targets for different restriction endonucleases, providing sites where the plasmid can later be cut to insert foreign DNA.

4.

Small size (4,361 bp) , which facilitates entry of the plasmid into cells and the biochemical manipulation of the DNA.

Transformation of typical bacterial cells with purified DNA (never a very efficient process) becomes less suc­ cessful as plasmid size increases, and it is difficult to clone DNA segments longer than about 1 5 ,000 bp when plasmids are used as the vector. Bacteriophages Bacteriophage A. has a very efficient mechanism for delivering its 48,502 bp of DNA into a bacterium, and it can be used as a vector to clone some­ what larger DNA segments (Fig. 9-5 ) . Two key fea­ tures contribute to its utility: 1.

2.

Agar containing tetracycline

Agar containing ampicillin + tetracycline

Cells that grow on tetracycline but not on tetracycline + ampicillin contain recombinant plasmids with disrupted ampicillin resistance, hence the foreign DNA. Cells with pBR322 without foreign DNA retain ampicillin resistance and grow on both plates. F I G U RE 9-4 Use of pBR322 to clone foreign DNA in f. coli and

identify cells containing it.

Two genes that confer resistance to different antibiotics (tetR , ampR) , allowing the identification of cells that contain the intact plasmid or a recombinant version of the plasmid (Fig. 9-4) .

transformed cells

Individual colonies are transferred to matching positions on additional plates. One plate contains tetracycline, the other tetracycline and ampicillin. Colonies with recombinant plasmids

®

2.

Plasmid Cloning

About one-third of the A. genome is nonessential and can be replaced with foreign DNA. DNA is packaged into infectious phage particles only if it is between 40,000 and 53,000 bp long, a constraint that can be used to ensure packaging of recombinant DNA only.

Researchers have developed bacteriophage A. vec­ tors that can be readily cleaved into three pieces, two of which contain essential genes but which together are only about 30,000 bp long. The third piece , "filler" DNA, is discarded when the vector is to be used for cloning, and additional DNA is inserted between the two essential segments to generate ligated DNA mole­ cules long enough to produce viable phage particles. In effect, the packaging mechanism selects for recombi­ nant viral DNAs . Bacteriophage A. vectors permit the cloning of DNA fragments of up to 23,000 bp. Once the bacteriophage A. fragments are ligated to foreign DNA fragments of suit­ able size , the resulting recombinant DNAs can be pack­ aged into phage particles by adding them to crude bacterial cell extracts that contain all the proteins needed to assemble a complete phage. This is called in vitro packaging (Fig. 9-5) . All viable phage particles will contain a foreign DNA fragment. The subsequent transmission of the recombinant DNA into E. coli cells is highly efficient.

9 . 1 D N A C l o n i n g : The Basics

re�tnt·tion

endnnnclell5e

Filler DNA (not needed

§§�§�§=�� �� �oreign D�A ! � fragments

DN.\ liga-

Lack essential DNA and/or are too small to be packaged

Recombinant DNAs

[3o9]

Bacterial Artificial Chromosomes (BACs) Bacte­ rial artificial chromosomes are simply plasmids designed for the cloning of very long segments (typically 1 00,000 to 300,000 bp) of DNA (Fig. 9-6) . They generally in­ clude selectable markers such as resistance to the an­ tibiotic chloramphenicol (CmR) , as well as a very stable origin of replication (ori) that maintains the plasmid at one or two copies per cell. DNA fragments of several hundred thousand base pairs are cloned into the BAC vector. The large circular DNAs are then introduced into host bacteria by electroporation. These procedures use host bacteria with mutations that compromise the struc­ ture of their cell wall, permitting the uptake of the large DNA molecules.

Cloning sites (include lacZ)

1



F plasmid

par genes

in vitro

�A. ]"

packaging n• rru:t10n

bacteriophage oontaining foreign DNA

,

cntlntlU ll'a�c

,

J

Large foreign DNA fragment with appropriate sticky enrls

FIGURE 9-5 Bacteriophage cloning vectors. Recomb i nant DNA meth­

ods are used to modify the bacteriophage r.. genome, removing the

ll!":\ !J!!a�t!

genes not needed for phage production and replacing them with

"filler" DNA to make the phage DNA large enough for packaging into phage particles. As shown here, the fil ler is replaced with foreign D NA i n clon i ng experiments. Recombi nants are packaged into viable phage particles in vitro only if they incl ude an appropriately sized foreign DNA fragment as wel l as both of the essential r.. DNA end fragments.

FIGURE 9-6 Bacterial artificial chromosomes (BACs) as cloning vectors. The vector is a relatively simple plasmid, with a repl ication ori­ gin (ori) that di rects replication. The par genes, derived from a type of

r

electroporation

plasmid cal led an F plasmid, assist i n the even distribution of plasm ids to daughter cel ls at cell division. This increases the l i kelihood of each daughter cel l carrying one copy of the plasmid, even when few copies are present. The low number of copies is useful in cloning l arge seg­ ments of DNA because it l imits the opportunities for unwanted recom­ bi nation reactions that can unpredictably alter large cloned DNAs over time. The BAC includes selectable markers. A JacZ gene (required for the production of the enzyme j3-galactosidase) is situated i n the cloning region such that it is inactivated by cloned DNA inserts. I ntroduction of recombinant BACs into cel ls by electroporation is promoted by the use of cells with an altered (more porous) cel l wal l . Recombinant DNAs are screened for resistance to the antibiotic chloramphenicol (Cm R). Plates

selection of

chloramphenicol-

resi tant ce\il:l

1

Agar containing chloramphenicol and substrate for ,a-galactosidase

-:::=:z ::: S

also contain a substrate for J3-galactosidase that yields a colored prod­ uct. Colonies with active J3-galactosidase and hence no DNA insert i n the BAC vector turn bl ue; colonies without f:l-galactosidase activity­ and thus with the desired DNA i nserts-are white.

Colonies with recombinant BACs are white.

' 310

D N A-Based I n formation Tec h n o l o g ies

Yeast Artificial Chromosomes (YACs) E. coli cells are by no means the only hosts for genetic engineering. Yeasts are particularly convenient eukaryotic organisms for this work. As with E. coli, yeast genetics is a well­ developed discipline. The genome of the most com­ monly used yeast, Saccharomyces cerevisiae, contains only 1 4 X 1 06 bp (a simple genome by eukaryotic standards, less than four times the size of the E. coli chromosome) , and its entire sequence is known. Yeast is also very easy to maintain and grow on a large scale in the laboratory. Plasmid vectors have been constructed for yeast, employing the same principles that govern the use of E. coli vectors described above . Convenient methods are now available for moving DNA into and out of yeast cells, facilitating the study of many aspects of eukaryotic cell biochemistry. Some recombinant plas­ mids incorporate multiple replication origins and other elements that allow them to be used in more than one species (for example, yeast or E. coli) . Plasmids that can be propagated in cells of two or more different species are called shuttle vectors. Research with large genomes and the associated need for high-capacity cloning vectors led to the devel­ opment of yeast artificial chromosomes (YACS; Fig. 9- 7) . YAC vectors contain all the elements needed to maintain a eukaryotic chromosome in the yeast nu­ cleus: a yeast origin of replication, two selectable mark­ ers, and specialized sequences (derived from the telomeres and centromere, regions of the chromosome discussed in Chapter 24) needed for stability and proper segregation of the chromosomes at cell division. Before being used in cloning, the vector is propagated as a cir­ cular bacterial plasmid. Cleavage with a restriction en­ donuclease (BamHI in Fig. 9-7) removes a length of DNA between two telomere sequences (TEL) , leaving the telomeres at the ends of the linearized DNA. Cleav­ age at another internal site (EcoRI in Fig. 9-7) divides the vector into two DNA segments, referred to as vector arms, each with a different selectable marker. The genomic DNA is prepared by partial digestion with restriction endonucleases (EcoRI in Fig. 9-7) to ob­ tain a suitable fragment size. Genomic fragments are then separated by pulsed field gel electrophoresis, a varia­ tion of gel electrophoresis (see Fig. 3-18) that allows the separation of very large DNA segments. The DNA fragments of appropriate size (up to about 2 x 1 06 bp) are mixed with the prepared vector arms and ligated. The ligation mixture is then used to transform treated yeast cells with very large DNA molecules. Culture on a medium that requires the presence of both selectable marker genes ensures the growth of only those yeast cells that contain an artificial chromosome with a large insert sandwiched between the two vector arms (Fig. 9-7) . The stability of YAC clones increases with size (up to a point) . Those with inserts of more than 1 50,000 bp are nearly as stable as normal cellular chromosomes, whereas those with inserts of less than 1 00,000 bp are gradually lost dur­ ing mitosis (so generally there are no yeast cell clones

BamHI digestion creates linear chromosome with telomeric ends EcoRl

TEL

Y

X

Left arm has selectable marker X

TEL

?,:;��· �-j[:)

V' ;



1

,

n ..r "-' 2 tu ., ...,.. (, "'

Right arm has selectable marker Y

C: J '" Fragments of genomic

Ligate

DNA generated by light digestion with EcoRI

YAC

Enzymatic cligestion of cell wall

Transform

Select for

X and Y -·--·�

Yeast spheroplast

Yeast cell

Yeast with YAC clone

FIGURE 9-7 Construction of a yeast artificial chromosome (YAC). A YAC vector includes an origin of repl ication (ori), a centromere (CEN),

two telomeres (TEL), and selectable markers (X and Y). Digestion with

Bam H I and fcoR I generates two separate DNA arms, each with a

telomeric end and one selectable marker. A large segment of DNA (e.g., up to 2

x

1 06 bp from the h u man genome) i s ligated to the two

arms to create a yeast artificial chromosome. The YAC transforms yeast cel l s (prepared by removal of the cel l wal l to form spheroplasts), and

the cells are selected for X and Y; the surviving cells propagate the DNA i nsert.

carrying only the two vector ends ligated together or with only short inserts) . YACs that lack a telomere at either end are rapidly degraded. Specific DNA Sequences Are Detectable by Hybridization

DNA hybridization, a process outlined in Chapter 8 (see Fig. 8-29) , is the most common sequence-based process for detecting a particular gene or segment of nucleic acid. There are many variations of the basic method, most making use of a labeled (such as radioactive) DNA

9 . 1 D N A Cloning: The Bas ics

Agar plate with transformed bacterial colonies

-----

[31 1j

or RNA fragment, known as a probe, complementary to the DNA being sought. In one classic approach to detect a particular DNA sequence within a DNA library (a col­ lection of DNA clones) , nitrocellulose paper is pressed onto an agar plate containing many individual bacterial colonies from the library, each colony with a different recombinant DNA. Some cells from each colony adhere to the paper, forming a replica of the plate. The paper is treated with alkali to disrupt the cells and denature the DNA within, which remains bound to the region of the paper around the colony from which it came . Added ra­ dioactive DNA probe anneals only to its complementary DNA. After any unannealed probe DNA is washed away, the hybridized DNA can be detected by autoradiography (Fig. 9-8 ) . A common limiting step in detecting and cloning a gene is the generation of a complementary strand of nucleic acid to use as a probe. The origin of a probe de­ pends on what is known about the gene under investiga­ tion. Sometimes a homologous gene cloned from another species makes a suitable probe . Or, if the pro­ tein product of a gene has been purified, probes can be designed and synthesized by working backward from the amino acid sequence, deducing the DNA sequence that would code for it (Fig. 9-9) . Now, researchers typ­ ically obtain the necessary DNA sequence information from sequence databases that detail the structure of millions of genes from a wide range of organisms .

Press nitrocellulose paper onto the agar plate. Some cells from each colony stick to the paper.

Nitrocellulose paper

DNA bound to paper

Radiolabeled DNA probe Incubate the paper with the radiolabeled probe, then wash. ....,._ . �--\-- Probe annealed to

FIGURE 9-9 Probe to detect the gene for a protein of known amino acid sequence. Because more than one DNA sequence can code for

colonies of interest \

any given amino acid sequence, the genetic code is said to be "degen­ erate." (As described in Chapter 27, an amino acid is coded for by a set of three nucleotides called a codon. Most a m i no acids have two or

Expose

more codons; see Fig. 2 7-7.) Thus the correct DNA sequence for a known amino acid sequence cannot be known in advance. The probe

x-ray film to paper.

is designed to be complementary to a region of the gene with m i n i ma l degeneracy, that is, a region with the fewest possible codons for the amino acids-two codons at most in the example shown here. Ol igonucleotides are synthesized with

selectively randomized

FIGURE 9-8 Use of hybridization to identify a clone with a particular

sequences, so that they conta i n either of the two possible nucleotides

DNA segment. The radioactive DNA probe hybridizes to complemen­

at each position of potential degeneracy (shaded in p i n k). The ol igonu­

tary DNA and is revealed by autoradiography. Once the labeled

cleotide shown here represents a mixture of eight different sequences:

colonies have been identified, the corresponding colonies on the orig­

one of the eight w i l l complement the gene perfectly, and a l l eight w i l l

inal agar plate can be used as a source of cloned DNA for further study.

match a t least 1 7 o f the 2 0 positions.

Known amino acid sequence H3N - - - Gly - Leu - Pro - Trp - Glu - Asp - Met - Trp - Phe - Val - Arg - - - coo+

Possible codons

(5') G G A U U A C C A : u G G G A A G A C A U G U G G U U C U UU GGC UUG C C C : GAG GAU GGU CUA C C U 1 G G G C UC C C G i C UU

Region of minimal degeneracy

C UG

Synthetic probes

G U:A G u:c G UIU G U:G

U

C C G G GAA G G A UA U G U G G U U U. G U 20 nucleotides long, 8 possible sequences

A G A C3') AGG C GA CGC CGU CGG

[3 1 2]

D N A-Based I nfo rmation Tech n o l o g i e s

Bacterial promoter (P) and operator (0) sequences

Expression of Cloned Genes Produces large Quantities of Protein

Frequently it is the product of the cloned gene, rather than the gene itself, that is of primary interest­ particularly when the protein has commercial, therapeu­ tic, or research value. With an increased understanding of the fundamentals of DNA, RNA, and protein metabo­ lism and their regulation in E. coli, investigators can now manipulate cells to express cloned genes in order to study their protein products. Most eukaryotic genes lack the DNA sequence elements-such as promoters, sequences that instruct RNA polymerase where to bind-required for their expression in E. coli cells, so bacterial regulatory se­ quences for transcription and translation must be in­ serted at appropriate positions relative to the eukaryotic gene in the vector DNA. (Promoters, regulatory se­ quences, and other aspects of the regulation of gene ex­ pression are discussed in Chapter 28.) In some cases cloned genes are so efficiently expressed that their protein product represents 1 0% or more of the cellular protein; they are said to be overexpressed. At these con­ centrations some foreign proteins can kill an E. coli cell, so gene expression must be limited to the few hours be­ fore the planned harvest of the cells. Cloning vectors with the transcription and transla­ tion signals needed for the regulated expression of a cloned gene are often called expression vectors. The rate of expression of the cloned gene is controlled by re­ placing the gene's own promoter and regulatory se­ quences with more efficient and convenient versions supplied by the vector. Generally, a well-characterized promoter and its regulatory elements are positioned near several unique restriction sites for cloning, so that genes inserted at the restriction sites will be expressed from the regulated promoter element ( Fig. 9-1 0 ). Some of these vectors incorporate other features, such as a bacterial ribosome binding site to enhance transla­ tion of the mRNA derived from the gene, or a transcrip­ tion termination sequence. Genes can similarly be cloned and expressed in eu­ karyotic cells, with various species of yeast as the usual hosts. A eukaryotic host can sometimes promote post­ translational modifications (changes in protein structure made after synthesis on the ribosomes) that might be re­ quired for the function of a cloned eukaryotic protein. Alterations i n Cloned Genes Produce Modified Proteins

Cloning techniques can be used not only to overproduce proteins but to produce protein products subtly altered from their native forms. Specific amino acids may be re­ placed individually by site-directed mutagenesis. This powerful approach to studying protein structure and function changes the amino acid sequence of a pro­ tein by altering the DNA sequence of the cloned gene. If appropriate restriction sites flank the sequence to be

Gene encoding repressor that binds 0 and regulates P

Polylinker with unique sites for several restriction / endonucleases (i.e., cloning sites)

,(� � ,(

Transcription termination sequence

ori

Selectable genetic marker (e.g., antibiotic resistance) FIGURE 9-10 DNA sequences in a typical f. coli expression vector.

The gene to be expressed is inserted i nto one of the restriction sites i n the polyl i nker, near the promoter (P), with the end encod i n g the amino terminus proxi m a l to the promoter. The promoter a l lows efficient transcription of the inserted gene, and the transcription termination se­ quence sometimes i mproves the amount and stabil ity of the mRNA produced. The operator (0) permits regulation by means of a repressor that binds to it (Chapter 28). The ribosome binding site provides se­ quence signals needed for efficient translation of the mRNA derived from the gene. The selectable marker allows the selection of cel l s con­ tain ing the recombi nant DNA.

altered, researchers can simply remove a DNA segment and replace it with a synthetic one that is identical to the original except for the desired change (Fig. 9-l l a). When suitably located restriction sites are not present, an approach called oligonucleotide-directed muta­ genesis (Fig. 9-l lb) can create a specific DNA se­ quence change. A short synthetic DNA strand with a specific base change is annealed to a single-stranded copy of the cloned gene within a suitable vector. The mismatch of a single base pair in 1 5 to 20 bp does not prevent annealing if it is done at an appropriate temper­ ature. The annealed strand serves as a primer for the synthesis of a strand complementary to the plasmid vec­ tor. This slightly mismatched duplex recombinant plas­ mid is then used to transform bacteria, where the mismatch is repaired by cellular DNA repair enzymes (Chapter 25) . About half of the repair events will re­ move and replace the altered base and restore the gene to its original sequence; the other half will remove and replace the normal base, retaining the desired muta­ tion. Transformants are screened (often by sequencing their plasmid DNA) until a bacterial colony containing a plasmid with the altered sequence is found. Changes can also be introduced that involve more than one base pair. Large parts of a gene can be deleted by cutting out a segment with restriction endonucleases

9 . 1 D N A Clon i n g : The Basics

� �

Recombinant DNA

plasmid

o

Ge n

Single strand of recombinant smid DNA Ge"'

h

ligonucleotid �V ith sequence hru1g

ynthetic DNA fragment with specific base-

() �

pair change

lJ!\ •. 1 •l.1 111rr dNTP , I>'JA 11

DNA liga.;e



Plasmid contains gen with desired base pair change. -

(a)

In E . coli cells, about half the plasmids will have gene with desired base-pair change. (b) FIGURE 9-1 1 Two approaches to site-directed mutagenesis. (a) A syn­ thetic DNA segment replaces a DNA fragment that has been removed by cleavage with a restriction endonuclease. (b) A synthetic ol igonu­ cleotide with a desi red sequence change at one position is hybridized to a single-stranded copy of the gene to be altered. This acts as primer

duction of the altered DNA into the cell permits investi­ gation of the consequences of the alteration. Site­ directed mutagenesis has greatly facilitated research on proteins by allowing investigators to make specific changes in the primary structure of a protein and to ex­ amine the effects of these changes on the folding, three­ dimensional structure, and activity of the protein. Terminal Tags Provide Binding Sites for Affinity Purification

Affinity chromatography is one of the most efficient meth­ ods available for protein purification (see Fig. 3-1 7c) . Unfortunately, there are many proteins for which there is no known ligand that can be conveniently immobilized on a chromatographic medium. The use of fusion pro­ teins has made it possible to purify almost any protein by affinity chromatography. First, the gene encoding the target protein is fused to a gene encoding a peptide or protein that binds to a known ligand with high affinity and specificity. The pep­ tide or protein used for this purpose, which may be at­ tached at either the amino or carboxyl terminus, is called a terminal tag or (more often) simply a tag. Some proteins and peptides commonly used as tags are listed in Table 9-3 along with their ligands. The general procedure is illustrated by the attach­ ment of a tag consisting of glutathione-S-transferase (GST) . GST is a small enzyme CMr 26,000) that binds tightly and specifically to the molecule glutathione (Fig 9-1 2 ) . If the GST gene sequence is fused to a tar­ get gene, the fusion protein acquires the capacity to bind glutathione. The fusion protein is expressed in a bacterial or other host organism, and a crude extract is prepared. A column is filled with a porous matrix con­ sisting of the ligand (in this case, glutathione) immobi­ lized to microscopic beads of a stable polymer such as cross-linked agarose. As the crude extract percolates through this column matrix, the fusion protein becomes immobilized by binding to the glutathione. The other TA B L E 9-3

Tag protein/ peptide Protein A

Molecular mass (kDa) 59 0.8

Immobilized ligand Fe portion of IgG

Ni2 +

for synthesis of a duplex DNA (with one mismatch), which is then used

(His)6

to transform cells. Cel lular DNA repair systems w i l l convert about 50%

Glutathione-Stransferase (GST)

26

Glutathione

Maltose-binding protein

41

Maltose

,a-Galactosidase

116

of the mismatches to reflect the desi red sequence change.

and ligating the remaining portions to form a smaller gene . Parts of two different genes can be ligated to create new combinations. The product of such a fused gene is called a fusion protein. Researchers now have ingenious methods to bring about virtually any genetic alteration in vitro. Reintro-

[31 3]

Chitin-binding domain

5.7

p-Aminophenyl-,8o-thiogalactoside (TPEG) Chitin

[314]

D N A-Based I n fo rmation Tec h n o l o g ies

(b)

(a)

Transcription

Glutathione-S-transferase (GST)

r-

Gene for target protein """'

'" GST

Gene for fusion protein



FIGURE 9-1 2 The use of tagged proteins in protein purification. The use of a GST tag is illustrated. (a) G lutathione-5-transferase (CST) is a smal l enzyme (depicted here by the purple icon) that binds glutathione

r. -:c c

(a gl utamate residue to which a Cys-Giy dipeptide is attached at the carboxyl carbon of the G l u side chain, hence the abbreviation GSH).

•e c

(b) The GST tag is fused to the carboxyl termi nus of the target protein by genetic engineering. The tagged protein is expressed i n host cel ls,

Express fusion protein in a cell.

Prepare cell extract containing fusion protein as part of the cell protein mixture.

and is present i n the crude extract when the cells are lysed. The extract is subjected to chromatography on a column conta i n i ng a medi u m with i m mobilized glutathione. The G ST-tagged protein binds t o the gl utathione, retard ing its m igration through the column, wh i l e the other proteins wash through rapi d ly. The tagged protei n is subse­ quently eluted from the column with a solution conta i ning elevated salt concentration or free gl utathione.

proteins in the extract are washed through the column and discarded. The interaction between GST and glu­ tathione is strong but noncovalent, allowing the fusion protein to be gently eluted from the column using a solu­ tion containing either a higher concentration of salts or free glutathione to compete with the immobilized ligand for GST binding. Fusion proteins can often be obtained with good yield and high purity in this way. In some com­ mercially available systems, the tag can be partially or completely removed from the purified fusion protein us­ ing a protease that cleaves a sequence near the junction between the target protein and its fused tag. A short tag with widespread application consists of a simple sequence of six or more histidine residues. These histidine tags or His tags, as they are more commonly known, bind tightly and specifically to nickel ions. Chro­ matography media with immobilized Ni2 + can then be used to efficiently separate His-tagged proteins from oth­ ers in an extract. Larger tags, such as maltose-binding protein, can enhance solubility and compensate for lack of stability in target proteins, allowing the purification of proteins that cannot be purified by other methods. Tag technology is powerful and convenient, and has been used successfully in thousands of published stud­ ies. However, one must be wary when using tagged pro­ teins in experiments. Terminal tags are not inert. Even very small tags can affect the properties of the proteins to which they are attached and thus affect experimental results. Activity may be affected even when tags are re­ moved by proteases, if one or a few extra amino acid residues remain associated with the target protein. Re­ sults obtained from tagged proteins should always be evaluated with the aid of well-designed controls to as­ sess the effect of the tag on protein function.

Elute fusion protein.

S U M M A RY 9 . 1 •





D N A Clon ing: The Bas i cs

DNA cloning and genetic engineering involve the cleavage of DNA and assembly of DNA segments in new combinations-recombinant DNA Cloning entails cutting DNA into fragments with enzymes; selecting and possibly modifying a fragment of interest; inserting the DNA fragment into a suitable cloning vector; transferring the vector with the DNA insert into a host cell for replication; and identifying and selecting cells that contain the DNA fragment. Key enzymes in gene cloning include restriction endonucleases (especially the type II enzymes) and DNA ligase .

9.2 From Genes to Genomes



Cloning vectors include plasmids, bacteriophages, and, for the longest DNA inserts, bacterial artificial chromosomes (BACs) and yeast artificial chromosomes (YACs) .



Cells containing particular DNA sequences can be identified by DNA hybridization methods.



Genetic engineering techniques manipulate cells to express and/or alter cloned genes.



Proteins or peptides can be attached to a protein of interest by altering its cloned gene, creating a fusion protein. The additional peptide segments can be used to detect the protein, or to purify it using convenient affinity chromatography methods.

9.2 From Genes to Genomes The modern science of genomics now permits the study of DNA on a cellular scale, from individual genes to the entire genetic complement of an organism-its genome . Genomic databases are growing rapidly, as one sequencing milestone is superseded by the next. Biology in the twenty-first century will move forward with the aid of informational resources undreamed of only a few years ago. We now turn to a consideration of some of the technologies fueling these advances.

[315]

Using hybridization methods, researchers can order individual clones in a library by identifying clones with overlapping sequences. A set of overlapping clones rep­ resents a catalog for a long contiguous segment of a genome, often referred to as a contig (Fig. 9-1 3 ) . Pre­ viously studied sequences or entire genes can be located within the library using hybridization methods to deter­ mine which library clones harbor the known sequence. If the sequence has already been mapped on a chromo­ some, investigators can determine the location (in the genome) of the cloned DNA and any contig of which it is a part. A well-characterized library may contain thou­ sands of long contigs, all assigned to and ordered on par­ ticular chromosomes to form a detailed physical map. The known sequences within the library (each called a sequence-tagged site, or STS) can provide landmarks for genomic sequencing proj ects. As more and more genome sequences become avail­ able, the utility of genomic libraries is diminishing and investigators are constructing more specialized libraries designed to study gene function. An example is a library that includes only those genes that are expressed-that is, are transcribed into RNA-in a given organism or even in certain cells or tissues. Such a library focuses on those portions of a genome relevant to the function of a tissue or cell type. The researcher first extracts mRNA from an organism or from specific cells of an

DNA libra ries Provide Specialized Catalogs of Genetic Information

A DNA library is a collection of DNA clones, gathered to­ gether as a source of DNA for sequencing, gene discov­ ery, or gene function studies. The library can take a variety of forms, depending on the source of the DNA. Among the largest types of DNA library is a genomic library, produced when the complete genome of a par­ ticular organism is cleaved into thousands of fragments, and all the fragments are cloned by insertion into a cloning vector. The first step in preparing a genomic library is par­ tial digestion of the DNA by restriction endonucleases, such that any given sequence will appear in fragments of a range of sizes-a range that is compatible with the cloning vector and ensures that virtually all sequences are represented among the clones in the library. Frag­ ments that are too large or too small for cloning are re­ moved by centrifugation or electrophoresis. The cloning vector, such as a BAC or YAC plasmid, is cleaved with the same restriction endonuclease and ligated to the genomic DNA fragments. The ligated DNA mixture is then used to transform bacterial or yeast cells to pro­ duce a library of cell types, each type harboring a differ­ ent recombinant DNA molecule. Ideally, all the DNA in the genome under study will be represented in the library. Each transformed bacterium or yeast cell grows into a colony, or "clone ," of identical cells, each cell bearing the same recombinant plasmid, one of many represented in the overall library.

--- 11 111111 1111 llll ll ll 11 1! 11 11 11 1111 ---

Segment of chromosome from organism X A BC D

BAC

clones 6 11 5 II

41 II I

ll

3 1 !I I I 2 1 II I I

EF

71 1?1�I

IIII 01

£1 1

Ill

II I I

G H 1

J

K L

MNO

PQ

11 11 w

£IT]

9 l ll fl ll 11 11

s 111 IJ ll ll I

FIGURE 9-1 3 Ordering of the clones in a DNA library. Shown here is

a segment of a chromosome from a hypothetical organism X, with

markers A through Q representi ng sequence-tagged sites (STSs-DNA segments of known sequence, including known genes) . Below the

chromosome is an array of ordered BAC clones, numbered 1 to 9. Or­

dering the clones on the genetic map is a many-stage process. The

presence or absence of an STS on an individual clone can be deter­ m ined by hybridization-for example, by probing each clone with DNA complementary to the STS. Once the STSs on each BAC clone are identified, the clones (and the STSs themselves, if their location is not yet known) can be ordered on the map. For example, compare

clones 3, 4, and 5. Marker E (blue) is found on a l l three clones; F (red)

on clones 4 and 5, but not on 3; and C (green) only on clone 5. This ind icates that the order of the sites is f, F, C. The clones partia l l y

overlap a n d their order must b e 3, 4, 5 . The resulting ordered series of clones is cal led a contig.

13 1 6 L

--'

D N A - Based I nfo rmation Te c h n o l ogies

organism and then prepares complementary DNAs ( cDNAs ) from the RNA in a multistep reaction cat­ alyzed by the enzyme reverse transcriptase (Fig. 9-14). The resulting double-stranded DNA fragments are then inserted into a suitable vector and cloned, creating a population of clones called a eDNA library. The search for a particular gene is made easier by focusing on a eDNA library generated from the mRNAs of a cell known to express that gene. For example, if we wished to clone globin genes, we could first generate a eDNA library from erythrocyte precursor cells, in which about half the mRNAs code for globins. To aid in the mapping of large genomes , cDNAs in a library can be partially sequenced at random to produce a useful type of STS called an ex­ pressed sequence tag (EST). ESTs, ranging in size from a few dozen to several hundred base pairs , can be

5'

mRNA

5'

5'

mRNA-DNA hybrid

3'

3'

3' -

5'

5'

Duplex DNA

3' -

AAAAAAA

1

1 1

1 1

AI

mRNA template is annealed to a synthetic

oligonucleotide (oligo dT) primer.

� 3 ' 1T T T T T T T TI

positioned within the larger genome map , providing markers for expressed genes. Hundreds of thousands of ESTs were included in the detailed physical maps used as a guide to sequencing the human genome. A eDNA library can be made even more specialized by cloning cDNAs or eDNA fragments into a vector that fuses each eDNA sequence with the sequence for a marker, or reporter gene ; the fused genes form a "reporter construct. " Two useful markers are the genes for green fluorescent protein and epitope tags . A target gene fused with a gene for green fluorescent pro­ tein (GFP) generates a fusion protein that is highly fluorescent-it literally lights up ( Fig. 9-1 5a) . GFP, derived from the jellyfish Aequorea victoria, has a f3-barrel structure, with a fluorophore in the center of the barrel (see Box 1 2-3, p. 434) . The fluorophore is

Transcription Insert GFP eDNA

(a)

AAAAAAA

transcriptase and dNTPs yield a oomplementary DNA strand.

Reverse

� T T T T T T T TI

-.---,----..---, In s ert Epitope eDNA tag

r:( b)

AAAAAAA

---+·� �� )

degraded with alkali.

'lb prime

synthesis of a seoond strand, an oligonucleotide of known sequence is often ligated to the 3' end of the eDNA T T T T T T T TI

DNA polymerase I and dNTPs extend the primer to yield double-stranded DNA

I T T T T T T T TI AAAAAAAA

lMak

Express tagged protein in a cell.

extract.

mRNA is

T T T T T T T TI

'----..·-·------/

II

Precipitate tagged protein

• Identify new proteins in

with , pecific antibody.

Precipitate

precipitate (e.g., with mass spectrometry). FIGURE 9-1 5 Specialized DNA libraries. (a) Cloning of eDNA next to a gene for green fluorescent prote i n (GFP) creates a reporter construct. RNA transcription proceeds through the gene of interest (insert DNA) and the reporter gene, and the mRNA transcript is then expressed as a fusion protein . The GFP part of the protei n is visible in the fluorescence microscope. The photograph shows a nematode worm conta i n i ng a

FIGURE 9-14 Construction of a eDNA library from mRNA. A cel l's

GFP fusion protei n expressed only i n the four "touch" neurons that run

m RNA includes transcripts from thousands of genes, and the cDNAs

the length of i ts body.

generated are correspondi ngly heterogeneous. The duplex DNA

cloned next to a gene for an epitope tag, the resu lting fusion protei n

8 Reporter

Constructs (b) I f the eDNA is

produced by this method i s i nserted into a n appropriate cloning vector.

can b e precipitated b y antibodies t o the epitope. Any other proteins

Reverse transcriptase can synthesize DNA on an RNA or a D NA

that interact with the tagged protein a lso precipitate, helping to eluci­

template (see Fig. 2 6-3 3 ) .

date protein-protei n i nteractions.

9.2 From Genes to Genomes

derived from a rearrangement and oxidation of several amino acid residues in an autocatalytic reaction that requires only molecular oxygen (see Box 12-3, Fig. 3). Thus the protein is readily cloned in an active form in almost any cell. Just a few molecules of this protein can be observed microscopically, allowing the study of its location and movements in a cell. Careful protein engi­ neering has generated mutant forms of GFP with a range of different colors and other properties (bright­ ness, stability), and related proteins have recently been isolated from other species. An epitope tag is a short protein sequence that is bound tightly by a well-characterized monoclonal anti­ body (p. 1 73). The tagged protein can be specifically precipitated from a crude protein extract by interac­ tion with the antibody (Fig. 9-15b). If any other pro­ teins bind to the tagged protein, those will precipitate as well, providing information about protein-protein interactions in a cell. The diversity and utility of special­ ized DNA libraries (and tagged proteins) are growing every year. The Polymerase Chain Reaction Amplifies Specific DNA Sequences

The Human Genome Project, along with the many asso­ ciated efforts to sequence the genomes of organisms of every type, is providing unprecedented access to gene sequence information. This in turn is simplifying the process of cloning individual genes for more detailed biochemical analysis. If we know the sequence of at least the flanking parts of a DNA segment to be cloned, we can hugely amplify the number of copies of that DNA segment, using the polymerase chain reaction (PCR), a process conceived by Kary Mullis in 1 983. The amplified DNA can be cloned directly or used in a variety of analytical procedures. The PCR procedure has an elegant simplicity. Two synthetic oligonucleotides are prepared, complemen­ tary to sequences on opposite strands of the target DNA at positions defining the ends of the segment to be am­ plified. The oligonucleotides serve as replication primers that can be extended by DNA polymerase. The 3' ends of the hybridized probes are oriented toward each other and positioned to prime DNA synthesis across the desired DNA segment ( Fig. 9-1 6) . (DNA polymerases synthesize DNA strands from deoxyribonu­ cleotides, using a DNA template, as described in Chapter 25.) Isolated DNA containing the segment to be amplified is heated briefly to denature it, and then cooled in the presence of a large excess of the synthetic oligonucleotide primers. The four deoxynucleoside triphosphates are then added, and the primed DNA seg­ ment is replicated selectively. The cycle of heating, cool­ ing, and replication is repeated 25 or 30 times over a few hours in an automated process, amplifying the DNA segment between the primers until it can be readily

[31 7]

analyzed or cloned. PCR uses a heat-stable DNA poly­ merase, such as the Taq polymerase (derived from a bacterium that lives at 90 °C), which remains active af­ ter every heating step and does not have to be replen­ ished. Careful design of the primers used for PCR, such as including restriction endonuclease cleavage sites, can facilitate the subsequent cloning of the amplified DNA (Fig. 9-16b). This technology is highly sensitive: PCR can detect and amplify as little as one DNA molecule in almost any type of sample. Although DNA degrades over time (p. 289), PCR has allowed successful cloning of DNA from samples more than 40,000 years old. Investigators have used the technique to clone DNA fragments from the mummified remains of humans and extinct animals such as the woolly mammoth, creating the new fields of molecular archaeology and molecular paleontology. DNA from burial sites has been amplified by PCR and used to trace ancient human migrations. Epidemiologists can use PCR-enhanced DNA samples from human remains to trace the evolution of human pathogenic viruses. In addition to its usefulness for cloning DNA, PCR is a potent tool in forensic medicine (Box 9-1). It is also be­ ing used for detection of viral infections before they cause symptoms and for prenatal diagnosis of a wide array of genetic diseases. The PCR method is also important in advancing the goal of whole genome sequencing. For example, the mapping of expressed sequence tags to particular chro­ mosomes often involves amplification of the EST by PCR, followed by hybridization of the amplified DNA to clones in an ordered library. Investigators found many other applications of PCR in the Human Genome Pro­ ject, to which we now turn. Genome Sequences Provide the Ultimate Genetic libraries

The genome is the ultimate source of information about an organism, and there is no genome we are more inter­ ested in than our own. Less than 1 0 years after the de­ velopment of practical DNA sequencing methods, serious discussions began about the prospects for se­ quencing the entire 3 billion base pairs of the human genome. The international Human Genome Project got underway with substantial funding in the late 1 980s. The effort eventually included significant contributions from 20 sequencing centers distributed among six na­ tions: the United States, Great Britain, Japan, France, China, and Germany. General coordination was provided by the Office of Genome Research at the National Insti­ tutes of Health, led first by James Watson and after 1 992 by Francis Collins. At the outset, the task of sequencing a 3 X 109 bp genome seemed to be a titanic job, but it gradually yielded to advances in technology. The com­ pleted sequence of the human genome was published in April 2003, several years ahead of schedule.

[31s]

D N A-Based I n formation Technologies

Region of target DNA to be amplified

FIGURE 9-16 Amplification of a DNA segment by the polymerase chain reaction. (a) The PCR procedure has three steps. DNA strands are

CD Heat to separate

strands. ® Add synthetic oligo­ nucleotide primers; cool.

3 'c=:======;:;;;;;;= ;;;= ===:r========:::::::�

CJ 5 ' ======�====�======:::J :: 5'r:::== D CJ

@ Add thermostable DNA polymerase to catalyze 5' � 3' DNA synthesis.

1 5'

3'

1

CD separated by heating, then Q) annealed to an excess of short

synthetic D NA primers (blue) that flank the region to be ampl ified;

G) new DNA is synthesized by polymerization. The three steps are re­

peated for 25 or 30 cycles. The thermostable DNA polymerase Taql

(from Thermus aquaticus, a bacterial species that grows in hot springs) is not denatured by the heating steps. (b) DNA amplified by PCR can be cloned. The primers can i nclude noncomplementary ends that have a site for cleavage by a restriction endonuclease. Although these parts of the primers do not anneal to the target DNA, the PCR process in­ corporates them i nto the DNA that is amplified. Cleavage of the ampl i­ fied fragments at these sites creates sticky ends, used i n ligation of the ampl ified DNA to a cloning vector.

CD Heat to separate strands.

@ Anneal primers containing

noncomplementary regions with cleavage site for restriction endonuclease.

DNA synthesis (step @ ) is catalyzed by the thermostable DNA polymerase (still present). (5')GAATTC

(5')GAATTC

/

!

&pomteP' Q)

through @.

After 25 cycles, the target sequence has been amplified about 1Q6-fold.

(a)

IBI

l

CTTAAG(5' ) /



Replication

/

CTTAAG (5 ' )GAATTC

5'

Polymerase Chain Reaction

G AATTC

� � � � �

l



CTTAAG(5') /

PCR

CTTAAG GAATTC(3') EcoRI

endonuclease

Clone by insertion at an EcoRI site in a cloning vector.

(b)

CTTAA G

9.2 From Genes to Genomes

[319]

A Potent Wea p o n in Fore n s i c M e d i c i n e

BOX 9-1

Traditionally, one of the most accurate methods for plac­ ing an individual at the scene of a crime has been a fingerprint. With the advent of recombinant DNA tech­ nology, a more powerful tool is now available: DNA fingerprinting (also called DNA typing or DNA profil­ ing) . The method was first described by English geneti­ cist Alec Jeffreys in 1 985. DNA fingerprinting is based on sequence poly­ morphisms, slight sequence differences between indi­ viduals, 1 bp in every 1 ,000 bp, on average. Each difference from the prototype human genome sequence (the first one obtained) occurs in some fraction of the human population; every individual has some differ­ ences. Some of the sequence changes affect recognition sites for restriction enzymes, resulting in variation in the size of DNA fragments produced by digestion with a particular restriction enzyme. These variations are re­ striction fragment length polymorphisms (RFLPs ) .

Another type of sequence variation, and the one now used most commonly in DNA typing, involves short tandem repeats (STRs). The detection of RFLPs relies on a specialized hy­ bridization procedure called Southern blotting (Fig. 1 ) . DNA fragments from digestion of genomic DNA by restriction endonucleases are separated by size elec­ trophoretically, denatured by soaking the agarose gel in alkali, and then blotted onto a nylon membrane to re­ produce the distribution of fragments in the gel. The membrane is immersed in a solution containing a ra­ dioactively labeled DNA probe. A probe for a sequence that is repeated several times in the human genome generally identifies a few of the thousands of DNA fragments generated when the human genome is di­ gested with a restriction endonuclease. Autoradiogra­ phy reveals the fragments to which the probe hybridizes, as in Figure 1 . The method is very accurate (continued on next page)

!

Chromosomal DNA (e.g., Suspect 1) Cleave with restriction endonucleases.

I�

# , ,.. �._: ) ( .... 1)";-, ·r •

!

\.,.: /"

' • ;..

DNA fragments



Separate fragments by agarose gel electrophoresis (unlabeled).

1(..-=£1,_

"' '11'1.

-

= - = -

Denature DNA, and transfer to nylon membrane.

-

Radiolabeled DNA probe

=­ !- - ! -

-! Incubate wit.h probe, then wa h.

F I G U RE 1 The Southern blot procedure, as applied to RFLP DNA fin· gerprinting. Southern blotti ng (used for many purposes in molecular

-

Expose x-ray film to membrane.

Radioactive DNA probes were used to identify a smal l subset of frag­ ments that contained sequences complementary to the probe. The

biology) was named after Jeremy Southern, who developed the tech­

sizes of the identified fragments varied from one i ndividual to the

nique. In this example of a forensic app l i cation, the DNA from a se­

next, as seen here in the different patterns for the three i ndividuals

men sample obtained from a rape and murder victim was compared

(victim and two suspects) tested. One suspect's DNA exh i b i ts a

with DNA samples from the victim and two suspects. Each sample

banding pattern identical to that of the semen sample taken from

was cleaved i nto fragments and separated by gel electrophores is.

the victim.

[no]

D N A-Based I n formation Tec h n o logies

BOX 9-1

A Potent Wea pon in Fore n s i c M e d i c i n e

and was first used in court cases in the late 1 980s. How­ ever, it requires a large sample of undegraded DNA (>25 ng) . That amount of DNA is often not available at a crime scene or disaster site. The requirement for more-sensitive DNA typing methods led to a focus on the polymerase chain reaction (PCR; see Fig. 9-1 6) , and on STRs. An STR locus is a short DNA sequence, repeated many times in tandem at a particular location in a chromosome; most commonly, the repeated sequences are 4 bp long. The STR loci that are most useful for DNA typing are quite short, from 4 to 50 repeats long ( 1 6 to 200 total base pairs for tetranu­ cleotide repeats) , and have multiple length variants in the human population. More than 20,000 tetranu­ cleotide STR loci have been characterized in the human genome. More than a million STRs of all types may be present in the human genome, accounting for about 3% of all human DNA. The polymerase chain reaction is readily applied to STR analysis, and the focus of forensic scientists changed from RFLPs to STRs as the promise of in­ creased sensitivity became apparent in the early 1 990s. The DNA sequences flanking STRs are unique to each type of STR and identical (except for very rare muta­ tions) in all humans. PCR primers are targeted to this flanking DNA, and designed to amplify the DNA across

TA B L E 1

Locus

(continued from previous page)

the STR (Fig. 2a) . The length of the PCR product then reflects the length of the STR in that sample . Since each human inherits one chromosome from each parent, the STR lengths on the two chromosomes are often different, generating two signals from one indi­ vidual. If multiple STR loci are analyzed, a profile can be generated that is essentially unique to a particular individual. PCR amplification allows investigators to obtain DNA fingerprints from less than 1 ng of partially degraded DNA, an amount that can be obtained from a single hair follicle, a drop of blood, a small semen sam­ ple on a bed sheet, or samples that might be months or even many years old. Successful forensic use of STR analysis required standardization. The first forensic STR standard was established in the United Kingdom in 1 995. The U.S. standard, called the COmbined DNA Index System (CODIS) , was established in 1 998. The CODIS system is based on 1 3 well-studied STR loci (Table 1 ) , which must be present in any DNA typing experiment carried out in the United States. The amelogenin gene is also used as a marker. This gene, present on the human sex chromosomes, has slightly different flanking DNA on the X and Y chromosomes. PCR amplification across the amelogenin gene thus generates different-size products that can reveal the sex of the DNA donor.

Properties of the Loci Used for the CODIS Database

----

Chromosome

Repeat motif

Repeat length (ranget

Number of alleles seent

CSFlPO

5

TAGA

5-16

20

FGA

4

CTTT

12.2-51.2

80

THO!

11

TCAT

3-14

20

TPOX

2

GAAT

4-16

15

VWA

12

[TCTG][TCTA]

10-25

28

D381358

3

[TCTG][TCTA]

8-2 1

24

D58818

5

AGAT

7-18

15

D7S820

7

GATA

5-16

30

D881 179

8

[TCTA][TCTG]

7-20

17

Dl383 1 7

13

TATC

5-16

17

D 1 68539

16

GATA

5-16

19

D 18851

18

AGAA

7-39.2

51

D21Sl l

21

[TCTA][TCTG]

12-4 1 .2

82

X,Y

Not applicable

Amelogenin

Source: Adapted from Butler, J.M. (2005) Forensic DNA Typing, 2nd edn, Academic Press, San Diego, p. 96.

• Repeat lengths observed in the human population. Partial or imperfect repeats can be included in some alleles. t Number of different alleles observed to date in the human population. Careful analysis of a locus in many individuals is a prerequisite to its use in forensic DNA typing.

9 . 2 From Genes to Genomes

The CODIS database contained 2.8 million samples prior to 2006, and is linked to all 50 United States. As of mid-2005, it had assisted more than 25,000 forensic investigations. Convenient kits have been developed commercially that allow the amplification of 1 6 or more STR loci in one test tube. These "multiplex" STR kits (Fig. 2b) have PCR primers unique to each locus. Each primer is care­ fully designed to avoid hybridization to any other primer in the kit and to generate PCR products of different sizes so as to spread out the signals from the different loci dur­ ing electrophoresis. The primers are linked to colored dyes to help distinguish the different PCR products. The most widely used kits now include the 13 CODIS loci, amelogenin, and two additional loci used by law enforce­ ment agencies elsewhere in the world ( 1 6 total) . The kits are very precise in establishing human identity. When good DNA profiles are obtained, the chance of an acci­ dental match between two individuals in the human pop­ ulation is less than 1 in 1 0 18 (quintillion) . DNA typing has been used to both convict and ac­ quit suspects and, in other cases, to establish paternity with an extraordinary degree of certainty. The impact of these procedures on court cases will continue to grow as standards are improved and as international DNA typing databases grow. Even very old mysteries can be solved: in 1 996, DNA fingerprinting helped to confirm the iden­ tification of the bones of the last Russian czar and his family, who were assassinated in 1918.

(a) 20 a· 5' 3' 5'

l

Allele 2 PCR amplifimtion

c-::J

TR sequences

Run PCR fragments on a � ..;_. ·� 'i*..-� �-;;j::, ,... �· :> e�r.·# ·�· \) .4} -:: --

�- Ql �· ,·; �- =-:· ��; 1:� ��� · ;' ·=·

j

II

nlcohol w :�ldchyde

Ha

CHa

Vitamin A1 ( retinol )

'\

CHJ

1r.CH20H

CH,b

CH3

j

j

oxidatiOn of

H/

CH3

(d)

light

visible

j



-------+

u

1 .2

c""'o

11-cis-Retinal (visual pigment)

(b)

Retinoic acid

(c)

12

CH,�

Hormonal signal to epithelial cells

Neuronal signal to brain

jn j

-----7

[3 61]

R/c""'o

CH3

all-trans-Retinal (e)

{:1-Carotene (a) FIGURE 1 0-21 Vitamin A1 and its precursor and derivatives. (a) {3-

Carotene is the precursor of vitami n A 1 . Isoprene structural units are set off by dashed red l ines (see p. 3 59). Cleavage of {3-carotene yields two

widespread in nature. In the dark, retinal of rhodopsi n is in the 1 1 -cis form (c). When a rhodopsi n molecule i s excited by visible light, the 1 1 -cis-retinal undergoes a series of photochemical reactions that con­

molecules of vitamin A1 (retinol) (b). Oxidation at C-1 5 converts retinol

vert it to all-trans-retinal (e), forci n g a change in the shape of the entire

to the aldehyde, retinal (c), and further oxidation produces retinoic acid

rhodopsi n molecule. This transformation i n the rod cel l of the verte­

(d), a hormone that regulates gene expression. Retinal combines with

brate retina sends an electrical signal to the bra i n that is the basis of

the prote i n opsin to form rhodopsin (not shown), a visual pigment

visual transduction, a topic we address in more deta i l i n Chapter 1 2 .

Vitamins E and K and the lipid Quinones Are

protein that holds blood clots together. Henrik Dam and Edward A Doisy independently discovered that vitamin K deficiency slows blood clotting, which can be fatal. Vita­ min K deficiency is very uncommon in humans, aside from a small percentage of infants who suffer from hem­ orrhagic disease of the newborn, a potentially fatal dis­ order. In the United States, newborns are routinely given a 1 mg injection of vitamin K. Vitamin K1 (phyllo­ quinone) is found in green plant leaves; a related form, vitamin K2 (menaquinone) , is formed by bacteria living in the vertebrate intestine.

Oxidation-Reduction Cofactors

Vitamin E is the collective name for a group of closely related lipids called tocopherols, all of which contain a substituted aromatic ring and a long iso­ prenoid side chain (Fig. 10-22a). Because they are hy­ drophobic, tocopherols associate with cell membranes, lipid deposits, and lipoproteins in the blood. Tocopherols are biological antioxidants. The aromatic ring reacts with and destroys the most reactive forms of oxygen radicals and other free radicals, protecting unsaturated fatty acids from oxidation and preventing oxidative damage to mem­ brane lipids, which can cause cell fragility. Tocopherols are found in eggs and vegetable oils and are especially abun­ dant in wheat germ. Laboratory animals fed diets depleted of vitamin E develop scaly skin, muscular weakness and wasting, and sterility. Vitamin E deficiency in humans is very rare; the principal symptom is fragile erythrocytes. The aromatic ring of vitamin K (Fig. 1 0-22b) un­ dergoes a cycle of oxidation and reduction during the formation of active prothrombin, a blood plasma protein essential in blood clotting. Prothrombin is a proteolytic enzyme that splits peptide bonds in the blood protein fibrinogen to convert it to fibrin, the insoluble fibrous

Edward A. Daisy, 1 893-1 986

Henrik Dam, 1 895-1 976

HO

(a)

Vitamin

E: an antioxidant

Ha

w



9�

Ha

C H2-CH2-CH2-CH-CH2-CH2-CH2-CH-CH2-CH2-CH2-CH-C Ha CHa

CH3

(b)

Ha

Vitamin K,: a blood-clotting

H=

cofactor (phylloquinone)

H2-

(

9Hs

H2- H2- H-G H2

)

2

-

9Hs

H2- Hz-GH- H3

(c) Warfarin: a blood anticoagulant

(d) Ubiquinone: a mitochondrial electron carrier (coenzyme Q) (n = 4 to 8 )

(e) Plastoquinone: a chloroplast electron carrier (n

(f)

=

4 to 8 )

Dotichol: a sugar carrier

(n

=

9 to 22)

Ha

9 H�

9Ha

HO-CH2-CH2- H - H,- ( 1-!2- H= - H2 ), - H2- H= -CH�

F IGURE 10-22 Some other biologically active isoprenoid compounds or derivatives. U n its derived from isoprene are set off by dashed red l ines. In most mamma l ian tissues, ubiquinone (also called coenzyme Q)

Warfarin (Fig. 1 0-22c) is a synthetic compound that inhibits the formation of active prothrombin. It is partic­ ularly poisonous to rats, causing death by internal bleeding. Ironically, this potent rodenticide is also an in­ valuable anticoagulant drug for treating humans at risk for excessive blood clotting, such as surgical patients and those with coronary thrombosis. • Ubiquinone (also called coenzyme Q) and plasto­ quinone (Fig. 1 0-22d, e) are isoprenoids that function as lipophilic electron carriers in the oxidation-reduction reactions that drive ATP synthesis in mitochondria and chloroplasts, respectively. Both ubiquinone and plasto­ quinone can accept either one or two electrons and either one or two protons (see Fig. 1 9-2) . Dolichols Activate Sugar Precursors for Biosynthesis

During assembly of the complex carbohydrates of bacte­ rial cell walls, and during the addition of polysaccharide

1

has 1 0 isoprene un its. Dol i chols of animals have 1 7 to 2 1 isoprene

units (85 to 1 OS carbon atoms), bacterial dolichols have 1 1 , and those

of plants and fungi have 1 4 to 24.

units to certain proteins (glycoproteins) and lipids (gly­ colipids) in eukaryotes, the sugar units to be added are chemically activated by attachment to isoprenoid alco­ hols called dolichols (Fig. 1 0-22f) . These compounds have strong hydrophobic interactions with membrane lipids, anchoring the attached sugars to the membrane, where they participate in sugar-transfer reactions. Many N atural Pigments Are lipidic Conjugated Dienes

Conjugated dienes have carbon chains with alternating single and double bonds. Because this structural arrange­ ment allows the delocalization of electrons, the corn­ pounds can be excited by low-energy electromagnetic radiation (visible light) , giving them colors visible to hu­ mans and other animals. Carotene (Fig. 1 0-2 1 ) is yellow­ orange ; similar compounds give bird feathers their striking reds, oranges, and yellows (Fig. 1 0 - 23). Like sterols, steroids, dolichols , vitamins A, E , D, and K,

1 0.4 Working with Lipids

0

HO

Canthaxanthin (bright red)

:Q

7. ...

H

_,

.

. ;� '"" . '" J., ..:.•· . ..

;,

0

[363]

� ... .

:-:- -,,, ,_..

•. ..

.· " •

_,. r.\.. • :·r· a ::·

·' ' · · · ··' .

"'

Zeaxanthin (bright yellow)

FIGURE 1 0-23 Lipids as pigments in plants and bird feathers. Com­

ments that color their feathers red or yellow by eating plant materials that

pounds with long conjugated systems absorb l ight in the visible region of

contain carotenoid pigments, such as canthaxanthin and zeaxanthin. The

the spectrum. Subtle differences in the chemistry of these compounds

differences in pigmentation between male and female birds are the result

produce pigments of strikingly different colors. Birds acquire the pig-

of differences in i ntestinal uptake and processing of carotenoids.

ubiquinone, and plastoquinone, these pigments are syn­ thesized from five-carbon isoprene derivatives; the biosynthetic pathway is described in detail in Chapter 2 1 .

S U M M A RY 1 0 . 3

L i p i d s a s S i g n a l s, Cofa ctors, a n d P i g m e n t s













Some types of lipids, although present in relatively small quantities, play critical roles as cofactors or signals. Phosphatidylinositol bisphosphate is hydrolyzed to yield two intracellular messengers, diacylglycerol and inositol l ,4,5-trisphosphate. Phosphatidylinositol 3,4,5-trisphosphate is a nucleation point for supramolecular protein complexes involved in biological signaling. Prostaglandins, thromboxanes, and leukotrienes (the eicosanoids) , derived from arachidonate, are extremely potent hormones. Steroid hormones, derived from sterols, serve as powerful biological signals, such as the sex hormones. Vitamins D, A, E , and K are fat-soluble compounds made up of isoprene units. All play essential roles in the metabolism or physiology of animals. Vitamin D is precursor to a hormone that regulates calcium metabolism. Vitamin A furnishes the visual pigment of the vertebrate eye and is a regulator of gene expression during epithelial cell growth. Vitamin E functions in the protection of membrane lipids from oxidative damage, and vitamin K is essential in the blood-clotting process. Ubiquinones and plastoquinones, also isoprenoid derivatives, are electron carriers in mitochondria and chloroplasts, respectively.





Dolichols activate and anchor sugars to cellular membranes; the sugar groups are then used in the synthesis of complex carbohydrates, glycolipids, and glycoproteins. Lipidic conjugated dienes serve as pigments in flowers and fruits and give bird feathers their striking colors.

1 0.4 Working with Lipids Because lipids are insoluble in water, their extraction and subsequent fractionation require the use of organic solvents and some techniques not commonly used in the purification of water-soluble molecules such as proteins and carbohydrates. In general, complex mix­ tures of lipids are separated by differences in polarity or solubility in nonpolar solvents. Lipids that contain ester- or amide-linked fatty acids can be hydrolyzed by treatment with acid or alkali or with specific hydrolytic enzymes (phospholipases, glycosidases) to yield their components for analysis. Some methods commonly used in lipid analysis are shown in Figure 10-24 and discussed below. Lipid Extraction Requires Organic Solvents Neutral lipids (triacylglycerols, waxes, pigments, and so forth) are readily extracted from tissues with ethyl ether, chloroform, or benzene, solvents that do not per­ mit lipid clustering driven by hydrophobic interactions. Membrane lipids are more effectively extracted by more polar organic solvents, such as ethanol or methanol, which reduce the hydrophobic interactions among lipid molecules while also weakening the hydrogen bonds and electrostatic interactions that bind membrane lipids to membrane proteins. A commonly used extractant is a

Tissue

FIGURE 1 0-24 Common procedures in the extraction, separation, and identification of cellular lipids. (a) Tissue is homogenized in a

homogenized in chloroform/methanol/water

chloroform/methanol/water m i xture, which on addition of water and removal of unextractable sediment by centrifugation yields two phases. Different types of extracted l i pids in the ch loroform phase may be separated by (b) adsorption chromatography on a column of s i l ica gel, through which solvents of i ncreasing polarity are passed, or

(c) thin-layer chromatography (TLC), in which l i p ids are carried up a

Methanol/water

sil ica gel-coated plate by a rising solvent front, less polar l i p ids travel­ ing farther than more polar or charged l ipids. TLC with appropriate solvents can also be used to separate closely related l ipid species; for example, the charged l ipids phosphatidylserine, phosphatidylglycerol, and phosphatidy l inositol are easily separated by TLC. For the determination of fatty acid composition, a l ipid fraction conta i n i ng ester- l i n ked fatty acids is transesterified in a warm aqueous

(b)

/

(c)

/

solution of NaOH and methanol (d), producing a m ixture of fatty acyl methyl esters. These methyl esters are then separated on the basis of chain length and degree of saturation by (e) gas-liquid chromatogra­ phy (GLC) or (f) h igh-performance l iquid chromatography (H PLC). Pre­ cise determination of molecular mass by mass spectrometry al lows



Adso rption chromatography

_yv

L__ _ _

Thin-layer chromatography



1

2 3 4 5 6 7

8 9

Neutral Polar Charged lipids lipids lipids

unambiguous identification of individual l ipids.

mixture of chloroform, methanol, and water, initially in volume proportions (1 :2:0.8) that are miscible, produc­ ing a single phase. After tissue is homogenized in this solvent to extract all lipids, more water is added to the resulting extract and the mixture separates into two phases, methanol/water (top phase) and chloroform (bottom phase) . The lipids remain in the chloroform layer, and the more polar molecules such as proteins and sugars partition into the methanol/water layer. Adsorption Chromatogra phy Separates lipids of

Fatty acyl methyl esters

(e)

Gas-liquid chromatography

High­ performance liquid chromatography

18:0

16:1

Elution time

Different Polarity

Complex mixtures of tissue lipids can be fractionated by chromatographic procedures based on the different po­ larities of each class of lipid. In adsorption chromatogra­ phy (Fig. 1 0-24b) , an insoluble, polar material such as silica gel (a form of silicic acid, Si(OH) 4) is packed into a glass column, and the lipid mixture (in chloroform solution) is applied to the top of the column. (In high­ performance liquid chromatography, the column is of smaller diameter and solvents are forced through the column under high pressure .) The polar lipids bind tightly to the polar silicic acid, but the neutral lipids pass directly through the column and emerge in the first chloroform wash. The polar lipids are then eluted, in or­ der of increasing polarity, by washing the column with solvents of progressively higher polarity. Uncharged but polar lipids (cerebrosides, for example) are eluted with acetone, and very polar or charged lipids (such as glycerophospholipids) are eluted with methanol. Thin-layer chromatography on silicic acid employs the same principle (Fig. 1 0-24c) . A thin layer of silica gel is spread onto a glass plate, to which it adheres. A small sample of lipids dissolved in chloroform is applied near

1 0 . 4 Worki n g with L i p i d s

one edge of the plate, which is dipped in a shallow con­ tainer of an organic solvent or solvent mixture; the entire setup is enclosed in a chamber saturated with the solvent vapor. As the solvent rises on the plate by capillary ac­ tion, it carries lipids with it. The less polar lipids move farthest, as they have less tendency to bind to the silicic acid. The separated lipids can be detected by spraying the plate with a dye (rhodamine) that fluoresces when associated with lipids, or by exposing the plate to iodine fumes. Iodine reacts reversibly with the double bonds in fatty acids, such that lipids containing unsaturated fatty acids develop a yellow or brown color. Several other spray reagents are also useful in detecting specific lipids. For subsequent analysis, regions containing separated lipids can be scraped from the plate and the lipids recovered by extraction with an organic solvent. Gas-liquid Chromatography Resolves M ixtures of Volatile lipid Derivatives

Gas-liquid chromatography separates volatile compo­ nents of a mixture according to their relative tendencies to dissolve in the inert material packed in the chro­ matography column or to volatilize and move through the column, carried by a current of an inert gas such as helium. Some lipids are naturally volatile, but most must first be derivatized to increase their volatility (that is, lower their boiling point) . For an analysis of the fatty acids in a sample of phospholipids, the lipids are first transesterified: heated in a methanol/HCl or methanol/NaOH mixture to convert fatty acids esteri­ fied to glycerol into their methyl esters (Fig. 10-24d) . These fatty acyl methyl esters are then loaded onto the gas-liquid chromatography column, and the column is heated to volatilize the compounds. Those fatty acyl es­ ters most soluble in the column material partition into (dissolve in) that material; the less soluble lipids are car­ ried by the stream of inert gas and emerge first from the column. The order of elution depends on the nature of the solid adsorbant in the column and on the boiling point of the components of the lipid mixture. Using these techniques, mixtures of fatty acids of various chain lengths and various degrees of unsaturation can be completely resolved (Fig. 1 0-24e) . Specific Hydrolysis Aids in Determination of lipid Structure

Certain classes of lipids are susceptible to degradation un­ der specific conditions. For example, all ester-linked fatty acids in triacylglycerols, phospholipids, and sterol esters are released by mild acid or alkaline treatment, and some­ what harsher hydrolysis conditions release amide-bound fatty acids from sphingolipids. Enzymes that specifically hydrolyze certain lipids are also useful in the determina­ tion of lipid structure. Phospholipases A, C, and D (Fig. 1 0-16) each split particular bonds in phospholipids and yield products with characteristic solubilities and chromatographic behaviors. Phospholipase C, for example,

[3 65]

releases a water-soluble phosphoryl alcohol (such as phos­ phocholine from phosphatidylcholine) and a chloroform­ soluble diacylglycerol, each of which can be characterized separately to determine the structure of the intact phospholipid. The combination of specific hydrolysis with characterization of the products by thin-layer, gas-liquid, or high-performance liquid chromatography often allows determination of a lipid structure. Mass Spectrometry Reveals Complete lipid Structure

To establish unambiguously the length of a hydrocarbon chain or the position of double bonds, mass spectromet­ ric analysis of lipids or their volatile derivatives is in­ valuable. The chemical properties of similar lipids (for example, two fatty acids of similar length unsaturated at different positions, or two isoprenoids with different numbers of isoprene units) are very much alike, and their order of elution from the various chromatographic procedures often does not distinguish between them. When the eluate from a chromatography column is sampled by mass spectrometry, however, the compo­ nents of a lipid mixture can be simultaneously separated and identified by their unique pattern of fragmentation (Fig. 10-25). lipidomics Seeks to Catalog All lipids and Their Functions

In exploring the biological role of lipids in cells and tis­ sues, it is important to know which lipids are present and in what proportions , and to know how this lipid composition changes with embryonic development, dis­ ease, or drug treatment. As lipid biochemists have be­ come aware of the thousands of different naturally occurring lipids, they have proposed a new nomencla­ ture system, with the aim of making it easier to compile and search databases of lipid composition. The system places each lipid in one of eight chemical groups (Table 10 -3) designated by two letters. Within these groups, finer distinctions are indicated by numbered classes and subclasses. For example, all glycerophosphocholines are GP0 1 ; the subgroup of glycerophosphocholines with two fatty acids in ester linkage is designated GP0 1 0 1 ; with one fatty acid ether-linked at position 1 and one in ester linkage at position 2, this becomes GP0 102. Specific fatty acids are designated by numbers that give every lipid its own unique identifier, so that each individual lipid, including lipid types not yet discovered, can be un­ ambiguously described in terms of a 1 2-character iden­ tifier. One factor used in this classification is the nature of the biosynthetic precursor. For example, prenol lipids (dolichols and vitamins E and K, for example) are formed from isoprenyl precursors . Polyketides, which we have not discussed in this chapter, include some nat­ ural products, many toxic, with biosynthetic pathways related to those for fatty acids. The eight chemical cate­ gories in Table 10-3 do not coincide perfectly with the divisions according to biological function that we have

90

0



92

70

N

60

10

§ 50 �

"

"" � ::l



01

· II +o+ I H II I I I 108 I

u.

92

0

I

164

I I I

: 220 : I I

206

164

I

I

I I I

234 I

300 : 32 : 356 I I 314 342

I I I

260 : I

274 I

I l I

I

I

I I

I

40 30 20

55

67

260

151

274

10 60

80

300

3 14

328

100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 m lz The prominent ions at m/z

92, 1 08, 1 5 1 , and 1 64 contai n the

FIGURE 1 0-25 Determination of fatty acid structure by mass spec­ trometry. The fatty acid is first converted to a derivative that m i n i m izes

pyridine ring of the picolinol and various fragments of the carboxyl group,

migration of the double bonds when the molecule is fragmented by

showing that the compound is indeed a picolinyl ester. The molecular ion,

electron bombardment. The derivative shown here is a pico l i nyl ester

M+ (m/z

=

=

3 7 1 ), confirms the presence of a C 1 8 fatty acid with two dou­

of l inoleic acid-1 8:2(.:l g· 1 2 ) (M, 3 7 1 )-in which the alcohol is picol i­

ble bonds. The uniform series of ions 1 4 atomic mass units (u) apart repre­

nol (red). When bombarded with a stream of electrons, this molecule

sents loss of each successive methyl and methylene group from the methyl

is volati l ized and converted to a parent ion (M+; M, 3 7 1 ), in which the

end of the acyl chain (begin n i ng at C-1 8; the right end of the molecule as

N atom bears the positive charge, and a series of smal ler fragments produced by breakage of C-C bonds in the fatty acid. The mass spec­ trometer separates these charged fragments according to their

shown here), unti l the ion at mlz

=

300 is reached. This is fol lowed by a

gap of 26 u for the carbons of the terminal double bond, at m/z further gap of 1 4 u for the C-1 1 methylene group, at m/z

=

=

2 74; a

260; and so

mass/charge ratio (m/z). (To review the principles of mass spectrome­

forth. By this means the entire structure is determined, although these data

try, see Box 3-2 .)

alone do not reveal the configuration (cis or trans) of the double bonds.

used in this chapter. For example, the structural lipids of membranes include both glycerophospholipids and sphingolipids , separate categories in Table 1 0 -3. Each method of categorization has its advantages. The application of mass spectrometric techniques with high throughput and high resolution can provide quantitative catalogs of all the lipids present in a spe­ cific cell type-the lipidome-under particular condi­ tions, and of the ways in which the lipidome changes with differentiation, disease such as cancer, or drug treatment. An animal cell contains about a thousand different lipid species, each presumably having a spe-

cific function. These functions are known for a growing number of lipids , but the still largely unexplored lipidome offers a rich source of new problems for the next generation of biochemists and cell biologists to solve.

S U M MA RY 1 0 .4 •

Worki n g w i t h l i p i d s

In the determination of lipid composition, the lipids are first extracted from tissues with organic solvents and separated by thin-layer, gas-liquid, or high-performance liquid chromatography.

TA B L E 1 0-3

Category

Category code

Examples

Fatty acids

FA

Oleate, stearoyl-CoA, palmitoylcarnitine

Glycerolipids

GL

Di- and triacylglycerols

Glycerophospholipids

GP

Phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine

Sphingolipids

SP

Sphingomyelin, ganglioside GM2

Sterol lipids

ST

Cholesterol, progesterone, bile acids

Prenol lipids

PR

Farnesol, geraniol, retinol, ubiquinone

Saccharolipids

SL

Lipopolysaccharide

Polyketides

PK

Tetracycline, aflatoxin B 1

Further Read ing







Phospholipases specific for one of the bonds in a phospholipid can be used to generate simpler compounds for subsequent analysis. Individual lipids are identified by their chromatographic behavior, their susceptibility to hydrolysis by specific enzymes, or mass spectrometry. Lipidomics combines powerful analytical techniques to determine the full complement of lipids in a cell or tissue (the lipidome) and to assemble annotated databases that allow comparisons between lipids of different cell types and under different conditions.

[3 67]

Lipids as Nutrients Angerer, P. & von Schacky, C. (2000) Omega-3 polyunsaturated fatty acids and the cardiovascular system. Curr: Opin. Lipidol. 11, 57-63 . Covington, M.B. (2004) Omega-3 fatty acids. Am. Fam Physician 70, 133-140 Succinct statement of the findings that omega-3 fatty acids reduce the risk of cardiovascular disease. de Logeril, M., Salen, P., Martin, J.L., Monjaud, 1., Delaye, J., & Marnelle, N. (1 999) Mediterranean diet, traditional risk factors, and the rate of cardiovascular complications after myocardial infarc­ tion: final report of the Lyon Diet Hea1t Study. Circulation 99, 779-785. Mozaffarian, D., Katan, M.B., Ascherio, P.H., Starnpfer, M.J., & Willet, W.C. (2006) Trans fatty acids and cardiovascular disease. N Engl J Med. 354, 1601-1 6 1 3. A summaJy of the evidence that dietary trans fatty acids predis­ pose to coronaJy heart disease.

Key Terms Structural Lipids in Membranes

Terms in bold are defined ·in the glossary. fatty acid

343

acids ( PUFAs )

neutral glycolipids

polyunsaturated fatty triacylglycerols lipases

gangliosides

345 346

346

phospholipid glycolipids

349 349

glycerophospholipid ether lipid

350

plasmalogens

350 352 sphingolipids 352 ceramide 354 sphingomyelin 354 glycosphingolipids 354 cerebrosides 354 globosides 354 galactolipids

354

350

354 355 cholesterol 355 prostaglandins 358 thromboxanes 358 leukotrienes 359 vitamin 360 vitamin D3 360 cholecalciferol 360 sterols

vitamin A

360 361 tocopherols 36 1 vitamin K 361 dolichols 362 (retinol)

vitamin

E

lipidome

366

Bogdanov, M. & Dowhan, W. ( 1 999) Lipid-assisted protein folding. J. Biol. Chem 274, 36,827-36,830 A minireview of the role of membrane lipids in the folding of membrane proteins. De Rosa, M. & Garnbacorta, A. (1 988) The lipids of archaebacte­ ria Frog Lipid Res . 27, 153-1 75. Dowhan, W. ( 1 997) Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232. Gravel, R.A., Kaback, M.M., Proia, R., Sandhoff, K., Suzuki, K., & Suzuki, K. (2001) The GM2 gangliosidoses. In The Metabolic and Molecular Bases of Inherited Disease, 8th edn (Scriver, C.R., Sly, W.S., Childs, B . , Beaudet, AL., Valle, D. , Kinzler, K.W., & Vogelstein, B., eds), pp. 3827-3876, McGraw-Hill, Inc., New York. This article is one of many in a four-volume set that contains de­ finitive descriptions of the clinical, biochemical, and genetic aspects of hundreds of human metabolic diseases-an authOJitative source and fascinating reading. Hoekstra, D. ( ed. ). ( 1 994) Cell Lipids, Current Topics in Mem­ branes, Vol. 4, Academic Press, Inc , San Diego.

Lipids as Signals, Cofactors, and Pigments Bell, R.M., Exton, J.H., & Prescott, S.M. (eds). ( 1 996) Lipid

Further Reading

Second Messengers , Handbook of Lipid Research, VoL 8, Plenum

General

Press, New York.

Fahy, E., Subramaniam, S., Brown, H.A., Glass, C.K., Merrill, A.H., Jr. , Murphy, R.C., Raetz, C.R.H., Russell, D.W., Seyarna, Y. , Shaw, W., Shimizu, T., Spener, F., van Meers, G., Van­ Nieuwenhze, M.S., White, S.H., Witzturn, J.L., & Dennis, E.A. (2005) A comprehensive classification system for lipids J. Lipid Res 46, 839-862. A new system of nomenclature for biological lipids, separating them into eight major categories The defmitive reference on lipid classification

Binkley, N.C. & Suttie, J.W. ( 1 995) Vitamin K nutrition and osteoporosis. J. Nutr. 125, 1 8 1 2-1 82 1 .

Gurr, M.I., Harwood, J.L., & Frayn, K.N. (2002) Lipid Biochem­ istry: An Introduction, 5th edn, Blackwell Science Ltd., Oxford. A good general resource on lipid structure and metabolism, at the intermediate level. Vance, D.E. & Vance, J.E. (eds). (2002) Biochemistry of Lipids, Upoproteins, and Membranes, New Comprehensive Biochemistry, Vol 36, Elsevier Science Publishing Co., Inc., New York An excellent collection of reviews on various aspects of lipid structure, biosynthesis, and function.

Brigelius-Flohe, R. & Traber, M.G. (1 999) Vitamin E: function and metabolism. FASEB J 13, 1 145-1 1 55.

Chojnacki, T. & Dallner, G. ( 1988) The biological role of dolichol.

Biochem J. 251, 1-9.

Clouse, S.D. (2002) Brassinosteroid signal transduction: clarifying the pathway from ligand perception to gene expression. Mol Cell 10, 973-982

Lemmon, M.A. & Ferguson, K.M. (2000) Signal-dependent mem­ brane targeting by pleckstrin homology (PH) domains. Biochem. J. 350, 1-18 Prescott, S.M., Zimmerman, G.A., Stafforini, D.M., & Mcintyre, T.M. (2000) Platelet-activating factor and related lipid mediato rs . Annu. Rev Biochem 69, 4 1 9-445. Schneiter, R. ( 1 999) Brave little yeast, please guide us to Thebes: sphingolipid function in S. cerevisiae BioEssays 2 1 , 1004-1010.

[368]

lipids

Suttie, J.W. ( 1 993) Synthesis o f vitamin K-dependent proteins. FASEB J 7, 445-452.

Vermeer, C. (1990) y-Carboxyglutamate-containing proteins and the vitamin K-dependent carboxylase . Biochem J. 266, 625-636 . Describes the biochemical basis for the requirement of vitamin K in blood clotting and the importance of carboxylation in the synthesis of the blood-clotting protein thrombin. Viitala, J. & Jiirnefelt, J. ( 1 985) The red cell surface revisited. Trends Biochem. Sci. 10, 392-395. Includes discussion of the human A, B, and 0 blood type determinants. Weber, H. (2002) Fatty acid-derived signals in plants. Trends Plant SC'i 7, 2 1 7-224. Zittermann, A. (2001) Effects of vitamin K on calcium and bone metabolism. Curr Opin Clin Nutr Metab Care 4, 483-487 Working with Lipids

Christie, W.W. ( 1 998) Gas chromatography-mass spectrometry methods for structural analysis of fatty acids Lipids 33, 343-353 . A detailed description of the methods used to obtain data such as those presented in Figure 1 0-25.

(a) What structural aspect of these IS-carbon fatty acids can be correlated with the melting point? (b) Draw all the possible triacylglycerols that can be con­ structed from glycerol, palmitic acid, and oleic acid. Rank them in order of increasing melting point. (c) Branched-chain fatty acids are found in some bacterial membrane lipids. Would their presence increase or decrease the fluidity of the membranes (that is, give them a lower or higher melting point)? Why?

3. Preparation of Bearnaise Sauce During the prepara­

tion of bearnaise sauce, egg yolks are incorporated into melted butter to stabilize the sauce and avoid separation . The stabiliz­ ing agent in the egg yolks is lecithin (phosphatidylcholine) . Suggest why this works.

4. Isoprene Units in Isoprenoids Geraniol, farnesol, and squalene are called isoprenoids, because they are synthesized

from five-carbon isoprene units. In each compound, circle the five-carbon units representing isoprene units (see Fig. 1 0 -22) .

Christie, W.W. (2003) Lipid Analysis, 3rd edn, The Oily Press, Bridgwater, England. German, J.B., Gillies, L.A., Smilowitz, J.T., Zivkovic, A.M., & Watkins, S.M. (2007) Lipidomics and lipid profiling in metabolomics. Curr Opin Lipidol. 18, 66-71 Short review of the goals and methods of lipidomics. Griffiths, W., Desiderio, D.M., & Nibbering, N.M. (2007) Lipid Mass Spectrometry in Metabolomics and Systems Biology, Wiley InterScience, New York.

OH Geraniol

OH

Hamilton, R.J. & Hamilton, S. (eds). (1 992) Lipid Analysis. A Practical Approach, IRL Press, New York. This text, now out of print, is available as part of the IRL Press Practical Approach Series on CD-ROM, from Oxford University Press (www.oup-usa.org/acadsci/pasbooks .html) Matsubara, T. & Hagashi, A. ( 1 99 1 ) FAB/mass spectrometry of lipids. Frog Lipid Res 30, 301-322 An advanced discussion of the identification of lipids by fast atom bombardment (FAB) mass spectrometry, a powerful technique for structure determination Watson, A.D. (2006) Lipidomics: a global approach to lipid analysis in biological systems . J Lipid Res 47, 2 1 01-2 1 1 1 . A short, intermediate-level review of the classes of lipids, the methods for extracting and separating them, and mass spectrometric means for identifying and quantifying all lipids in a given cell, tissue, or organelle. Wenk, M.R. (2005) The emerging field of lipidomics. Nat. Rev. Drug

Squalene

Discov. 4, 594-61 0.

Intermediate-level discussion of the methods of lipidomics and the potential of this approach in biomedical research and drug development.

ties; the one on the left smells like spearmint, and that on the right, like caraway. Name the compounds using the RS system.

Problems 1. Operational Definition of Lipids How is the definition

of "lipid" different from the types of definitions used for other biomolecules that we have considered, such as amino acids, nucleic acids, and proteins?

2. Melting Points of Lipids The melting points of a series

69.6 °C; oleic acid, -5 °C ; and linolenic acid, - 1 1 °C .

of 18-carbon fatty acids are: stearic acid, 1 3 . 4 °C; linoleic acid,

5 . Naming Lipid Stereoisomers The two compounds be­ low are stereoisomers of carvone with quite different proper­

Problems

6. RS Designations for Alanine and Lactate Draw (using wedge-bond notation) and label the (R) and

(S)

isomers of

(a) All detergents are amphipathic. What are the hy­ drophilic and hydrophobic portions of lysolecithin?

2-aminopropanoic acid (alanine) and 2-hydroxypropanoic acid (lactic acid) .

H2N /

I

[3 69]

(b) The pain and inflammation caused by a snake bite can be treated with certain steroids. What is the basis of this

I

H

H

C

C

� COOH

OH /

CH3

2-Aminopropanoic acid (alanine)

treatment? (c) Though the high levels of phospholipase A2 in venom

� COOH CH3

2-Hydroxypropanoic acid (lactic acid)

can be deadly, this enzyme is necessary for a variety of normal metabolic processes. What are these processes?

15. Lipids in Blood Group Determination We note in Fig­ ure 1 0- 1 5 that the structure of glycosphingolipids determines the blood groups A, B, and 0 in humans. It is also true that gly­

7. Hydrophobic and Hydrophilic Components of Mem­

coproteins determine blood groups. How can both statements

brane Lipids A common structural feature of membrane

be true?

lipids is their amphipathic nature. For example , in phos­ phatidylcholine, the two fatty acid chains are hydrophobic and the phosphocholine head group is hydrophilic. For each of the following membrane lipids, name the components that serve as

the

hydrophobic

and

hydrophilic

units:

(a)

phos­

phatidylethanolamine; (b) sphingomyelin; (c) galactosylcere­ broside; (d) ganglioside; (e) cholesterol.

8. Structure of Omega-6 Fatty Acid Draw the structure of the omega-6 fatty acid 1 6: 1 .

drogenation, used in the food industry, converts double bonds in

the fatty acids of the oil triacylg]ycerols to -CH2-CH2-. How

does this affect the physical properties of the oils?

10. Alkali Lability of Triacylglycerols A common proce­ dure for cleaning the grease trap in a sink is to add a product that contains sodium hydroxide. Explain why this works.

Lipid

Structure

the

hormone

vasopressin

stimulates

cleavage

of

phosphatidylinositol 4,5-bisphosphate by hormone-sensitive phospholipase C, two products are formed. What are they? Com­ pare their properties and their solubilities in water, and predict whether either would diffuse readily through the cytosol.

1 7 . Storage of Fat-Soluble Vitamins In contrast to water­ soluble vitamins, which must be part of our daily diet, fat-soluble vitamins can be stored in the body in amounts sufficient for many

9 . Catalytic Hydrogenation of Vegetable Oils Catalytic hy­

1 1 . Deducing

16. Intracellular Messengers from Phosphatidylinositols When

from

Composition

Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phos­ phate Could this be a glycerophospholipid? A ganglioside? A sphingomyelin?

months. Suggest an explanation for this difference.

18. Hydrolysis of Lipids Name the products of mild hydroly­ sis with dilute NaOH of (a) 1 -stearoyl-2,3-dipalmitoylglycerol;

(b)

1 -palmitoyl-2-oleoylphosphatidylcholine.

19. Effect of Polarity on Solubility Rank the following in order of increasing solubility in water: a triacylglycerol, a dia­ cylglycerol,

and a monoacylglycerol,

all containing only

palmitic acid.

20. Chromatographic Separation of Lipids A mixture of lipids is applied to a silica gel column, and the column is then washed with increasingly polar solvents. The mixture consists of phosphatidylserine, phosphatidylethanolamine,

12. Deducing Lipid Structure from Molar Ratio of Com­

phosphatidylcholine, cholesteryl palmitate (a sterol ester) ,

ponents Complete hydrolysis of a glycerophospholipid yields

sphingomyelin, palmitate, n-tetradecanol, triacylglycerol, and

_9 glycerol, two fatty acids ( 1 6: 1 (6 ) and 1 6 : 0) , phosphoric acid,

cholesterol. In what order will the lipids elute from the column?

and serine in the molar ratio 1 : 1 : 1 : 1 : 1 . Name this lipid and

Explain your reasoning.

draw its structure.

2 1 . Identification of Unknown Lipids Johann Thudichum,

13. Impermeability of Waxes What property of the waxy

who practiced medicine in London about 1 00 years ago, also

cuticles that cover plant leaves makes the cuticles imperme­

dabbled in lipid chemistry in his spare time. He isolated a vari­

able to water?

14. The Action of Phospholipases The venom

of the E astern diamondback rattler and the Indian cobra contains phospholipase A2 , which catalyzes the hy­ drolysis of fatty acids at the C-2 position of glycerophos­ pholipid s . The phospholipid breakdown product of this reaction is lysolecithin (lecithin is phosphatidylcholine) . At high concentrations, this and other lysophospholipids

ety of lipids from neural tissue, and characterized and named many of them. His carefully sealed and labeled vials of isolated lipids were rediscovered many years later. (a) How would you confirm, using techniques not avail­ able to Thudichum, that the vials labeled "sphingomyelin" and "cerebroside" actually contain these compounds? (b) How would you distinguish sphingomyelin from phos­ phatidylcholine by chemical, physical, or enzymatic tests?

act as detergents, dissolving the membranes of erythro­

22. Ninhydrin to Detect Lipids on TLC Plates Ninhydrin

cytes and lysing the cells. Extensive hemolysis may b e life­

reacts specifically with primary amines to form a purplish-blue

threatening.

product. A thin-layer chromatogram of rat liver phospholipids

is sprayed with ninhydrin, and the color is allowed to develop. Which phospholipids can be detected in this way?

Data Analysis Problem 23. Determining the Structure of the Abnormal Lipid in Thy-Sachs Disease Box 10-2 , Figure 1 , shows the pathway

of breakdown of gangliosides in healthy (normal) individuals and individuals with certain genetic diseases. Some of the data on which the figure is based were presented in a paper by Lars Svennerholm ( 1962) . Note that the sugar Neu5Ac, N-acetylneuraminic acid, represented in the Box 1 0-2 figure as + , is a sialic acid. Svennerholm reported that "about 90% of the monosia!io­ gangliosides isolated from normal human brain" consisted of a compound with ceramide, hexose, N-acetylgalactosamine, and N-acetylneuraminic acid in the molar ratio 1 :3 : 1 : 1 . (a) Which of the gangliosides (GMl through GM3 and glo­ boside) in Box 10-2, Figure 1, fits this description? Explain your reasoning. (b) Svennerholm reported that 90% of the gangliosides from a patient with Tay-Sachs had a molar ratio (of the same four components given above) of 1 :2 : 1 : 1 . Is this consistent with the Box 1 0-2 figure? Explain your reasoning. To determine the structure in more detail, Svennerholm treated the gangliosides with neuraminidase to remove the N­ acetylneuraminic acid. This resulted in an asialoganglioside that was much easier to analyze. He hydrolyzed it with acid collected the ceramide-containing products, and determine the molar ratio of the sugars in each product. He did this for both the normal and the Tay-Sachs gangliosides. His results are shown below.

d

Ganglioside Ceramide Glucose Galactose Galactosamine Normal Fragment 1 Fragment 2 Fragment 3 Fragment 4 Tay-Sachs Fragment 1 Fragment 2 Fragment 3

1 1 l

1 l 1

1 1

0 1 1 2

0 0 1 1

1

0

0 0 1

1

1

(c) Based on these data, what can you conclude about the structure of the normal ganglioside? Is this consistent with the structure in Box 10-2? Explain your reasoning. (d) What can you conclude about the structure of the Tay­ Sachs ganglioside? Is this consistent with the structure in Box 1 0-2? Explain your reasoning. Svennerholm also reported the work of other researchers who "permethylated" the normal asialoganglioside. Permethylation is the same as exhaustive methylation: a methyl group is added to every free hydroxyl group on a sugar. They found the following permethylated sugars: 2,3,6-trimethylglycopyranose; 2,3,4,6tetramethylgalactopyranose; 2,4,6-trimethylgalactopyranose; and 4,6-dimethyl-2-deoxy-2-aminogalactopyranose. (e) To which sugar of GM1 does each of the permethylated sugars correspond? Explain your reasoning. (f) Based on all the data presented so far, what pieces of information about normal ganglioside structure are missing? Reference

Svennerholm, L. ( 1 962) The chemical structure of normal human brain and Tay-Sachs gangliosides. Biochem Biophys Res Comm 9, 436-441 .

mak good neighbors. -Robert Fro I, "Mending Wall, " in North of Boston,

1�

Bio ogical embranes and Transport 1 1 .1

1 1 .2

1 1 .3

The Composition and Architecture of Membranes Membrane Dynamics

381

Sol ute Transport across Membranes

3 72

389

T

he first cell probably came into being when a mem­ brane formed, enclosing a small volume of aqueous solution and separating it from the rest of the uni­ verse. Membranes define the external boundaries of cells and regulate the molecular traffic across that boundary (Fig. 1 1- 1 ) ; in eukaryotic cells, they divide the internal space into discrete compartments to segre­ gate processes and components. They organize complex reaction sequences and are central to both biological en­ ergy conservation and cell-to-cell communication. The biological activities of membranes flow from their re­ markable physical properties. Membranes are flexible, self-sealing, and selectively permeable to polar solutes.

FIGURE 1 1 -1 Biological membranes. Viewed in cross section, a l l cell membranes share a characteristic trilaminar appearance. This erythro­ cyte was stained with osm i u m tetroxide and viewed with an electron

ture, 5 to 8 nm (50 to 80 Al thick. The tri laminar image consists of microscope. The plasma membrane appears as a three-layer struc­

two electron-dense layers (the osmi um, bound to the inner and outer surfaces of the membrane) separated by a less dense central region.

Their flexibility permits the shape changes that accom­ pany cell growth and movement (such as amoeboid movement) . With their ability to break and reseal, two membranes can fuse, as in exocytosis, or a single mem­ brane-enclosed compartment can undergo fission to yield two sealed compartments, as in endocytosis or cell division, without creating gross leaks through cellular surfaces. Because membranes are selectively perme­ able, they retain certain compounds and ions within cells and within specific cellular compartments, while excluding others. Membranes are not merely passive barriers. They include an array of proteins specialized for promoting or catalyzing various cellular processes . At the cell surface, transporters move specific organic solutes and inorganic ions across the membrane; receptors sense extracellular signals and trigger molecular changes in the cell; adhe­ sion molecules hold neighboring cells together. Within the cell, membranes organize cellular processes such as the synthesis of lipids and certain proteins, and the en­ ergy transductions in mitochondria and chloroplasts. Because membranes consist of just two layers of mole­ cules, they are very thin-essentially two-dimensional. Intermolecular collisions are far more probable in this two-dimensional space than in three-dimensional space, so the efficiency of enzyme-catalyzed processes organ­ ized within membranes is vastly increased. In this chapter we first describe the composition of cellular membranes and their chemical architecture­ the molecular structures that underlie their biological functions. Next, we consider the remarkable dynamic features of membranes, in which lipids and proteins move relative to each other. Cell adhesion, endocytosis, and the membrane fusion accompanying neurotransmit­ ter secretion illustrate the dynamic roles of membrane proteins. We then turn to the protein-mediated passage of solutes across membranes via transporters and ion channels. In later chapters we discuss the roles of mem­ branes in signal transduction (Chapters 12 and 23) , energy transduction (Chapter 1 9) , lipid synthesis (Chapter 2 1 ) , and protein synthesis (Chapter 27) .

[3 7 1]

[3 72]

Biological Membranes a n d Transport

1 1 .1 The Composition and Architecture of Mem branes One approach to understanding membrane function is to study membrane composition-to determine, for example, which components are common to all mem­ branes and which are unique to membranes with specific functions. So before describing membrane structure and function we consider the molecular components of mem­ branes: proteins and polar lipids, which account for almost all the mass of biological membranes, and carbohydrates, present as part of glycoproteins and glycolipids.

cardiolipin (Fig. 11-2); this distribution is reversed in the inner mitochondrial membrane, which has very low cholesterol and high cardiolipin. In all but a few cases, the functional significance of these combinations is not yet known. Plasma

� Q)

Q) 1'1 til .... ..0 Q)

Ei Ei

Q)

Each Type of Membrane Has Characteristic

� 0

..., til 0.. Q) ..0 ...,

Lipids and Proteins

The relative proportions of protein and lipid vary with the type of membrane (Table 1 1-1), reflecting the diversity of biological roles. For example, certain neurons have a myelin sheath, an extended plasma membrane that wraps around the cell many times and acts as a pas­ sive electrical insulator. The myelin sheath consists pri­ marily of lipids, whereas the plasma membranes of bacteria and the membranes of mitochondria and chloro­ plasts, the sites of many enzyme-catalyzed processes, contain more protein than lipid (in mass per total mass) . For studies of membrane composition, the first task is to isolate a selected membrane. When eukaryotic cells are subjected to mechanical shear, their plasma mem­ branes are torn and fragmented, releasing cytoplasmic components and membrane-bounded organelles such as mitochondria, chloroplasts, lysosomes, and nuclei. Plasma membrane fragments and intact organelles can be isolated by techniques described in Chapter 1 (see Fig. 1-8) and in Worked Example 2-1 , p. 53. Cells clearly have mechanisms to control the kinds and amounts of membrane lipid they synthesize and to target specific lipids to particular organelles. Each kingdom, each species, each tissue or cell type, and the organelles of each cell type have a characteristic set of membrane lipids. Plasma membranes, for example, are enriched in cholesterol and contain no detectable

til ll::

Inner mitochondrial Outer mitochondrial Lysosomal Nuclear Rough ER Smooth ER Golgi 0

40

20

60

80

Percent membrane lipid Cholesterol

• Cardiolipin 0 Minor lipids

• Sphingolipids � Phosphatidylcholine � Phosphatidylethanolamine

FIGURE 11-2 Lipid composition of the plasma membrane and or­

ganelle membranes of a rat hepatocyte. The functional spec i a l i zation

of each membrane type is reflected in its u n ique l i p i d composition. Cholesterol is prominent in plasma membranes but barely detectable i n m itochondrial membranes. Cardiolipin is a major component of the i n ner m itochondrial membrane but not of the p l asma membrane . Phosphatidylserine, phosphatidy l i nositol, and phosphatidylglycerol are relatively m i nor components (yellow) of most membranes but serve critical functions; phosphatidyl i nositol and its derivatives, for example, are i mportant in signal transductions triggered by hormones. Sphi n ­ gol ipids, phosphatidylcholi ne, and phosphatidylethanol a m i n e are present in most membranes, but in varyi n g proportions. G lycolipi ds, which are major components of the chloroplast membranes of plants, are virtually absent from animal cells.

TA BLE 1 1 - 1

Components (% by weight)

Human myelin sheath

Protein

Phospholipid

Sterol

Sterol type

Other lipids

30

30

19

Cholesterol

Galactolipids, plasmalogens

Cholesterol

Mouse liver

45

27

25

Maize leaf

47

26

7

Sitosterol

Galactolipids

Yeast

52

7

4

Ergosterol

Triacylglycerols, steryl esters

Paramecium (ciliated protist)

56

40

4

Stigmasterol

E. coli

75

25

0

Note: Values do not add up to 100% in every case, because there are components other than protein , phospholipids, and sterol; plants, for example, have high levels of glycolipids.

1 1 . 1 The Composition a n d Architecture of Mem branes

The protein composition of membranes from differ­ ent sources varies even more widely than their lipid composition, reflecting functional specialization. In ad­ dition, some membrane proteins are covalently linked to oligosaccharides. For example, in glycophorin, a glyco­ protein of the erythrocyte plasma membrane, 60% of the mass consists of complex oligosaccharides cova­ lently attached to specific amino acid residues . Ser, Thr, and Asn residues are the most common points of attach­ ment (see Fig. 7-29) . The sugar moieties of surface gly­ coproteins influence the folding of the proteins, as well as their stability and intracellular destination, and they play a significant role in the specific binding of ligands to glycoprotein surface receptors (see Fig. 7-35) . Some membrane proteins are covalently attached to one or more lipids, which serve as hydrophobic anchors that hold the proteins to the membrane, as we shall see.

tion of individual protein and lipid molecules within membranes, led to the development of the fluid mo­ saic model for the structure of biological membranes (Fig. 11-3). Phospholipids form a bilayer in which the nonpolar regions of the lipid molecules in each layer face the core of the bilayer and their polar head groups face outward, interacting with the aqueous phase on either side. Proteins are embedded in this bilayer sheet, held by hydrophobic interactions between the membrane lipids and hydrophobic domains in the pro­ teins. Some proteins protrude from only one side of the membrane; others have domains exposed on both sides. The orientation of proteins in the bilayer is asymmetric, giving the membrane "sidedness": the protein domains exposed on one side of the bilayer are different from those exposed on the other side, reflect­ ing functional asymmetry. The individual lipid and pro­ tein units in a membrane form a fluid mosaic with a pattern that, unlike a mosaic of ceramic tile and mor­ tar, is free to change constantly. The membrane mosaic is fluid because most of the interactions among its components are noncovalent, leaving individual lipid and protein molecules free to move laterally in the plane of the membrane. We now look at some of these features of the fluid mosaic model in more detail and consider the experi­ mental evidence that supports the basic model but has necessitated its refinement in several ways.

All Biological Membranes Share Some Fundamental Properties

Membranes are impermeable to most polar or charged solutes, but permeable to nonpolar compounds ; they are 5 to 8 nm (50 to 80 A) thick and appear trilaminar when viewed in cross section with the electron micro­ scope (Fig. 1 1-1). The combined evidence from elec­ tron microscopy and studies of chemical composition, as well as physical studies of permeability and the mo-

/

Glycolipid



[3 7 3]

Oligo accharide

• C chains of

glycoprotein

Outside

'}

Lipid bilayer

lnside

Sterol

� Integral protein

(single trans­ membrane helix)

)

;

Phospholipid polar heads

Peripheral protein

FIGURE 11-3 Fluid mosaic model for membrane structure. The fatty

movement of either from one leaflet of the b i layer to the other is re­

acyl chains in the i nterior of the membrane form a flu id, hydrophobic

stricted. The carbohydrate moieties attached to some proteins and

region. Integral proteins float i n this sea of l i p i d, held by hydrophobic

l ipids of the plasma membrane are exposed on the extracel l u lar sur­

i nteracti ons with their nonpolar a m i no acid side chains. Both proteins

face of the membrane.

and l i p i ds are free to move lateral l y i n the plane of the b i l ayer, but

[}74]

Biological Mem bra n es a n d Tra nsport

A lipid B ilayer Is the Basic Structural Element of Membranes

Glycerophospholipids, sphingolipids, and sterols are vir­ tually insoluble in water. When mixed with water, they spontaneously form microscopic lipid aggregates, clus­ tering together, with their hydrophobic moieties in con­ tact with each other and their hydrophilic groups interacting with the surrounding water. This clustering reduces the amount of hydrophobic surface exposed to water and thus minimizes the number of molecules in the shell of ordered water at the lipid-water interface (see Fig. 2-7), resulting in an increase in entropy. Hy­ drophobic interactions among lipid molecules provide the thermodynamic driving force for the formation and maintenance of these clusters . Depending on the precise conditions and the nature of the lipids, three types of lipid aggregate can form when amphipathic lipids are mixed with water (Fig. 1 1- 4 ). Micelles are spherical structures that contain anywhere from a few dozen to a few thousand amphi­ pathic molecules. These molecules are arranged with their hydrophobic regions aggregated in the interior, where water is excluded, and their hydrophilic head groups at the surface, in contact with water. Micelle for­ mation is favored when the cross-sectional area of the head group is greater than that of the acyl side chain(s), as in free fatty acids, lysophospholipids (phospholipids lacking one fatty acid), and detergents such as sodium dodecyl sulfate (SDS; p. 89) . A second type of lipid aggregate in water is the bi­ layer, in which two lipid monolayers (leaflets) form a two-dimensional sheet. Bilayer formation is favored if the cross-sectional areas of the head group and acyl side chain(s) are similar, as in glycerophospholipids and sphingolipids. The hydrophobic portions in each mono­ layer, excluded from water, interact with each other. The

Individual units are wedge-shaped (cross section of head greater than that of side chain)

(a) Micelle

hydrophilic head groups interact with water at each sur­ face of the bilayer. Because the hydrophobic regions at its edges (Fig. ll-4b) are in contact with water, the bilayer sheet is relatively unstable and spontaneously folds back on itself to form a hollow sphere, a vesicle (Fig. 11-4c). The continuous surface of vesicles eliminates exposed hydrophobic regions, allowing bilayers to achieve maxi­ mal stability in their aqueous environment. Vesicle forma­ tion also creates a separate aqueous compartment. It is likely that the precursors to the first living cells resem­ bled lipid vesicles, their aqueous contents segregated from their surroundings by a hydrophobic shell. The lipid bilayer is 3 nm (30 A) thick. The hydrocar­ bon core, made up of the -CH2- and -CH3 of the fatty acyl groups , is about as nonpolar as decane, and vesicles formed in the laboratory from pure lipids (lipo­ somes) are essentially impermeable to polar solutes, as is the lipid bilayer of biological membranes (although the latter, as we shall see, are permeable to solutes for which they have specific transporters). Plasma membrane lipids are asymmetrically distrib­ uted between the two monolayers of the bilayer, although the asymmetry, unlike that of membrane proteins, is not absolute. In the plasma membrane of the erythrocyte, for example , choline-containing lipids (phosphatidyl­ choline and sphingomyelin) are typically found in the outer (extracellular, or exoplasmic) leaflet (Fig. 1 1- 5 ), whereas phosphatidylserine, phosphatidylethanolamine, and the phosphatidylinositols are much more common in the inner (cytoplasmic) leaflet. Changes in the distri­ bution of lipids between plasma membrane leaflets have biological consequences . For example, only when the phosphatidylserine in the plasma membrane moves into the outer leaflet is a platelet able to play its role in for­ mation of a blood clot. For many other cell types, phos­ phatidylserine exposure on the outer surface marks a cell for destruction by programmed cell death.

Individual units are cylindrical (cross section of head equals that of side chain)

(b) Bilayer

Aqueous cavity

(c) Vesicle

FIGURE 11-4 Amphipathic lipid aggregates that form in water. (a) In

edges of the sheet are protected from i nteraction with water. (c) When

m icel les, the hydrophobic chains of the fatty acids are sequestered at

a two-d i mensional bilayer folds on itself, it forms a closed b i l ayer, a

the core of the sphere. There is virtually no water i n the hydrophobic

three-di mensional hollow vesicle ( l i posome) enclosing an aqueous

interior. (b) I n an open b i l ayer, all acyl side chains except those at the

cavity.

1 1 . 1 The Composition and Architecture of Mem branes

Membrane phospholipid

Percent of total membrane phospholipid

100 Phosphatidylethanolamine

30

Phosphatidylcholine

27

Sphingomyelin

23

Phosphatidylserine

15

Phosphatidylinositol 4,5-bisphosphate

0

Outer monolayer

100

-

• l

Phosphatidylinositol Phosphatidylinositol 4-phosphate

Amphil.ropic protein

Distribution in membrane Inner monolayer

[3 7 5]

5

protein

Phosphatidic acid FIGURE 11-5 Asymmetric distribution of phospholipids between

Integral protein (hydrophobic domain coated with detergent)

the inner and outer monolayers of the erythrocyte plasma mem­ brane. The distribution of a specific phosphol ipid i s determi ned by

treating the intact cel l with phospholipase C, which cannot reach

FIGURE 11-6 Peripheral, integral, and amphitropic proteins. Mem­

lipids in the inner monolayer (leaflet) but removes the head groups of

brane proteins can be operationally distinguished by the conditions re­

l ipids in the outer monolayer. The proportion of each head group re­

q u i red to release them from the membrane. Most peripheral proteins are released by changes in pH or ionic strength, removal of Ca 2 + by a

leased provides an estimate of the fraction of each l i pid i n the outer monol ayer.

chelating agent, or addition of urea or carbonate. I ntegral p roteins are extractable with detergents, which di srupt the hydrophobic interac­ tions with the l i p i d b i l ayer and form m icel le-l i ke clusters around i ndi­

Three Types of Membrane Proteins Differ in Their Association with the Membrane

Integral membrane proteins are very firmly associ­ ated with the lipid bilayer, and are removable only by agents that interfere with hydrophobic interactions, such as detergents , organic solvents, or denaturants (Fig. 1 1- 6 ) . Peripheral membrane proteins associ­ ate with the membrane through electrostatic interac­ tions and hydrogen bonding with the hydrophilic domains of integral proteins and with the polar head groups of membrane lipids. They can be released by relatively mild treatments that interfere with electro­ static interactions or break hydrogen bonds; a commonly used agent is carbonate at high pH. Amphitropic proteins are found both in the cytosol and in associ­ ation with membranes. Their affinity for membranes results in some cases from the protein's noncovalent interaction with a membrane protein or lipid, and in other cases from the presence of one or more lipids covalently attached to the amphitropic protein (see Fig. 11-14). Generally, the reversible association of amphitropic proteins with the membrane is regu­ lated; for example, phosphorylation or ligand binding can force a conformational change in the protein, ex­ posing a membrane-binding site that was previously inaccessible.

vidual prote i n molecules. I ntegral proteins cova lently attached to a membrane l i pid, such as a glycosyl phosphatidy l i nositol (GPI; see Fig. 1 1 - 1 4), can be released by treatment with phospholipase C. Am­ phitropic proteins are sometimes associated with membranes and sometimes not, dependi n g on some type of regulatory process such as reversible palm itoylation .

Many Membrane Proteins Span the lipid B ilayer

Membrane protein topology (the localization of protein domains relative to the lipid bilayer) can be deter­ mined with reagents that react with protein side chains but cannot cross membranes-polar chemical reagents that react with primary amines of Lys residues, for ex­ ample, or enzymes such as trypsin that cleave proteins but cannot cross the membrane . The human erythro­ cyte is convenient for such studies because it has no membrane-bounded organelles; the plasma membrane is the only membrane present. If a membrane protein in an intact erythrocyte reacts with a membrane-im­ permeant reagent, that protein must have at least one domain exposed on the outer (extracellular) face of the membrane. Trypsin cleaves extracellular domains but does not affect domains buried within the bilayer or exposed on the inner surface only, unless the plasma membrane is broken to make these domains accessible to the enzyme.

[376]

Biological M e m b ra n e s a n d Tra nsport

Experiments with such topology-specific reagents

that each has a specific orientation in the bilayer, giving

glycophorin

the membrane a distinct sidedness. For glycophorin,

spans the plasma membrane. Its amino-terminal domain

and for all other glycoproteins of the plasma membrane,

(bearing the carbohydrate chains) is on the outer surface

the glycosylated domains are invariably found on the

show that the erythrocyte glycoprotein

and is cleaved by trypsin. The carboxyl terminus pro­

extracellular face of the bilayer. As we shall see, the

trudes on the inside of the cell, where it cannot react with

asymmetric arrangement of membrane proteins results

impermeant reagents. Both the amino-terminal and car­

in functional asymmetry. All the molecules of a given ion

boxyl-terminal domains contain many polar or charged

pump, for example, have the same orientation in the

amino acid residues and are therefore hydrophilic. How­

membrane and pump ions in the same direction.

ever, a segment in the center of the protein (residues to

93)

75

contains mainly hydrophobic amino acid residues,

suggesting that glycophorin has a transmembrane seg­ ment an·anged as shown in

Figure 1 1-7.

These noncrystallographic experiments also revealed that the orientation of glycophorin in the membrane is asymmetric: its amino-terminal segment is always on the outside. Similar studies of other membrane proteins show

Integral Proteins Are Held in the Membrane by Hydrophobic I nteractions with lipids The firm attachment of integral proteins to membranes is the result of hydrophobic interactions between mem­ brane lipids and hydrophobic domains of the protein. Some proteins have a single hydrophobic sequence in the middle (as in glycophorin) or at the amino or carboxyl terminus. Others have multiple hydrophobic sequences, each of which, when in the a-helical conformation, is long enough to span the lipid bilayer

(Fig. 1 1-8 ).

One of the best-studied membrane-spanning pro­ teins, bacteriorhodopsin, has seven very hydrophobic in­ ternal sequences and crosses the lipid bilayer seven times. Bacteriorhodopsin is a light-driven proton pump densely packed in regular arrays in the purple membrane

of the bacterium Halo bacterium salinarum. X-ray crys­

tallography reveals a structure with seven a-helical seg­

ments, each traversing the lipid bilayer, connected by nonhelical loops at the inner and outer face of the mem­ brane

(Fig. 11-H ). In the amino acid sequence of bacte­ 20 hydrophobic residues can be identified, each forming an a helix that riorhodopsin, seven segments of about

spans the bilayer. The seven helices are clustered to­ gether and oriented not quite perpendicular to the bilayer plane, a pattern that (as we shall see in Chapter

12) is a

common motif in membrane proteins involved in signal reception. Hydrophobic interactions between the nonpo­ lar amino acids and the fatty acyl groups of the membrane loside

lipids firmly anchor the protein in the membrane. Crystallized membrane proteins solved (i.e., their molecular structure deduced) by crystallography often include molecules of phospholipids, which are pre­ sumed to be positioned in the crystals as they are in the native membranes. Many of these phospholipid mole­ cules lie on the protein surface, their head groups inter­ acting with polar amino acid residues at the inner and

131

FIGURE 11-7 Transbilayer disposition of glycophorin in an erythro­ cyte. One hydrophi l ic domain, conta i n ing a l l the sugar residues, is on

the outer su rface, and another hydrop h i l i c dom a i n protrudes from the i nner face of the membrane. Each red hexagon represents a tetrasac­ charide (conta i n i n g two NeuSAc (sial ic acid), Gal, and Gai NAc) 0/ i n ked to a Ser or Thr residue; the blue hexagon represents a n

outer membrane-water interfaces and their side chains associated with nonpolar residues. These annular lipids form a bilayer shell (annulus) around the protein, oriented roughly as expected for phospholipids in a bi­ layer

(Fig. 1 1-10). Other phospholipids are found at

the interfaces between monomers of multisubunit mem­

ol igosaccharide N-l i n ked t o an A s n residue. The relative size o f the

brane proteins, where they form a "grease seal." Yet oth­

o l i gosaccharide u n its i s larger than shown here. A segment of 1 9 hy­

ers are embedded deep within a membrane protein,

drophobic residues (residues 75 to 93) forms an

often with their head groups well below the plane of the

a hel ix that traverses

the membrane b i l ayer (see Fig. 1 1 -1 1 a). The segment from residues

bilayer. For example, succinate dehydrogenase (Com­

64 to 74 has some hydrophobic residues and probably penetrates the

plex II, found in mitochondria; see Fig.

outer face of the lipid b i layer, as shown.

19-10) has sev­

eral deeply embedded phospholipid molecules.

1 1 . 1 The Com position a n d Architect u re of Mem branes

[3 77]

Type I

\

Type III

arboxyl terminus

FIGURE 11-9 Bacteriorhodopsin, a membrane-spanning protein. (PDB ID 2AT9) The s i ngle polypeptide cha i n folds i nto seven hy­ drophobic

a hel ices, each of which traverses the l i p i d b i layer rough l y

perpend icular t o t h e p l a n e o f t h e membrane. The seven transmem­ Type IV

brane helices are clustered, and the space around and between them is filled with the acyl chains of membrane l i pids. The l i ght-absorbi ng pigment retinal (see Fig. 1 0-2 1 ) is buried deep in the membrane i n contact with several of the helical segments (not shown). The hel i ces are colored to correspond with the hydropathy plot in Figure 1 1 -1 1 b .

TypeV

Type VI

FIGURE 11-8

Integral membrane proteins.

For known proteins of

the plasma membrane, the spatial relations h i ps of protein domains to the lipid b i l ayer fal l i nto six categories. Types I and II have a s i ngle transmembrane hel ix; the ami no-terminal domain i s outside the cell in type I proteins and ins ide i n type II. Type Ill proteins have multiple transmembrane hel ices i n a s i ngle polypeptide. I n type I V proteins, transmembrane domains of several different polypeptides assemble to form a channel through the membrane. Type V proteins are held to the b i layer primarily by cova lently l i n ked lipids (see Fig. 1 1 -1 4), and type VI proteins have both transmembrane helices and l i pid (GPJ) anchors. In this figure, and i n figu res throughout the book, we represent transmembrane protein segments in their most l ikely conformations: as

a hel ices of six to seven turns. Sometimes these hel ices are shown sim­ ply as cylinders. As relatively few membrane protein structures have

been deduced by x-ray crysta l lography, our representation of the ex­ tramembrane doma ins is arbitrary and not necessari ly to scale.

proteins. (a) The crystal structure of sheep aquaporin (PDB JD 2860),

depicted as a green surface representation. ( b ) The crysta l structure of the F0 i ntegral protein complex of the V-type Na + -ATPase from Entero·

FIGURE 11-10 Lipid annuli associated with two i ntegral membrane a transmembrane water channel, i ncludes a shell of phosphol i pids po­

coccus hirae (PDB ID 2Bl2) has 1 0 identical subun its, each with four

siti oned with their head groups (bl ue) at the expected pos itions on the

transmembrane helices, surrou nding a centra l cavity fil led with phos­

i n ner and outer membrane su rfaces and their hydrophobic acyl chains

phatidylglycerol (PG). Here five of the subu n i ts have been cut away to

(gold) inti mately associated with the surface of the prote i n exposed to

reveal the PG molecules associated with each subunit around the inte­

the b i l ayer. The l ipid forms a "grease seal" around the protein, which i s

rior of this structure.

[378]

Biological M e m b ra n e s a n d Transport

The Topology of an I ntegra l Membrane Protein Can Sometimes Be Predicted from Its Sequence



3

£ .....

0

-o c

Determination of the three-dimensional structure of a

t.

brane proteins, but relatively few three-dimensional

-3

0

100

50

Residue number

100

50

0

structures have been established by crystallography or NMR spectroscopy. The presence of unbroken sequences

130

t Hydrophobic Hydrophilic

130

t

(a) Glycophorin

of more than 20 hydrophobic residues in a membrane protein is commonly taken as evidence that these se­ quences traverse the lipid bilayer, acting as hydrophobic

50

anchors or forming transmembrane channels. Virtually all integral proteins have at least one such sequence. Application of this logic to entire genomic sequences leads to the conclusion that in many species, 20% to 30% of all proteins are integral membrane proteins. What can we predict about the secondary structure of the membrane-spanning portions of integral pro­ teins? An a-helical sequence of 20 to 25 residues is just long enough to span the thickness (30

A)

of the

lipid bilayer (recall that the length of an a helix is 1.5

A

(0.15 nm) per amino acid residue). A polypeptide chain surrounded by lipids, having no water molecules with which to hydrogen-bond, will tend to form

a

� � -o

t Hydrophobic Hydrophilic

.s

>.



0

::c:

-3

0. 0 .... -o >.

10

50

Residue number 100

150

200

250



(b) Bacteriorhodopsin

helices or {3

FIGURE 11-11 Hydropathy plots. Hydropathy i ndex (see Table 3-1 ) i s

sheets, in which intrachain hydrogen bonding is maxi­

plotted against residue number for two i ntegral membrane proteins.

mized. If the side chains of all amino acids in a helix are

The hydropathy i ndex for each a m i no acid residue i n a sequence of

nonpolar, hydrophobic interactions with the surround­

defined length, or "window," i s used to calcu late the average hy­

ing lipids further stabilize the helix.

dropathy for that wi ndow. The horizontal axis shows the residue num­

Several simple methods of analyzing amino acid

ber i n the m iddle of the window. (a) G l ycophori n from h uman

sequences yield reasonably accurate predictions of

erythrocytes has a s i ngle hydrophobi c sequence between residues 75

secondary structure for transmembrane proteins. The

a n d 93 (yellow); compare t h i s w i th Figure 11-7. (b) Bacteri­

relative polarity of each amino acid has been deter­

orhodopsin, known from i ndependent physical studies to have seven

mined experimentally by measuring the free-energy change accompanying the movement of that amino acid side chain from a hydrophobic solvent into water. This free energy of transfer, which can be expressed as a

transmembrane hel i ces (see Fig. 1 1 -9), has seven hydrophobic re­ gions. N ote, however, that the hydropathy plot is ambiguous in the re­ gion of segments 6 and 7. X-ray crysta l lography has confirmed that this region has two transmembrane segments.

hydropathy index (see Table 3-1), ranges from

very exergonic for charged or polar residues to very

structure are scanned in this way, we find a reasonably

endergonic for amino acids with aromatic or aliphatic

good correspondence between predicted and known

hydrocarbon side chains. The overall hydropathy index

membrane-spanning segments. Hydropathy analysis

(hydrophobicity) of a sequence of amino acids is esti­

predicts a single hydrophobic helix for glycophorin

mated by summing the free energies of transfer for the

(Fig. 11-lla) and seven transmembrane segments for

residues in the sequence. To scan a polypeptide se­

bacteriorhodopsin (Fig. 11-llb)-in agreement with

quence for potential membrane-spanning segments, an

experimental studies.

investigator calculates the hydropathy index for suc­

On the basis of their amino acid sequences and hy­

cessive segments (called windows) of a given size,

dropathy plots, many of the transport proteins de­

7 to 20 residues. For a window of seven residues, 7, 2 to 8, 3 to 9, and so on, are plotted as in Figure 1 1- 1 1 (plotted for the middle residue in each window-residue 4 for residues 1 to 7, for example). A region with more than from

scribed in this chapter are believed to have multiple

for example, the indices for residues 1 to

membrane-spanning helical regions-that is, they are type III or type IV integral proteins (Fig. 11-8). When predictions are consistent with chemical studies of pro­ tein localization (such as those described above for gly­

20 residues of high hydropathy index is presumed

cophorin and bacteriorhodopsin), the assumption that

to be a transmembrane segment. When the sequences

hydrophobic regions correspond to membrane-spanning

of membrane proteins of known three-dimensional

domains is much better justified.

1 1 .1 The Composition a n d Arch itecture of Memb ranes

[379]

• Charged residues • Trp OTyr

K+

channel

Maltoporin

FIGURE 11-12 Tyr and Trp residues of membrane proteins clustering at the water-lipid interface. The detai led structures of these five i nte­

Outer membrane phospholipase A

OmpX

Phosphoporin E

E (PDB 10 1 PHO) are p roteins of the outer membrane of E. coli.

Residues of Tyr (orange) and Trp (red) are found p redom i nantly where

gral membrane proteins are known from crystallographic studies. The

the nonpolar region of acyl chai ns meets the polar head group region.

K+ channel (PDB ID 1 BLB) is from the bacterium Streptomyces lividans

Charged residues (Lys, Arg, Glu, Asp; shown i n b l ue) are found almost

(see Fig. 1 1 -48); maltoporin (PDB I D 1 AF6), outer membrane phospho­

exclusively in the aqueous phases.

lipase A (PDB ID 1 QDS), OmpX (PDB ID 1 QJ9), and phosphoporin

A further remarkable feature of many transmem­ brane proteins of known structure is the presence of Tyr and Trp residues at the interface between lipid and wa­ ter (Fig. 1 1-12). The side chains of these residues ap­ parently serve as membrane interface anchors, able to interact simultaneously with the central lipid phase and the aqueous phases on either side of the membrane. An­ other generalization about amino acid location relative to the bilayer is described by the positive-inside rule: the positively charged Lys, His, and Arg residues of membrane proteins occur more commonly on the cyto­ plasmic face of membranes. Not all integral membrane proteins are composed of transmembrane a helices. Another structural motif com­ mon in bacterial membrane proteins is the fJ barrel (see Fig. 4-17b), in which 20 or more transmembrane seg­ ments form {3 sheets that line a cylinder (Fig. 1 1-13). The same factors that favor a-helix formation in the hy­ drophobic interior of a lipid bilayer also stabilize {3

FepA

OmpLA

Maltoporin

barrels: when no water molecules are available to hydrogen-bond with the carbonyl oxygen and nitrogen of the peptide bond, maximal intrachain hydrogen bonding gives the most stable conformation. Planar {3 sheets do not maximize these interactions and are generally not found in the membrane interior; {3 barrels allow all possi­ ble hydrogen bonds and are apparently common among membrane proteins. Porins, proteins that allow certain polar solutes to cross the outer membrane of gram­ negative bacteria such as E. coli, have many-stranded f3 barrels lining the polar transmembrane passage. A polypeptide is more extended in the {3 conforma­ tion than in an a helix; just seven to nine residues of f3 conformation are needed to span a membrane. Recall that in the f3 conformation, alternating side chains project above and below the sheet (see Fig. 4--6). In f3 strands of membrane proteins, every second residue in the mem­ brane-spanning segment is hydrophobic and interacts with the lipid bilayer; aromatic side chains are commonly found at the lipid-protein interface. The other residues may or may not be hydrophilic. The hydropathy plot is not useful in predicting transmembrane segments for proteins with f3 barrel motifs, but as the database of known {3-barrel motifs increases, sequence-based predic­ tions of transmembrane f3 conformations have become feasible. For example, some outer membrane proteins of gram-negative bacteria (Fig. 11-13) have been correctly predicted, by sequence analysis, to contain {3 barrels.

FIGURE 11-13 Membrane proteins with P-barrel structure. Th ree pro­ teins of the £. coli outer membrane are shown, v iewed in the plane of

Cova lently Attached lipids Anchor

the membrane. FepA (POB 10 1 FEP), i nvolved i n i ron uptake, has 2 2

Some Membrane Proteins

a phosphol ipase, is a 1 2 -stranded {3 barrel that exists as a d i mer i n the

Some membrane proteins contain one or more cova­ lently linked lipids, which may be of several types: long­ chain fatty acids, isoprenoids, sterols, or glycosylated

membrane-spann i ng {3 strands. OmpLA (derived from P O B I D 1 Q DS),

membrane. Ma ltoporin (derived from PDB 10 1 MAL), a maltose trans­

porter, is a trimer; each monomer consists of 1 6 {3 strands.

L3 soj

Biological M em bra nes a n d Tra nsport

derivatives of phosphatidylinositol (GPis; Fig. 1 1-1 4) . The attached lipid provides a hydrophobic anchor that inserts into the lipid bilayer and holds the protein at the membrane surface. The strength of the hydrophobic in­ teraction between a bilayer and a single hydrocarbon chain linked to a protein is barely enough to anchor the protein securely, but many proteins have more than one attached lipid moiety. Other interactions, such as ionic attractions between positively charged Lys residues in the protein and negatively charged lipid head groups, probably contribute to the stability of the attachment. The association of these lipid-linked proteins with the membrane is certainly weaker than that for integral membrane proteins and is, in at least some cases, re­ versible. But treatment with alkaline carbonate does not release GPI-linked proteins, which are therefore, by the working definition, integral proteins. Beyond merely anchoring a protein to the mem­ brane, the attached lipid may have a more specific role. In the plasma membrane, proteins with GPI an­ chors are exclusively on the outer face and are clus­ tered in certain regions, as we shall see (pp. 384-386), whereas other types of lipid-linked proteins (with far­ nesyl or geranylgeranyl groups attached; Fig. 11-14) are exclusively on the inner face. In polarized epithe­ lial cells (such as intestinal epithelial cells, see Fig. 11-44), in which apical and basal surfaces have

different roles, GPI-linked proteins are directed specifically to the apical surface. Attachment of a spe­ cific lipid to a newly synthesized membrane protein therefore has a targeting function, directing the pro­ tein to its correct membrane location.

S U M M A R Y 11.1 •





Biological membranes define cellular boundaries, divide cells into discrete compartments, organize complex reaction sequences, and act in signal reception and energy transformations. Membranes are composed of lipids and proteins in varying combinations particular to each species, cell type, and organelle. The lipid bilayer is the basic structural unit. Peripheral membrane proteins are loosely associated with the membrane through electrostatic interactions and hydrogen bonds or by covalently attached lipid anchors. Integral proteins associate firmly with membranes by hydrophobic interactions between the lipid bilayer and their nonpolar amino acid side chains, which are oriented toward the outside of the protein molecule. Amphitropic proteins associate reversibly with membranes.

FIGURE 11-14 Lipid-linked membrane proteins. Covalently attached l ipids anchor membrane proteins to the l ipid b i l ayer. A palm itoyl group i s shown at­ tached by thioester l i n kage to a Cys res idue; an N-myristoyl group is general l y attached t o an amino-term inal Gly; t h e farnesyl a n d geranylgeranyl groups at­ tached to carboxyl-terminal Cys residues are isoprenoids of 1 5 and 20 car­ bons, respectively. These three lipid-protein assemblies are fou nd only on the i n ner face of the plasma membrane. Glycosyl phosphatidy l i nositol (GPI) an­ chors are derivatives of phosphatidy l i nositol i n which the i nositol bears a short o l i gosaccharide covalently joined to the carboxyl-terminal residue of a pro­ tein through phosphoethanolamine. GPI-Ii nked proteins are always on the ex­ tracel l u l a r face of the plasma membrane.

Palmitoy! group on internal Cys (or Ser)

N-Myristoyl group on amino-terminal Gly

Farnesyl (or geranylgeranyl) group on carboxyl-terminal Cys

s

coo -

coo-

I CH2 I CH 0 '\. � / NH I OCH3

T h e Co m p ositi o n a n d A rchitect u re o f M e mbra n e s

C=O I NH I CH2 I R2 I GPT anchor on

?

carboxyl terminu ·

-P=O I

-o

Outside

Inside

1 1 . 2 Membrane Dynam ics





Many membrane proteins span the lipid bilayer several times, with hydrophobic sequences of about 20 amino acid residues forming transmembrane a helices. Multistranded f3 barrels are also common in integral proteins in bacterial membranes. Tyr and Trp residues of transmembrane proteins are commonly found at the lipid-water interface.

(a) Paracrystalline state (gel)

The lipids and proteins of membranes are inserted into the bilayer with specific sidedness; thus membranes are structurally and functionally asymmetric. Plasma membrane glycoproteins are always oriented with the oligosaccharide-bearing domain on the extracellular surface. (b) Fluid state

1 1 .2 Membrane Dynamics One remarkable feature of all biological membranes is their flexibility-their ability to change shape without losing their integrity and becoming leaky. The basis for this property is the noncovalent interactions among lipids in the bilayer and the mobility allowed to individ­ ual lipids because they are not covalently anchored to one another. We turn now to the dynamics of mem­ branes: the motions that occur and the transient struc­ tures allowed by these motions.

[381]

1l

HeaL produces thermal motion ofside chains (gel �fluid transition)

FIGURE 11-15 Two extreme states of bilayer lipids. (a) In the paracrys­ tal l i ne state, or gel phase, polar head groups are un iformly arrayed at the su rface, and the acyl chains are nearly moti onless and packed with regular geometry. (b) In the l i q u id-disordered state, or fluid state, acyl chains undergo much thermal motion and have no regular organiza­ tion. Intermed iate between these extremes is the l iquid-ordered state,

Acyl Groups in the Bilayer I nterior Are Ordered to Varying Degrees

Although the lipid bilayer structure is quite stable, its in­ dividual phospholipid and sterol molecules have much freedom of motion (Fig. 1 1- 1 5 ) . The structure and flexibility of the lipid bilayer depend on the kinds of lipids present, and change with temperature. Below nor­ mal physiological temperatures, the lipids in a bilayer form a semisolid gel phase, in which all types of motion of individual lipid molecules are strongly constrained; the bilayer is paracrystalline (Fig. 11-15a). Above phys­ iological temperatures, individual hydrocarbon chains of fatty acids are in constant motion produced by rotation about the carbon-carbon bonds of the long acyl side chains. In this liquid-disordered state , or fluid state (Fig. 11-15b), the interior of the bilayer is more fluid than solid and the bilayer is like a sea of constantly mov­ ing lipid. At intermediate (physiological) temperatures, the lipids exist in a liquid-ordered state; there is less thermal motion in the acyl chains of the lipid bilayer, but lateral movement in the plane of the bilayer still takes place. These differences in bilayer state are easily ob­ served in liposomes composed of a single lipid, but bio­ logical membranes contain many lipids with a variety of fatty acyl chains and thus do not show sharp phase changes with temperature. At temperatures in the physiological range for a mammal (about 20 to 40°C), long-chain saturated fatty acids (such as 16:0 and 18:0) pack into a liquid-ordered array, but the kinks in unsaturated fatty acids (see Fig.

i n which i ndividual phospholipid molecules can diffuse latera l l y but the acyl groups remain extended and more or less ordered.

10-2) interfere with packing, favoring the liquid-disor­ dered state. Shorter-chain fatty acyl groups have the same effect. The sterol content of a membrane (which varies greatly with organism and organelle; Table 11-1) is another important determinant of lipid state. The rigid planar structure of the steroid nucleus, inserted between fatty acyl side chains, reduces the freedom of neighboring acyl chains to move by rotation about their carbon-carbon bonds, forcing the chains into their fully extended conformation. The presence of sterols there­ fore reduces the fluidity in the core of the bilayer, thus favoring the liquid-ordered phase, and increases the thickness of the lipid leaflet (as described below). Cells regulate their lipid composition to achieve a constant membrane fluidity under various growth condi­ tions. For example, bacteria synthesize more unsatu­ rated fatty acids and fewer saturated ones when cultured at low temperatures than when cultured at higher temperatures (Table 11-2). As a result of this ad­ justment in lipid composition, membranes of bacteria cultured at high or low temperatures have about the same degree of fluidity. Transbilayer Movement of Lipids Requires Catalysis

At physiological temperatures, transbilayer- or "flip­ flop"-diffusion of a lipid molecule from one leaflet of

[382]

Biological M e m b ranes a n d Tra n sport

TA B LE 1 1 -2

Fatty Add Composiden Temperatures Percentage of total fatty acids* 10 oc

Myristic acid Palmitic acid

40 oc

30 oc

(14:0)

4

4

4

8

( 16:0)

18

25

29

48

26

24

23

9

Palmitoleic acid Oleic acid

20 oc

(16: 1)

(18:1)

Hydroxyrnyristic acid Ratio of unsaturated to saturatedt

38

34

30

12

13

10

10

8

2.0

2.9

1.6

0.38

Soun:e: Data from Marr, A.G. & Ingraham, J.l. ( 1962) Effect of temperature on the composition of fatty acids in Escherichia co li. J. Bacterial. 84, 1260. *The exact fatty acid composition depends not only on growth temperature but on growth stage and growth medium composition. ! Ratios calculated as the total percentage of 16:1 plus 18: 1 divided by the total percentage of 14:0 plus 16:0 Hydroxymyristic acid was omitted from this calculation.

the bilayer to the other (Fig. l l-16a) occurs very slowly if at all in most membranes, although lateral dif­ fusion in the plane of the bilayer is very rapid (Fig . l l -16b). Transbilayer movement requires that a polar or charged head group leave its aqueous environment and move into the hydrophobic interior of the bilayer, a process with a large, positive free-energy change. There are, however, situations in which such movement is es­ sential. For example, in the ER, membrane glycerophos­ pholipids are synthesized on the cytosolic surface, whereas sphingolipids are synthesized or modified on the lumenal surface. To get from their site of synthesis to their eventual point of deposition, these lipids must undergo flip-flop diffusion. Several families of proteins , including the flip­ pases, floppases, and scramblases (Fig. l l-16c), facil­ itate the transbilayer movement of lipids , providing a path that is energetically more favorable and much faster than the uncatalyzed movement. The combina­ tion of asymmetric biosynthesis of membrane lipids, very slow uncatalyzed flip-flop diffusion, and the pres­ ence of selective, energy-dependent lipid translocators is responsible for the transbilayer asymmetry in lipid composition shown in Figure 11-5. Besides contribut­ ing to this asymmetry of composition, the energy­ dependent transport of lipids to one bilayer leaflet may, by creating a larger surface on one side of the bilayer, be important in generating the membrane cur­ vature essential in the budding of vesicles. Flippases catalyze translocation of the aminophos­ pholipids phosphatidylethanolamine and phosphatidyl­ serine from the extracellular to the cytosolic leaflet of the plasma membrane, contributing to the asymmetric dis­ tribution of phospholipids : phosphatidylethanolamine and phosphatidylserine primarily in the cytosolic leaflet, and the sphingolipids and phosphatidylcholine in the outer leaflet. Keeping phosphatidylserine out of the ex­ tracellular leaflet is important: its exposure on the outer

(a) Uncatalyzed transbilayer ("flip·flop") diffusion

(b) Uncatalyzed lateral diffusion

very fast

(1 JJ-rn/S)

(c) Catalyzed transbilayer translocations +

Outside

NH3

Inside ATP

ADP+Pi

Flippase (P-type ATPase) moves PE and PS from outer to cytosolic leaflet

ATP

ADP+Pi

Floppase

(ABC transporter)

moves phospholipids from cytosolic to outer leaflet

Scramblase moves lipids in either direction, toward equilibrium

FIGURE 11-16 Motion of single phospholipids in a bilayer. (a) Uncat­ alyzed movement from one leaflet to the other is very slow, but (b) lat­ eral diffusion with i n the leaflet is very rapid, requiring no catalysis. (c) Three types of phospholipid translocaters i n the plasma mem­

brane. F l i ppases translocate primarily ami nophosphol ipids (phos­ phatidylethanolamine (PE), phosphatidylserine (PS)) from the outer (exo­ plasmic) leaflet to the i n ner (cytosolic) leaflet; they req u i re ATP and are members of the P-type ATPase fam i l y. Floppases move phospholipids from the cytosolic to the outer leaflet, require ATP, and are members of the ABC transporter fam i l y. Scramblases equ i l ibrate phospho l i pids

across both leaflets; they do not require ATP but are activated by Ca2 + .

1 1 . 2 Membrane Dynamics

surface triggers apoptosis (programmed cell death; see Chapter 12) and engulfment by macrophages that carry phosphatidylserine receptors. Flippases also act in the ER, where they move newly synthesized phospholipids from their site of synthesis in the cytosolic leaflet to the lumenal leaflet. Flippases consume about one ATP per molecule of phospholipid translocated, and they are structurally and functionally related to the P-type ATP­ ases (active transporters) described on page 396. Floppases move plasma membrane phospholipids from the cytosolic to the extracellular leaflet, and like flippases are ATP-dependent. Floppases are members of the ABC transporter family described on page 400, all of which actively transport hydrophobic substrates out­ ward across the plasma membrane. Scramblases are proteins that move any membrane phospholipid across the bilayer down its concentration gradient (from the leaflet where it has a higher concentration to the leaflet where it has a lower concentration); their activity is not dependent on ATP. Scramblase activity leads to con­ trolled randomization of the head-group composition on the two faces of the bilayer. The activity rises sharply with 2 an increase in cytosolic Ca + concentration, which may result from cell activation, cell injury, or apoptosis; as noted above , exposure of phosphatidylserine on the outer surface marks a cell for apoptosis and engulfment by macrophages. Finally, a group of proteins that act pri­ marily to move phosphatidylinositol lipids across lipid bilayers, the phosphatidylinositol transfer proteins, are believed to have important roles in lipid signaling and membrane trafficking. Lipids a n d Proteins Diffuse Laterally i n the Bilayer

Individual lipid molecules can move laterally in the plane of the membrane by changing places with neigh­ boring lipid molecules; that is, they undergo Brownian movement within the bilayer (Fig. l l- 16b), which can be quite rapid. A molecule in the outer leaflet of the ery­ throcyte plasma membrane, for example, can diffuse lat­ erally so fast that it circumnavigates the erythrocyte in seconds. This rapid lateral diffusion in the plane of the bilayer tends to randomize the positions of individual molecules in a few seconds. Lateral diffusion can be shown experimentally by attaching fluorescent probes to the head groups of lipids and using fluorescence microscopy to follow the probes over time (Fig. 1 1-17) . In one technique, a small re­ gion (5 JLm2) of a cell surface with fluorescence-tagged lipids is bleached by intense laser radiation so that the irradiated patch no longer fluoresces when viewed with less-intense (nonbleaching) light in the fluorescence mi­ croscope. However, within milliseconds, the region re­ covers its fluorescence as unbleached lipid molecules diffuse into the bleached patch and bleached lipid mole­ cules diffuse away from it. The rate of jluorescence re­ covery after photobleaching, or FRAP, is a measure of the rate of lateral diffusion of the lipids. Using the FRAP

[383]

Cell

Fluorescent probe on lipids

l

React cell with fiuorescent probe to label lipids

microscope

1

With time, unbleached phospholipids diffuse into bleached area

of fluorescence return

FIGURE 1 1 -17 Measurement of lateral diffusion rates of lipids by fluorescence recovery after photobleaching (FRAP). Lipi ds i n the

outer leaflet of the plasma membrane are labeled by reaction with a membrane-i mpermeant fluorescent probe (red), so the surface is uni­ formly labeled when viewed with

a

fluorescence m icroscope. A sma l l

area i s bleached b y irradiation with an i ntense laser beam a n d be­ comes nonfluorescent. With the passage of time, labeled lipid mole­ cules d iffuse i nto the bleached region,

and it aga i n becomes

fluorescent. Researchers can track the time course of fluorescence re­ turn and determine a diffusion coefficient for the labeled lipid . The dif­ fusion rates are typically h igh; a l i pid moving at this speed cou ld c i rcumnavigate an E. coli cel l i n one second. (The FRAP method can also be used to measure lateral diffusion of membrane proteins.)

[3 s4]

Biological M em branes and Tra nsport

technique, researchers have shown that some mem­ brane lipids diffuse laterally at rates of up to

1 JLm!S .

Another technique, single particle tracking, allows one to follow the movement of a single lipid molecule in

the plasma membrane on a much shorter time scale. Re­

sults from these studies confirm rapid lateral diffusion within small, discrete regions of the cell surface and

Plasma membrane

show that movement from one such region to a nearby

Ankyrin ----����

region ("hop diffusion") is inhibited; membrane lipids behave as though corralled by fences that they can occa­ sionally cross by hop diffusion

(Fig. 1 1- 1 8 ) .

Many membrane proteins seem to be afloat in a sea of lipids. Like membrane lipids, these proteins are free to diffuse laterally in the plane of the bilayer and are in con­

Spectrin ------':--=41. """"'...._�...-,.·

Path of single ---.:...;-..!P.=1�,...-t./ lipid molecule Junctional complex -----iJJ::._-----:iJE";:_ :--.:!! �� (actin) Inside

stant motion, as shown by the FRAP technique with fluo­ rescence-tagged

surface

proteins .

Some

membrane

proteins associate to form large aggregates ("patches") on the surface of a cell or organelle in which individual protein molecules do not move relative to one another; for example, acetylcholine receptors form dense, near­ crystalline patches on neuronal plasma membranes at synapses. Other membrane proteins are anchored to in­ ternal structures that prevent their free diffusion. In the erythrocyte membrane, both glycophorin and the chlo­ ride-bicarbonate exchanger (p.

395) are tethered to spec­ (Fig. 1 1-1 9 ) .

trin, a filamentous cytoskeletal protein

One possible explanation for the pattern o f lateral diffu­ sion of lipid molecules shown in Figure

FIGURE 1 1 - 1 9 Restricted motion of the erythrocyte chloride­ bicarbonate exchanger and glycophorin. The proteins span the mem­

brane and are tethered to spectrin, a cytoskeletal protein, by another protein, ankyrin, l i m iting their lateral mob i l ity. Ankyrin i s anchored i n the membrane b y a covalently bound palm itoyl side cha i n (see Fig. 1 1 -1 4). Spectrin, a long, filamentous protein, i s cross-l i n ked at ju nc­ tional complexes conta i n i n g actin . A network of cross-l i nked spectri n molecules attached to the cytoplasmic face o f the plasma membrane sta b i l i zes the membrane, making it resistant to deformation. Th i s net­ work of anchored membrane proteins may form the "corra l " suggested by the experiment shown in Figure 1 1 -1 8; the l i pid tracks shown here are confined to regions defined by the tethered membrane protei ns.

11-18 is that

membrane proteins immobilized by their association with spectrin form the "fences" that define the regions of rela­ tively unrestricted lipid motion.

Sphingolipids and Cholesterol Cluster Together in Membrane Rafts We have seen that diffusion of membrane lipids from one bilayer leaflet to the other is very slow unless catalyzed, and that the different lipid species of the plasma mem­ brane are asymmetrically distributed in the two leaflets of the bilayer (Fig.

11-5). Even within a single leaflet, the

lipid distribution is not random. Glycosphingolipids (cere­ brosides and gangliosides), which typically contain long­ chain saturated fatty acids, form transient clusters in the outer leaflet that largely exclude glycerophospholipids, which typically contain one unsaturated fatty acyl group

i

t

Start

Finish

and a shorter saturated acyl group. The long, saturated acyl groups of sphingolipids can form more compact, more stable associations with the long ring system of cholesterol than can the shorter, often unsaturated, chains of phos­ pholipids. The cholesterol-sphingolipid microdomains in

0.1 "'"

,__

FIGURE 1 1 -1 8 Hop diffusion of individual lipid molecules. The mo­

tion of a single fluorescently labeled l ipid molecule in a cel l surface i s recorded on v ideo b y fluorescence microscopy, with a t i m e resolution of 25 JLS (equivalent to 40,000 frames/s). The track shown here repre­

sents a molecule fol l owed for 56 ms (2,250 frames); the trace begins i n

the purple area a n d continues through b l ue, green, a n d orange. The

the outer monolayer of the plasma membrane, visible with atomic force microscopy (Box

11-1), are slightly thicker

and more ordered (less fluid) than neighboring mi­ crodomains rich in phospholipids and are more difficult to dissolve with nonionic detergents; they behave like liquid­ ordered sphingolipid

rafts adrift on an ocean of liquid­ (Fig. 1 1-20, p. 386).

disordered phospholipids

These lipid rafts are remarkably enriched in two

pattern of movement i n d icates rapid diffusion with i n a confined region

classes of integral membrane proteins: those anchored

(about 250 nm in d i ameter, shown by a single color), with occasional

to the membrane by two covalently attached long-chain

hops into an adj o i n i ng region. This fi nding suggests that the l i p i ds are

saturated fatty acids (two palmitoyl groups or a palmi­

corralled by molec u l ar fences that they occasion a l l y j ump.

toy! and a myristoyl group) and GPI-anchored proteins

1 1 . 2 Membra n e Dynamics

BOX 1 1 -1

M E T H O D S

[3ss]

Ato m i c F o rce M icroscopy to V is u a l ize M e m b ra n e P rote i n s

In atomic force microscopy (AFM), the sharp tip of a mi­ croscopic probe attached to a flexible cantilever is drawn across an uneven surface such as a membrane (Fig. 1). Electrostatic and van der Waals interactions between the tip and the sample produce a force that moves the probe up and down (in the z dimension) as it encounters hills and valleys in the sample. A laser beam reflected from the cantilever detects motions of as little as 1 A. In one type of atomic force microscope, the force on the probe is held constant (relative to a standard force, on the order of piconewtons) by a feedback cir­ cuit that causes the platform holding the sample to rise or fall to keep the force constant. A series of scans in the x and y dimensions (the plane of the membrane) yields a three-dimensional contour map of the surface with resolution near the atomic scale-0. 1 nm in the vertical dimension, 0.5 to 1 .0 nm in the lateral dimensions. The membrane rafts shown in Figure 1 1-20b were visualized by this technique. In favorable cases, AFM can be used to study single membrane protein molecules. Single molecules of bac­ teriorhodopsin (see Fig. 1 1-9) in the purple membranes of the bacterium Halobacterium salinarum are seen as highly regular structures (Fig. 2a) . When several im­ ages of individual units are superimposed with the help of a computer, the real parts of the image reinforce each other and the noise in individual images is averaged out, yielding a high-resolution image of the protein (inset in Fig. 2a) . AFM of purified E. coli aquaporin, reconstituted

Laser



La.er light detector (detects cantilever deflection)

X

Platform moves to maintain constant pressure on cantilever tip. Excursions in the z dimension are plotted as a function of x, y.

FIGURE 1

into lipid bilayers and viewed as if from the outside of a cell, shows the fine details of the protein's periplasmic domains (Fig. 2b) . And AFM reveals that F0 , the proton­ driven rotor of the chloroplast ATP synthase (p. 760) , is composed of many subunits (14 in Fig. 2c) arranged in a circle.

0 ··; 0{.) 0 .

o o o o·

c oOo o· () ' �. · r �

(a)

10 nm

FIGURE 2

t---i

2 nm

(Fig. 1 1-14) . Presumably these lipid anchors, like the acyl chains of sphingolipids, form more stable associa­ tions with the cholesterol and long acyl groups in rafts than with the surrounding phospholipids. Ot is notable that other lipid-linked proteins, those with covalently attached isoprenyl groups such as farnesyl, are not pref­ erentially associated with the outer leaflet of sphin­ golipid/cholesterol rafts (Fig. 1 1-20a) .) The "raft" and "sea" domains of the plasma membrane are not rigidly separated; membrane proteins can move into and out of

(c)

...

lipid rafts on a time scale of seconds. But in the shorter time scale (microseconds) more relevant to many mem­ brane-mediated biochemical processes, many of these proteins reside primarily in a raft. We can estimate the fraction of the cell surface oc­ cupied by rafts from the fraction of the plasma mem­ brane that resists detergent solubilization, which can be as high as 50% in some cases: the rafts cover half of the ocean (Fig. 1 1-20b) . Indirect measurements in cultured fibroblasts suggest a diameter of roughly 50 nm for an

[3 86]

Biological Mem branes a n d Tra nsport

Caveolin is an integral membrane protein with two

Raft, enriched in sphingolipids, cholesterol

globular domains connected by a hairpin-shaped hy­ drophobic domain, which binds the protein to the cytoplas­ mic leaflet of the plasma membrane. Three palmitoyl groups attached to the carboxyl-terminal globular domain further anchor it to the membrane. Caveolin (actually, a

Outsi de

family of related caveolins) binds cholesterol in the mem­ brane, and the presence of caveolin forces the associated lipid bilayer to curve inward, forming

caveolae ("little (Fig. 1 1-2 1). Caveolae are unusual rafts: they involve both leaflets of the bilayer­ caves'') in the surface of the cell

the cytoplasmic leaflet, from which the caveolin globular Pre.nylated protein

domains project, and the extracellular leaflet, a typical sphingolipid/cholesterol raft with associated GPI-anchored proteins. Caveolae are implicated in a variety of cellular

(a)

functions, including membrane trafficking within cells and the transduction of external signals into cellular responses. The receptors for insulin and other growth factors, as well as certain GTP-binding proteins and protein kinases asso­ ciated with transmembrane signaling, seem to be localized

(b)

(a)

FIGURE 11-20 Membrane microdomains (rafts). (a) Stable assoc iations

Plasma membrane

of sphi ngol ipids and cholesterol i n the outer leaflet produce a m i ­

Outside

crodoma in, slightly thicker than other membrane regions, that is en­ riched with specific types of membrane proteins. GPI-Iinked proteins

Inside

are common i n the outer leaflet of these rafts, and proteins with one or several covalently attached long-chain acyl groups are common in the i n ner leaflet. Caveolin is especially common i n inwardly cu rved rafts cal led caveolae (see Fig. 1 1 -2 1 ). Proteins with attached prenyl groups (such as Ras; see Box 1 2-2) tend to be excluded from rafts. (b) In this ar­ tificial membrane-reconstituted (on a mica su rface) from cholesterol, synthetic phospholipid (dioleoylphosphatidylcho l ine), and the G P I ­ I i n ked protein placental alkal ine phosphatase-the greater thickness of raft regions is visualized by atomic force mi croscopy (see Box 1 1 -1 ). The rafts protrude from a lipid b ilayer ocean (the black surface is the top of the upper monolayer); sharp peaks represent GPI-Ii nked proteins. Note that these peaks are found a l most exclusively i n the rafts.

individual raft, which corresponds to a patch containing a few thousand sphingolipids and perhaps

10 to 50

membrane proteins. Because most cells express more than 50 different kinds of plasma membrane proteins, it is likely that a single raft contains only a subset of mem­ brane proteins and that this segregation of membrane proteins is functionally significant. For a process that in­ volves interaction of two membrane proteins, their pres­ ence in a single raft would hugely increase the likelihood of their collision. Certain membrane receptors and sig­ naling proteins, for example, seem to be segregated to­ gether in membrane rafts. Experiments show that

(b)

Caveolin dimer (si'i fatly acyl moieties)

FIGURE 11-21 Caveolin forces inward curvature of a membrane. Caveolae are sma l l i nvaginations in the plasma membrane, as seen i n (a) a n electron micrograph of an adipocyte surface-labeled with a n

electron-dense marker. (b) Each caveo l i n monomer has a central hy­ drophobic domain and three long-cha i n acyl groups (red), which hold the molecule to the i nside of the plasma membrane. When several

signaling through these proteins can be disrupted by

caveo l i n d i mers are concentrated in a small region (a raft), they force a

manipulations that deplete the plasma membrane of

cu rvature in the l ipid b i layer, forming a caveola. Cholesterol molecules

cholesterol and destroy lipid rafts.

i n the b i l ayer are shown in orange.

1 1 . 2 M e m b ra n e Dynamics

in rafts and perhaps in caveolae. We discuss some possible roles of rafts in signaling in Chapter 12. Membrane Curvature and Fusion Are Central to Many Biological Processes Caveolin is not unique in its ability to induce curvature in membranes. Changes of curvature are central to one of the most remarkable features of biological membranes: their ability to undergo fusion with other membranes without losing their continuity. Although membranes are stable, they are by no means static. Within the eukaryotic endomembrane system (which includes the nuclear mem­ brane, endoplasmic reticulum, Golgi, and various small vesicles) , the membranous compartments constantly re­ organize. Vesicles bud from the ER to carry newly synthe­ sized lipids and proteins to other organelles and to the plasma membrane. Exocytosis, endocytosis, cell division, fusion of egg and sperm cells, and entry of a membrane­ enveloped virus into its host cell all involve membrane re­ organization in which the fundamental operation is fusion of two membrane segments without loss of continuity (Fig. 1 1-22 ). Most of these processes begin with a local increase in membrane curvature. Three mechanisms for inducing membrane curvature are shown in Figure 1 1-23. A protein that is intrinsically curved may force curvature in a bilayer by binding to it; the binding energy provides the driving force for the increase in bilayer curva­ ture. Alternatively, many subunits of a scaffold protein may assemble into curved supramolecular complexes and

[3 8 7]

stabilize curves that spontaneously form in the bilayer. Or, a protein may insert one or more hydrophobic helices into one face of the bilayer, expanding its area relative to the other face and thereby forcing curvature. Specific fusion of two membranes requires that (1) they recognize each other; (2) their surfaces become closely apposed, which requires the removal of water molecules normally associated with the polar head groups of lipids; (3) their bilayer structures become lo­ cally disrupted, resulting in fusion of the outer leaflet of each membrane (hemifusion) ; and (4) their bilayers fuse to form a single continuous bilayer. The fusion occurring in receptor-mediated endocytosis, or regulated secretion, also requires that (5) the process is triggered at the ap­ propriate time or in response to a specific signal. Integral proteins called fusion proteins mediate these events, bringing about specific recognition and a transient local distortion of the bilayer structure that favors membrane fusion. (Note that these fusion proteins are unrelated to the products encoded by two fused genes, also called fu­ sion proteins, discussed in Chapter 9.) (a)

A protein with intrinsic curvature on its surface interacts strongly with a curved membrane surface, allowing both membrane and protein to achieve their lowest energy.

Budding of vesicles from Golgi complex Exocytosis

Endocytosis Fusion of endosome and lysosome

If a membrane region spontaneously curves, monomeric subunits of certain proteins can polymerize into a superstructure that favors and maintains the curvature.

Viral infection

(c) Fusion

of sperm and egg Fusion of small vacuoles (plants)

A protein with one or more amphipathic helices inserted into one leaflet of the bilayer crowds the lipids in that leaflet, forcing the membrane to bend.

Separation of two plasma membranes at cell division

FIGURE 11-22 Membrane fusion. The fusion of two membranes is central to a variety of cel lular processes involving organelles and the

FIGURE 11-23 Three models for protein-induced curvature of

plasma membrane.

membranes.

[3ssJ

Biological Mem branes a n d Tra nsport

Cytosol Secretory vesicle

""'

Neurotransmitter-filled vesicle approaches plasma membrane.

� Ne urotransmitter molecules \__ v-SNARE

(t-

II II •

NARE

Plasma membrane

AP25 v-SNARE and t-SNARE bind to each other, zipping up from the amino termini and drawing the two membranes together.

l '

.

'

Zipping causes curvature and lateral tension on bilayers, favoring hemifusion between outer leaflets.

�· · �

A well-studied example of membrane fusion is that occurring at synapses, when intracellular vesicles loaded with neurotransmitter fuse with the plasma membrane. This process involves a family of proteins called SNARE S (Fig. 1 1-24) . SNAREs in the cytoplas­ mic face of the intracellular vesicle are called v­ SNAREs; those in the target membrane with which the vesicle fuses (the plasma membrane during exocytosis) are t-SNAREs. Two other proteins , SNAP25 and NSF, are also involved. During fusion, a v-SNARE and t­ SNARE bind to each other and undergo a structural change that produces a bundle of long thin rods made up of helices from both SNARES and two helices from SNAP25 (Fig. 1 1-24) . The two SNAREs initially interact at their ends, then zip up into the bundle of helices. This structural change pulls the two membranes into contact and initiates the fusion of their lipid bilayers. The complex of SNAREs and SNAP25 is the target of the powerful Clostridium botulinum toxin, a pro­ tease that cleaves specific bonds in these proteins , pre­ venting neurotransmission and thereby causing the death of the organism. Because of its very high speci­ ficity for these proteins, purified botulinum toxin has served as a powerful tool for dissecting the mechanism of neurotransmitter release in vivo and in vitro. I ntegral Proteins of the Plasma Membrane Are I nvolved in Surface Adhesion, Signaling, a n d Other Cellular Processes

Hemifusion: inner leaflets of both membranes come into contact.

l

- ,

Complete fusion creates a fusion pore.

l

Pore widens; vesicle contents are released outside cell.

\� .. ' . ./

FIGURE 1 1 -24 Membrane fusion during neurotransmitter release at a synapse. The secretory vesicle membrane conta i n s the v-SNARE

synaptobrev i n (red). The target (plasma) membrane contains the t-SNAREs syntaxin (bl ue) and SNAP25 (violet). When a local increase in 2 [Ca + ] signals release of neu rotransm itter, the v-SNARE, SNAP25, and

t-SNARE interact, forming a coiled bundle of four a hel ices, pu l l i ng the two membranes together and disrupting the bilayer loca lly. This leads first to hemifusion, joining the i n ner leaflets of the two membranes, then to complete membrane fusion and neurotransm itter release.

Several families of integral proteins in the plasma mem­ brane provide specific points of attachment between cells, or between a cell and extracellular matrix pro­ teins. Integrins are surface adhesion proteins that me­ diate a cell's interaction with the extracellular matrix and with other cells, including some pathogens. Inte­ grins also carry signals in both directions across the plasma membrane, integrating information about the extracellular and intracellular environments. All inte­ grins are heterodirneric proteins composed of two un­ like subunits , a and (3, each anchored to the plasma membrane by a single transmembrane helix. The large extracellular domains of the a and (3 subunits combine to form a specific binding site for extracellular proteins such as collagen and fibronectin, which contain a com­ mon determinant of integrin binding, the sequence Arg-Gly-Asp (RGD) . We discuss the signaling functions of integrins in more detail in Chapter 12 (p. 455) . Other plasma membrane proteins involved in sur­ face adhesion are the cadherins, which undergo ho­ mophilic ("with same kind") interactions with identical cadherins in an adjacent cell. Selectins have extracel­ 2 lular domains that, in the presence of Ca + , bind spe­ cific polysaccharides on the surface of an adjacent cell. Selectins are present primarily in the various types of blood cells and in the endothelial cells that line blood vessels (see Fig. 7-3 1 ) . They are an essential part of the blood-clotting process. Integral membrane proteins play roles in many other cellular processes. They serve as transporters and ion

1 1 . 3 Sol ute Tra nsport across Mem b ranes

channels (discussed in Section 11.3) and as receptors for hormones, neurotransmitters, and growth factors (Chap­ ter 12). They are central to oxidative phosphorylation and photophosphorylation (Chapter 19) and to cell-cell and cell-antigen recognition in the immune system (Chap­ ter 5) . Integral proteins are also important players in the membrane fusion that accompanies exocytosis, endocyto­ sis, and the entry of many types of viruses into host cells.

S U M M A RY 11.2 •





M e m b ra n e D y n a m i cs

Flip-flop diffusion of lipids between the inner and outer leaflets of a membrane is very slow except when specifically catalyzed by fiippases, floppases, or scramblases. Lipids and proteins can diffuse laterally within the plane of the membrane, but this mobility is limited by interactions of membrane proteins with internal cytoskeletal structures and interactions of lipids with lipid rafts. One class of lipid rafts consists of sphingolipids and cholesterol with a subset of membrane proteins that are GPI-linked or attached to several long-chain fatty acyl moieties.

Ion channel (down electrochemical gradient; may be gated by a ligand or ion)





Lipids in a biological membrane can exist in liquid-ordered or liquid-disordered states; in the latter state, thermal motion of acyl chains makes the interior of the bilayer fluid. Fluidity is affected by temperature, fatty acid composition, and sterol content.

Simple diffusion (nonpolar compounds only, down concentration gradient)



Caveolin is an integral membrane protein that associates with the inner leaflet of the plasma membrane, forcing it to curve inward to form caveolae, probably involved in membrane transport and signaling. Specific proteins cause local membrane curvature and mediate the fusion of two membranes, which accompanies processes such as endocytosis, exocytosis, and viral invasion. Integrins are transmembrane proteins of the plasma membrane that act both to attach cells to each other and to carry messages between the extracellular matrix and the cytoplasm.

1 1 .3 Sol ute Tra nsport across Membra nes Every living cell must acquire from its surroundings the raw materials for biosynthesis and for energy production, and must release to its environment the byproducts of metabolism. A few nonpolar compounds can dissolve in the lipid bilayer and cross the membrane unassisted, but for transmembrane movement of any polar compound or ion, a membrane protein is essential. In some cases a membrane protein simply facilitates the diffusion of a solute down its concentration gradient, but transport can also occur against a gradient of concentration, electrical charge, or both, in which case the process requires energy (Fig. J 1--2 5 ). The energy may come directly from ATP hydrolysis or may be supplied in the form of one solute moving down its electrochemical gradient, with the release of enough energy to drive another solute up its gradient. Ions may also move across membranes via Primary active transport (against ion channels formed by proteins, electrochemical or they may be carried across by gradient) ionophores, small molecules that mask the charge of ions and allow them to diffuse through the lipid bilayer. With very few exceptions, the traffic of small molecules across the plasma membrane is mediated by proteins such as transmembrane channels, carriers, or pumps. Within the eukaryotic cell, different compartments have different concentrations of ions and of metabolic intermediates and products, and these, too, must move across intracellular mem­ branes in tightly regulated, pro­ tein-mediated processes. 0

Ion

g

Ion

[3s9J

Secondary active transport (against electrochemical gradient, driven by ion moving down its gradient)

FIGURE 1 1 -25 Summary of transport types.

[39(0

B i o l o g i ca l Mem branes a n d Tra nsport

(a)

FIGURE 1 1 -26 Movement of solutes across a per­ meable membrane. (a) Net movement of an elec­

trica l l y neutral solute is toward the side of lower sol ute concentration unti l equ i l i brium is achi eved. The sol ute concentrations on the left and right sides of the membrane are designated C1 and C2 • The rate of transmembrane movement (indi cated by the arrows) is proportional to the concentration Cl

>>

Cz

Before equilibrium Net flux

Cl

=

Cz

At equilibrium No net flux

vm

>

gradient, C2/C1 • (b) Net movement of an electri­ cally charged solute is di ctated by a combination

0

Before equilibrium

At equilibrium

Wml

and the chemical

concentration difference (C2/C 1 ) across the mem­ brane; net ion movement continues until this elec­



trochem ical potenti al reaches zero.

Passive Tra nsport Is Facil itated by Mem brane Proteins When two aqueous compartments containing unequal concentrations of a soluble compound or ion are sepa­ rated by a permeable divider (membrane), the solute moves by

of the electrical potential

simple diffusion from the region of higher

concentration, through the membrane, to the region of lower concentration, until the two compartments have

Membrane proteins lower the activation energy for transport of polar compounds and ions by providing an alter­ native path through the bilayer for specific solutes. Proteins that bring about this

facilitated diffusion, or passive transport, are not enzymes in the usual sense; their "sub­

strates" are moved from one compartment to another but are not chemically altered . Membrane proteins that speed

equal solute concentrations (Fig. l l-26a ) . When ions of

opposite charge are separated by a permeable mem­

Hydrated solute

brane, there is a transmembrane electrical gradient, a

membrane potential,

Vm (expressed in millivolts) . This

membrane potential produces a force opposing ion move­

ments that increase Vm and driving ion movements that

(a)

reduce Vm (Fig. ll-26b). Thus the direction in which a charged solute tends to move spontaneously across a membrane depends on both the chemical gradient (the difference in solute concentration) and the electrical gra­

' )

\

) (

-/A\..

(., J::

'A" ��

Simple ditl'usion wi01out transporter

dient (Vm) across the membrane. Together, these two factors are referred to as the electrochemical gradient or

electrochemical potential. This behavior of solutes

is in accord with the second law of thermodynamics: mol­ ecules tend to spontaneously assume the distribution of greatest randomness and lowest energy. To pass through a lipid bilayer, a polar or charged solute must first give up its interactions with the water molecules in its hydration shell, then diffuse about 3 nm (30

A)

through a substance (lipid) in which it is poorly

soluble ( Fig. 1 1-2 7 ). The energy used to strip away the hydration shell and to move the polar compound from

(b)

water into lipid, then through the lipid bilayer, is regained as the compound leaves the membrane on the other side and is rehydrated. However, the intermediate stage of transmembrane passage is a high-energy state com­ parable to the transition state in an enzyme-catalyzed chemical reaction. In both cases, an activation barrier must be overcome to reach the intermediate stage

Transporter FIGURE 1 1 -27 Energy changes accompanying passage of a hydrophilic solute through the lipid bilayer of a biological membrane. (a) I n sim­

ple diffusion, removal of the hydration shell is highly endergonic, and

(Fig. 11-27; compare with Fig. 6-3). The energy of

activation (liG:J:) for translocation of a polar solute

the energy of activation (D.G*) for diffusion through the b i l ayer is very

across the bilayer is so large that pure lipid bilayers are

fusion of the solute. It does this by form ing noncovalent i nteractions

h igh. (b) A transporter protein reduces the llG* for transmembrane dif­

virtually impermeable to polar and charged species over

with the dehyd rated solute to replace the hydrogen bondi ng with wa­

periods of time relevant to cell growth and division.

ter and by providing a hydrop h i l i c transmembrane pathway.

1 1 . 3 Sol ute Tra nsport across M em branes

the movement of a solute across a membrane by facilitating diffusion are called transporters or permeases. Like enzymes, transporters bind their substrates with stereochemical specificity through multiple weak, non­ covalent interactions. The negative free-energy change associated with these weak interactions, LlGbinding, counterbalances the positive free-energy change that accompanies loss of the water of hydration from the substrate , LlGdehydratiow thereby lowering LlG+ for trans­ membrane passage (Fig. 1 1-27) . Transporters span the lipid bilayer several times , forming a transmembrane channel lined with hydrophilic amino acid side chains . The channel provides an alternative path for a specific substrate to move across the lipid bilayer without its having to dissolve in the bilayer, further lowering LlG+ for transmembrane diffusion. The result is an increase of several to many orders of magnitude in the rate of transmembrane passage of the substrate. Transporters Can Be Grouped i nto Superfamilies Based on Their Structures We know from genomic studies that transporters con­ stitute a significant fraction of all proteins encoded in the genomes of both simple and complex organisms . There are probably a thousand or more different trans­ porters in the human genome. Transporters fall within two very broad categories: carriers and channels (Fig. 1 1-28 ) . Carriers bind their substrates with high stereo­ specificity, catalyze transport at rates well below the limits of free diffusion, and are saturable in the same sense as are enzymes: there is some substrate concen­ tration above which further increases will not produce a greater rate of transport. Channels generally allow transmembrane movement at rates orders of magnitude greater than those typical of carriers, rates approaching the limit of unhindered diffusion. Channels typically show less stereospecificity than carriers and are usually not saturable. Most channels are oligomeric complexes of several, often identical, subunits , whereas many car­ riers function as monomeric proteins . The classification as carrier or channel is the broadest distinction among transporters. Within each of these categories are super­ families of various types, defined not only by their pri-

I

Transporters

I

Carriers

I

Secondary active transporters

I

I

Passive transporters

FIGURE 1 1 -28 Classification of transporters.

[39 1]

mary sequences but by their secondary structures. Some channels are constructed primarily of helical transmembrane segments, others have /3-barrel struc­ tures . Among the carriers, some simply facilitate diffu­ sion down a concentration gradient; they are the passive transporter superfamily. Active trans­ porters can drive substrates across the membrane against a concentration gradient, some using energy provided directly by a chemical reaction (primary ac­ tive transporters) and some coupling uphill transport of one substrate with downhill transport of another (sec­ ondary active transporters) . We now consider some well-studied representatives of the main transporter superfamilies. You will encounter some of these trans­ porters again in later chapters in the context of the metabolic pathways in which they participate. The Glucose Transporter of Erythrocytes Mediates Passive Transport Energy-yielding metabolism in erythrocytes depends on a constant supply of glucose from the blood plasma, where the glucose concentration is maintained at about 5 mM. Glucose enters the erythrocyte by facilitated dif­ fusion via a specific glucose transporter, at a rate about 50,000 times greater than uncatalyzed transmembrane diffusion. The glucose transporter of erythrocytes (called GLUT1 to distinguish it from related glucose transporters in other tissues) is a type III integral pro­ tein CMr �45,000) with 12 hydrophobic segments, each of which is believed to form a membrane-spanning helix. The detailed structure of GLUT1 is not yet known, but one plausible model suggests that the side-by-side as­ sembly of several helices produces a transmembrane channel lined with hydrophilic residues that can hydro­ gen-bond with glucose as it moves through the channel (Fig. 1 1-29). The process of glucose transport can be described by analogy with an enzymatic reaction in which the "substrate" is glucose outside the cell CSout) , the "prod­ uct" is glucose inside (Sin) , and the "enzyme" is the transporter, T. When the initial rate of glucose uptake is measured as a function of external glucose concentra­ tion (Fig. 1 1 -30), the resulting plot is hyperbolic; at high external glucose concentrations the rate of uptake approaches Vmax · Formally, such a transport process can be described by the equations

Channel

Primary active transporters

in which k 1 , k _ 1 , and so forth, are the forward and re­ verse rate constants for each step; T1 is the transporter conformation in which the glucose-binding site faces

[39 2J

Biologi cal M e m b ranes a n d Tra nsport

g$ 0

u � ;::1 1':1

· �§ 'o �

v

- - - -- - - - ------- - - - - - -mm:

:;., ::t � 0

�� -

·�

"'"

>

....

"; � :.0

·s -

(a)

-

S

coo-

er Leu Val Thr Asn Phe Ile -

-

-

-

-

-

Q)

[Slout

Extracellular glucose (mM) concentration,

-

2

1

(c) F IGURE 1 1 -29 Proposed structure of GLUT1 . (a) Transmembrane he­ l i ces are represented here as obli que (angled) rows of three or four

(b)

[S�out (:J

FIGURE 1 1 -30 Kinetics of glucose transport into erythrocytes. (a) The i n itial rate of glucose entry i nto an erythrocyte, V0, depends on the

i n itial concentration of glucose on the outside, [Slo u t· (b) Double­

amino acid residues, each row depicting one turn of the a hel i x . N i ne

rec iprocal plot of the data i n (a). The ki netics of fac i l itated diffusion is

or red), often separated by several hydrophobic residues (ye l low). Th is

these plots with Figure 6-1 1 , and with Figure 1 in Box 6-1 . Note that

of the 1 2 helices contain three or more polar or charged residues (blue representation of topology i s not intended to represent three-d i men­ sional structure. (b) A hel i ca l wheel d iagram shows the d istribution of

analogous to the ki netics of a n enzyme-catalyzed reaction. Compare K, i s analogous to Km, the Michael i s constant.

polar and nonpolar residues on the surface of a hel i ca l segment. The helix is diagrammed as though observed along its axis from the a m i no terminus. Adjacent residues in the l i near sequence are con nected, and each residue i s pl aced around the wheel i n the position it occupies in the hel ix; recall that 3.6 res idues are requ i red to make one complete turn of the

a helix. I n this example, the polar residues (bl ue) are on one

side of the hel ix and the hydrophobi c residues (yel low) on the other.

Th i s is, by defi n ition, an amphipathic helix. (c) Side-by-side associa­

Outside

tion of four amph ipath ic heli ces, each with its polar face oriented toward the central cavity, can produce a transmembrane channel l i ned with polar (and charged) residues. Th is channel provides many oppor­ tunities for hydrogen bonding with glucose as it moves through.

Inside

out, and T2 the conformation in which it faces in. The steps are summarized in Figur�· 1 1-:J I . Given that every step in this sequence is reversible, the transporter is, in principle, equally able to move glucose into or out of the cell. However, glucose always moves down its concentra­ tion gradient, which normally means into the cell. Glucose that enters a cell is generally metabolized immediately, and the intracellular glucose concentration is thereby kept low relative to its concentration in the blood.

FIGURE 1 1 �3 1 Model of glucose transport into erythrocytes by G L UT1 . The transporter exists in two conformations: T 1 , with the

glucose-binding site exposed on the outer su rface of the plasma mem­ brane, and T2 , with the binding site exposed on the i n ner su rface. G l u ­ cose transport occurs i n four steps. CD G l u cose i n blood plasma binds

to a stereospec ific s i te on T 1 ; this lowers the activation energy for ell a conformational change from gl ucoseou t · T 1 to gl ucose;n T2 , effecti ng the transmembrane passage of the glucose.

·

Q) G l ucose is re­

leased from T2 i nto the cytoplasm, and @ the transporter retu rns to the T1 conformation, ready to transport another gl ucose molecule.

1 1 . 3 Solute Tra nsport across Mem branes

[}93]

TA B L E 1 1 -3

Transporter

Tissue(s) where expressed

Gene

Role*

GLUTl

Ubiquitous

SLC2Al

Basal glucose uptake

GLUT2

Liver, pancreatic islets, intestine

SLC2A2

In liver, removal of excess glucose from blood; in pancreas, regulation of insulin release

GLUT3

Brain (neuronal)

SLC2A3

Basal glucose uptake

GLUT4

Muscle, fat, heart

SLC2A4

Activity increased by insulin

GLUT5

Intestine, testis, kidney, sperm

SLC2A5

Primarily fructose transport

GLUT6

Spleen, leukocytes, brain

SLC2A6

Possibly no transporter function

GLUT7

Liver microsomes

SLC2A7

GLUTS

Testis, blastocyst, brain

SLC2A8

GLUT9

Liver, kidney

SLC2A9

GLUTIO

Liver, pancreas

SLC2A 1 0

GLUTH

Heart, skeletal muscle

SLC2A l l

GLUT1 2

Skeletal muscle, adipose, small intestine

SLC2A12

*Dash indicates role uncertain.

The rate equations for glucose transport can be derived exactly as for enzyme-catalyzed reactions (Chapter 6), yielding an expression analogous to the Michaelis-Menten equation: " _ vo -

Vma� [SJout

Kt

( 1 1-1)

fSlout

in which V0 is the initial velocity of accumulation of glucose inside the cell when its concentration in the surrounding medium is [Slout, and Kt CKtransport) is a constant analogous to the Michaelis constant, a combi­ nation of rate constants that is characteristic of each transport system. This equation describes the initial velocity, the rate observed when [Slin 0. As is the case for enzyme-catalyzed reactions, the slope-inter­ cept form of the equation describes a linear plot of l! V0 against 1/[Slout, from which we can obtain values of Kt and Vmax (Fig. 1 1-30b) . When [Slout Kt, the rate of uptake is 1/z vmax ; the transport process is half-satu­ rated. The concentration of glucose in blood is 4.5 to 5 mM, about three times Kt, which ensures that GLUT1 is nearly saturated with substrate and operates near =

=

Vmax ·

Because no chemical bonds are made or broken in the conversion of Sout to Sin, neither "substrate" nor "product" is intrinsically more stable, and the process of entry is therefore fully reversible. As [SLn approaches [Slout' the rates of entry and exit become equal. Such a system is therefore incapable of accumulating glucose within a cell at concentrations above that in the sur­ rounding medium; it simply equilibrates glucose on the two sides of the membrane much faster than would oc­ cur in the absence of a specific transporter. GLUTl is specific for o-glucose, with a measured Kt of 1 .5 mM. For the close analogs o-mannose and o-galactose,

which differ only in the position of one hydroxyl group, the values of Kt are 20 and 30 mM, respectively; and for 1-glucose, Kt exceeds 3,000 mM. Thus GLUT I shows the three hallmarks of passive transport: high rates of diffu­ sion down a concentration gradient, saturability, and specificity. Twelve glucose transporters are encoded in the human genome, each with its unique kinetic proper­ ties , patterns of tissue distribution, and function (Table 1 1-3) . In liver, GLUT2 transports glucose out of hepatocytes when liver glycogen is broken down to replenish blood glucose. GLUT2 has a Kt of about 66 mM and can therefore respond to increased levels of in­ tracellular glucose (produced by glycogen breakdown) by increasing outward transport. Skeletal and heart muscle and adipose tissue have yet another glucose transporter, GLUT4 CKt 5 mM) , which is distin­ guished by its response to insulin: its activity increases when insulin signals a high blood glucose concentra­ tion, thus increasing the rate of glucose uptake into muscle and adipose tissue (Box 1 1-2 describes some malfunctions of this transporter) . =

The Chloride-Bicarbonate Exchanger Catalyzes Electro neutral Cotransport of Anions across the Plasma Membrane The erythrocyte contains another facilitated diffusion sys­ tem, an anion exchanger that is essential in C02 transport to the lungs from tissues such as skeletal muscle and liver. Waste C02 released from respiring tissues into the blood plasma enters the erythrocyte, where it is converted to bi­ carbonate (HC03) by the enzyme carbonic anhydrase. (Recall that HC03 is the primary buffer of blood pH; see Fig. 2-20.) The HC03 reenters the blood plasma for

394

B i o l o g i ca l M e m b ranes a n d Transport

D efective G l u cose a n d Water Tra n s p o rt i n Two F o r m s o f D i a b etes

BOX 1 1 -2

transporters) results in low rates of glucose uptake into muscle and adipose tissue. One consequence is a pro­ longed period of high blood glucose after a carbohydrate­ rich meal. This condition is the basis for the glucose tolerance test used to diagnose diabetes (Chapter 23) . The water permeability of epithelial cells lining the renal collecting duct in the kidney is due to the presence of an aquaporin (AQP-2) in their apical plasma mem­ branes (facing the lumen of the duct) . Vasopressin (an­ tidiuretic hormone, ADH) regulates the retention of water by mobilizing AQP-2 molecules stored in vesicle membranes within the epithelial cells, much as insulin mobilizes GLUT4 in muscle and adipose tissue. When the vesicles fuse with the epithelial cell plasma mem­ brane, water permeability greatly increases and more water is reabsorbed from the collecting duct and re­ turned to the blood. When the vasopressin level drops, AQP-2 is resequestered within vesicles, reducing water retention. In the relatively rare human disease diabetes insipidus, a genetic defect in AQP-2 leads to impaired water reabsorption by the kidney. The result is excre­ tion of copious volumes of very dilute urine.

When ingestion of a carbohydrate-rich meal causes blood glucose to exceed the usual concentration be­ tween meals (about 5 mM) , excess glucose is taken up by the myocytes of cardiac and skeletal muscle (which store it as glycogen) and by adipocytes (which convert it to triacylglycerols) . Glucose uptake into myocytes and adipocytes is mediated by the glucose transporter GLUT4. Between meals, some GLUT4 is present in the plasma membrane , but most is sequestered in the membranes of small intracellular vesicles (Fig. 1 ) . In­ sulin released from the pancreas in response to high blood glucose triggers the movement of these intracel­ lular vesicles to the plasma membrane , where they fuse, thus exposing GLUT4 molecules on the outer sur­ face of the cell (see Fig. 1 2-1 6) . With more GLUT4 mol­ ecules in action, the rate of glucose uptake increases 1 5-fold or more. When blood glucose levels return to normal, insulin release slows and most GLUT4 mole­ cules are removed from the plasma membrane and stored in vesicles. In type 1 Guvenile-onset) diabetes mellitus, the in­ ability to release insulin (and thus to mobilize glucose

®

When in ulin interac with it receptor, ve icles move to urface and fuse with the pla ma membrane, increasing th numb r of glucos transporters in the plasma membrane. •

I

Insulin· receptor membrane

en

Kidney

Intracellular vesicles

AQP-7

Water (high) , glycerol (high) , urea (high) , arsenite

Adipose tissue, kidney, testis

Plasma membrane

AQP-8 t

Water (high)

Testis, kidney, liver, pancreas, small intestine, colon

Plasma membrane, intracellular vesicles

AQP-9

Water (low) , glycerol (high) , urea (high) , arsenite

Liver, leukocyte, brain, testis

Plasma membrane

AQP-10

Water (low) , glycerol (high) , urea (high)

Small intestine

Intracellular vesicles

Source: Data from King, L.S., Kozono, D., & Agre, P. (2004) From structure to disease: the evolving tale of aquaporin biology. Nat. Rev. 5, 688. •Aquaporins that are present primarily in the apical or in the basolateral membrane are noted as localized in one of these membranes; those present in both membranes a re described as localized in the plasma membrane.

tAQP-8 might also be permeated by urea.

cells) , transports glycerol efficiently. Mice with defec­ tive AQP-7 develop obesity and adult-onset diabetes, presumably as a result of their inability to move glycerol into or out of adipocytes as triacylglycerols are con­ verted to free fatty acids and glycerol, and vice versa. I on-Selective Channels Allow Rapid Movement of Ions across Membra nes

Ion-selective channels-first recognized in neurons and now known to be present in the plasma membranes of all cells, as well as in the intracellular membranes of eukaryotes-provide another mechanism for moving in­ organic ions across membranes. Ion channels, together with ion pumps such as the Na + K+ ATPase, determine a plasma membrane's permeability to specific ions and reg­ ulate the cytosolic concentration of ions and the mem­ brane potential. In neurons, very rapid changes in the activity of ion channels cause the changes in membrane potential (action potentials) that carry signals from one end of a neuron to the other. In myocytes, rapid opening of Ca2 + channels in the sarcoplasmic reticulum releases the Ca2+ that triggers muscle contraction. We discuss the signaling functions of ion channels in Chapter 12. Here we describe the structural basis for ion-channel

function, using as examples a voltage-gated K+ channel, the neuronal Na + channel, and the acetylcholine recep­ tor ion channel. Ion channels are distinct from ion transporters in at least three ways . First, the rate of flux through chan­ nels can be several orders of magnitude greater than the turnover number for a transporter-1 0 7 to 1 0 8 ions/s for an ion channel, approaching the theoretical maximum for unrestricted diffusion. By contrast , the turnover rate of the Na+ K + ATPase is about 1 00 s- 1 ! Second, ion channels are not saturable: rates do not approach a maximum at high substrate concentration. Third, they are gated in response to some cellular event. In ligand-gated channels (which are generally oligomeric) , binding of an extracellular or intracellular small molecule forces an allosteric transition in the protein, which opens or closes the channel. In volt­ age-gated ion channels, a change in transmembrane electrical potential (Vm) causes a charged protein do­ main to move relative to the membrane, opening or closing the channel. Both types of gating can be very fast. A channel typically opens in a fraction of a mil­ lisecond and may remain open for only milliseconds, making these molecular devices effective for very fast signal transmission in the nervous system.

1 1 . 3 Solute Tra nsport across Membranes

I on-Channel Function Is Measured Electrical ly Because a single ion channel typically remains open for only a few milliseconds, monitoring this process is be­ yond the limit of most biochemical measurements. Ion fluxes must therefore be measured electrically, either as changes in Vm (in the millivolt range) or as electric cur­ rents I (in the microampere or picoampere range) , using microelectrodes and appropriate amplifiers. In patch­ clamping, a technique developed by Erwin Neher and Bert Sakrnann in 1 976, very small currents are meas­ ured through a tiny region of the membrane surface containing only one or a few ion-channel molecules (Fig. 1 1-4 7) . The researcher can measure the size and duration of the current that flows during one opening of an ion channel and can determine how often a channel

[" J L_407

-

opens and how that frequency is affected by membrane potential, regulatory ligands, toxins, and other agents 4 Patch-clamp studies have revealed that as many as 1 0 ions can move through a single ion channel i n 1 ms . Such an ion flux represents a huge amplification of the initial signal; for example, only two acetylcholine molecules are needed to open an acetylcholine receptor channel (as described below) .

Channel

Erwin Neher

Bert Sakmann

The Structure of a K + Channel Reveals the Basis for Its Specificity

Patch of membrane placed in aqueous solution /- " I

Electronics to hold transmembrane potential (Vml constant and measure current flowing across membrane FIGURE 1 1 -47 Electrical measurements of ion-channel function. The "activity" of an ion channel is estimated by measuring the flow of ions through it, using the patch -clamp techn iq u e. A fi nely drawn-out pi pette (mi cropi pette) is pressed against the cell su rface, and negative pressure in the pi pette forms a pressure seal between pi pette and mem­ brane. As the pi pette is pulled away from the cell, it pulls off a tiny patch of membrane (which may contain one or a few ion channels) . Af­ ter placing the pi pette and attached patch i n an aqueous solution, the researcher can measure channel activity as the electric current that flows between the contents of the pi pette and the aqueous solution In practice, a circuit is set up that "cla mps" the transmembrane potential at a given value and measu res the current that must flow to mainta i n t h i s voltage. W i t h h ighly sensitive current detectors, researchers can measure the current flowing through a single ion channel, typica l l y a few picoamperes . The trace showing the current as a function of time (in m i l l iseconds) reveals how fast the channel opens and closes, how frequently it opens, and how long it stays open. Clamping the Vm at d if­ ferent values permits determination of the effect of membrane poten­

tial on these parameters of channel function.

The structure of a potassium channel from the bacterium Streptomyces lividans , deter­ mined crystallographically by Roderick MacKinnon in 1 998, provides much insight into the way ion channels work. This bacterial ion channel is related in sequence to all other known K+ channels and serves as the prototype for such channels, including the voltage-gated K+ Roderick Mac Ki nnon channel of neurons. Among the members of this protein family, the similarities in se­ quence are greatest in the "pore region," which conrains the ion selectivity filter that allows K + (radius 1 .33 A) to pass 10,000 times more readily than Na+ (radius 0.95 A!­ at a rate (about 1 08 ions/s) approaching the theoretical limit for unrestricted diffusion. The K + channel consists of four identical subunits that span the membrane and form a cone within a cone surrounding the ion channel, with the wide end of the double cone facing the extracellular space (Fig. 1 1 -48) . Each subunit has two transmembrane a he­ lices as well as a third, shorter helix that contributes to the pore region. The outer cone is formed by one of the transmembrane helices of each subunit. The inner cone ' formed by the other four transmembrane he­ lices surrounds the ion channel and cradles the ion selectivity filter. Both the ion specificity and the high flux through the channel are understandable from what we know of the channel's structure . At the inner and outer plasma '

[4 oa]

Biological Membranes and Tra nsport

(a)

(b)

Backbone carbonyl oxygens form cage that fits K+ precisely, replacing waters of hydration sphere

Alternating K+ sites (blue or green) occupied

Outside

In

ide

J

K+ with hydrating water molecules

Large water-liB d vestibule al lows hydration of K+

sphere. Further stabilization is provided by the short helices in the pore region of each subunit, with the par­ tial negative charges of their electric dipoles pointed at K+ in the channel. About two-thirds of the way through the membrane, this channel narrows in the region of the selectivity filter, forcing the ion to give up its hydrating water molecules. Carbonyl oxygen atoms in the back­ bone of the selectivity filter replace the water molecules in the hydration sphere, forming a series of perfect coor­ dination shells through which the K+ moves. This favor­ able interaction with the filter is not possible for Na + , which i s too small t o make contact with all the potential oxygen ligands. The preferential stabilization of K+ is the basis for the ion selectivity of the filter, and muta­ tions that change residues in this part of the protein eliminate the channel's ion selectivity. The K+ -binding sites of the filter are flexible enough to collapse to fit any Na + that enters the channel, and this conformational change closes the channel. There are four potential K+ -binding sites along the selectivity filter, each composed of an oxygen "cage" that provides ligands for the K+ ions ( Fig. 1 1-4!) ) . In the crystal structure, two K+ ions are visible within the selectivity filter, about 7.5 A apart, and two water mole­ cules occupy the unfilled positions. K+ ions pass through the filter in single file; their mutual electrostatic repulsion most likely just balances the interaction of each ion with the selectivity filter and keeps them mov­ ing. Movement of the two K+ ions is concerted: first they occupy positions 1 and 3, then they hop to positions 2 and 4 (Fig. l l-48c) . The energetic difference between

(c)

FIGURE 1 1 -48 The K + channel of Streptomyces Jividans. (PDB I D

1 BLB) (a) Viewed i n the plane of the membrane, the channel consists

of eight transmembrane hel ices (two from each of four identical sub­

un its), form ing a cone with its wide end toward the extracellular space. The i n ner helices of the cone (lighter colored) l i ne the transmembrane channel, and the outer hel ices i nteract with the l i p i d b i l ayer. Short seg­ ments of each subunit converge in the open end of the cone to make a selectivity filter. (b) Th is view, perpendicular to the pl ane of the mem­ brane, shows the four subun its arranged around a central channel j ust wide enough for a s i ngle K + ion to pass. (c) D iagram of a K + channel i n cross section, showing the structural features critical to function. (See a I so Fig. 1 1 -49 .)

FIGURE 1 1 -49 K + binding sites in the selectivity pore of the K+ chan­

nel. (PDB ID 1 )95) Carbonyl oxygens (red) of the peptide backbone i n

t h e selectivity filter protrude i nto t h e channel, i nteracting w i t h a n d sta­ b i l i z i ng a K + ion passing through. These l igands are perfectly posi­ tioned to i nteract with each of four K + ions, but not with the smaller ions. Th i s preferential interaction with K + is the basis for the ion selectivity. The mutual repulsion between K + ions results in occupa­ tion of only two of the four K + s ites at a time (both green or both blue) Na

membrane surfaces, the entryways to the channel have several negatively charged amino acid residues, which presumably increase the local concentration of cations such as K+ and Na + . The ion path through the mem­ brane begins (on the inner surface) as a wide, water­ filled channel in which the ion can retain its hydration

+

and counteracts the tendency for a lone K+ to stay bound i n one site.

The combi ned effect of K + binding to carbonyl oxygens and repu l sion

between K + ions ensu res that each ion keeps moving, changing posi­ tions with i n 1 0 to 1 00 ns, and that there are no large energy barri ers to ion flow through the membrane.

1 1 . 3 Sol ute Tra nsport across Mem branes

these two configurations ( 1 , 3 and 2, 4) is very small; en­ ergetically, the selectivity pore is not a series of hills and valleys but a fiat surface, which is ideal for rapid ion movement through the channel. The structure of the channel seems to have been optimized during evolution to give maximal flow rates and high specificity. Voltage-gated K+ channels are more complex struc­ tures than that illustrated in Figure 1 1-48, but they are variations on the same theme. For example, the mam­ malian voltage-gated K+ channels in the Shaker family have an ion channel like that of the bacterial channel shown in Figure 1 1 -48, but with additional protein do­ mains that sense the membrane potential, move in re­ sponse to a change in potential, and in moving trigger (a)

(c)

[4o9]

the opening or closing of the K + channel (Fig. 1 1-50) . The critical transmembrane helix in the voltage-sensing domain of Shaker K+ channels contains four Arg residues; the positive charges on these residues cause the helix to move relative to the membrane in response to changes in the transmembrane electrical field (the membrane potential) . Cells also have channels that specifically conduct Na + or Ca2 + , and exclude K + . In each case, the ability to discriminate among cations requires both a cavity in the binding site of just the right size (neither too large nor too small) to accommodate the ion and the precise posi­ tioning within the cavity of carbonyl oxygens that can replace the ion's hydration shell. This fit can be achieved Voltage sensor

View from inside face Open

Closed

(d)

FIGURE 1 1 -50 Structural basis for voltage gating i n the K+ channel.

conserved Arg residues and is believed to be the chief moving part of the

(PDB ID 2A79) This crystal structure of the Kv1 .2-132 subunit complex

voltage-sensing mechanism. (c) A schematic diagram of the voltage­

from rat brain shows the basic K+ channel (corresponding to that shown

gated channel, showing the basic pore structure (center) and the extra

in Fig. 1 1 -48) with the extra machinery necessary to make the channel

structu res that make the channel voltage-sensitive; 54, the Arg-containing

sensitive to gating by membrane potential: four transmembrane helical

helix, is orange_ For clarity, the 13 subunits are not shown in this view.

extensions of each subunit and four 13 subun its. The entire complex,

Normally, the transmembrane electrical potential (inside negative) exerts

viewed (a) in the plane of the membrane and (b) perpendicular to the

a pull on positively charged Arg side chains in 54, toward the cytosol i c

membrane plane (as viewed from outside the membrane), is represented

side. When the membrane is depolarized the pull is lessened, a n d with

as in Figure 1 1 -48, with each subunit in a different color; each of the four

complete reversal of the membrane potential, 54 is drawn toward the ex­

13 subu nits i s colored l i ke the subunit with which it associates. I n (b), each 56 from each of four subun its form the channel itself, and are compara­

tracel lular side. (d) This movement of 54 is physically coupled to opening and closing of the K + channel, which is shown here i n its open and c losed conformations. Although K + is present in the closed channel, the

ble to the two transmembrane hel ices of each subunit in Figure 1 1 -48. 5 1

pore closes on the bottom, near the cytosol, preventing K + passage.

transmembrane helix of one subunit (red) is numbered, 51 to 56. 55 and

t o 54 are four transmembrane hel ices. The 5 4 hel ix conta ins the highly

[4 1 o]

Biological Mem branes a n d Tra nsport

with molecules smaller than proteins; for example, vali­ nomycin (Fig. 1 1-45) can provide the precise fit that gives high specificity for the binding of one ion rather than another. Chemists have designed small molecules with very high specificity for binding of Li+ (radius 0.60 A) , Na+ (radius 0.95 A) , K + (radius 1 .33 A) , or Rb + (radius 1 .48 A) . The biological versions, however-the channel proteins-not only bind specifically but con­ duct ions across membranes in a gated fashion. Gated I on Channels Are Central in Neuronal Function Virtually all rapid signaling between neurons and their target tissues (such as muscle) is mediated by the rapid opening and closing of ion channels in plasma mem­ branes. For example, Na + channels in neuronal plasma membranes sense the transmembrane electrical gradi­ ent and respond to changes by opening or closing. These voltage-gated ion channels are typically very selective for Na + over other monovalent or divalent cations (by factors of 100 or more) and have very high flux rates (> 107 ions/s) . Closed in the resting state, Na+ channels are opened-activated-by a reduction in the mem­ brane potential; they then undergo very rapid inactiva­ tion. Within milliseconds of opening, a channel closes and remains inactive for many milliseconds. Activation followed by inactivation of Na + channels is the basis for signaling by neurons (see Fig. 1 2-25) . Another very well-studied ion channel is the nico­ tinic acetylcholine receptor, which functions in the passage of an electrical signal from a motor neuron to a muscle fiber at the neuromuscular junction (signaling the muscle to contract) . Acetylcholine released by the motor neuron diffuses a few micrometers to the plasma membrane of a myocyte, where it binds to an acetyl­ choline receptor. This forces a conformational change in the receptor, causing its ion channel to open. The result­ ing inward movement of positively charged ions into the myocyte depolarizes its plasma membrane and triggers contraction. The acetylcholine receptor allows Na + , Ca2+, and K+ to pass through its channel with equal ease, but other cations and all anions are unable to pass. Movement of Na + through an acetylcholine receptor ion channel is unsaturable (its rate is linear with respect to extracellular [Na +]) and very fast -about 2 x 1 07 ions/s under physiological conditions.

Acetylcholine

The acetylcholine receptor channel is typical of many other ion channels that produce or respond to electrical signals: it has a "gate" that opens in response to stimula­ tion by a signal molecule (in this case acetylcholine) and an intrinsic timing mechanism that closes the gate after a

split second. Thus the acetylcholine signal is transient­ an essential feature of all electrical signal conduction. Based on similarities between the amino acid se­ quences of other ligand-gated ion channels and the acetylcholine receptor, neuronal receptor channels that respond to the extracellular signals y-aminobutyric acid (GABA) , glycine, and serotonin are grouped to­ gether in the acetylcholine receptor superfamily, and probably share three-dimensional structure and gating mechanisms. The GABAA and glycine receptors are anion channels specific for Cl- or HC03, whereas the serotonin receptor, like the acetylcholine receptor, is cation-specific . Another class of ligand-gated ion channels respond to intracellular ligands: 3 ' ,5'-cyclic guanosine mono­ nucleotide (cGMP) in the vertebrate eye, cGMP and cAMP in olfactory neurons, and ATP and inositol 1 ,4 ,5trisphosphate (IP3) in many cell types. These channels are composed of multiple subunits, each with six trans­ membrane helical domains. We discuss the signaling functions of these ion channels in Chapter 12. Table 1 1-6 shows some transporters discussed in other chapters in the context of the pathways in which they act. Defective I on Channels Can Have Severe Physiological Consequences The importance of ion channels to physiological processes is clear from the effects of mutations in specific ion-channel proteins (Table 1 1-7, Box 1 1-3) . Genetic defects in the voltage-gated Na + channel of the myocyte plasma membrane result in diseases in which muscles are periodically either paralyzed (as in hyper­ kalemic periodic paralysis) or stiff (as in paramyotonia congenita) . Cystic fibrosis is the result of a mutation that changes one amino acid in the protein CFTR, a Cl­ ion channel; the defective process here is not neuro­ transmission but secretion by various exocrine gland cells with activities tied to Cl- ion fluxes. Many naturally occurring toxins act on ion channels, and the potency of these toxins further illustrates the importance of normal ion-channel function. Tetro­ dotoxin (produced by the puffer fish, Sphaeroides rubripes) and saxitoxin (produced by the marine di­ noflagellate Gonyaulax, which causes "red tides") act by binding to the voltage-gated Na + channels of neurons and preventing normal action potentials. Puffer fish is an ingredient of the Japanese delicacy fugu, which may be prepared only by chefs specially trained to separate succulent morsel from deadly poison. Eating shellfish that have fed on Gonyaulax can also be fatal; shellfish are not sensitive to saxitoxin, but they concentrate it in their muscles, which become highly poisonous to organ­ isms higher up the food chain. The venom of the black mamba snake contains dendrotoxin, which interferes with voltage-gated K + channels. Tubocurarine, the active

1 1 .3 Solute Tra nsport across Membranes

TAB L E 1 1 -6

[41 1]

Transport Systems Desaibed Elsewhere in This Text

--------�

Transport system and location

Figure number

Role

Adenine nucleotide antiporter of mitochondrial inner membrane

1 9-28

Imports substrate ADP for oxidative phosphorylation, and exports product ATP

Acyl-carnitine/carnitine transporter of mitochondrial inner membrane

1 7-6

Imports fatty acids into matrix for f3 oxidation

Pi-H+ symporter of mitochondrial inner membrane

1 9-28

Supplies Pi for oxidative phosphorylation

Malate-a-ketoglutarate transporter of mitochondrial inner membrane

1 9-29

Shuttles reducing equivalents (as malate) from matrix to cytosol

Glutamate-aspartate transporter of mitochondrial inner membrane

1 9-29

Completes shuttling begun by malate-a-ketoglutarate shuttle

Citrate transporter of mitochondrial inner membrane

2 1-1 0

Provides cytosolic citrate as source of acetyl-GoA for lipid synthesis

Pyruvate transporter o f mitochondrial inner membrane

21-10

Is part of mechanism for shuttling citrate from matrix to cytosol

Fatty acid transporter of myocyte plasma membrane

1 7-3

Imports fatty acids for fuel

Complex I, III, and N proton transporters of mitochondrial inner membrane

19-16

Acts as energy-conserving mechanism in oxidative phosphorylation, converting electron flow into proton gradient

Thermogenin (uncoupler protein) , a proton pore of mitochondrial inner membrane

19-34, 23-35

Allows dissipation of proton gradient in mitochondria as means of thermogenesis and/or disposal of excess fuel

Cytochrome bj complex, a proton transporter of chloroplast thylakoid

1 9-59

Acts as proton pump, driven by electron flow through the Z scheme; source of proton gradient for photosynthetic ATP synthesis

Bacteriorhodopsin, a light-driven proton pump

1 9-66

Is light-driven source of proton gradient for ATP synthesis in halophilic bacterium

FoF1 ATPase/ATP synthase of mitochond1ial inner membrane, chloroplast thylakoid, and bacterial plasma membrane

1 9-64

Interconverts energy of proton gradient and ATP during oxidative phosphorylation and photophosphorylation

Pi-triose phosphate antiporter of chloroplast inner membrane

20-15, 20-16

Exports photosynthetic product from stroma; imports Pi for ATP synthesis

Bacterial protein transporter

27-44

Exports secreted proteins through plasma membrane

Protein translocase of ER

27-38

Transports into ER proteins destined for plasma membrane, secretion, or organelles

Nuclear pore protein translocase

27-42

Shuttles proteins between nucleus and cytoplasm

LDL receptor in animal cell plasma membrane

2 1-42

Imports, by receptor-mediated endocytosis, lipid carrying particles

Glucose transporter of animal cell plasma to membrane; regulated by insulin IP3-gated Ca2 + channel of endoplasmic reticulum

1 2-16

Increases capacity of muscle and adipose tissue to take up excess glucose from blood Allows signaling via changes of cytosolic Ca2 +

cGMP-gated Ca2+ channel of retinal rod and cone cells

1 2-36

Allows signaling via rhodopsin linked to cAMP phosphodiesterase in vertebrate eye

Voltage-gated Na+ channel of neuron

1 2-25

Creates action potentials in neuronal signal transmission

12-10

concentration

component of curare (used as an arrow poison in the Amazon region) , and two other toxins from snake ven­ oms, cobrotoxin and bungarotoxin, block the acetyl­ choline receptor or prevent the opening of its ion

channel. By blocking signals from nerves to muscles, all these toxins cause paralysis and possibly death. On the positive side, the extremely high affinity of bungaro­ toxin for the acetylcholine receptor CKct 1 0 - 15 M) has =

[4 12]

Biological Mem branes a n d Tra nsport

TAB L E 1 1 -7

Some Diseases Resulting from lon Channel Defects

Ion channel

Affected gene

Disease

Na + (voltage-gated, skeletal muscle)

SCN4A

Hyperkalemic periodic paralysis (or paramyotonia congenita)

Na + (voltage-gated, neuronal)

SCNJA

Generalized epilepsy with febrile seizures

Na + (voltage-gated, cardiac muscle) 2 Ca + (neuronal) 2 Ca + (voltage-gated, retina) Ca2 + (polycystin-1)

SCN5A

Long QT syndrome 3

CACNAJA

Familial hemiplegic migraine

CACNAJF

Congenital stationary night blindness

PKDJ

Polycystic kidney disease

K+ (neuronal)

KCNQ4

Dominant deafness

K+ (voltage-gated, neuronal)

KCNQ2

Benign familial neonatal convulsions

Nonspecific cation (cGMP-gated, retinal)

CNCGJ

Retinitis pigmentosa

Acetylcholine receptor (skeletal muscle)

CHRNAJ

Congenital myasthenic syndrome

Cl-

CFTR

Cystic fibrosis

proved useful experimentally: the radiolabeled toxin was used to quantify the receptor during its purification. •

Tetrodotoxin

H

concentration to the side with lower. Others transport solutes against an electrochemical gradient; this requires a source of metabolic energy. •

Carriers, like enzymes, show saturation and stereospecificity for their substrates. Transport via these systems may be passive or active. Primary active transport is driven by ATP or electron-transfer reactions; secondary active transport is driven by coupled flow of two solutes, one of which (often H + or Na + ) flows down its electrochemical gradient as the other is pulled up its gradient.



The GLUT transporters, such as GLUT! of erythrocytes, carry glucose into cells by facilitated diffusion. These transporters are uniporters, carrying only one substrate. Symporters permit simultaneous passage of two substances in the same direction; examples are the lactose transporter of E. coli, driven by the energy of a proton gradient Oactose-H+ symport) , and the glucose transporter of intestinal epithelial cells, driven by a Na + gradient (glucose-Na + symport) . Antiporters mediate simultaneous passage of two substances in opposite directions; examples are the chloride-bicarbonate exchanger of erythrocytes and the ubiquitous Na + K+ ATPase.



In animal cells, Na + K + ATPase maintains the differences in cytosolic and extracellular concentrations of Na + and K + , and the resulting Na + gradient is used as the energy source for a variety of secondary active transport processes.



The Na + K+ ATPase of the plasma membrane and the Ca2 + transporters of the sarcoplasmic and endoplasmic reticulum (the SERCA pumps) are examples of P-type ATPases; they undergo reversible phosphorylation during their catalytic cycle. F-type ATPase proton pumps (ATP synthases) are central to energy-conserving

r NHz

N

H OH N

HaC CHa r\:OCH "-+/ CH2\J" _ O� c � 3 -H H 0'0 H2/ HaCO OH - H CH3 Saxitoxin

D-Tubocurarine

S U M M A RY 1 1 . 3 •



chloride

S o l u t e Tra n s p o rt a cross M e mbra n e s

Movement of polar compounds and ions across biological membranes requires transporter proteins. Some transporters simply facilitate passive diffusion across the membrane from the side with higher

Further Reading

mechanisms in mitochondria and chloroplasts. V-type ATPases produce gradients of protons across some intracellular membranes, including plant vacuolar membranes.

Further Reading Composition and Architecture of Membranes



ABC transporters carry a variety of substrates (including many drugs) out of cells , using ATP as energy source.



Ionophores are lipid-soluble molecules that bind specific ions and carry them passively across membranes, dissipating the energy of electrochemical ion gradients.





[41 3]

Boon, J.M. & Smith, B.D. (2002) Chemical control of phospholipid distribution across bilayer membranes . Med Res Rev. 22, 251-281. Intermediate-level review of phospholipid asymmetry and factors that influence it. Dowhan, W. ( 1997) Molecular basis for membrane phospholipids di­ versity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232. Ediden, M. (2002) Lipids on the frontier: a century of cell-membrane bilayers. Nat. Rev. Mol. Cell Biol. 4, 4 1 4-4 1 8.

Water moves across membranes through aquaporins. Some aquaporins are regulated; some also transport glycerol or urea. Ion channels provide hydrophilic pores through which select ions can diffuse, moving down their electrical or chemical concentration gradients; they characteristically are unsaturable, have very high flux rates, and are highly specific for one ion. Most are voltage- or ligand-gated. The neuronal Na + channel is voltage-gated, and the acetylcholine receptor ion channel is gated by acetylcholine, which triggers conformational changes that open and close the transmembrane path.

Short review of how the notion of a lipid bilayer membrane was developed and confirmed. Haltia, T. & Freire, E. ( 1 995) Forces and factors that contribute to the structural stability of membrane proteins. Biochim. Biophys Acta 1241, 295-322. Good discussion of the secondary and tertiary structures of membrane proteins and the factors that stabilize them . Von Heijne, G. (2006) Membrane protein topology. Nat. Rev. Mol Cell Biol. 7, 909-918.

White, S.H., Ladokhin, A.S., Jayasinghe, S., & Hristova, K.

(2001) How membranes shape protein structure. J Biol. Chem 276, 32,395-32,398. Brief, intermediate-level review of the forces that shape trans­ membrane helices. Wimley, W.C. (2003) The versatile f3 barrel membrane protein. Curr: Opin. Struct Biol 13, 1-8.

Intermediate-level review.

Membrane Dynamics

Key Terms

Arnaout, M.A., Mahalingam, B., & Xiong, J.-P. (2005) Integrin

Terms in bold are defined in the glossary.

Biol.

fluid mosaic model 373 micelle 374 bilayer 374 integral proteins

375

peripheral proteins 375 amphitropic proteins 375 hydropathy index 378 {3 barrel 379 gel phase 381 liquid-disordered state 381 liquid-ordered state 381 flippases 382 floppases 383 scramblases 383 FRAP 383 microdomains 384 rafts 384 caveolin 386 caveolae 386 fusion proteins 387 SNAREs 388 simple diffusion 390 membrane potential ( Vm) 390

structure, allostery, and bidirectional signaling. Annu. Rev. Cell Dev. 21, 381-410.

Brown, D.A. & London, E. ( 1 998) Functions of lipid rafts in biolog­ ical membranes. Annu. Rev. Cell Dev. Biol . 14, 1 1 1-136.

electrochemical gradient 390 electrochemical potential 390 facilitated diffusion 390

Daleke, D.L. (2007) Phospholipid flippases. J Biol. Chem. 282,

821-825. Intermediate-level review.

passive transport

Deveaux, P.F., Lopez-Montero, I., & Bryde, S. (2006) Proteins involved in lipid translocation in eukaryotic cells. Chem. Phys. Lipids 141, 1 1 9-132.

transporters

Didier, M., Lenne, P.-F., Rigneault, H., & He, H.-T (2006)

390 391

carriers 391 channels 391 electroneutral 395 cotransport systems antiport 395

395

symport 395 uniport 395 active transport 395 electrogenic 396 P-type ATPases 396 SERCA pump 397 F-type ATPases 399 ATP synthase 399

V-type ATPases

399 ABC transporters 400 ionophores 404 aquaporins (AQPs) 404 ion channel 406

Dynamics in the plasma membrane: how to combine fluidity and order. EMBO J 25, 3446-3457. Intermediate-level review of studies of membrane dynamics, with fluorescent and other probes. Edidin, M. (2003) The state of lipid rafts: from model membranes to cells. Annu. Rev. Biophys Biomol. Struct. 32, 257-283 .

Advanced review. Frye, L.D. & Ediden, M. (1 970) The rapid intermixing of cell­ surface antigens after formation of mouse-human heterokaryons .

J Cell Sci. 7, 3 1 9-335. The classic demonstration of membrane protein mobility. Graham, T.R. (2004) Flippases and vesicle-mediated protein trans­

port. Trends Cell Biol. 14, 670-677. Intermediate review of flippase function. Jahn, R. & Scheller, R.H. (2006) SNAREs-engines for membrane fusion. Nat. Rev. Cell Mol. Biol. 7, 63 1-643 . Excellent intermediate-level review of the role of SNAREs in membrane fusion, and the fusion mechanism itself. Janmey, P.A. & Kunnunen, P.K.J. (2006) Biophysical properties of lipids and dynamic membranes. Trends Cell Biol. 16, 538-546

[4 14]

Biological Mem bra n es and Tra nsport

Linder, M.E. & Deschenes, R.J. (2007) Palmitoylation: policing

Stokes, D.L. & Green, N.M. (2003) Structure and function of the

protein stability and traffic. Nat. Rev Mol. Cell Biol. 8,

calcium pump. Annu Rev. Biophys Biomol Struct. 32,

74-84.

Marguet, D., Lenne, P.-F., Rigneault, H., & He, H.-T. (2006) Dy­

445-468

Advanced review

namics in the plasma membrane: how to combine fluidity and order.

Sui, H., Han, B.-G., Lee, J.K., Walian, P., & Jap, B.K. (2001)

EMBO J. 2 5 , 3446-3457

Structural basis of water-specific transport through the AQP1 water

Intermediate-level review of the methods and results of studies

channel. Natur-e 414,

872-878.

High-resolution solution of the aquaporin structure by x-ray

on molecular motions in the membrane .

Mayer, A. (2002) Membrane fusion in eukaryotic cells. Annu Rev

crystallography.

Toyoshima, C. & Mizutani, T. (2004) Crystal structure of the

Cell Dev Biol. 18, 289-3 14. Advanced review of membrane fusion, with emphasis on the conserved general features

calcium pump with a bound ATP analogue. Nature 43 0 ,

529-535.

Toyoshima, C., Nomura, H., & Tsuda, T. (2004) Lumenal gating

Palsdottir, H. & Hunte, C. (2004) Lipids in membrane protein

mechanism revealed in calcium pump crystal structures with

structures. Biochim Biophys Acta 1666,

phosphate analogs Natur-e 432,

2-18

Parton, R.G. (2003) Caveolae-from ultrastructure to molecular mechanisms Nat Rev Mol. Cell Biol 4,

162-167.

A concise historical review of caveolae, caveolin, and rafts.

Parton, R.G. & Simons, K. (2007) The multiple faces of caveolae Nat Rev Mol Cell Biol. 8, 185-194

Phillips, S.E., Vmcent, P., Rizzieri, K.E., Schaaf, G., & Bankaitis, V.A. (2006) The diverse biological functions of phos­ phatidylinositol transfer proteins in eukaryotes Grit Rev Biochem

Mol. Biol 4 1 , 2 1-49 Advanced review of the role of these proteins in lipid signaling

361-368.

The supplementary materials available with the online version of this article include an excellent movie of the putative gating mechanism.

Watson, R.T. & Pessin, J.E. (2006) Bridging the GAP between insulin signaling and GLUT4 translocation. Trends Biochem. Sci.

3 1 , 215-222 . Intermediate-level review of the regulation of glucose transpmt through GLUT4.

Ion Channels

and membrane trafficking

Ashcroft, F.M. (2006). From molecule to malady. Nature 440,

Pomorski, T. , Holthuis, J.C.M., Herrmann, A., & van Meer, G.

440-447.

(2004) Tracking down lipid flippases and their biological functions. J Cell Sci. 117, 805-8 13

in ion channels lead to disease in humans.

Sprong, H., van der Sluijs, P. , & van Meer, G. (2001) How pro­

Doyle, D.A., Cabral, K.M., Pfuetzner, R.A., Kuo, A., Gulbis,

teins move lipids and lipids move proteins. Nat. Rev Mol Cell Biol.

2, 504-5 13 . Intermediate-level review.

Throm, L.K. ( ed. ). (2005) Pr-otein-Lipid Inter-actions. From Membmne

Domains to Cellular- Networ-ks, W!ley-VCH, Weinheim, Germany.

van Deurs, B., Roepstortf, K., Hommelgaard, A.M., & Sandvig, K. (2003) Caveolae: anchored, multifunctional platforms in the lipid ocean. Trends Cell Biol

13, 92-100.

J.M., Cohen, S.L., Chait, B.T., & MacKinnon, R. (1 998) The

structure of the potassium channel: molecular basis of K + conduction and selectivity. Science 280,

69-77.

The first crystal structure of an ion channel is described.

Edelstein, S.J. & Changeux, J.P. (1 998) Allosteric transitions of the acetylcholine receptor. A dv. Prot Chem 5 1 , 1 2 1-1 84 . Advanced discussion of the conformational changes induced by acetylcholine.

Gadsby, D.C., Vergani, P., & Csanady, L. (2006) The ABC protein

Yeagle, P.L. (ed.). (2004) The Structure of Biological

turned chloride channel whose failure causes cystic fibrosis. Nature

Membranes, 2nd edn, CRC Press, Inc ., Boca Raton, FL.

Zimmerberg, J. & Kozlov, M.M. (2006) How proteins produce cellular membrane curvature. Nat Rev. Mol Cell Biol 7,

A short review of the many known cases in which genetic defects

9-19

440, 477-483 This is one of seven excellent reviews of ion channels published together in this issue of Natur-e

Gouaux, E. & MacKinnon, R. (2005) Principles of selective ion

Transporters

transport in channels and pumps. Science

Abramson, J., Smirnova, I., Kasho, V., Verner, G., Kaback, H.R., & Iwata, S. (2003) Structure and mechanism of the lactose permease of Escherichia coli. Science

30 1 , 6 1 0-615.

3 10, 1461-1465.

Short review of the architectural features of channels and pumps that give each protein its ion specificity.

Guggino, W.B. & Stanton, B.A. (2006) New insights into cystic

Fujiyoshi, Y., Mitsuoka, K., de Groot, B.L., Philippsen, A.,

fibrosis: molecular switches that regulate CFTR. Natur-e Rev Malec

Grubmiiller, H., Agre, P., & Engel, A. (2002) Structure and

Cell Bioi 7, 426-436

function of water channels. Curr: Opin Struct Bioi 12,

509-5 1 5. Jorgensen, P.L., Hakansson, K.O., & Karlish, S.J.D. (2003) Structure and mechanism of Na,K-ATPase: functional sites and their interactions. Annu. Rev. Physiol . 65 ,

Hille, B. (2001) Jon Channels of Excitable Membranes, 3rd edn, Sinauer Associates, Sunderland, MA.

8 1 7-849.

Intermediate-level text emphasizing the function of ion channels.

Jiang, Y., Lee, A., Chen, J., Ruta, V., Cadene, M., Chait, B.T., & MacKinnon, R. (2003) X-ray structure of a voltage-dependent K +

Kjellbom, P., Larsson, C., Johansson, I., Karlsson, M., &

channel. Nature 42 3 ,

Johanson, U. ( 1 999) Aquaporins and water homeostasis in plants .

King, L.S., Kozono, D., & Agre, P. (2004) From structure to dis­

Trends Plant Sci 4, 308-3 14.

33-4 1 .

ease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Bioi.

Intermediate-level review.

5, 687-698

Kiihlbrandt, W. (2004) Biology, structure and mechanism of P-type 5, 282-295.

ATPases. Nat Rev Mol. Cell Bioi.

Intermediate-level review, very well illustrated

Intermediate-level review of the localization of aquaporins in mammalian tissues and the effects of aquaporin defects on physiology.

Lee, A.G. & East, J.M. (2001) What the structure of a calcium

J. 3 5 6 , 665-683.

Mueckler, M. (1 994) Facilitative glucose transporters. Eur: J.

pump tells us about its mechanism. Biochem

Schmitt, L. & Tampe, R. (2002) Structure and mechanism of ABC

structure of a mammalian voltage-dependent Shaker family K +

transporters. Curr: Opin. Struct Bioi. 12,

channel. Science 3 09,

Biochem. 21 9, 713-725.

Long, S.B., Campbell, E.B., & MacKinnon, R. (2005) Crystal

754-760.

897-902

Problems

Long, S.B., Campbell, E.B., & MacKinnon, R. (2005) Voltage

sensor of Kv 1 .2 : structural basis of electromechanical coupling. Science 309, 903-908.

These two articles by Long and coauthors describe the structural studies that led to models for voltage sensing and gating in the K+ channel. Miyazawa, A., Fujiyoshi, Y. , & Unwin, N. (2003) Structure and gating mechanism of the acetylcholine receptor pore. Nature 423, 949-955.

Intermediate-level review. Neher, E. & Sakmann, B. ( 1 992) The patch clamp technique. Sci_ Am (March) 266, 44-51.

2. Evidence for a Lipid Bilayer In 1 925, E . Gorter and F. Grendel used an apparatus like that described in Problem 1 to determine the surface area of a lipid monolayer formed by lipids extracted from erythrocytes of several animal species. They used a microscope to measure the dimensions of individ­ ual cells, from which they calculated the average surface area of one erythrocyte. They obtained the data shown in the table. Were these investigators justified in concluding that "chromo­ cytes [erythrocytes] are covered by a layer of fatty substances that is two molecules thick" (i.e., a lipid bilayer)?

Clear description of the electro physiological methods used to measure the activity of single ion channels, by the Nobel Prize­ winning developers of this technique. Sheppard, D.N. & Welsh, M.J. ( 1 999) Structure and function of

the CFTR chloride channel . Physiol Rev. 79, S23-S46. One of 1 1 reviews in this journal issue on the CFTR chloride channel; the reviews cover structure, activity, regulation, biosynthe­ sis, and pathophysiology. Shi, N., Ye, S., Alam, A., Chen, L., & Jiang, Y. (2006) Atomic struc­ ture of a Na+ - and K + -conducting channel Nature 440, 427-429

Crystallographic study of an ion channel that admits both Na + and K + , and the structural explanation for this dual specificity. Tombola, F., Pathak, M.M., & Isacoff, E.Y. (2006) How does voltage open an ion channel? Annu Rev. Cell Dev. Biol 22, 23-52. Advanced review of the mechanisms of voltage gating of ion channels Yellen, G. (2002) The voltage-gated potassium channels and their

relatives . Nature 419. 35-42

P ro b l e m s 1 . Determining the Cross-Sectional Area of a Lipid

Molecule When phospholipids are layered gently onto the surface of water, they orient at the air-water interface with their head groups in the water and their hydrophobic tails in the air. An experimental apparatus ( a) has been devised that reduces the surface area available to a layer of lipids. By meas­ uring the force necessary to push the lipids together, it is pos­ sible to determine when the molecules are packed tightly in a continuous monolayer; as that area is approached, the force needed to further reduce the surface area increases sharply (b). How would you use this apparatus to determine the aver­ age area occupied by a single lipid molecule in the monolayer? Force applied here to compress f"l monolayer

. . . - --- 'l!l

·- - --- �

40

(a)

8 �



30 20

(b)

Total surface

Animal

Volume of

Number

area of lipid

Total surface

packed

of cells

monolayer

area of one 2 cell (p,m )

cells

(mL)

(per mm3)

2 from cells (m )

Dog

40

8,000,000

Sheep

10

9,900,000

6.0

29.8

4,740,000

0.92

99.4

Human

62

98

Source: Data from Gorter, E & Grende l , F. (1925) On bimolecular layers Exp Med 41, 439-443.

of lipoids on the chromocytes of the blood. J.

3. Number of Detergent Molecules per Micelle When a small amount of the detergent sodium dodecyl sulfate (SDS; Na+CH3 (CH2) 1 1 0803) is dissolved in water, the deter­ gent ions enter the solution as monomeric species. As more detergent is added, a concentration is reached (the critical mi­ celle concentration) at which the monomers associate to form micelles The critical micelle concentration of SDS is 8.2 mM. The micelles have an average particle weight (the sum of the molecular weights of the constituent monomers) of 1 8,000. Calculate the number of detergent molecules in the average micelle. 4. Properties of Lipids and Lipid Bilayers Lipid bilayers formed between two aqueous phases have this important property: they form two-dimensional sheets, the edges of which close upon each other and undergo self-sealing to form

vesicles (liposomes) . (a) What properties of lipids are responsible for this prop­ erty of bilayers? Explain. (b) What are the consequences of this property for the structure of biological membranes? 5. Length of a Fatty Acid Molecule The carbon-carbon bond distance for single-bonded carbons such as those in a saturated fatty acyl chain is about 1 .5 A. Estimate the length of a single molecule of palmitate in its fully extended form. If two molecules of palmitate were placed end to end, how would their total length compare with the thickness of the lipid bi­ layer in a biological membrane? 6. Temperature Dependence of Lateral Diffusion The experiment described in Figure 1 1-1 7 was performed at 37 °C. If the experiment were carried out at 10 oc, what effect would

� 10 Q) u

[4 1 5]

you expect on the rate of diffusion? Why?

0.2

0.6

1.0

Area (nm2/molecule)

7. Synthesis of Gastric Juice: Energetics Gastric juice 1.4

(pH 1 .5) is produced by pumping HCl from blood plasma (pH 7.4) into the stomach. Calculate the amount of free energy

[416]

Biological M embranes and Tra n sport

required to concentrate the H

+

° in 1 L of gastric juice at 37 C .

sphingomyelin. Although the phospholipid components of the

Under cellular conditions, h o w many moles of ATP must be hy­

membrane can diffuse in the ftuid bilayer, this sidedness is pre­

drolyzed to provide this amount of free energy? The free ­

served at all times. How?

energy change for ATP hydrolysis under cellular conditions i s about - 58 kJ/mol (as explained in Chapter 13) . Ignore the effects of the transmembrane electrical potential.

15. Membrane Permeability At pH 7, tryptophan crosses a lipid bilayer at about one-thousandth the rate of indole, a closely related compound:

8. Energetics of the Na+K + ATPase For a typical verte­

� v-- N/

brate cell with a membrane potential of - 0 . 070 V (inside neg­ ative) , what is the free-energy change for transporting 1 mol of

Na + from the cell into the blood at 37 oc? Assume the concen­ + tration of Na inside the cell is 1 2 mM and that in blood plasma

H

Suggest an explanation for this observation.

is 145 mM.

9. Action of Ouabain on Kidney Tissue Ouabain specifi­

+ + cally inhibits the Na K ATPase activity of animal tissues but

is not known to inhibit any other enzyme. When ouabain is added to thin slices of living kidney tissue, it inhibits oxygen consumption by

66% . Why? What does this observation tell us

about the use of respiratory energy by kidney tissue?

10. Energetics of Symport Suppose you determined ex­ perimentally that a cellular transport system for glucose,

driven by symport of Na +, could accumulate glucose to con­

centrations 25 times greater than in the external medium, + while the external [Na ] was only 10 times greater than the in­ + tracellular [Na ] . Would this violate the laws of thermodynam­ ics? If not, how could you explain this observation?

16. Water Flow through an Aquaporin A human erythro­ 5 cyte has about 2 X 1 0 AQP-1 monomers . If water molecules 8 ftow through the plasma membrane at a rate of 5 X 1 0 per

AQP - 1 tetramer per second, and the volume of an erythrocyte 11 is 5 x 10mL, how rapidly could an erythrocyte halve its volume as it encountered the high osmolarity (1

M) in the in­

terstitial ftuid of the renal medulla? Assume that the erythro­ cyte consists entirely of water.

17. Labeling the Lactose Transporter A bacterial lactose transporter, which is highly specific for lactose, contains a Cys residue that is essential to its transport activity. Covalent reac­ tion of N-ethylmaleimide (NEM) with this Cys residue irre­ versibly inactivates the transporter. A high concentration of lactose in the medium prevents inactivation by NEM, presum­

1 1 . Location of a Membrane Protein The following observa­

ably by sterically protecting the Cys residue, which is in or near

tions are made on an w1knovvn membrane protein, X. It can be

the lactose-binding site . You know nothing else about the trans­

extracted from disrupted erythrocyte membranes into a concen­

porter protein. Suggest an experiment that might allow you to

trated salt solution, and it can be cleaved into fragments by

determine the Mr of the Cys-containing transporter polypeptide.

proteolytic enzymes. Treatment of erythrocytes with proteolytic

18. Predicting Membrane Protein Topology from Se­ quence You have cloned the gene for a human erythrocyte

enzymes followed by disruption and extraction of membrane components yields intact X. However, treatment of erythrocyte "ghosts" (which consist of just plasma membranes, produced by disrupting the cells and washing out the hemoglobin) with prote­ olytic enzymes followed by disruption and extraction yields ex­ tensively fragmented X. What do these observations indicate about the location of X in the plasma membrane? Do the proper­ ties of X resemble those of an integral or peripheral membrane

protein?

12. Membrane Self-sealing Cellular membranes are self­ sealing-if they are punctured or disrupted mechanically, they quickly and automatically reseal. What properties of mem­ branes are responsible for this important feature?

protein, which you suspect is a membrane protein. From the nucleotide sequence of the gene, you know the amino acid se­ quence. From this sequence alone, how would you evaluate the possibility that the protein is an integral protein? Suppose the protein proves to be an integral protein, either type I or type

II.

Suggest biochemical or chemical experiments that

might allow you to determine which type it is.

19. Intestinal Uptake of Leucine You are studying the up­ take of L-leucine by epithelial cells of the mouse intestine. Measurements of the rate of uptake of L-leucine and several of its analogs, with and without Na + in the assay buffer, yield the results given in the table. What can you conclude about the

13. Lipid Melting Temperatures Membrane lipids in tissue

properties and mechanism of the leucine transporter? Would

samples obtained from different parts of the leg of a reindeer

you expect L-leucine uptake to be inhibited by ouabain?

have different fatty acid compositions. Membrane lipids from

Uptake in

presence of Na +·

tissue near the hooves contain a larger proportion of unsatu­ rated fatty acids than those from tissue in the upper leg. What

Uptake in

absence of Na +

is the significance of this observation?

Substrate

Vmax

Kt (mM)

Vmax

14. Flip-Flop Diffusion The inner leaflet (monolayer) of

L-Leucine

420

0.24

23

0.2

the human erythrocyte membrane consists predominantly of

o-Leucine

310

4.7

5

4.7

phosphatidylethanolamine and phosphatidylserine . The outer

L-Valine

225

0.31

leaflet consists predominantly of phosphatidylcholine and

19

Kt (mM)

0.31

Problems

20. Effect of an Ionophore on Active Transport Consider the leucine transporter described in Problem 19. Would Vmax and/or Kt change if you added a Na + ionophore to the assay so­ lution containing Na + ? Explain. 2 1 . Surface Density of a Membrane Protein E. coli can be induced to make about 1 0,000 copies of the lactose trans­ porter CMr 3 1 ,000) per cell. Assume that E. coli is a cylinder 1 �tm in diameter and 2 �tm long. 'What fraction of the plasma membrane surface is occupied by the lactose transporter mol­ ecules? Explain how you arrived at this conclusion. 22. Use of the Helical Wheel Diagram A helical wheel is a two-dimensional representation of a helix, a view along its cen­ tral axis (see Fig. 1 1-29b; see also Fig. 4-4d) . Use the helical wheel diagram below to determine the distribution of amino acid residues in a helical segment with the sequence -Val­ Asp-Arg-Val-Phe-Ser-Asn-Val-Cys-Thr-His-Leu-Lys-Thr­ Leu-Gln-Asp-Lys-

[417]

(c) Go to the Protein Data Bank (www.rcsb.org) . Use the PDB identifier 1 DE P to retrieve the data page for a por­ tion of the ,8-adrenergic receptor (one type of epinephrine receptor) isolated from a turkey. Using Jmol to explore the structure, predict whether this portion of the receptor is lo­ cated within the membrane or at the membrane surface. Explain. (d) Retrieve the data for a portion of another receptor, the acetylcholine receptor of neurons and myocytes, using the PDB identifier 1Al l . As in (c) , predict where this portion of the receptor is located and explain your answer. If you have not used the PDB, see Box 4-4 (p. 129) for more information.

Data Analysis Problem 25. The Fluid Mosaic Model of Biological Membrane Structure Figure 1 1-3 shows the currently accepted fluid

mosaic model of biological membrane structure. This model was presented in detail in a review article by S. J . Singer i n 1 9 7 1 . I n the article, Singer presented the three models of membrane structure that had been proposed by that time:

What can you say about the surface properties of this helix? How would you expect the helix to be oriented in the tertiary structure of an integral membrane protein? 23. Molecular Species in the E. coli Membrane The plasma membrane of E. coli is about 75% protein and 25% phospholipid by weight. How many molecules of membrane lipid are present for each molecule of membrane protein? As­ sume an average protein Mr of 50,000 and an average phos­ pholipid Mr of 750. What more would you need to know to estimate the fraction of the membrane surface that is covered by lipids?

Biochemistry on the I nternet 24. Membrane Protein Topology The receptor for the hormone epinephrine in animal cells is an integral membrane protein CMr 64,000) that is believed to have seven membrane­ spanning regions. (a) Show that a protein of this size is capable of spanning the membrane seven times. (b) Given the amino acid sequence of this protein, how would you predict which regions of the protein form the membrane-spanning helices?

B

A

c A. The Davson-Danielli-Robertson Model. This was the most widely accepted model in 1 9 7 1 , when Singer's review was published. In this model, the phospholipids are arranged as a bilayer. Proteins are found on both surfaces of the bilayer, at­ tached to it by ionic interactions between the charged head groups of the phospholipids and charged groups in the pro­ teins. Crucially, there is no protein in the interior of the bilayer. B. The Benson Lipoprotein Subunit Model. Here, the pro­ teins are globular and the membrane is a protein-lipid mixture. The hydrophobic tails of the lipids are embedded in the hy­ drophobic parts of the proteins. The lipid head groups are exposed to the solvent. There is no lipid bilayer.

[4 1 8]

Biological Mem branes and Tra nsport

C. The Lipid-Globular Protein Mosaic Model. This is the

monolayer area to cell membrane area was about 2 .0 . At

model shown in Figure 1 1-3 . The lipids form a bilayer and pro­

higher pressures-thought to be more like those found in

teins are embedded in it, some extending through the bilayer

cells-the ratio was substantially lower.

and others not. Proteins are anchored in the bilayer by hy­

(e) Circular dichroism spectroscopy uses changes in po­

drophobic interactions between the hydrophobic tails of the

larization of UV light to make inferences about protein second­

ary structure (see Fig. 4-9) . On average, this technique showed

lipids and hydrophobic portions of the protein. For the data given below, consider how each piece of in­ formation aligns with each of the three models of membrane

that membrane proteins have a large amount of a helix and little

structure. Which model(s) are supported, which are not sup­

proteins having a globular structure.

ported, and what reservations do you have about the data or

or no f3 sheet. This finding was consistent with most membrane (f) Phospholipase C is an enzyme that removes the polar head group (including the phosphate) from phospholipids. In

their interpretation? Explain your reasoning. (a) When cells were fixed, stained with osmium tetroxide,

several studies, treatment of intact membranes with phospho­

and examined in the electron microscope, they gave images

lipase C removed about 70% of the head groups without dis­

like that in Figure 1 1- 1 : the membranes showed a "railroad

rupting the "railroad track" structure of the membrane.

track" appearance, with two dark-staining lines separated by a (b) The thickness of membranes in cells fixed and stained

5 to 9 nm The thickness of a "naked" phospholipid bilayer, without proteins, was 4 to 4.5 nm

in the same way was found to be

(g) Singer described a study in which "a glycoprotein of molecular weight about 3 1 ,000 in human red blood cell mem­

light space. .

The thickness of a single monolayer of proteins was about 1

.

nm.

(c) In Singer's words: "The average amino acid composi­

branes is cleaved by tryptic treatment of the membranes into soluble glycopeptides of about 10,000 molecular weight, while the remaining portions are quite hydrophobic" (p. 1 99) . Trypsin treatment did not cause gross changes in the mem­ branes, which remained intact.

tion of membrane proteins is not distinguishable from that of

Singer's review also included many more studies in this

soluble proteins. In particular, a substantial fraction of the

area. In the end, though, the data available in 1971 did not con­

residues is hydrophobic" (p. 1 6 5) .

clusively prove Model C was correct. As more data have accu­

(d) As described in Problems 1 and 2 of this chapter, re­ searchers had extracted membranes from cells, extracted

mulated, this model of membrane structure has been accepted by the scientific community.

the lipids, and compared the area of the lipid monolayer with the area of the original cell membrane. The interpretation of the results was complicated by the issue illustrated in the graph of Problem 1 : the area of the monolayer depended on how hard it was pushed. With very light pressures, the ratio of

Reference Singer, S.J. (1971) The molecular organization of biological mem­ branes . In Structure and Function ofBiological Membranes (Roth­ field, L.l., ed.) , pp . 145-222, Academic Press, Inc., New York.

When I first entered the study of hormone action, some 2 5 years ago, there was a widespread fee l i n g among b i o l ogists that hormone action cou l d not be stud ied mea n i ngfu l ly in the absence of orga n i zed cel l structure. However, as I reflected on the h i story of b i ochemistry, it

seemed to me there was a real pos s i b i l ity that hormones m ight act at the molec u l ar leve l . -Earl W Sutherland, Nobel Address, 7 9 7 7

Biosignaling 1 2. 1

General Features of Signai Transduction

1 2.2

G Protein-Coupled Receptors and Second Messengers

1 2 .3 1 2 .4

423

Receptor Tyrosine Kinases

1 2 .7

Gated lon Channels

449

455

1 2 . 1 General Features of Signal Transduction

Regulation ofTranscription by Steroid Hormones

1 2.9

446

lntegrins: Bidirectional Cell Adhesion Receptors

1 2.8

445

Multivalent Adaptor Proteins and Membrane Rafts

1 2 .6

439

Receptor Guanylyl Cyclases, cGMP, and Protein Kinase G

1 2.5

medium. In multicellular organisms, cells with different functions exchange a wide variety of signals. Plant cells respond to growth hormones and to variations in sunlight. Animal cells exchange information about the concentra­ tions of ions and glucose in extracellular fluids, the inter­ dependent metabolic activities taking place in different tissues, and, in an embryo, the correct placement of cells during development. In all these cases, the signal repre­ sents information that is detected by specific receptors and converted to a cellular response, which always in­ volves a chemical process. This conversion of informa­ tion into a chemical change, signal transduction, is a universal property of living cells.

41 9

456

Signaling in Microorganisms and Plants

457

1 2. 1 0 Sensory Transduction in Vision, Olfaction, and Gustation 1 2.1 1

461

Regulation of the Cell Cycle by Protein Kinases

469

1 2 . 1 2 Oncogenes, Tumor Suppressor Genes, and Programmed Cell Death

T

473

he ability of cells to receive and act on signals from beyond the plasma membrane is fundamental to life. Bacterial cells receive constant input from mem­ brane proteins that act as information receptors, sam­ pling the surrounding medium for pH, osmotic strength, the availability of food, oxygen, and light, and the pres­ ence of noxious chemicals, predators, or competitors for food. These signals elicit appropriate responses, such as motion toward food or away from toxic substances or the formation of dormant spores in a nutrient-depleted

Signal transductions are remarkably specific and exquis­ itely sensitive. Specificity is achieved by precise molec­ ular complementarity between the signal and receptor molecules (Fig. 1 2-la), mediated by the same kinds of weak (noncovalent) forces that mediate enzyme­ substrate and antigen-antibody interactions. Multicel­ lular organisms have an additional level of specificity, because the receptors for a given signal, or the intracel­ lular targets of a given signal pathway, are present only in certain cell types . Thyrotropin-releasing hormone, for example, triggers responses in the cells of the anterior pituitary but not in hepatocytes, which lack receptors for this hormone. Epinephrine alters glycogen metabo­ lism in hepatocytes but not in adipocytes; in this case, both cell types have receptors for the hormone, but whereas hepatocytes contain glycogen and the glycogen­ metabolizing enzyme that is stimulated by epinephrine, adipocytes contain neither. Three factors account for the extraordinary sensi­ tivity of signal transducers: the high affinity of receptors for signal molecules, cooperativity (often but not al­ ways) in the ligand-receptor interaction, and amplifica­ tion of the signal by enzyme cascades. The affinity

[420]

Biosignaling

Signal

(a) Specificity

(c) Desensitization/Adaptation

Signal molecule fits binding site on its complementary receptor; other signals do not fit.

Receptor activation triggers a feedback circuit that shuts off the receptor or removes it from the cell surface.

t

Response

Effect

(b) Amplification

(d) Integration

When enzymes activate enzymes, the number of affected molecules increases geometrically in an enzyme cascad

ignal

�e._�::::J-T-C�--,

When two signals have opposite effects on a metabolic characteristic such as the concentration of a second messenger X, or the membrane potential Vm• the regulatory outcome results from the integrated input from both receptors.

1 :!-:!:3 shows just a few of the multivalent proteins known to participate in sig­ naling. Many of the complexes include components with membrane-binding domains. Given the location of so many signaling processes at the inner surface of the /,.,--- ---......

Adaptor

SH3

\-

/�

Binding domains

Grb2

� proline-rich protein or membrane lipid PIP3

(,....}

® Tyr-® Tyr-

Adaptor

PIP3 Kinase

phospholipids (Ca2+-dependent)

l

DNA transcriptional activation

Phosphatase

carboxyl-terminal domain marking protein for attachment of ubiquitin I

Transcription

Signal regulation

.



C2 H GTPase-activating t-"

Ras signaling

�A

--- ------

---·-- ---

- ---- -

RasGAP

STAT

socs



socs

Phospholipid second­ messenger signaling FIGURE 1 2 -23 Some binding modules of signaling proteins. Each

activities. The name of each protein is given at its carboxyl -terminal

protein is represented by a l i ne (with the amino term inus to the left);

end. These signa ling proteins interact with phosphorylated proteins

symbols i ndicate the location of conserved binding dom a i ns (with

or phosphol i pids i n many permutations and combinations to form

specificities as l isted in the key; PH denotes plextrin homology; other

i ntegrated signa l i ng complexes.

abbreviations explained in the text); green boxes indi cate cata l ytic

1 2. 6 Gated lon Channels

proximity and correct orientation and even conferring allosteric properties on the interactions among the ki­ nases, which makes their serial phosphorylation sensi­ tive to very small stimuli. Phosphotyrosine phosphatases remove the phos­ phate from ®-Tyr residues, reversing the effect of phosphorylation. Some of these are receptorlike mem­ brane proteins, presumably controlled by extracellular factors not yet identified; other PTPases are soluble and contain SH2 domains. In addition, animal cells have protein ®- Ser and ®-Thr phosphatases, which re­ verse the effects of Ser- and Thr-specific protein ki­ nases. We can see, then, that signaling occurs in protein circuits, which are effectively hard-wired from signal receptor to response effector and can be switched off instantly by the hydrolysis of a single upstream phos­ phate ester bond. The multivalency of signaling proteins allows for the assembly of many different combinations of signaling modules, each combination suited to particular signals, cell types, and metabolic circumstances, yielding diverse signaling circuits of extraordinary complexity. Membrane Rafts and Caveolae Segregate

activity; mutant receptors lacking this activity remain in the raft during treatment with EGF. Caveolin, an in­ tegral membrane protein localized in caveolae, is phosphorylated on Tyr residues in response to insulin, and the now-activated E GF-R may be able to draw its binding partners into the raft. Spatial segregation of signaling proteins in rafts adds yet another dimension to the already complex processes initiated by extra­ cellular signals. S U M MA RV 1 2 . 5







Signaling Proteins

Membrane rafts (Chapter 1 1) are regions of the mem­ brane bilayer enriched in sphingolipids, sterols, and certain proteins, including many attached to the bi­ layer by GPI anchors. The f3-adrenergic receptor is segregated in rafts that contain G proteins, adenylyl cyclase, PKA, and a specific protein phosphatase , PP2, which together provide a highly integrated sig­ naling unit. By segregating in a small region of the plasma membrane all of the elements required for re­ sponding to and ending the signal, the cell is able to produce a highly localized and brief "puff" of second messenger. Some RTKs (EGF-R and PDGF-R) seem to be local­ ized in rafts, and this sequestration is very probably functionally significant. When cholesterol is removed from rafts by treatment of the membrane with cy­ clodextrin (which binds and removes cholesterol) , the rafts are disrupted and the RTK signaling pathways become defective. If an RTK in a raft is phosphorylated, and the only locally available PTPase that reverses this phosphory­ lation is in another raft, then dephosphorylation of the RTK is slowed or prevented. Interactions between adaptor proteins might be strong enough to recruit into a raft a signaling protein not normally located there, or might even be strong enough to pull recep­ tors out of a raft. For example, the E GF-R in isolated fibroblasts is normally concentrated in specialized rafts called caveolae (see Fig. 1 1-2 1 ) , but treatment with EGF causes the receptor to leave the raft. This migration depends on the receptor's protein kinase

[449]





M u ltiva l e n t A d a p t o r P rote i n s a n d M e m b ra n e Rafts

Many signaling proteins have domains that bind phosphorylated Tyr, Ser, or Thr residues in other proteins; the binding specificity for each domain is determined by sequences that adjoin the phosphorylated residue in the substrate. SH2 and PTB domains bind to proteins containing ®-Tyr residues; other domains bind ®-Ser and ®-Thr residues in various contexts. SH3 and PH domains bind the membrane phospholipid PIP3. Many signaling proteins are multivalent, with several different binding modules. By combining the substrate specificities of various protein kinases with the specificities of domains that bind phosphorylated Ser, Thr, or Tyr residues, and with phosphatases that can rapidly inactivate a signaling pathway, cells create a large number of multiprotein signaling complexes. Membrane rafts and caveolae sequester groups of signaling proteins in small regions of the plasma membrane, enhancing their interactions and making signaling more efficient.

1 2.6 Gated I on Chan nels Ion Channels U nderlie Electrical Signaling i n Excitable Cells

Certain cells in multicellular organisms are "excitable": they can detect an external signal, convert it into an electrical signal (specifically, a change in membrane po­ tential), and pass it on. Excitable cells play central roles in nerve conduction, muscle contraction, hormone se­ cretion, sensory processes, and learning and memory. The excitability of sensory cells, neurons, and myocytes depends on ion channels, signal transducers that pro­ vide a regulated path for the movement of inorganic ions such as Na+ , K+, Ca2+, and Cl - across the plasma mem­ brane in response to various stimuli. Recall from Chap­ ter 1 1 that these ion channels are "gated": they may be open or closed, depending on whether the associated re­ ceptor has been activated by the binding of its specific

l_4 50j



I

Biosig n a l i n g

FIGURE 1 2-24 Transmembrane electrical potential. (a) The electrogen ic Na + K + ATPase produces a transmembrane electrical poten­ tial of about - 60 mV ( i nside negative). (b) Blue arrows show the d i rection in which ions tend to move spontaneously across the

(a) The electrogenic Na+K+ ATPase establishes the membrane potential.

plasma membrane in an animal cel l , driven by the combination of

Membrane potential - 50 to - 70 mV

chemical and electrical grad ients. The chemical gradient drives N a + and Ca 2 + i nward (prod u c i ng depolarization) and K + outward (producing hyperpolar i zation). The electrical gradient drives Cl- outward, against its concentration gradient (producing

Plasma membrane

=

+

+

depolarization).

(b)

+

+

+

ligand (a neurotransmitter, for example) or by a change in the transmembrane electrical potential, Vm · The Na + K+ ATPase is electrogenic; it creates a charge im­ balance across the plasma membrane by carrying 3 Na + out of the cell for every 2 K+ carried in (Fig. 1 2-24a), making the inside negative relative to the outside. The membrane is said to be polarized. KEY CO N V E N T I O N : Vm is negative when the inside of the cell is negative relative to the outside. For a typical animal cell, Vm = - 50 to - 70 mV. •

Because ion channels generally allow passage of ei­ ther anions or cations but not both, ion flux through a channel causes a redistribution of charge on the two sides of the membrane, changing Vm · Influx of a posi­ tively charged ion such as Na + , or efflux of a negatively charged ion such as Cl-, depolarizes the membrane and brings Vm closer to zero. Conversely, efflux of K+ hyper­ polarizes the membrane and Vm becomes more nega­ tive. These ion fluxes through channels are passive, in contrast to active transport by the Na+K+ ATPase. The direction of spontaneous ion flow across a polarized membrane is dictated by the electrochemical potential of that ion across the membrane, which has two components: the difference in concentration (C) of the ion on the two sides of the membrane, and the dif­ ference in electrical potential, typically expressed in millivolts. The force (�G) that causes a cation (say, Na +) to pass spontaneously inward through an ion channel is a function of the ratio of its concentrations on the two sides of the membrane (Gin/Gout) and of the dif­ ference in electrical potential (Vm or �lji) :

(12-1)

where R is the gas constant, T the absolute temperature, the charge on the ion, and J the Faraday constant. (Note that the sign of the charge on the ion determines the sign of the second term in Eqn 12-1 .) In a typical neu­ ron or myocyte, the concentrations of Na + , K+, Ca2 + , and Cl- in the cytosol are very different from those in the ex­ tracellular fluid (Table 12-6) . Given these concentration differences, the resting Vm of about -60 mV, and the re­ lationship shown in Equation 12-1 , the opening of a Na + or Ca2 + channel will result in a spontaneous inward flow of Na + or Ca2+ (and depolarization) , whereas opening Z

+ +

Ions tend to move down their electrochemical gradient across the polarized membrane.

[Na+ l High

0 0 2 K•

High

�--411� [K+]

Low

[Ca2 + J H.igh

+

+

+

+

of a K+ channel will result in a spontaneous outward flux of K+ (and hyperpolarization) (Fig. 12-24b) . A given ionic species continues to flow through a channel only as long as the combination of concentra­ tion gradient and electrical potential provides a driving force. For example, as Na + flows down its concentration gradient, it depolarizes the membrane. When the mem­ brane potential reaches_ct- 70 mV, the effect of this mem­ brane potential (resistance to further entry of Na +) exactly equals the effect of the [Na +] gradient (promotion of Na + flow inward) . At this equilibrium potential (E) , the driving force (�G) tending to move a Na+ ion is zero. The equilibrium potential is different for each ionic species because the concentration gradients differ. The number of ions that must flow to produce a physiologically significant change in the membrane po­ tential is negligible relative to the concentrations of Na + , K+, and Cl- in cells and extracellular fluid, s o the ion fluxes that occur during signaling in excitable cells have essentially no effect on the concentrations of these ions. With Ca2+, the situation is different; because the intra­ cellular [Ca2+] is generally very low (�10-7 M) , inward flow of Ca2 + can significantly alter the cytosolic [Ca2 +]. The membrane potential of a cell at a given time is the result of the types and numbers of ion channels open at that instant. In most cells at rest, more K+ channels than Na+ , CC, or Ca2 + channels are open and thus the resting potential is closer to the E for K+ ( 98 mV) than that for any other ion. When channels for Na + , Ca2 + , or Cl- open, the membrane potential moves toward the E for that ion. The precisely timed opening and closing of ion channels and the resulting transient changes in -

1 2.6 Gated ion Channels

TAB LE 1 2-6

lon Conctntradons K+ Out

Squid axon

400

20

Frog muscle

124

2.3

In

Out

In

Out

In

10

40-150

50

440

:S0.4

1 0.4

109

10 7 ions/s) . After being opened-activated-by a reduction in transmembrane electrical potential, a Na+ channel undergoes very rapid inactivation-within milliseconds, the channel closes and remains inactive for many milliseconds. As voltage-gated K+ channels open in response to the depolarization induced by the opening of Na + channels, the resulting efflux of K+ repolarizes the membrane locally. A brief pulse of depolarization thus traverses the axon as local depolarization triggers the brief opening of neighboring Na+ channels, then K+ channels (Fig. 12-25) . The short refractory period that follows the opening of each Na + channel, during which it cannot open again, ensures that a unidirectional wave of depolarization-the action potential-sweeps from the nerve cell body toward the end of the axon (step CD in Fig. 12-25) . When the wave of depolarization reaches the voltage-gated Ca2 + channels, they open (step @) , and Ca2 + enters from the extracellular space. The rise in cy­ toplasmic [Ca2 + ] then triggers release of acetylcholine by exocytosis into the synaptic cleft (step @) . Acetyl-

I Domain �

III



choline diffuses to the postsynaptic cell (another neu­ ron or a myocyte) , where it binds to acetylcholine re­ ceptors and triggers depolarization. Thus the message is passed to the next cell in the circuit. We see, then, that gated ion channels convey signals in either of two ways: by changing the cytoplasmic concentration of an ion (such as Ca2 +), which then serves as an intracellular second messenger, or by changing Vm and affecting other membrane proteins that are sensitive to Vm· The passage of an electrical signal through one neuron and on to the next illustrates both types of mechanism. We discussed the structure and mechanism of volt­ age-gated K+ channels in some detail in Section 1 1 .3 (see Figs 1 1--48 through 1 1-50) . Here we take a closer look at Na + channels. The essential component of a Na+ channel is a single, large polypeptide (1 ,840 amino acid residues) organized into four domains clustered around a central channel (Fig. 1 2-26a, b ), providing a path for Na + through the membrane. The path is made Na +-specific by a "pore region" composed of the segments between trans­ membrane helices 5 and 6 of each domain, which fold into the channel. Helix 4 of each domain has a high density of positively charged Arg residues; this segment is believed

Selectivity filter (pore region)

IV

Activation gate (a)

Inactivation gate

Voltage sensor

FIGURE 1 2-26 Voltage-gated Na+ channels of neurons. Sodium chan­ nels of different tissues and organisms have a variety of subunits, but only the principal subunit

(a) is essential.

(a) The

a subunit is a large

protein with four homologous domains (I to IV, shown spread out here

Activation gate

to i l l ustrate the parts), each conta i n ing six transmembrane hel ices (1 to 6). Hel i x 4 in each domain (bl ue) is the voltage sensor; helix 6 (orange) is thought to be the activation gate. The segments between helices 5 and

6, the pore region (red), form the selectivity fi lter, and the segment con­ necting domains Ill and IV (green) i s the i nactivation gate. (b) The four domains are wrapped about a central transmembrane channel l i ned

with polar amino acid residues. The four pore regions (red) come to­ gether near the extracellu lar su rface to form the selectivity filter, which is conserved i n all N a + channels. The filter gives the channel its abil ity to discriminate between Na + and other ions of simi lar size. The inacti­

�id-;;-Membrane polarized, Voltage sensor channel closed

vation gate (green) c loses (dotted l i nes) soon after the activation gate opens. (c) The voltage-sensing mechanism i nvolves movement of hel i x 4 (bl ue) perpendicular t o t h e plane o f t h e membrane i n response t o a change in transmembrane potential. As shown at the top, the strong positive charge on helix 4 a l lows it to be pul led inward in response to the i nsi de-negative membrane potential Wml· Depolarization lessens this pull, and helix 4 relaxes by moving outward (bottom). This move­ ment is communicated to the activation gate (orange), inducing confor­ mational changes that open the channel in response to depolarization.

M.embrane de� olarized, ••

(c)

Na '

channel open

1 2 .6 Gated l o n Channels

to move within the membrane in response to changes in the transmembrane voltage, from the resting potential of about -60 mV to about + 30 mV. The movement of helix 4 triggers opening of the channel, and this is the basis for the voltage gating (Fig. 12-26c) . Inactivation of the channel is thought to occur by a ball-and-chain mechanism. A protein domain on the cy­ toplasmic surface of the Na + channel, the inactivation gate (the ball) , is tethered to the channel by a short seg­ ment of the polypeptide (the chain; Fig. 12-26b) . This domain is free to move about when the channel is closed, but when it opens, a site on the inner face of the channel becomes available for the tethered ball to bind, blocking the channel. The length of the tether seems to determine how long an ion channel stays open: the longer the tether, the longer the open period. Other gated ion channels may be inactivated by a similar mechanism. The Acetylcholine Receptor Is a Ligand-Gated I on Channel

The nicotinic acetylcholine receptor mediates the passage of an electrical signal at some types of synapses and at a neuromuscular junction (between motor neuron and muscle fiber) , signaling the muscle to contract. (Nicotinic acetylcholine receptors were originally distinguished from muscarinic acetylcholine receptors by the sensitivity of the former to nicotine, the latter to the mushroom alkaloid muscarine. They are structurally and functionally different.) Acetyl­ choline released by the presynaptic neuron or motor neuron diffuses a few micrometers to the plasma mem­ brane of the postsynaptic neuron or myocyte, where it binds to the acetylcholine receptor. This forces a con­ formational change in the receptor, causing its ion channel to open. The resulting inward movement of cations depolarizes the plasma membrane. In a muscle fiber, this triggers contraction. The acetylcholine recep­ tor allows ready passage to Na +, Ca2 + , and K+ ions, but other cations and all anions are unable to pass. Move­ ment of Na + through an acetylcholine receptor ion chan­ nel is unsaturable (its rate is linear with respect to extracellular [Na +]) and very fast-about 2 x 107 ions/s under physiological conditions.

[453]

ceptor, but not the exact mechanism of "desensitization," in which the gate remains closed even in the continued presence of acetylcholine. The nicotinic acetylcholine receptor has five sub­ units: single copies of subunits {3, y, and 8, and two identical a subunits that each contain an acetylcholine­ binding site. All five subunits are related in sequence and tertiary structure, each having four transmembrane helical segments (Ml to M4) (Fig. 1 2-27a) . The five subunits surround a central pore, which is lined with their M2 helices (Fig. 12-27b, c) . The pore is about 20 A wide in the parts of the channel that protrude on the cy­ toplasmic and extracellular surfaces, but narrows as it passes through the lipid bilayer. Near the center of the bilayer is a ring of bulky hydrophobic side chains of Leu residues in the M2 helices, positioned so close together that they prevent ions from passing through the channel (Fig. 12-27d) . Allosteric conformational changes in­ duced by acetylcholine binding to the two a subunits in­ clude a slight twisting of the M2 helices, which draws these hydrophobic side chains away from the center of the channel, opening it to the passage of ions. Neurons Have Receptor Channels That Respond to Different Neurotransmitters

Animal cells, especially those of the nervous system, con­ tain a variety of ion channels gated by ligands, voltage, or both. We have so far focused on acetylcholine as neuro­ transmitter, but there are many others. 5-Hydroxytrypta­ mine (serotonin) , glutamate, and glycine all can act through receptor channels that are structurally related to the acetylcholine receptor. Serotonin and glutamate trig­ ger the opening of cation (K+ , Na + , Ca2 +) channels, whereas glycine opens Cl--specific channels. Cation and anion channels are distinguished by subtle differences in the amino acid residues that line the hydrophilic channel. Cation channels have negatively charged Glu and Asp side chains at crucial positions. When a few of these acidic residues are experimentally replaced with basic residues, the cation channel is converted to an anion channel. +

coo­ I

H3N- CH

I

CH2 Serotonin ( 5-hydroxytryptamine) Acetylcholine

Like other gated ion channels, the acetylcholine re­ ceptor opens in response to stimulation by its signal molecule and has an intrinsic timing mechanism that closes the gate milliseconds later. Thus the acetylcholine signal is transient-as we have seen, an essential feature of electrical signal conduction. We understand the struc­ tural changes underlying gating in the acetylcholine re-

I

CH2

I coo-

Glutamate

Depending on which ion passes through a channel, binding of the ligand (neurotransmitter) for that chan­ nel results in either depolarization or hyperpolarization of the target cell. A single neuron normally receives input from many other neurons, each releasing its own characteristic neurotransmitter with its characteristic depolarizing or hyperpolarizing effect. The target cell's

[4 s 4]

Biosig n a l i n g

(a) Subunit folds into four transmembrane a helices +

NH3

(b) M2 amphipathic helices surround channel

(c) Acetylcholine binding sites

coo-

Bulky, hydrophobic Leu side chains of M2 helices close the channel.

Binding of two acetylcholine molecules causes twisting of the M2 helices.

M2 helices now have smaller, polar residues lining the channel.

FIGURE 1 2-27 The acetylcholine receptor ion channel. (a) Each of the

(d) This top view of a cross section through the center of the M2 hel i ces

five homologous subun its (a2 f3y/3) has four transmembrane hel ices, M 1

shows five Leu side chains (yellow), one from each M2 hel i x, protrud­

drophobic residues. (b) The five subunits are arranged around a central

passage of Ca2 + , Na + , or K + . When both acetylchol ine receptor sites

to M4. The M2 helices are amphipathic; the others have mainly hy­

i ng into the channel and constricting it to a diameter too sma l l to al low

transmembrane channel, which is l i ned with the polar sides of the M2

(one on each a subunit) are occupied, a conformational cha nge oc­

hel ices. At the top and bottom of the channel are rings of negatively

curs. As the M2 hel i ces twist slightly, the five Leu residues rotate away

cha rged amino acid residues. (c) A model of the acetylcho l i ne recep­

from the channel and are replaced by smal ler, polar residues (blue).

tor, based on electron mi croscopy and x-ray structure determi nation of

Th is gating mechanism opens the channel, a l lowing the passage of Ca2 + , N a + , or K + .

a related protein (the acetylcholi ne-binding protein from a mollusk).

Vm therefore reflects the integrated input (Fig. 1 2-ld) from multiple neurons. The cell responds with an action potential only if the integrated input adds up to a net de­ polarization of sufficient size. The receptor channels for acetylcholine, glycine, glu­ tamate, and y-aminobutyric acid (GABA) are gated by extracellular ligands. Intracellular second messengers­ such as cAMP, cGMP, IP3, Ca2 + , and ATP-regulate ion channels of another class, which, as we shall see in Section 12.10, participate in the sensory transductions of vision, olfaction, and gustation. Toxins Target I on Channels

Many of the most potent toxins found in nature act on ion channels. As we noted in Section 1 1 .3, for example, dendrotoxin (from the black mamba snake) blocks the action of voltage-gated K+ channels, tetrodotoxin

(produced by puffer fish) acts on voltage-gated Na + channels, and cobrotoxin disables acetylcholine recep­ tor ion channels. Why, in the course of evolution, have ion channels become the preferred target of toxins, rather than some critical metabolic target such as an en­ zyme essential in energy metabolism? Ion channels are extraordinary amplifiers; opening of a single channel can allow the flow of 10 million ions per second. Consequently, relatively few molecules of an ion channel protein are needed per neuron for signaling functions. This means that a relatively small number of toxin molecules with high affinity for ion channels, acting from outside the cell, can have a very pronounced effect on neurosignaling throughout the body. A compa­ rable effect by way of a metabolic enzyme, typically present in cells at much higher concentrations than ion channels, would require far more copies of the toxin molecule.

1 2 . 7 l ntegrins: B i d i rectio n a l Cell Adhesion Receptors

S U M M A RY 1 2 . 6

Gated l o n C h a n n e l s



Ion channels gated by membrane potential or ligands are central to signaling in neurons and other cells.



The voltage-gated Na + and K+ channels of neuronal membranes carry the action potential along the axon as a wave of depolarization (Na + influx) followed by repolarization (K+ efflux) .



The gating mechanism for voltage-sensitive channels involves the movement, perpendicular to the plane of the membrane, of a transmembrane peptide with a high charge density, due to the presence of Arg or other charged residues.



Arrival of an action potential at the distal end of a presynaptic neuron triggers neurotransmitter release. The neurotransmitter (acetylcholine , for example) diffuses to the postsynaptic neuron (or the myocyte, at a neuromuscular junction) , binds to specific receptors in the plasma membrane, and triggers a change in Vm.



The acetylcholine receptor of neurons and myocytes is a ligand-gated ion channel; acetylcholine binding triggers a conformational change that opens the channel to Na + and Ca2 + ions.



[4ss]

Neurotoxins produced by many organisms attack neuronal ion channels, and are therefore fast-acting and deadly.

Cysteine-rich domain

Outside

Actin filaments in cytt�skeleton

/

FIGURE 1 2-28 Two-way signaling by integrins. A l l i ntegrins have one

a and one {3 subun it, each with a short cytoplasmic extension, a single transmembrane hel ix, and a large extracellu lar domain with the l ig­ and-b inding site. The {3 subunit is rich in Cys res idues and has exten­

1 2.7 l nteg ri ns: Bidirectional Cel l

sive i ntrachain disu lfide bonding. The

a subunit in many integrins has

several binding sites for d ivalent cations such as Ca2 +, which are i n­

Adhesion Receptors

trinsic to the l igand-binding activity. Ligands in the extrace l l u l a r matrix

Integrins are proteins of the plasma membrane that me­ diate the adhesion of cells to each other and to the extra­ cellular matrix, and carry signals in both directions across the membrane (Fig. 12-28). The mammalian genome encodes 1 8 different a subunits and 8 different f3 sub­ units, which are found in a range of combinations with various ligand-binding specificities in various tissues. Each of the 24 different integrins found thus far seems to have a unique function. Because they can inform cells about the extracellular neighborhood, integrins play cru­ cial roles in processes that require selective cell-cell inter­ actions, such as embryonic development, blood clotting, immune cell function, and tumor growth and metastasis. The extracellular ligands that interact with integrins include collagen, fibrinogen, fibronectin, and many other proteins that have the sequence recognized by integrins: -Arg-Gly-Asp- (RGD) . The short, cytoplasmic exten­ sions of the a and f3 subunits interact with cytoskeletal proteins just beneath the plasma membrane-talin, a­ actinin, vinculin, paxillin, and others-modulating the assembly of actin-based cytoskeletal structures. The dual association of integrins with the extracellular matrix and the cytoskeleton allows the cell to integrate infor­ mation about its extracellular and intracellular environ­ ments, and to coordinate cytoskeletal positioning with

n i zed by an i ntegrin, or proteoglycan components such as heparan sul­

include proteins such as collagen that have the RGD sequence recog­ fate. The extracellu lar l igand b i n d i ng is comm u n i cated to the cytosol i c domains, produc ing conformational changes that affect the assoc iation of i ntegrin with proteins such as tal in, which, i n turn, connect the integrin to actin filaments in the cytoskeleton underlying the plasma membrane . B i nding of i ntracellular protein l igands to the cytosol i c doma i n c a n alter t h e affi n ity o f t h e integrin for i t s extrace l l u lar b i n d i n g partners, cha nging t h e cel l's adhesion t o t h e extracel l u lar matrix.

extracellular adhesion sites. In this capacity, integrins govern the shape, motility, polarity, and differentiation of many cell types. In "outside-in" signaling, the extracellular domains of an integrin undergo dramatic, global conforma­ tional changes when ligand binds at a site many angstroms from the transmembrane helices. These changes somehow alter the dispositions of the cytoplasmic tails of the a and f3 subunits, changing their interactions with intracellular pro­ teins and thereby conducting the signal inward. The conformation and adhesiveness of integrin extracellular domains are also dramatically altered by signals from inside the cell. In one conformation, the extracellular domains have no affinity for the proteins of the extracellular matrix, but signals from the cell can fa­ vor another conformation in which integrins adhere tightly to extracellular proteins (Fig. 12-28) .

[4s6]

Biosignaling

Regulation of adhesiveness is central to leukocyte homing to the site of an infection (see Fig. 7-3 1 ) , interactions between immune cells, and phagocytosis by macrophages. During an immune response, for example, leukocyte integrins are activated (exposing their extra­ cellular ligand-binding sites) from inside the cell via a signaling pathway triggered by cytokines (extracellular developmental signals) . Thus activated, the integrins can mediate the attachment of leukocytes to other im­ mune cells or can target cells for phagocytosis. Mutation in an integrin gene encoding the f3 subunit known as CD18 is the cause of leukocyte adhesion deficiency, a rare human genetic disease in which leukocytes fail to pass out of blood vessels to reach sites of infection. In­ fants with a severe defect in CD18 commonly die of in­ fections before the age of two. An integrin specific to platelets (aubf33) is involved in both normal and pathological blood clotting. Local damage to blood vessels at a site of injury exposes high-affinity binding sites (RGD sequences in thrombin and collagen, for example) for the integrins of platelets, which attach themselves to the lesion, to other platelets, and to the clot­ ting protein fibrinogen, leading to clot formation that pre­ vents further bleeding. Mutations in the a or f3 subunit of platelet integrin aubf33 lead to a bleeding disorder known as Glanzma:n:n thrombasthenia, in which individuals bleed excessively after a relatively minor injury. Overly effective blood coagulation is also undesirable. Dysregulation of platelet adhesion can lead to pathological blood clot for­ mation, resulting in blockage of the arteries that supply blood to the heart and brain and increasing the risk of heart attack and stroke. Drugs such as tirofiban and eptifi­ batide that block the external ligand-binding sites of platelet integrin reduce clot formation and are useful in treating and preventing heart attacks and strokes. When tumors metastasize, tumor cells lose their ad­ hesion to the originating tissue and invade new loca­ tions. Both the changes in tumor cell adhesion and the development of new blood vessels (angiogenesis) to support the tumor at a new location are modulated by specific integrins. These proteins are therefore potential targets for drugs that suppress the migration and reloca­ tion of tumor cells. • ,

S U M M A RY 1 2 . 7 •





l n t e g r i n s : B i d i recti o n a l C e l l A d h e s i o n Receptors

Integrins are a family of dimeric (a{3 ) plasma membrane receptors that interact with extracellular macromolecules and the cytoskeleton, carrying signals in and out of the cell. The active and inactive forms of an integrin differ in the conformation of their extracellular domains. Intracellular events and signals can interconvert the active and inactive forms. Integrins mediate various aspects of the immune response, blood clotting, and angiogenesis, and they play a role in tumor metastasis.

1 2.8 Regu lation of Transcription by Steroid Hormones The steroid, retinoic acid (retinoid) , and thyroid hor­ mones form a large group of hormones (receptor lig­ ands) that exert at least part of their effects by a mechanism fundamentally different from that of other hormones: they act in the nucleus to alter gene expres­ sion. We discuss their mode of action in detail in Chap­ ter 28, along with other mechanisms for regulating gene expression. Here we give a brief overview. Steroid hormones (estrogen, progesterone, and cor­ tisol, for example) , too hydrophobic to dissolve readily in the blood, are transported on specific carrier proteins from their point of release to their target tissues. In tar­ get cells, these hormones pass through the plasma membrane by simple diffusion and bind to specific re­ ceptor proteins in the nucleus (Fig. 12-29) . Steroid hormone receptors with no bound ligand (aporecep­ tors) often act to suppress the transcription of target genes. Hormone binding triggers changes in the confor­ mation of a receptor protein so that it becomes capable of interacting with specific regulatory sequences in DNA called hormone response elements (HREs), thus altering gene expression (see Fig. 28-34) . The bound receptor-hormone complex enhances the expression of specific genes adjacent to HREs, with the help of several other proteins essential for transcription. Hours or days are required for these regulators to have their full effect-the time required for the changes in RNA syn­ thesis and subsequent protein synthesis to become evident in altered metabolism. The specificity of the steroid-receptor interac­ tion is exploited in the use of the drug tamox­ ifen to treat breast cancer. In some types of breast cancer, division of the cancerous cells depends on the continued presence of estrogen. Tamoxifen is an estro­ gen antagonist; it competes with estrogen for binding to the estrogen receptor, but the tamoxifen-receptor com­ plex has little or no effect on gene expression. Conse­ quently, tamoxifen administered after surgery or during chemotherapy for hormone-dependent breast cancer slows or stops the growth of remaining cancerous cells. Another steroid analog, the drug mifepristone (RU486) , binds to the progesterone receptor and blocks hormone actions essential to implantation of the fertilized ovum in the uterus. •

Tamoxifen

Mifepristone (RU486)

1 2 .9 S i g n a l i n g in M icroorganisms a n d Pla nts

Serum binding protein with bound hormone

[4s 7]

CD

I

Plasma membrane

Hormone (H), carried to the target tissue on serum binding proteins, diffuses across the plasma membrane and binds to its specific receptor protein (Rec) in the nucleus.

®

Hormone binding changes the conformation of Rec; it forms homo­ or heterodimers with other hormone­ receptor complexes and binds to specific regulatory regions called hormone response elements (HREs) in the DNA adjacent to specific genes.

Nucleus Rec

®

RNA pol ymeras

r.:ransc:Mplion)

HRE

Ql.R

� �� ��

,

·

\

G ne

@

A

:/

®

Receptor attracts coactivator or corepressor protein(s) and, with them, regulates transcription of the adjacent gene(s), increasing or decreasing the rate of mRNA formation.

0

Altered levels of the hormone­ regulated gene product produce the cellular response to the hormone.

translation on ribosomes

FIGURE 1 2-29 General mechanism by which steroid and thyroid hormones, retinoids, and vitamin D regulate gene expression. The deta i l s of transcription and protein synthesis are discussed in Chapters 26 and 2 7 . Some

steroids also act through plasma membrane receptors by a comp letely different mechanism.

1 2.9 Signaling in Microorganisms and Plants

Certain effects of steroids seem to occur too fast to be the result of altered protein synthesis via the classic mechanism of steroid hormone action through nuclear receptors. For example, the estrogen-mediated dilation of blood vessels is known to be independent of gene transcription or protein synthesis, as is the steroid­ induced decrease in cellular [cAMP] . Another transduc­ tion mechanism involving plasma membrane receptors may be responsible for some of these effects.

Much of what we have said here about signaling relates to mammalian tissues or cultured cells from such tissues. Bacteria, archaea, eukaryotic microorganisms, and vas­ cular plants must also respond to a variety of external signals-02 , nutrients, light, noxious chemicals, and so on. We turn here to a brief consideration of the kinds of signaling machinery used by microorganisms and plants.

S U M M A RY 1 2 . 8

i n a Two-Component System

Bacterial Signaling Entails Phosphorylation

R e g u l a t i o n of Tra n sc r i p t i o n by Stero i d H o r m o n e s



Steroid hormones enter cells and bind to specific receptor proteins.



The hormone-receptor complex binds specific regions of DNA, the hormone response elements, and interacts with other proteins to regulate the expression of nearby genes.



Certain effects of steroid hormones may occur through a different, faster, signaling pathway.

responds to nutrients in its environ­ ment, including sugars and amino acids, by swimming toward them, propelled by one or a few flagella. A fam­ ily of membrane proteins have binding domains on the outside of the plasma membrane to which specific at­ tractants (sugars or amino acids) bind (Fig. 1 2-30). Ligand binding causes another domain on the inside of the plasma membrane to autophosphorylate a His residue. This first component of the two-component system, the receptor histidine kinase, then cat­ alyzes transfer of the phosphoryl group from the His residue to an Asp residue on a second, soluble protein,

Escherichia coli

[4 s8]

Biosig n a l i n g

Receptor/His kinase (component 1)

FIGURE 1 2-30 The two-component sig­

I

naling mechanism i n bacterial chemo­ taxis. When an attractant l igand (A) b i nds

to the receptor doma i n of the membrane­ bound receptor, a protei n H is k i nase i n the cytoso l i c dom a i n (component 1 ) i s activated and autophosphorylates a H i s residue. Th is phosphoryl group i s then transferred to an Asp residue on compo­ nent 2 (in some cases, as shown here, a separate protein; in others, another do­ m a i n of the receptor protein). After phos­ phorylation, component 2 moves to the

d q� �)� �

Attractant

base of the flagellum, where it reverses the d i rection of rotation of the flage l l a r motor.

'

His

\

Phosphorylated form of component 2 reverses direction of motor

E. coli

Plasma membrane

the response regulator; this phosphoprotein moves to the base of the flagellum, carrying the signal from the membrane receptor. The flagellum is driven by a rotary motor that can propel the cell through its medium or cause it to stall, depending on the direction of motor rotation. Information from the receptor allows the cell to determine whether it is moving toward or away from the source of the attractant. If its motion is toward the attractant, the response regulator signals the cell to continue in a straight line; if away from it, the cell tum­ bles momentarily, acquiring a new direction. Repeti­ tion of this behavior results in a random path, biased toward movement in the direction of increasing attrac­ tant concentration. E. coli detects not only sugars and amino acids but also 0 2 , extremes of temperature, and other environ­ mental factors, using this basic two-component system. TWo-component systems have been detected in many other bacteria, both gram-positive and gram-negative, and in archaea, as well as in protists and fungi. Clearly, this signaling mechanism developed early in the course of cellular evolution and has been conserved. Various signaling systems used by animal cells also have analogs in bacteria. As the full genomic sequences of more, and more diverse, bacteria become known, re­ searchers have discovered genes that encode proteins similar to protein Ser or Thr kinases, Ras-like proteins regulated by GTP binding, and proteins with SH3 do­ mains. Receptor Tyr kinases have not been detected in bacteria, but ®-Tyr residues do occur in some bacte­ rial proteins, so there must be an enzyme that phospho­ rylates Tyr residues. Signaling Systems of Plants Have Some of the Same

Rotary motor (controls flagellum)

Response regulator (component 2)

to warn of the presence of noxious chemicals and dam­ aging pathogens (Fig. 12-3 1 ) . At least a billion years of evolution have passed since the plant and animal branches of the eukaryotes diverged, which is reflected in the differences in signaling mechanisms: some plant mechanisms are conserved-that is, are similar to those in animals (protein kinases, adaptor proteins, cyclic nucleotides, electrogenic ion pumps, and gated ion channels) ; some are similar to bacterial two-component systems; and some are unique to plants (light-sensing mechanisms, for example) (Table 12-7) . The genome of the plant Arabidopsis thaliana, for example, encodes about 1 ,000 protein Sertrhr kinases, including about 60 MAPKs and nearly 400 membrane-associated receptor ki­ nases that phosphorylate Ser or Thr residues; a variety of protein phosphatases; adaptor proteins that form scaf­ folds on which proteins assemble in signaling complexes;

Temperature Humidity

Wind

=:=>

Insects Herbivores Pathogens

Pathogens Parasites

Com ponents Used by Microbes and Mammals

Like animals, vascular plants must have a means of com­ munication between tissues to coordinate and direct growth and development; to adapt to conditions of 02 , nutrients, light, temperature, and water availability; and

Toxic molecules Water status

Microorganisms Gravity

FIGURE 1 2-31 Some stimuli that produce responses in plants.

1 2 . 9 Signaling i n M icroorga n i s m s and Plants

[4s9]

TAB L E 1 2-7 Mammals

Plants

Bacteria

Ion channels

+

+

+

Electrogenic ion pumps

+

+

+

'I\vo-component His kinases

+

+

+

Adenylyl cyclase

+

+

+

Guanylyl cyclase

+

+

?

Receptor protein kinases (Sertrhr) Ca2 + as second messenger

+

+

?

+

+

Ca2 + channels

?

+

+

?

Calmodulin, CaM-binding protein

+

+

MAPK cascade

+

+

Cyclic nucleotide-gated channels IP3-gated Ca2 + channels

+

+

+

+

Phosphatidylinositol kinases

+

+

+

+1-

Trimeric G proteins

+

+1 -

Signaling component

GPCRs PI-specific phospholipase C

+

?

Tyrosine kinase receptors

+

?

SH2 domains

+

?

Nuclear steroid receptors

+

Protein kinase A

+

Protein kinase G

+

enzymes for the synthesis and degradation of cyclic nu­ cleotides; and I 00 or more ion channels, including about 20 gated by cyclic nucleotides. Inositol phospholipids are present, as are kinases that interconvert them by phos­ phorylation of inositol head groups. However, some types of signaling proteins common in animal tissues are not present in plants, or are repre­ sented by only a few genes. Cyclic nucleotide-dependent protein kinases (PKA and PKG) seem to be absent, for example. Heterotrimeric G proteins and protein Tyr kinase genes are much less prominent in the plant genome, and genes for GPCRs, the largest family of pro­ teins in the human genome ( - 1 ,000 genes) , are very sparsely represented in the plant genome. DNA-binding nuclear steroid receptors are certainly not prominent, and may be absent from plants. Although plants lack the most widely conserved light-sensing mechanism present in animals (rhodopsin, with retinal as pigment) , they have a rich collection of other light-detecting mecha­ nisms not found in animal tissues-phytochromes and cryptochromes, for example (Chapter 19) . The kinds o f compounds that elicit signals in plants are similar to certain signaling molecules in mammals (Fig. 12-32). Instead of prostaglandins, plants have jas­ monate; instead of steroid hormones, brassinosteroids. About 100 different small peptides serve as plant signals, and both plants and animals use compounds derived from aromatic amino acids as signals.

+

?

Animals

Plants

0

coo-

OH

0

Jasmonate

U:Jcoo­ H

[ndole-3-acetate (an auxin)

OH

'(c) Prostaglandin E 1

HO

� I

'

N

I



NH 3

H

Serotonin (5-hydroxytryptamine)

OH HO HO Brassinolide (a brassinosteroid)

Estradiol

FIGURE 1 2-32 Structural similarities between plant and animal signals.

[460]

Biosign a l i n g

Plants Detect Ethylene through a Two-Component System and a MAPK Cascade

The gaseous plant hormone ethylene (CH2 =CH 2 ) , which stimulates the ripening of fruits (among other functions) , acts through receptors that are related in primary sequence to the receptor His kinases of the bacterial two-component systems and probably evolved from them. In Arabidopsis , the two-compo­ nent signaling system is contained within a single inte­ gral membrane protein of the endoplasmic reticulum (not the plasma membrane) . Ethylene diffuses into the cell through the plasma membrane and into the ER. The first downstream component affected by eth­ ylene signaling is a protein Ser/Thr kinase (CTR l ; Fig. 1 2-33) with sequence homology to Raf, the pro­ tein kinase that begins the MAPK cascade in the mam­ malian response to insulin (see Fig. 12-1 5) . In plants,

8�

Ethylene

Ethylene receptor

I ®

2

Two-component system

ER lumen

I

Endoplasmic reticuJum

Cytosol

Nucleus

.r DNA

J.'\/"r mRNA � Ethylene­ response proteins

FIGURE 1 2-33 Transduction mechanism for detection of ethylene by plants. The ethylene receptor (pink) in the endoplasmic reticu l u m is a

two-component system contained in a si ngle protein, with a receptor domain (component 1 ) and a response regul ator domain (component 2 ) . The receptor controls ( i n ways we do not yet u nderstand) the activ­ ity of CTR l , a protein ki nase similar to MAPKKKs and therefore pre­ sumed to be part of a MAPK cascade. CTRl is a negative regulator of the ethylene response; when CTRl is inactive, the ethylene signal is

transm itted through the gene product EIN2 (thought to be a nuclear envelope protei n), which causes increased synthesis of ERFl , a tran­ scription factor. ERFl stimulates expression of proteins specific to the ethylene response.

in the absence of ethylene, the CTR1 kinase is active and inhibits the MAPK cascade, preventing transcrip­ tion of ethylene-responsive genes. Exposure to ethyl­ ene inactivates the CTRl kinase, thereby activating the MAPK cascade that leads to activation of the tran­ scription factor EIN3. Active E IN3 stimulates the syn­ thesis of a second transcription factor (ERF1 ) , which in turn activates transcription of ethylene-responsive genes; the gene products affect processes ranging from seedling development to fruit ripening. Although ap­ parently derived from the bacterial two-component signaling system, the ethylene system in Arabidopsis is different in that the His kinase activity that defines component 1 in bacteria is not essential to signal trans­ duction in Arabidopsis. Receptorlike Protein Kinases Transduce Signals from Peptides and Brassinosteroids

One common motif in plant signaling involves receptor­ like kinases (RLKs) , which have a single helical seg­ ment in the plasma membrane that connects a receptor domain on the outside with a protein Ser/Thr kinase on the cytoplasmic side. This type of receptor participates in the defense mechanism triggered by infection with a bacterial pathogen (Fig. 1 2-34a) . The signal to turn on the genes needed for defense against infection is a pep­ tide (flg22) released by breakdown of flagellin, the ma­ jor protein of the bacterial flagellum. Binding of flg22 to the FLS2 receptor of Arabidopsis induces receptor dimerization and autophosphorylation on Ser and Thr residues, and the downstream effect is activation of a MAPK cascade like that described above for insulin ac­ tion (Fig. 12-15) . The final kinase in this cascade acti­ vates a specific transcription factor, triggering synthesis of the proteins that defend against the bacterial infec­ tion. The steps between receptor phosphorylation and the MAPK cascade are not yet known. A phosphoprotein phosphatase (KAPP) associates with the active receptor protein and inactivates it by dephosphorylation to end the response. The MAPK cascade in the plant's defense against bacterial pathogens is remarkably similar to the innate immune response in mammals (Fig. 12-34b) that is trig­ gered by bacterial lipopolysaccharide and mediated by the Toll-like receptors (TLRs, a name derived from a Drosophila mutant originally called Toll (German, "mad") ; TLRs were subsequently found in many other organisms and were shown to function in embryonic de­ velopment) . Other membrane receptors use similar mechanisms to activate a MAPK cascade, ultimately ac­ tivating transcription factors and turning on the genes essential to the defense response. Most of the several hundred RLKs in plants are pre­ sumed to act in similar ways: ligand binding induces dimerization and autophosphorylation, and the acti­ vated receptor kinase triggers downstream responses by phosphorylating key proteins at Ser or Thr residues.

1 2. 1 0 Sensory Tra nsd uction in Vision, Olfaction, a n d Gustation

(a)

Plant (Arabidopsis)

(b)

[46 1]

Mammal Toll-like receptors

cascade

Transcription factors WRKY22, 29

Transcription factors Jun, Fos

Transcription factor NFKB

[mmune­ response proteins FIGURE 1 2-34 Similarities between the signaling pathways that trig­

phosphorylation triggers proteolytic degradation of the inhibitor and

ger immune responses in plants and animals. (a) I n Arabidopsis

frees the transcription factors to sti mulate gene expression related to

thaliana, the peptide flg2 2 , derived from the flagella of a bacterial

the i mmune response. (b) In mammals, a toxic bacterial l ipopolysac­

pathogen, bi nds to its receptor (FLS) in the p l asma membrane, caus i ng

charide (LPS; see Fig. 7-30) is detected by p l asma membrane recep­

the receptor to form di mers and triggering autophosphorylation of the

tors, which then associate with and activate a soluble protein kinase

cytosol i c protein kinase domain on a Ser orThr residue (not a Tyr). Thus

( I RAK). The major flagel lar protein of pathogen i c bacteria acts through

activated, the protein k i nase phosphorylates downstream proteins (not

a s i m i l a r receptor, also activating IRAK. The activated I RAK i n i tiates

shown). The activated receptor also activates (by means unknown) a

two distinct MAPK cascades that end i n the nucleus, causing the

MAPK cascade, which leads to phosphorylation of a nuclear protein

synthesis of proteins needed in the i mmune response. jun, Fos, and

that normally i n h ibits the transcription factors WRKY22 and 29; this

NFKB are transcription factors.

S U M M A RY 1 2 . 9



S ig n a l i n g i n M icro o rg a n isms a n d Pla nts



Bacteria and eukaryotic microorganisms have a variety of sensory systems that allow them to sample and respond to their environment. In the two-component system, a receptor His kinase senses the signal and autophosphorylates a His residue, then phosphorylates an Asp residue of the response regulator.



Plants respond to many environmental stimuli and employ hormones and growth factors to coordinate the development and metabolic activities of their tissues. Plant genomes encode hundreds of signaling proteins, including some very similar to those of mammals.



1\vo-component signaling mechanisms common in bacteria are found in modified forms in plants, used in the detection of chemical signals and light.

Plant receptorlike kinases (RLKs) participate in detecting a wide variety of stimuli, including brassinosteroids, peptides that originate from pathogens, and developmental signals. RLKs autophosphorylate Ser!rhr residues, then activate downstream proteins, which in some cases are MAPK cascades. The end result is increased transcription of specific genes.

1 2. 1 0 Sensory Transd uction in Vision, Olfaction, and Gustation The detection of light, odors, and tastes (vision, olfaction, and gustation, respectively) in animals is accomplished by specialized sensory neurons that use signal-transduction mechanisms fundamentally similar to those that detect hormones, neurotransmitters, and growth factors. An initial sensory signal is amplified greatly by mechanisms that include gated ion channels and intracellular second

[462]

Biosig n a l i n g

messengers; the system adapts to continued stimulation by changing its sensitivity to the stimulus (desensitiza­ tion) ; and sensory input from several receptors is inte­ grated before the final signal goes to the brain. The Visual System Uses Classic G PCR Mechanisms

In the vertebrate eye, light entering through the pupil is focused on a highly organized collection of light­ sensitive neurons (Fig. 1 2-35 ) . The light-sensing cells are of two types: rods (about 1 09 per retina) , which sense low levels of light but cannot discriminate colors, and cones (about 3 x 1 06 per retina) , which are less sensitive to light but can discriminate colors. Both cell types are long, narrow, specialized sensory neurons with two distinct cellular compartments: the outer segment contains dozens of membranous disks loaded with re­ ceptor proteins and their photosensitive chromophore retinal; the inner segment contains the nucleus and many mitochondria, which produce the ATP essential to phototransduction. Like other neurons, rods and cones have a trans­ membrane electrical potential (Vm) , produced by the electrogenic pumping of the Na +K+ ATPase in the plasma membrane of the inner segment (Fig. 12-36 ) .

v = -45 m

mv:' ' 0 '

Ion channel open

Na+ - -·

""- Na+K+

ATPase

Light •

Eye

Light



Ion channel closed

FIGURE 1 2-36 Light-induced hyperpolarization of rod cells. The rod cel l consi sts of an outer segment, fil led with stacks of membranous di sks (not shown) conta i n i ng the photoreceptor rhodopsi n, and an i n ­

/ � "---y-----J

To optic Ganglion Interconnecting nerve neurons neurons

n e r segment that conta i n s t h e nuc leus and other organel les (not shown). The i n ner segment synapses with i nterconnecting neurons (see Fig. 1 2-35). Cones have a simi lar structure. ATP in the inner segment

l ight on the retina, which is composed of layers of neurons. The pri­

powers the N a + K+ ATPase, which creates a transmembrane electrical potential by pumping 3 N a + out for every 2 K + pumped in. The mem­ brane potential is reduced by the inflow of N a and Ca2 + through

mary photosensory neurons are rod cells (yellow), which are responsi­

cGMP-gated cation channels in the outer-segment plasma membrane.

FIGURE 12-35 Light reception in the vertebrate eye. The lens focuses

+

ble for h igh-resolution and n i ght vision, and cone cel ls of three

When rhodopsi n absorbs l ight, it triggers degradation of cGMP (green

subtypes (pink), which initiate color vision. The rods and cones form

dots) in the outer segment, causing closure of the ion channel . Without

synapses with several ranks of interconnecting neurons that convey

cation i nflux through this channel, the cel l becomes hyperpolarized.

and i ntegrate the electrical signals. The signals eventua l l y pass from

This electrical signal is passed to the brain through the ranks of neurons

ganglion neurons through the optic nerve to the b ra i n .

shown i n Figure 1 2-3 5 .

1 2 . 1 0 Sensory Tra nsd uction in Vision, Olfaction, a n d Gustation

Also contributing to the membrane potential is an ion channel in the outer segment that permits passage of either Na + or Ca2 + and is gated (opened) by cGMP. In the dark, rod cells contain enough cGMP to keep this chan­ nel open. The membrane potential is therefore deter­ mined by the difference between the amount of Na + and K+ pumped by the inner segment (which polarizes the membrane) and the influx of Na+ through the ion chan­ nels of the outer segment (which tends to depolarize the membrane) . The essence of signaling in the rod or cone cell is a light-induced decrease in [cGMP] , which causes the cGMP-gated ion channel to close. The plasma membrane then becomes hyperpolarized by the Na +K+ ATPase. Rod and cone cells synapse with interconnecting neu­ rons (Fig. 12-35) that carry information about the elec­ trical activity to ganglion neurons near the inner surface of the retina. The ganglion neurons integrate the output from many rod or cone cells and send the resulting signal through the optic nerve to the visual cortex of the brain. Visual transduction begins when light falls on rhodopsin, many thousands of molecules of which are present in each disk of the outer segments of rod and cone cells. Rhodopsin (Mr 40,000) is an integral protein with seven membrane-spanning a helices (Fig. 1 2-3 7 ), the characteristic GPCR architecture. The light-absorbing pigment (chromophore) 1 1 -cis­ retinal is covalently attached to opsin, the protein component of rhodopsin, through a Schiff base to a Lys residue. The retinal molecule lies near the middle of the bilayer (Fig. 1 2-37) , oriented with its long axis approximately in the plane of the membrane. When a photon is absorbed by the retinal component of rhodopsin, the energy causes a photochemical change; 1 1 -cis-retinal is converted to all-trans-retinal (see Figs 1-18b and 1 0-2 1 ) . This change in the structure of the chromophore forces conformational changes in the rhodopsin molecule-the first stage in visual transduction. Retinal is derived from vitamin A 1 (retinol) , which is produced from .B-carotene (see Fig. 1 0-2 1 ) . Dietary deficiency of vitamin A leads to night blindness (the inability to adapt to low light levels) , which is relatively common in some developing countries. Vita­ min A supplements or vegetables rich in carotene (such as carrots) supply the vitamin and reverse the night blindness. • Excited Rhodopsin Acts through the G Protein Transdudn to Red uce the cGMP Concentration

In its excited conformation, rhodopsin interacts with a second protein, transducin, which hovers nearby on the cytoplasmic face of the disk membrane (Fig. 12-37) . Transducin (T) belongs to the same family of het­ erotrimeric GTP-binding proteins as Gs and Gi. Although specialized for visual transduction, transducin shares

[463]

FIGURE 1 2-37 Complex of rhodopsin with the G protein transducin. (PDB 10 1 BAC) Rhodopsin (red) has seven transmembrane hel ices em­

bedded in the disk membranes of rod outer segments and is oriented

with its carboxyl term inus on the cytosol i c side and its a m i no term i nus i n side the disk. The chromophore 1 1 -cis-reti nal (blue space-fi l l ing

structure), attached through a Schiff base l i nkage to Lys256 of the sev­ enth helix, lies near the center of the bilayer. (This location is similar to

that of the epineph ri ne-binding site in the {3-adrenergic receptor.) Sev­ eral Ser and Thr residues near the carboxyl terminus are su bstrates for phosphorylations that are part of the desensitization mechanism for rhodopsi n . Cytoso l i c loops that i nteract with the G protein transducin are shown i n orange; their exact positions are not yet known. The th ree subun its of transducin (green) are shown in their l i kely arrangement. Rhodopsin is pal mitoyl ated at its carboxyl term i nus, and both the

a

and y subun its of transducin have attached l i p i ds (yellow) that assist i n anchoring them t o t h e membrane.

many functional features with Gs and Gi. It can bind either GDP or GTP. In the dark, GDP is bound, all three subunits of the protein (Ta, Tf3• and Ty) remain together, and no signal is sent. When rhodopsin is excited by light, it interacts with transducin, catalyzing the replacement of bound GDP by GTP from the cytosol (Fig. 12-38, steps CD and @ ) . Transducin then dissociates into Ta and Tf3"Y• and the Ta-GTP carries the signal from the ex­ cited receptor to the next element in the transduction pathway, a cGMP phosphodiesterase; this enzyme con­ verts cGMP to 5'-GMP (steps ® and @). Note that this is not the same cyclic nucleotide phosphodiesterase that hydrolyzes cAMP to terminate the .B-adrenergic re­ sponse. One isoform of the cGMP-specific PDE is unique to the visual cells of the retina.

!464_j

l_

Biosigna l i n g

CD

®

Activated rhodopsin Light absorption catalyzes replacement converts 1 1-cisof GDP by GTP retinal to on transducin (T), all-trans-retinal, which then dissociates activating rhodopsin (Rh). into Ta·GTP and TiJ-r ·

®

Ta-GTP activates cGMP phosphodiesterase (PDE) by binding and removing its inhibitory subunit (I).

@

Active PDE reduces [cGMP] to below the level needed to keep cation channels open.

5'-GMP

('ii::l -�

I

@ C ation channels

Di k membrane

Excitation

Recov ry/Adaptation

close, preventing influx ofNa+ and Ca2 +; membrane is hyperpolarized. This signal passes to the brain.

® Continued efflux of

Ca2+ through the Na+.c a 2+ exchanger reduces cytosolic [Ca2+] .

Rhodopsin kinase (RK) phosphorylates "bleached" rhodopsin; low [Ca2•] and recoverin (Recov) stimulate this reaction. Arrestin (Arr) binds phosphorylated carboxyl terminus, inactivating rhodopsin.

®

Slowly, arrestin dissociates, rhodopsin is dephosphorylated, and all-trans-retinal is replaced with 11-cis-retinal. Rhodopsin is ready for another phototransduction cycle.

Q)

Reduction of [Ca2•] activates guanylyl cyclase (GC) and inhibits PDE; [cGMPl rises toward "dark" level, reopening cation channels and returning Vm to prestimulus level.

' Plasma membrane

FIGURE 1 2-38 Molecular consequences of photon absorption by rhodopsin in the rod outer segment.

The top half of the figure (steps adaptation after i l lumi nation.

G) to ®l descri bes excitation; the bottom (steps ® to @l , recovery and

The PDE of the retina is an integral protein with its active site on the cytoplasmic side of the disk membrane. In the dark, a tightly bound inhibitory subunit very effec­ tively suppresses the PDE activity. When Ta·GTP en­ counters the PDE , the inhibitory subunit leaves the enzyme and instead binds T"' and the enzyme's activity immediately increases by several orders of magnitude. Each molecule of the active PDE degrades many mole­ cules of cGMP to the biologically inactive 5' -GMP, lower­ ing [cGMP] in the outer segment within a fraction of a second. At the new, lower [cGMP], the cGMP-gated ion channels close, blocking reentry of Na + and Ca2 + into the outer segment and hyperpolarizing the membrane of the rod or cone cell (step @) . Through this process, the initial stimulus-a photon-changes the Vm of the cell. Several steps in the visual-transduction process re­ sult in a huge amplification of the signal. Each excited rhodopsin molecule activates at least 500 molecules of transducin, each of which can activate a molecule of the

PDE . This phosphodiesterase has a remarkably high turnover number, each activated molecule hydrolyzing 4,200 molecules of cGMP per second. The binding of cGMP to cGMP-gated ion channels is cooperative, and a relatively small change in [cGMP] therefore registers as a large change in ion conductance. The result of these am­ plifications is exquisite sensitivity to light. Absorption of a single photon closes 1 ,000 or more ion channels and changes the cell's membrane potential by about 1 mV. The Visual Signal Is Quickly Terminated

As your eyes move across this line, the retinal images of the first words disappear rapidly-before you see the next series of words. In that short interval, a great deal of biochemistry has taken place. Very shortly after illu­ mination of the rod or cone cells stops, the photo­ sensory system shuts off. The a subunit of transducin (with bound GTP) has intrinsic GTPase activity. Within

1 2 . 1 0 Sensory Transduction in Vision, Olfaction, and G u station

milliseconds after the decrease in light intensity, GTP is hydrolyzed and Ta reassociates with T,By· The inhibitory subunit of the PDE , which had been bound to Ta-GTP, is released and reassociates with the enzyme, strongly in­ hibiting its activity. To return [cGMP] to its "dark" level, the enzyme guanylyl cyclase converts GTP to cGMP (step (/) in Fig. 12-38) in a reaction that is inhibited by high [Ca2 +] (> 100 nM) . Calcium levels drop during illu­ mination, because the steady-state [Ca2 +] in the outer segment is the result of outward pumping of Ca2 + through the Na + -Ca2 + exchanger of the plasma mem­ brane (see Fig. 12-36) and influx of Ca2 + through open cGMP-gated channels. In the dark, this produces a [Ca2 +] of about 500 nM-enough to inhibit cGMP syn­ thesis. After brief illumination, Ca2 + entry slows and [Ca2 +] declines (step @) . The inhibition of guanylyl cyclase by Ca2 + is relieved, and the cyclase converts GTP to cGMP to return the system to its prestimulus state (step (7)). Rhodopsin itself also undergoes changes in response to prolonged illumination. The conformational change in­ duced by light absorption exposes several Thr and Ser residues in the carboxyl-terminal domain. These residues are quickly phosphorylated by rhodopsin ki­ nase (step ® in Fig. 12-38) , which is functionally and structurally homologous to the �-adrenergic kinase �ARK) that desensitizes the �-adrenergic receptor (Fig. 12-8) . The Ca2 + -binding protein recoverin in­ hibits rhodopsin kinase at high [Ca2 +], but the inhibition is relieved when [Ca2 +] drops after illumination, as de­ scribed above. The phosphorylated carboxyl-terminal domain of rhodopsin is bound by the protein arrestin 1 , preventing further interaction between activated rhodopsin and transducin. Arrestin 1 is a close homolog of arrestin 2 �arr; Fig. 12-8) . On a relatively long time scale (seconds to minutes) , the all-trans-retinal of an ex­ cited rhodopsin molecule is removed and replaced by 1 1cis-retinal, to produce rhodopsin that is ready for another round of excitation (step ® in Fig. 12-38) . Cone Cells Specialize in Color Vision

Color vision involves a path of sensory transduction in cone cells essentially identical to that described above, but triggered by slightly different light receptors. Three types of cone cells are specialized to detect light from dif­ ferent regions of the spectrum, using three related pho­ toreceptor proteins (opsins) . Each cone cell expresses only one kind of opsin, but each type is closely related to rhodopsin in size, amino acid sequence, and presumably three-dimensional structure. The differences among the opsins, however, are great enough to place the chro­ mophore, 1 1-cis-retinal, in three slightly different envi­ ronments, with the result that the three photoreceptors have different absorption spectra (Fig. 12-39) . We discriminate colors and hues by integrating the output from the three types of cone cells, each containing one of the three photoreceptors.

100 90 80 70 -e 60 50 .� 40 � 30 20 10 0

[465]

Q)

s:: ro

0 rLl ..0 ro Q) ..., Q)



400 450 500 550 600 650 Wavelength (nm)

FIGURE 1 2-39 Absorption spectra of purified rhodopsin and the red, green, and blue receptors of cone cells. The spectra, obtained from i n­

dividual cone cel ls isolated from cadavers, peak at about 420, 530, and 5 60 nm, and the maximum absorption for rhodopsin is at about 500 nm. For reference, the visible spectrum for h umans is about 380 to 750 nm.

Color blindness, such as the inability to distin­ guish red from green, is a fairly common, geneti­ cally inherited trait in humans. The various types of color blindness result from different opsin mutations. One form is due to loss of the red photoreceptor; af­ fected individuals are red- dichromats (they see only two primary colors) . Others lack the green pigment and are green - dichromats. In some cases, the red and green photoreceptors are present but have a changed amino acid sequence that causes a change in their absorption spectra, resulting in abnormal color vision. Depending on which pigment is altered, such individuals are red-anomalous trichromats or green-anomalous trichromats. Examination of the genes for the visual receptors has allowed the diagnosis of color blindness in a famous "patient" more than a century after his death (Box 12-4) ! • Vertebrate Olfaction a n d Gustation Use Mechan isms Similar to the Visual System

The sensory cells that detect odors and tastes have much in common with the rod and cone cells. Olfactory neurons have long thin cilia extending from one end of the cell into a mucous layer that overlays the cell. These cilia present a large surface area for interaction with ol­ factory signals. The receptors for olfactory stimuli are ciliary membrane proteins with the familiar GPCR struc­ ture of seven transmembrane a helices. The olfactory signal can be any one of the many volatile compounds for which there are specific receptor proteins. Our abil­ ity to discriminate odors stems from hundreds of differ­ ent olfactory receptors in the tongue and nasal passages and from the brain's ability to integrate input from

[466]

Biosignaling

The chemist John Dalton (of atomic theory fame) was color-blind. He thought it probable that the vitreous hu­ mor of his eyes (the fluid that fills the eyeball behind the lens) was tinted blue, unlike the colorless fluid of normal eyes. He proposed that after his death, his eyes should be dissected and the color of the vitreous humor deter­ mined. His wish was honored. The day after Dalton's death in July 1844, Joseph Ransome dissected his eyes and found the vitreous humor to be perfectly colorless. Ransome, like many scientists, was reluctant to throw samples away. He placed Dalton's eyes in a jar of preser­ vative, where they stayed for a century and a half. Then, in the rnid-1990s, molecular biologists in En­ gland took small samples of Dalton's retinas and ex­ tracted DNA. Using the known gene sequences for the opsins of the red and green light receptors, they ampli­ fied the relevant sequences (using techniques described

in Chapter 9) and determined that Dalton had the opsin gene for the red photopigment but lacked the opsin gene for the green photopigment. Dalton was a green­ dichromat. So, 150 years after his death, the experiment Dalton started-by hypothesizing about the cause of his color blindness-was finally finished.

different types of olfactory receptors to recognize a "hybrid" pattern, extending our range of discrimination far beyond the number of receptors. The olfactory stimulus arrives at the sensory cells by diffusion through the air. In the mucous layer covering the olfactory neurons, the odorant molecule binds di-

rectly to an olfactory receptor or to a specific binding pro­ tein that carries the odorant to a receptor (Fig. 1 2-40). Interaction between odorant and receptor triggers a change in receptor conformation that results in the replacement of bound GDP by GTP on a G protein, G01t, analogous to transducin and to Gs of the ,B-adrenergic

C1)

FIGURE 1 Dalton's eyes.

Olfactory neuron

Cilia

Odorant (0) arrives at the mucous layer and binds directly to an olfactory receptor (OR) or to a binding protein (BP) that carries it to the OR.

II ®

Activated OR catalyzes GDP-GTP exchange on a G protein (Golf), causing its dissociation into a and f3r ·

Dendrite

Axon

®

Air Mucous layer

cAMP-gated cation channels open. Ca2+ enters, raising internal [Ca2 +] .

�0 0 •:. :::• 1, a preference. (b) All four types of knockout strains had the same re­ sponses to salt and bitter tastes as did wild-type mice. Which of the above issues did this experiment address? What do you conclude from these results? The researchers then studied umami taste reception by measuring the relative lick rates of the different mouse strains with different quantities of MSG in the feeding solution. Note that the solutions also contained inosine monophosphate (IMP), a strong potentiator of umami taste reception (and a common ingredient in ramen soups, along with MSG) , and ameloride, which suppresses the pleasant salty taste imparted by the sodium of MSG. The results are shown in the graph.

Ql +'

"" .... "



� Ql

Wild type and TlR2 knockout

:d""

Q) 0::

T1R1 knockout T1R3 knockout 1

1

10

MS G + IMP + ameloride (mM)

100

(c) Are these data consistent with the umami taste recep­ tor consisting of a heterodimer of T 1 R 1 and T1R3? Why or why not? (d) Which model(s) of taste encoding does this result sup­ port? Explain your reasoning. Zhao and coworkers then performed a series of similar ex­ periments using sucrose as a sweet taste. These results are shown below. 20

Wild Lype and. TlRl knockout

100

Sucrose (mM)

1000

(e) Are these data consistent with the sweet taste recep­ tor consisting of a heterodimer of T1R2 and T1R3? Why or why not? (f) There were some unexpected responses at very high sucrose concentrations. How do these complicate the idea of a heterodimeric system as presented above? In addition to sugars, humans also taste other compounds (e.g. , the peptides monellin and aspartame) as sweet; mice do not taste these as sweet. Zhao and coworkers inserted into TIR2 knockout mice a copy of the human T 1R2 gene under the control of the mouse T 1 R2 promoter. These modified mice now tasted monellin and saccharin as sweet. The researchers then went further, adding to T l R 1 knockout mice the RASSL protein-a G protein-linked receptor for the synthetic opiate spiradoline; the RASSL gene was under the control of a pro­ moter that could be induced by feeding the mice tetracycline. These mice did not prefer spiradoline in the absence of tetra­ cycline; in the presence of tetracycline, they showed a strong preference for nanomolar concentrations of spiradoline. (g) How do these results strengthen Zhao and coauthors' conclusions about the mechanism of taste sensation? Reference Zhao, G.Q., Zhang, Y., Boon, M.A., Chandrashekar, J., Eden­ bach, 1., Ryba, N.J.P., & Zuker, C. (2003) The receptors for mam­ malian sweet and umarni taste. Cell l l 5 , 255-266.

PA RT

II

B I OE N E RG ETI CS AN D M ETABOLISM

13

Bioenergetics and Biochemical Reaction Types

14

489

Glycolysis, Gluconeogenesis, and the Pentose Phosphate Pathway

527

Principles of Metabolic Regulation

16

The Citric Acid Cycle

17

Fatty Acid Catabolism

18

Amino Acid Oxidation and the Production of Urea

19

615 647

673

Oxidative Phosphorylation and 707

Photophosphorylation 20

Carbohydrate Biosynthesis in Plants and Bacteria

773

21

lipid Biosynthesis

22

Biosynthesis of Amino Adds, Nucleotides, and Related Molecules

23

805 851

Hormonal Regulation and Integration of Mammalian Metabolism

etabolism is a highly coordinated cellular activ­

569

15

901

Part II is the central metabolic pathways, which are few

ity in which many multienzyme systems (meta­

in number and remarkably similar in all forms of life. Liv­

bolic pathways) cooperate to (1) obtain chemical

ing organisms can be divided into two large groups

energy by capturing solar energy or degrading energy­

according to the chemical form in which they obtain car­

rich nutrients from the environment; (2) convert nutrient

bon from the environment. Autotrophs (such as photo­

molecules into the cell's own characteristic molecules,

synthetic bacteria, green algae, and vascular plants) can

including precursors of macromolecules; (3) polymerize

use carbon dioxide from the atmosphere as their sole

monomeric precursors into macromolecules: proteins,

source of carbon, from which they construct all their

nucleic acids, and polysaccharides; and (4) synthesize

carbon-containing biomolecules (see Fig. 1-5) . Some

and degrade biomolecules required for specialized cellu­

autotrophic organisms , such as cyanobacteria, can

lar functions, such as membrane lipids, intracellular

also use atmospheric nitrogen to generate all their

messengers, and pigments.

nitrogenous components. Heterotrophs cannot use

Although metabolism embraces hundreds of differ­

atmospheric carbon dioxide and must obtain carbon

ent enzyme-catalyzed reactions, our major concern in

from their environment in the form of relatively complex

[48 6]

Bioenergetics a n d Meta b o l i s m

organic molecules such as glucose. Multicellular animals and most microorganisms are heterotrophic. Autotrophic cells and organisms are relatively self-sufficient, whereas heterotrophic cells and organisms, with their require­ ments for carbon in more complex forms, must subsist on the products of other organisms. Many autotrophic organisms are photosynthetic and obtain their energy from sunlight, whereas het­ erotrophic organisms obtain their energy from the degradation of organic nutrients produced by au­ totrophs. In our biosphere , autotrophs and heterotrophs live together in a vast, interdependent cycle in which au­ totrophic organisms use atmospheric carbon dioxide to build their organic biomolecules, some of them generat­ ing oxygen from water in the process. Heterotrophs in turn use the organic products of autotrophs as nutrients

FIGURE 2 Cycling of nitrogen in the biosphere. Gaseous n itrogen (N2) makes up 80% of the earth's atmosphere.

and return carbon dioxide to the atmosphere. Some of

N2. Thus, in addition to the global carbon and oxygen

the oxidation reactions that produce carbon dioxide also

cycle, a nitrogen cycle operates in the biosphere, turn­

consume oxygen, converting it to water. Thus carbon,

ing over huge amounts of nitrogen (Fig. 2 ). The cycling

oxygen, and water are constantly cycled between the

of carbon, oxygen, and nitrogen, which ultimately in­

heterotrophic and autotrophic worlds, with solar energy

volves all species, depends on a proper balance between

as the driving force for this global process (Fig. 1 ) .

the activities of the producers (autotrophs) and con­

All living organisms also require a source of nitro­ gen, which is necessary for the synthesis of amino acids,

sumers (heterotrophs) in our biosphere . These cycles of matter are driven by an enormous

nucleotides, and other compounds. Bacteria and plants

flow of energy into and through the biosphere, beginning

can generally use either ammonia or nitrate as their sole

with the capture of solar energy by photosynthetic organ­

source of nitrogen, but vertebrates must obtain nitrogen

isms and use of this energy to generate energy-rich car­

in the form of amino acids or other organic compounds.

bohydrates and other organic nutrients; these nutrients

Only a few organisms-the cyanobacteria and many

are then used as energy sources by heterotrophic organ­

species of soil bacteria that live symbiotically on the

isms. In metabolic processes, and in all energy transfor­

roots of some plants-are capable of converting

mations, there is a loss of useful energy (free energy) and

("fixing") atmospheric nitrogen (N2 ) into ammonia.

an inevitable increase in the amount of unusable energy

Other bacteria (the nitrifying bacteria) oxidize ammonia

(heat and entropy) . In contrast to the cycling of matter,

to nitrites and nitrates ; yet others convert nitrate to N2. The anammox bacteria convert ammonia and nitrite to

therefore, energy flows one way through the biosphere; or­

ganisms cannot regenerate useful energy from energy dis­

sipated as heat and entropy. Carbon, oxygen, and nitrogen FIGURE 1 Cycling of carbon dioxide and oxy­

recycle continuously, but energy is constantly trans­

gen between the autotrophic (photosynthetic)

formed into unusable forms such as heat.

and heterotrophic domains in the biosphere.

The flow of mass through this cycle is enor­ mous; about 4 x 1 0 1 1 metric tons of carbon are turned over in the biosphere annually.

Metabolism, the sum of all the chemical transfor­ mations taking place in a cell or organism, occurs through a series of enzyme-catalyzed reactions that con­ stitute metabolic pathways. Each of the consecutive steps in a metabolic pathway brings about a specific, small chemical change, usually the removal, transfer, or addition of a particular atom or functional group. The precursor is converted into a product through a series of metabolic intermediates called metabolites. The term

intermediary metabolism is often applied to the com­ bined activities of all the metabolic pathways that inter­ convert precursors, metabolites, and products of low molecular weight (generally, Mr < 1 ,000) .

Bioen ergetics and Meta b o l i s m

[487]

Catabolism is the degradative phase of metabolism

the pathway is regenerated in a series of reactions that

in which organic nutrient molecules (carbohydrates,

converts another starting component into a product. We

fats, and proteins) are converted into smaller, simpler

shall see examples of each type of pathway in the follow­

end products (such as lactic acid, C02 , NH3) . Catabolic

ing chapters.

pathways release energy, some of which is conserved in

Most cells have the enzymes to carry out both the

the formation of ATP and reduced electron carriers

degradation and the synthesis of the important categories

(NADH, NADPH, and FADH2) ; the rest is lost as heat. In

of biomolecules-fatty acids, for example. The simultane­

anabolism, also called biosynthesis, small, simple pre­

ous synthesis and degradation of fatty acids would be

cursors are built up into larger and more complex mole­

wasteful, however, and this is prevented by reciprocally

cules, including lipids, polysaccharides, proteins, and

regulating the anabolic and catabolic reaction sequences:

nucleic acids. Anabolic reactions require an input of en­

when one sequence is active, the other is suppressed.

ergy, generally in the form of the phosphoryl group

Such regulation could not occur if anabolic and catabolic

transfer potential of ATP and the reducing power of

pathways were catalyzed by exactly the same set of en­

NADH, NADPH, and FADH2 (Fig. 3).

zymes, operating in one direction for anabolism, the oppo­

Some metabolic pathways are linear, and some are

site direction for catabolism: inhibition of an enzyme

branched, yielding multiple useful end products from a

involved in catabolism would also inhibit the reaction se­

single precursor or converting several starting materials

quence in the anabolic direction. Catabolic and anabolic

into a single product. In general, catabolic pathways are

pathways that connect the same two end points (glucose

convergent and anabolic pathways divergent (Fig. 4 ).

� � pyruvate, and pyruvate � � glucose, for example)

Some pathways are cyclic: one starting component of

may employ many of the same enzymes, but invariably at least one of the steps is catalyzed by different enzymes in

r

l1

the catabolic and anabolic directions, and these enzymes Cell macromolecules

Proteins Polysaccharides Lipids Nucleic acids

Energy­ containing nutrients

Carbohydrates Fats Proteins

are the sites of separate regulation. Moreover, for both an­ abolic and catabolic pathways to be essentially irre­ versible, the reactions unique to each direction must include at least one that is thermodynamically very favor­ able-in other words, a reaction for which the reverse re­ action is very unfavorable. As a further contribution to the separate regulation of catabolic and anabolic reaction se­ quences, paired catabolic and anabolic pathways com­ monly take place in different cellular compartments: for example, fatty acid catabolism in mitochondria, fatty acid synthesis in the cytosol. The concentrations of intermedi­

Anabolism

Catabollam

ates, enzymes, and regulators can be maintained at differ­ ent levels in these different compartments. Because metabolic pathways are subject to kinetic control by sub­ strate concentration, separate pools of anabolic and cata­ bolic intermediates also contribute to the control of metabolic rates. Devices that separate anabolic and cata­

bolic processes will be of particular interest in our discus­ sions of metabolism. Precursor molecules

Amino acids Sugars Fatty acids Nitrogenous bases

Energy­ depleted end products

C02 H20 NH3

Metabolic pathways are regulated at several levels, from within the cell and from outside. The most immedi­ ate regulation is by the availability of substrate; when the intracellular concentration of an enzyme's substrate is near or below Km (as is commonly the case) , the rate of the reaction depends strongly upon substrate concentra­

FIGURE 3 Energy relationships between catabolic and anabolic path­ ways. Catabolic pathways del iver chem ical energy in the form of ATP,

NADH, NADPH, and FADH 2 . These energy carriers are used i n ana­

tion (see Fig. 6-1 1 ) . A second type of rapid control from within is allosteric regulation (p. 220) by a metabolic in­

bolic pathways to convert small precursor molecules i nto cel l u l ar

termediate or coenzyme-an amino acid or ATP, for ex­

macromolecules.

ample-that signals the cell's internal metabolic state.

[4ss]

Bioe n ergetics a n d Metabolism

Rubber

Phospholipids Triacylglycerols Starch Glycogen

Alanine

"""

'' Sucrose

Glucose Serine

Carotenoid pigments

Stemid hormones

Isopentenyl­ pyrophosphate

Bile acids

Fatty acids Mevalonate

Phenyl­ alanine

.Pyruvate '*

Acetoacetyl-CoA

Cholesteryl esters

Vitamin K

Eicosanoids

Leucine

Fatty acid

Isoleucine

Triacylglycetols

(a) Converging catabolism

CDP-diacylglycerol Oxaloacetate

Phospholipids

(b) Diverging anabolism

FIGURE 4 Three types of nonlinear metabolic pathways. (a) Converging, catabol ic, (b) diverging, anabolic, and (c)

co2

cycl i c pathways. In (c), one of the starting materials (ox­ al oacetate in this case) is regenerated and reenters the pathway. Acetate, a key metabol ic i ntermediate, is the breakdown product of a variety of fuels (a), serves as the precursor for an array of products (b), and is consumed in

(c) Cyclic pathway

the catabolic pathway known as the citric acid cycle (c).

When the cell contains an amount of, say, aspartate suffi­

produced either by substrate oxidation or by light

cient for its immediate needs, or when the cellular level

absorption, drives the synthesis of ATP.

of ATP indicates that further fuel consumption is unnec­

Chapters 20 through 22 describe the major anabolic

essary at the moment, these signals allosterically inhibit

pathways by which cells use the energy in ATP to pro­

the activity of one or more enzymes in the relevant path­

duce carbohydrates, lipids, amino acids, and nucleotides

way. In multicellular organisms the metabolic activities

from simpler precursors. In Chapter 23 we step back

of different tissues are regulated and integrated by

from our detailed look at the metabolic pathways-as

growth factors and hormones that act from outside the

they occur in all organisms, from Escherichia coli to

cell. In some cases this regulation occurs virtually instan­

humans-and consider how they are regulated and inte­

taneously (sometimes in less than a millisecond) through

grated in mammals by hormonal mechanisms.

changes in the levels of intracellular messengers that

As we undertake our study of intermediary metabo­

modify the activity of existing enzyme molecules by al­

lism, a final word. Keep in mind that the myriad reac­

losteric mechanisms or by covalent modification such as

tions described in these pages take place in, and play

phosphorylation. In other cases, the extracellular signal

crucial roles in, living organisms . As you encounter each

changes the cellular concentration of an enzyme by al­

reaction and each pathway ask, What does this chemical

tering the rate of its synthesis or degradation, so the ef­

transformation do for the organism? How does this path­

fect is seen only after minutes or hours.

way interconnect with the other pathways operating si­

We begin Part II with a discussion of the basic ener­

multaneously in the same cell to produce the energy and

getic principles that govern all metabolism (Chapter 13).

products required for cell maintenance and growth?

We then consider the major catabolic pathways by

How do the multilayered regulatory mechanisms coop­

which cells obtain energy from the oxidation of various

erate to balance metabolic and energy inputs and out­

fuels (Chapters 14 through 1 9) . Chapter 19 is the pivotal

puts, achieving the dynamic steady state of life? Studied

point of our discussion of metabolism; it concerns

with this perspective, metabolism provides fascinating

chemiosmotic energy coupling, a universal mechanism

and revealing insights into life, with countless applica­

in which a transmembrane electrochemical potential,

tions in medicine, agriculture, and biotechnology.

The tota l energy of the u n iverse is consta n t; the total entropy is conti n­ ual l y i nc reasing.

-Rudolf Clau iu

, The Mec h a n iGJI Theory f Heat w i t h Its App l ica t i o n to the Steam-Engine and to the Phy ical Properties of Bodies, 7 865 (trans. 1 867)

The isomorphism of entropy and i nformation establ ishes a l i n k between th two forms of power: the power to do and the power to d i re 1 what is done.

-Franr;ois jacob,

La logique du vivant: u ne h i stoire de l ' hered ite (The Logic of L i fe: A H i stor r Her dityl 19 0

Bioenergetics and Biochemical Reaction Types 13.1

Bioenergetics and Thermodynamics

1 3 .2

Chemical logic and Common Biochemical Reactions

490

into heat and that this process of respiration is essential to life. He observed that

495

1 3 .3

Phosphoryl Group Transfers and ATP

1 3 .4

Biological Oxidation-Reduction Reactions

501 512

iving cells and organisms must perform work to stay alive, to grow, and to reproduce. The ability to har­ ness energy and to channel it into biological work is a fundamental property of all living organisms; it must have been acquired very early in cellular evolution. Modern or­ ganisms carry out a remarkable variety of energy trans­ ductions, conversions of one form of energy to another. They use the chemical energy in fuels to bring about the synthesis of complex, highly ordered macromolecules from simple precursors. They also convert the chemical energy of fuels into concentration gradients and electrical gradients, into motion and heat, and, in a few organisms such as fireflies and deep-sea fish, into light. Photosynthetic organisms transduce light energy into all these other forms of energy. The chemical mechanisms that underlie biological energy transductions have fascinated and challenged biologists for centuries. The French chemist Antoine Lavoisier recognized that animals somehow trans­ Antoine Lavo isier, 1 743-1 794 form chemical fuels (foods)

. . . in general, respiration is nothing but a slow combustion of carbon and hydrogen, which is en­ tirely similar to that which occurs in a lighted lamp or candle , and that, from this point of view, animals that respire are true combustible bodies that burn and consume themselves . . . One may say that this analogy between combustion and respiration has not escaped the notice of the poets, or rather the philosophers of antiquity, and which they had ex­ pounded and interpreted. This fire stolen from heaven, this torch of Prometheus , does not only represent an ingenious and poetic idea, it is a faith­ ful picture of the operations of nature , at least for animals that breathe ; one may therefore say, with the ancients, that the torch of life lights itself at the moment the infant breathes for the first time, and it does not extinguish itself except at death. * I n the twentieth century, we began t o understand much of the chemistry underlying that "torch of life ." Bi­ ological energy transductions obey the same chemical and physical laws that govern all other natural processes. It is therefore essential for a student of biochemistry to understand these laws and how they apply to the flow of energy in the biosphere. In this chapter we first review the laws of thermody­ namics and the quantitative relationships among free en­ ergy, enthalpy, and entropy. We then review the common types of biochemical reactions that occur in living cells, reactions that harness, store, transfer, and release the *From a memoir by Armand Seguin and Antoine Lavoisier, dated 1 789, quoted in Lavoisier, ale, Paris.

A.

(1862)

Oeuvres de Lavoisier,

lmprimerie Imperi­

[490]

Bioen ergetics a n d Biochemical Reaction Types

energy taken up by organisms from their surroundings. Our focus then shifts to reactions that have special roles in biological energy exchanges, particularly those involv­ ing ATP. We finish by considering the importance of oxi­ dation-reduction reactions in living cells, the energetics of biological electron transfers, and the electron carriers commonly employed as cofactors in these processes.

1 3 . 1 Bioenergetics and Thermodynamics Bioenergetics is the quantitative study of energy transductions-changes of one form of energy into an­ other-that occur in living cells, and of the nature and function of the chemical processes underlying these transductions. Although many of the principles of ther­ modynamics have been introduced in earlier chapters and may be familiar to you, a review of the quantitative aspects of these principles is useful here. Biological Energy Tra nsformations Obey the Laws of Thermodyna mics Many quantitative observations made by physicists and chemists on the interconversion of different forms of en­ ergy led, in the nineteenth century, to the formulation of two fundamental laws of thermodynamics. The first law is the principle of the conservation of energy: for any physical or chemical change, the total amount of energy in the universe remains constant; energy may changeform or it may be transportedfrom one region to another, but it cannot be created or destroyed. The second law of thermodynamics, which can be stated in several forms, says that the universe always tends toward increasing disorder: in all natural processes, the en­ tropy of the universe increases.

second law of thermodynamics. But living organisms do not violate the second law; they operate strictly within it. To discuss the application of the second law to biolog­ ical systems, we must first define those systems and their surroundings. The reacting system is the collection of matter that is undergoing a particular chemical or physical process; it may be an organism, a cell, or two reacting com­ pounds. The reacting system and its surroundings to­ gether constitute the universe. In the laboratory, some chemical or physical processes can be carried out in iso­ lated or closed systems, in which no material or energy is exchanged with the surroundings. Living cells and or­ ganisms, however, are open systems, exchanging both material and energy with their surroundings; living sys­ tems are never at equilibrium with their surroundings, and the constant transactions between system and sur­ roundings explain how organisms can create order within themselves while operating within the second law of thermodynamics. In Chapter 1 (p. 22) we defined three thermody­ namic quantities that describe the energy changes oc­ curring in a chemical reaction:

Gibbs free energy, G, expresses the amount of en­ ergy capable of doing work during a reaction at con­ stant temperature and pressure . When a reaction proceeds with the release of free energy (that is, when the system changes so as to possess less free energy) , the free-energy change, !J.G, has a negative value and the reaction is said to be exergonic. In en­ dergonic reactions, the system gains free energy and !J.G is positive. Enthalpy, H, is the heat content of the reacting system. It reflects the number and kinds of chemical bonds in the reactants and products. When a chem­ ical reaction releases heat, it is said to be exother­ mic; the heat content of the products is less than that of the reactants and t::.H has, by convention, a negative value. Reacting systems that take up heat from their surroundings are endothermic and have positive values of !::.H.

Entropy, S, is a quantitative expression for the ran­ domness or disorder in a system (see Box 1-3). When the products of a reaction are less complex and more disordered than the reactants, the reac­ tion is said to proceed with a gain in entropy.

" ow, in lhe second law of thermodynamic

Living organisms consist of collections of molecules much more highly organized than the surrounding ma­ terials from which they are constructed, and organisms maintain and produce order, seemingly oblivious to the

The units of !J.G and t::.H are joules/mole or calories/mole (recall that 1 cal = 4.184 J) ; units of entropy are joules/ mole · Kelvin (J/mol · K) (Table 13-1) . Under the conditions existing in biological systems (including constant temperature and pressure) , changes in free energy, enthalpy, and entropy are related to each other quantitatively by the equation t.G

=

t.H - Tt.S

(13-1)

1 3 . 1 Bioenergetics a n d Thermod y n a m i cs

I

TABLE 1 3 - 1

Some Physical Constanb and Units Used In Thennodynamks

Boltzmann constant, k = Avogadro's number, N Faraday constant, J Gas constant, R ( =

= =

=

2 1 .381 x 1 0 - 3 J/K 1 23 6.022 x 10 mol96,480 JN mol 8 . 3 1 5 J/mol K 1 . 987 caVmol K) ·

·

·

Units of A.G and f1H are J/mol (or caVmol) Units of AS are J/mol K (or caVmol K) 1 cal = 4 . 1 84 J ·

·

Units of absolute temperature, T, are Kelvin, K 25 oc 298 K At 25 °C, RT 2.478 kJ/mol ( 0 . 592 kcal!mol) = =

=

in which A.G is the change in Gibbs free energy of the re­ acting system, M! is the change in enthalpy of the sys­ tem, T is the absolute temperature, and A.S is the change in entropy of the system. By convention, A.S has a posi­ tive sign when entropy increases and A.H, as noted above, has a negative sign when heat is released by the system to its surroundings. Either of these conditions, which are typical of energetically favorable processes, tend to make A.G negative . In fact, A.G of a sponta­ neously reacting system is always negative. The second law of thermodynamics states that the entropy of the universe increases during all chemical and physical processes, but it does not re­ quire that the entropy increase take place in the re­ acting system itself. The order produced within cells as they grow and divide is more than compensated for by the disorder they create in their surroundings in the course of growth and division (see Box 1-3 , case 2) . In short, living organisms preserve their internal or­ der by taking from the surroundings free energy in the form of nutrients or sunlight, and returning to their surroundings an equal amount of energy as heat and entropy.

Cells Require Sources of Free Energy Cells are isothermal systems-they function at essen­ tially constant temperature (and also function at con­ stant pressure) . Heat flow is not a source of energy for cells, because heat can do work only as it passes to a zone or object at a lower temperature. The energy that cells can and must use is free energy, described by the Gibbs free-energy function G, which allows prediction of the direction of chemical reactions, their exact equilib­ rium position, and the amount of work they can (in theory) perform at constant temperature and pressure . Heterotrophic cells acquire free energy from nutrient molecules, and photosynthetic cells acquire it from ab­ sorbed solar radiation. Both kinds of cells transform this free energy into ATP and other energy-rich compounds

[491]

capable of providing energy for biological work at con­ stant temperature.

Standard Free-Energy Change Is Directly Related to the Equilibrium Constant The composition of a reacting system (a mixture of chemical reactants and products) tends to continue changing until equilibrium is reached. At the equilib­ rium concentration of reactants and products , the rates of the forward and reverse reactions are exactly equal and no further net change occurs in the sys­ tem. The concentrations of reactants and products at equilibrium define the equilibrium constant, Keq (p. 2 4) . In the general reaction aA + bB � c C + dD, where a, b, c, and d are the number of molecules of A, B , C, and D participating, the equilibrium constant is given by

Keq

[C]c[D] d

[A]a[B]b

= =�:-.

{13-2)

where [A) , [B) , [C) , and [D] are the molar concentrations of the reaction components at the point of equilibrium. When a reacting system is not at equilibrium, the tendency to move toward equilibrium represents a driv­ ing force, the magnitude of which can be expressed as the free-energy change for the reaction, A.G. Under stan­ dard conditions (298 K = 25 °C) , when reactants and products are initially present at 1 M concentrations or, for gases, at partial pressures of 1 0 1 .3 kilopascals (kPa) , or 1 atm, the force driving the system toward equilibrium is defined as the standard free-energy change, A.G0• By this definition, the standard state for reactions that involve + hydrogen ions is [H ] = 1 M, or pH 0. Most biochemical reactions, however, occur in well-buffered aqueous solu­ tions near pH 7; both the pH and the concentration of water (55.5 M) are essentially constant. KEY CO NVE NTI O N : For convenience of calculations, bio­

chemists define a standard state different from that used in chemistry and physics: in the biochemical stan­ dard state, [H + ] is 10- 7 M (pH 7) and [H2 0] is 55.5 M. For 2 reactions that involve Mg + (which include most of 2 those with ATP as a reactant) , [Mg + ] in solution is com­ monly taken to be constant at 1 mM . • Physical constants based on this biochemical stan­ dard state are called standard transformed con­ stants and are written with a prime (such as A.G'o and K�q) to distinguish them from the untransformed con­ stants used by chemists and physicists. (Note that most other textbooks use the symbol A.G0' rather than A.G'0• Our use of A.G'0, recommended by an international com­ mittee of chemists and biochemists, is intended to emphasize that the transformed free energy, G ' , is the criterion for equilibrium.) For simplicity, we will here­ after refer to these transformed constants as standard

free-energy changes.

[49 2]

Bioen ergetics a n d Biochemical Reaction Types

K EY CON V E N T I O N : In another simplifying convention used 2 by biochemists, when H20, H + , and/or Mg + are reac­ tants or products, their concentrations are not included in equations such as E quation 1 3-2 but are instead incorporated into the constants K�q and 6.G'0. •

Just as K�q is a physical constant characteristic for each reaction, so too is 6.G'o a constant. As we noted in Chapter 6 , there is a simple relationship between K�q and 6.G'0:

(13-3)

The standard free-energy change of a chemical reac­ tion is simply an alternative mathematical way of expressing its equilibrium constant. Table 1 3-2 shows the relationship between 6.0'0 and K�q· If the equilibrium constant for a given chemical reaction is 1 .0, the standard free-energy change of that reaction is 0.0 (the natural logarithm of 1 .0 is zero) . If K�q of a reaction is greater than 1 .0, its 6.G'0 is negative . If K�q is less than 1 .0, 6.0'0 is positive. Because the relationship between 6.0'0 and K�q is exponential, relatively small changes in 6.0'0 correspond to large changes in K�q· It may be helpful to think of the standard free­ energy change in another way. 6.0 '0 is the difference be­ tween the free-energy content of the products and the free-energy content of the reactants, under standard conditions. When 6.G'0 is negative, the products contain less free energy than the reactants and the reaction will proceed spontaneously under standard conditions; all chemical reactions tend to go in the direction that re­ sults in a decrease in the free energy of the system. A

TAB L E 1 3 -2

K�q 1 03 2 10 1 10

10- 1

10-

2 3

w-4

1 0- 5 10- 6

When K�q i s . . . > 1 .0 1.0 < 1 .0

t:.G'0 is . . .

Starting with all components at 1 M , the reaction . . .

negative

proceeds forward

zero

is at equilibrium

positive

proceeds in reverse

positive value of 6.0'0 means that the products of the re­ action contain more free energy than the reactants, and this reaction will tend to go in the reverse direction if we start with 1 . 0 M concentrations of all components (stan­ dard conditions) . Table 13-3 summarizes these points.

- WORKED EXAMPLE 1 3-1

Calculation of AG'0

Glucose !-phosphate � glucose 6-phosphate

Calculate the standard free-energy change of the reac­ tion catalyzed by the enzyme phosphoglucomutase

given that, starting with 20 mM glucose 1-phosphate and no glucose 6-phosphate, the final equilibrium mixture at 25 oc and pH 7.0 contains 1 .0 mM glucose 1 -phosphate and 1 9 mM glucose 6-phosphate. Does the reaction in the direction of glucose 6-phosphate formation proceed with a loss or a gain of free energy?

[glucose 6-phosphate) 19 mM [glucose !-phosphate) l.OmM 19

Solution: First we calculate the equilibrium constant: K' q e

=

=

--

=

ln K�q K)(298 K)(ln 19) - -(8.315J/mol· -7.3 kJ/mol

We can now calculate the standard free-energy change: t.G'o

= -RT =

(kJ/mol)

(kcaVmol)*

- 17.1

-4.1

- 1 1 .4

-2.7

57

- 1 .4

0.0

0.0

-

1

10-

Relationship between Equilibrium Constants and Standard Free-Energy Changes of Chemical Reactions ____, _ _ _ _ _

TAB L E 1 3-3

.

5.7

1 .4

1 1 .4

2 .7

17.1

4. 1

22.8

5.5

28 . 5

6.8

34.2

8.2

• Although joules and kilojoules are the standard units o f energy and are used through­ out this text, biochemists and nutritionists sometimes express L1G'0 values in kilocalo­ ries per mole. We have therefore included values in both kilojoules and kilocalories in this table and in Tables 13-4 and 13-6. To convert kilojoules to kilocalories, divide the number of kilojoules by 4. 184.

Because the standard free-energy change is negative, the conversion of glucose ! -phosphate to glucose 6-phosphate proceeds with a loss (release) of free energy. (For the reverse reaction, 6.0'0 has the same magnitude but the opposite sign.) Table 1 3-4 gives the standard free-energy changes for some representative chemical reactions. Note that hydrolysis of simple esters, amides, peptides, and glyco­ sides, as well as rearrangements and eliminations, pro­ ceed with relatively small standard free-energy changes, whereas hydrolysis of acid anhydrides is accompanied by relatively large decreases in standard free energy. The complete oxidation of organic compounds such as glucose or palmitate to C02 and H20, which in cells re­ quires many steps, results in very large decreases in standard free energy. However, standard free-energy

B ioenergetics a n d Thermodynam ics

13.1

[493]

TA B L E 1 3 -4 AG'o

(kJ/mol)

Reaction type

(kcaJ/mol)

Hydrolysis reactions

Acid anhydrides - 91 . 1 - 30.5 -45. 6 - 19.2 - 43.0

- 2 1 .8 - 7.3 - 1 0.9 - 4.6 - 10.3

Ethyl acetate + H20 � ethanol + acetate Glucose 6-phosphate + H20 � glucose + P;

- 1 9.6 - 13 8

-4.7 -3.3

Glutamine + H2 0 � glutamate + NH; Glycylglycine + H20 � 2 glycine

- 14.2 - 9.2

-3.4 - 2.2

- 15.5 - 1 5.9

-3.7 - 3.8

- 7.3

- 1 .7

- 1.7 - 0.4

3.1

0.8

Acetic anhydride + H20 � 2 acetate ATP + H20 � ADP + P; ATP + H20 � AMP + PP; PP; + H2 0 � 2P; UDP-glucose + H20 � UMP + glucose 1-phosphate Esters

.

Amides and peptides

Glycosides Maltose + H2 0 � 2 glucose Lactose + H2 0 � glucose + galactose Rearrangements

Glucose !-phosphate � glucose 6-phosphate Fructose 6-phosphate � glucose 6-phosphate Elimination of water

Malate � fumarate + H20 Oxidations with molecular oxygen

Glucose + 602 � 6C02 + 6H20 Palmitate + 2302 � 16C02 + 16H20

changes such as those in Table 13-4 indicate how much free energy is available from a reaction under standard conditions. To describe the energy released under the conditions existing in cells, an expression for the actual free-energy change is essential. Actual Free-Energy Changes Depend on Reactant and Product Concentrations

We must be careful to distinguish between two different quantities: the actual free-energy change, A.G, and the standard free-energy change, A.G'0• Each chemical reac­ tion has a characteristic standard free-energy change, which may be positive, negative, or zero, depending on the equilibrium constant of the reaction. The standard free-energy change tells us in which direction and how far a given reaction must go to reach equilibrium when the initial concentration of each component is 1. 0 M, the pH is 7.0, the temperature is 25 oc, and the pressure is 1 0 1 .3 kPa (1 atm) . Thus tlG'0 is a constant: it has a characteristic, unchanging value for a given reaction. But the actual free-energy change, tlG, is a function of reactant and product concentrations and of the temper­ ature prevailing during the reaction, none of which will

-2,840 - 9, 770

-686 - 2,338

necessarily match the standard conditions as defined above. Moreover, the tlG of any reaction proceeding spontaneously toward its equilibrium is always negative, becomes less negative as the reaction proceeds, and is zero at the point of equilibrium, indicating that no more work can be done by the reaction. tlG and tlG'0 for any reaction aA + bB � cC + dD are related by the equation t:.G

=

t:.G'o

+ RT ln

[CJ"[Dld (A]a(B]b

'I (13-4)

in which the terms in red are those actually prevailing in the system under observation. The concentration terms in this equation express the effects commonly called mass action, and the term [Cf[D] ct/[A]a[B]b is called the mass-action ratio, Q. Thus E quation 1 3--4 can be expressed as tlG = tlG'o + RT ln Q. As an example, let us suppose that the reaction A + B � C + D is taking place under the standard conditions of temperature (25 °C) and pressure ( 1 0 1 . 3 kPa) but that the concentrations of A, B, C, and D are not equal and none of the compo­ nents is present at the standard concentration of 1 .0 M. To determine the actual free-energy change, tlG, under these nonstandard conditions of concentration as the

[494]

Bioenergetics a n d Biochemical Reaction Types

reaction proceeds from left to right, we simply enter the actual concentrations of A, B, C, and D in E quation 1 3-4; the values of R, T, and 6.G'0 are the standard val­ ues . 6.G is negative and approaches zero as the reaction proceeds, because the actual concentrations of A and B decrease and the concentrations of C and D increase. Notice that when a reaction is at equilibrium-when there is no force driving the reaction in either direction and 6.G is zero-Equation 1 3-4 reduces to

and the reaction rate increases dramatically. The free­ energy changefor a reaction is independent of the path­ way by which the reaction occurs; it depends only on the nature and concentration of the initial reactants and the final products. Enzymes cannot, therefore, change equilibrium constants; but they can and do increase the rate at which a reaction proceeds in the direction dictated by thermodynamics (see Section 6.2) . Standard Free-Energy Changes Are Additive

or t!.. G'o =

-

RT ln K�q

which is the equation relating the standard free-energy change and equilibrium constant (Eqn 1 3-3) . The criterion for spontaneity of a reaction is the value of 6.G, not 6.0'0• A reaction with a positive 6.G '0 can go in the forward direction if 6.G is negative. This is possible if the term RT In ([products]/[reactants]) in E quation 1 3- 4 is negative and has a larger absolute value than 6.G'0. For example, the immediate removal of the products of a reaction can keep the ratio [products]/ [reactants] well below 1 , such that the term RT In ([products]/[reactants]) has a large, negative value. 6.G'0 and 6.G are expressions of the maximum amount of free energy that a given reaction can theoretically deliver-an amount of energy that could be realized only if a perfectly efficient device were available to trap or harness it. Given that no such device is possible (some energy is always lost to entropy during any process) , the amount of work done by the reaction at constant temperature and pressure is always less than the theoretical amount. Another important point is that some thermody­ namically favorable reactions (that is, reactions for which 6.G'0 is large and negative) do not occur at mea­ surable rates. For example, combustion of firewood to C02 and H20 is very favorable thermodynamically, but firewood remains stable for years because the activation energy (see Figs 6-2 and 6-3) for the combustion reac­ tion is higher than the energy available at room temper­ ature. If the necessary activation energy is provided (with a lighted match, for example) , combustion will be­ gin, converting the wood to the more stable products C02 and H2 0 and releasing energy as heat and light. The heat released by this exothermic reaction provides the activation energy for combustion of neighboring regions of the firewood; the process is self-perpetuating. In living cells, reactions that would be extremely slow if uncatalyzed are caused to proceed not by supplying additional heat but by lowering the activation energy through use of an enzyme. An enzyme provides an alter­ native reaction pathway with a lower activation energy than the uncatalyzed reaction, so that at room tempera­ ture a large fraction of the substrate molecules have enough thermal energy to overcome the activation barrier,

In the case of two sequential chemical reactions, A ;;===: B and B ;;===: C, each reaction has its own equilibrium con­ stant and each has its characteristic standard free­ energy change, 6.G]0 and 6.G'z0. As the two reactions are sequential, B cancels out to give the overall reaction A ;;===: C, which has its own equilibrium constant and thus its own standard free-energy change, 6.G��tal· The 6.G'0 values of sequential chemical reactions are additive. For the overall reaction A ;;===: C, 6.G��ta1 is the sum of the individual standard free-energy changes, 6.G]0and 6.Gz0, f of the two reactions: 6.G ��tal 6.0{0+ 6.Gt

(1) (2)

Sum:

=

A�C

This principle of bioenergetics explains how a thermody­ namically unfavorable (endergonic) reaction can be driven in the forward direction by coupling it to a highly exergonic reaction through a common intermediate. For example, the synthesis of glucose 6-phosphate is the first step in the utilization of glucose by many organisms:

13.8

Glucose + Pi � glucose 6-phosphate + H20 6.G'0

=

kJ/mol

The positive value of 6.0'0 predicts that under standard conditions the reaction will tend not to proceed sponta­ neously in the direction written. Another cellular reac­ tion, the hydrolysis of ATP to ADP and Pi, is very exergonic: 6.G'0

( 1) (2)

=

-30.5

kJ/mol

These two reactions share the common intermediates Pi and H20 and may be expressed as sequential reactions: Glucose + Pi � glucose 6-phosphate + H20 ATP + H20 � ADP + Pi

ATP + glucose � ADP + glucose 6-phosphate

Sum:

13.8

( -30.5

-16.7

The overall standard free-energy change is obtained by adding the 6.G'0 values for individual reactions: 6.G'0

=

kJ/mol +

kJ/mol)

=

kJ/mol

The overall reaction is exergonic. In this case, energy stored in ATP is used to drive the synthesis of glucose 6-phosphate, even though its formation from glucose and inorganic phosphate (Pi) is endergonic. The pathway of glucose 6-phosphate formation from glucose by phosphoryl transfer from ATP is different from reactions

1 3 .2

(1) and (2) above, but the net result is the same as the sum of the two reactions. In thermodynamic calcula­ tions, all that matters is the state of the system at the be­ ginning of the process and its state at the end; the route between the initial and final states is immaterial. We have said that /1G'0 is a way of expressing the equilibrium constant for a reaction. For reaction (1) above, K�q,

=

[glucose 6-phosphate] 3.9 X 10- M[glucose][P;] 3

=

1

Notice that H20 is not included in this expression, as its concentration (55.5 M) is assumed to remain unchanged by the reaction. The equilibrium constant for the hydro­ lysis of ATP is K'e q2

=

[ADP] [Pi] [ATPJ

=

20 .

X 105 M

[ADP] [Pi] [glucose 6-phosphate] ----:-::---:':=-: : :-:::-:::-c-: ---=[glucose] [Pi] [ATPJ (K�q )(K�q ) (3. 9 X 10- 3M- 1)(2 .0 7.8 X 102

The equilibrium constant for the two coupled reactions is K'eq,

=

=

=

1

2

=

X

105M)

This calculation illustrates an important point about equilibrium constants: although the !1G'0 values for two reactions that sum to a third, overall reaction are addi­ tive, the K�q for the overall reaction is the product of the individual K�q values for the two reactions. Equilib­ rium constants are multiplicative. By coupling ATP hy­ drolysis to glucose 6-phosphate synthesis, the K�q for formation of glucose 6-phosphate from glucose has been raised by a factor of about 2 x 1 05 . This common-intermediate strategy is employed by all living cells in the synthesis of metabolic intermediates and cellular components. Obviously, the strategy works only if compounds such as ATP are continuously avail­ able. In the following chapters we consider several of the most important cellular pathways for producing ATP.

S U M M A RY 1 3 . 1 •





Bioenergetics a n d Thermodynamics

Living cells constantly perform work. They require energy for maintaining their highly organized structures, synthesizing cellular components, generating electric currents, and many other processes. Bioenergetics is the quantitative study of energy relationships and energy conversions in biological systems. Biological energy transformations obey the laws of thermodynamics.

All

chemical reactions are influenced by two forces: the tendency to achieve the most stable bonding state (for which enthalpy, H, is a useful expression) and the tendency to achieve the highest degree of

Chem ical Logic a n d Co m m o n B iochemical Reactions

[495]

randomness, expressed as entropy, S. The net driving force in a reaction is /1G, the free-energy change, which represents the net effect of these two factors: /1G /1H - T!l.S. •







=

The standard transformed free-energy change, /1G'0, is a physical constant that is characteristic for a given reaction and can be calculated from the equilibrium constant for the reaction: /1G'0 -RT In K�q· =

The actual free-energy change, /1G, is a variable that depends on /1G'0 and on the concentrations of reactants and products: !1G !1G'0 + RT ln ([products]/[reactants] ) . =

When /1G is large and negative, the reaction tends to go in the forward direction; when /1G is large and positive, the reaction tends to go in the reverse direction; and when /1G = 0, the system is at equilibrium. The free-energy change for a reaction is independent of the pathway by which the reaction occurs. Free-energy changes are additive; the net chemical reaction that results from successive reactions sharing a common intermediate has an overall free-energy change that is the sum of the t::. G values for the individual reactions.

1 3 .2 Chemical Logic and Common Biochemical Reactions The biological energy transductions we are concerned with in this book are chemical reactions. Cellular chem­ istry does not encompass every kind of reaction learned in a typical organic chemistry course. Which reactions take place in biological systems and which do not is de­ termined by (1) their relevance to that particular meta­ bolic system and (2) their rates. Both considerations play major roles in shaping the metabolic pathways we consider throughout the rest of the book. A relevant re­ action is one that makes use of an available substrate and converts it to a useful product. However, even a po­ tentially relevant reaction may not occur. Some chemi­ cal transformations are too slow (have activation energies that are too high) to contribute to living sys­ tems even with the aid of powerful enzyme catalysts. The reactions that do occur in cells represent a toolbox that evolution has used to construct metabolic pathways that circumvent the "impossible" reactions. Learning to recognize the plausible reactions can be a great aid in developing a command of biochemistry. Even so, the number of metabolic transformations taking place in a typical cell can seem overwhelming. Most cells have the capacity to carry out thousands of specific, enzyme-catalyzed reactions: for example, trans­ formation of a simple nutrient such as glucose into amino acids, nucleotides, or lipids; extraction of energy from fu­ els by oxidation; and polymerization of monomeric sub­ units into macromolecules.

[49 6]

Bioenergetics a n d B iochemical Reaction Types

To study these reactions, some organization is es­ sential. There are patterns within the chemistry of life; you do not need to learn every individual reaction to comprehend the molecular logic of biochemistry. Most of the reactions in living cells fall into one of five general categories: ( 1 ) reactions that make or break carbon-carbon bonds; (2) internal rearrangements, iso­ merizations, and eliminations; (3) free-radical reactions; (4) group transfers; and (5) oxidation-reductions. We discuss each of these in more detail below and refer to some examples of each type in later chapters. Note that the five reaction types are not mutually exclusive; for example, an isomerization reaction may involve a free­ radical intermediate. Before proceeding, however, we should review two basic chemical principles. First, a covalent bond consists of a shared pair of electrons , and the bond can be broken in two general ways (Fig. 13-1 ) . In homolytic cleav­ age, each atom leaves the bond as a radical, carrying one unpaired electron. In heterolytic cleavage, which is more common, one atom retains both bonding elec­ trons. The species most often generated when C-C and C-H bonds are cleaved are illustrated in Figure 13-1 . Carbanions, carbocations, and hydride ions are highly unstable; this instability shapes the chemistry of these ions, as we shall see. The second basic principle is that many biochemical reactions involve interactions between nucleophiles Homolytic cleavage

I

-C-H

i

I I

H atom

I

I

I

I

1

I

I

I

I

-C :

I

+

Carbanion

I

-C-H

I

I

I

I

I

I

-c �

I

I

-c

I

Carbanion FIGURE 1 3-1

unprotonated hydroxyl

group or an ionized carboxylic acid)

/""' - s:

Negatively charged

carbonyl group (the

more electronegative

oxygen of the carbonyl group pulls electrons

away from the carbon)

" r:H+ C=, -

sulfhydryl

I

/ VI

r-­ -c:

H

I

Carbanion

-N1

/""'

Pronated imine group

(activated for nucleophilic

attack at the carbon by

Uncharged

protonation of the imine)

amine group

h

N

H NV

��

Carbon atom of a

cj/:R ru

o: )_

Imidazole

0

Phosphorus of

a phosphate group

/""'

H-OT

Hydroxide ion

FIGURE 1 3-2

Common nucleophiles and electrophiles in biochemi­

cal reactions.

Chemical reaction mechanisms, wh ich trace the for­

mation and breakage of covalent bonds, are communicated with dots

by dots (:) . Cu rved arrows ( r-- ) represent the movement of electron

a single-headed (fish hook-type) arrow is used (/""' ) . Most reaction

steps i nvolve an unshared e lectron pair.

H� Proton

+

Carbocation

- c - c- �

oxygen (as in an

pairs. For movement of a si ngle electron (as in a free rad ical reaction),

Carbon radicals

I

Negatively charged

c-

bonded electrons i mportant to the reaction mechanism are designated

- c - c- � - c · + · c -

I

-

ing." A covalent bond consists of a shared pai r of electrons. Non­

� -C ' + ' H

-C-H

(":R

/""' : -o

and cu rved arrows, a convention known informal ly as "electron push­

Carbon radical

Heterolytic cleavage

Electrophiles

Nucleophiles

+

H: Hydride

I

c-

1

Carbocation

Two mechanisms for cleavage of a C--C or C-H bond.

In a homolytic cleavage, each atom keeps one of the bonding electrons, resulting in the formation of carbon radicals (carbons having unpaired electrons) or uncharged hydrogen atoms. In a heterolytic c leavage, one of the atoms retains both bonding electrons. This can result i n the for­ mation of carbanions, carbocations, protons, or hydride ions.

(functional groups rich in and capable of donating elec­ trons) and electrophiles (electron-deficient functional groups that seek electrons) . Nucleophiles combine with and give up electrons to electrophiles. Common biological nucleophiles and electrophiles are shown in Figure 13-2 . Note that a carbon atom can act as either a nucleophile or an electrophile, depending on which bonds and functional groups surround it.

Reactions That Make or Break Carbon-Carbon Bonds Heterolytic cleavage of a C-C bond yields a carbanion and a carbocation (Fig. 1 3-1 ) . Con­ versely, the formation of a C-C bond involves the combination of a nucleophilic carbanion and an elec­ trophilic carbocation. Carbanions and carbocations are generally so unstable that their formation as reaction intermediates can be energetically inaccessible even with enzyme catalysts. For the purpose of cellular bio­ chemistry they are impossible reactions-unless chemical assistance is provided in the form of func­ tional groups containing electronegative atoms (0 and

Chem ica l log i c and Common Biochem ical Reactions

1 3 .2

N) that can alter the electronic structure of adjacent carbon atoms so as to stabilize and facilitate the forma­ tion of carbanion and carbocation intermediates. Carbonyl groups are particularly important in the chemical transformations of metabolic pathways. The car­ bon of a carbonyl group has a partial positive charge due to the electron-withdrawing property of the carbonyl oxy­ gen, and thus is an electrophilic carbon (Fig. 13-3a). A carbonyl group can thus facilitate the fonnation of a car­ banion on an adjoining carbon by delocalizing the carban­ ion's negative charge (Fig. 13- 3b) . An imine (C + NH2) group can serve a similar function (Fig. 13-3c). The ca­ pacity of carbonyl and imine groups to delocalize elec­ trons can be further enhanced by a general acid catalyst or by a metal ion such as Mg2+ (Fig. 13-3d; see also Figs 6-21 and 6-23). The importance of a carbonyl group is evident in three major classes of reactions in which C-C bonds are formed or broken (Fig. 13-4): aldol condensations , Claisen ester condensations , and decarboxylations. In each type of reaction, a carbanion intermediate is stabi­ lized by a carbonyl group, and in many cases another carbonyl provides the electrophile with which the nucle­ ophilic carbanion reacts. An aldol condensation is a common route to the formation of a C-C bond; the aldolase reaction, which converts a six-carbon compound to two three-carbon compounds in glycolysis, is an aldol condensation in re­ verse (see Fig. 14-5) . In a Claisen condensation, the carbanion is stabilized by the carbonyl of an adjacent thioester; an example is the synthesis of citrate in the cit­ ric acid cycle (see Fig. 16-9) . Decarboxylation also com­ monly involves the formation of a carbanion stabilized by a carbonyl group; the acetoacetate decarboxylase

o tu .e:.

o1

(b) - c - c =- � - c = c -

�NH2 11 .

-r; (c) -C- 1 I I

=-

I

NH2 I

1

I

� -C-C=C-

I

I

/ HA

(d)

o' II

-c-

FIGURE 1 3-3 Chemical properties of carbonyl groups. (a) The carbon atom of a carbonyl group is an electroph i le by v i rtue of the electron­ withdrawi n g capacity of the electronegative oxygen atom, which re­ sults in a resonance hybrid structure in which the carbon has a partial positive charge. (b) With i n a molecule, delocal ization of electrons i nto a carbonyl group stab i l i zes a carbanion on an adjacent carbon, fac i l itating its formation . (c) ! m i nes function m u ch l i ke carbonyl groups in faci l itating electron withd rawal . (d) Carbonyl groups do not a lways function alone; thei r capacity as electron s i nks often is aug­ mented by interaction with either a metal ion (Me2 + , such as Mg2 + ) or a general acid (HA).

H+

[497]

0 R.,' R R., R. II I " I '� II I ''"3 R -C-C : ......+ C 0 � R - C-C -C - O H I I I I I 0

H

H4 H Aldol condensation

O

II

H

I

HI

_

R1

1 (1!

CoA-S-C-C :......+ C - 0

I �

O H

II

H+



R.

I

0

II

HI �

..

0

I

H+

__L__.

11

CoA-S-C-C - C - OH

I

H

Claisen ester condensation

R -C- -C II'\

R

I �

0 H

II

I

R-C - C - H + CO2

I

o H H Decarboxylation of a /3-keto acid

F IGURE 13-4 Some common reactions that form and break C-C bonds in biological systems. For both the aldol condensation and the

Cla isen condensation, a carbanion serves as nucleophile and the car­ bon of a carbonyl group serves as electroph i le. The carbanion is stabi­ l ized in each case by another carbonyl at the adjoi n i ng carbon. In the decarboxylation reaction, a carban ion is formed on the carbon shaded b l ue as the C02 leaves. The reaction would not occur at an apprecia­

ble rate without the stabi l izing effect of the carbonyl adjacent to the carbanion carbon. Wherever a carbanion is shown, a stab i l izing reso­ nance with the adjacent carbonyl, as shown in Figure 1 3-3 b, is as­ sumed. An i m i ne ( Fig. 1 3-3c) or other electron-withdrawing group (including certai n enzymatic cofactors such as pyridoxal) can replace the carbonyl group in the stab i l i zation of carbanions.

reaction that occurs in the formation of ketone bodies during fatty acid catabolism provides an example (see Fig. 1 7-18) . Entire metabolic pathways are organized around the introduction of a carbonyl group in a particu­ lar location so that a nearby carbon-carbon bond can be formed or cleaved. In some reactions, an imine or a spe­ cialized cofactor such as pyridoxal phosphate plays the electron-withdrawing role of the carbonyl group. The carbocation intermediate occurring in some re­ actions that form or cleave C-C bonds is generated by the elimination of a very good leaving group, such as py­ rophosphate (see Group Transfer Reactions below) . An example is the prenyltransferase reaction (Fig. 13-5 ) , an early step in the pathway of cholesterol biosynthesis. Internal Rearrangements, lsomerizations, and Eliminations Another common type of cellular reac­ tion is an intramolecular rearrangement in which redis­ tribution of electrons results in alterations of many different types without a change in the overall oxidation state of the molecule . For example, different groups in a molecule may undergo oxidation-reduction, with no net change in oxidation state of the molecule; groups at a double bond may undergo a cis-trans rearrangement; or the positions of double bonds may be transposed. An ex­ ample of an isomerization entailing oxidation-reduction is the formation of fructose 6-phosphate from glucose

L498]

Bioen ergetics a n d Biochemical Rea ction Types

CH Hz I 0 0 I I /c,C4'c,CH3 -o - P-0P-0 H I I oo-

6-phosphate in glycolysis (Fig. 1 3-6 ; this reaction is discussed in detail in Chapter 1 4) : C-1 is reduced (alde­ hyde to alcohol) and C-2 is oxidized (alcohol to ketone) . Figure 1 3-6b shows the details of the electron move­ ments in this type of isomerization. A cis-trans re­ arrangement is illustrated by the prolyl cis-trans isomerase reaction in the folding of certain proteins (see Fig. 4-7b) . A simple transposition of a C = C bond oc­ curs during metabolism of oleic acid, a common fatty acid (see Fig. 1 7-9) . Some spectacular examples of double-bond repositioning occur in the biosynthesis of cholesterol (see Fig. 2 1-33) . An example of an elimination reaction that does not affect overall oxidation state is the loss of water from an alcohol, resulting in the introduction of a C=C bond:

a

Dirnethyiallyi pyrophosphate

Isopente nyl pyTophosphate

PP;

CH3 H I CHr_,_c2 '-�4'c'-CH3 o o /CH 2 ...-.:: CI � -o - Pl - 0 - PI - 0 /C ' CH I I '( o - o- H H 2

Isopentenyl pyrophosphate

�w

I

H H

� �

Dimethylallylic carbocation

HI OH

� � -o -�P - 0-P-0 I Ioo F I G U R E 1 3 - 5 Carbocations in carbon-carbon bond formation. I n p renyl transferase catal yzes condensation of i sopentenyl py­ rophosphate and d i methy l a l l y l pyrophosph ate to form geranyl py­ is

i n iti ated by

e l i m i nation of pyrophosphate from the d i m ethy l a l l y l pyrophos­ p h ate to generate a carbocat ion, sta b i l i zed by reson ance with the adjacent C=C bond.

(a)

/ ' c=C

1 � H/

H 20

"-

R1

Free-Radical Reactions Once thought to be rare, the homolytic cleavage of covalent bonds to generate free radicals has now been found in a wide range of biochem­ ical processes. These include: isomerizations that make use of adenosylcobalarnin (vitamin B12) or S-adenosyl­ methionine, which are initiated with a 5'-deoxyadenosyl radical (see the methylrnalonyl-CoA mutase reaction in Box 1 7-2) ; certain radical-initiated decarboxylation re­ actions (Fig. 13-7) ; some reductase reactions, such as that catalyzed by ribonucleotide reductase (see Fig. 22-4 1 ) ; and some rearrangement reactions, such as that catalyzed by DNA photolyase (see Fig. 25-27) .

o n e o f t h e early steps i n chol esterol b i osynthes i s, the enzyme

F i g . 2 1 -3 6 ) . The reaction

H

R

Similar reactions can result from eliminations in arnines.

Geranyt pyrophosphate

rophosphate (see

H 20

R - - -R ____1__.

I

I I

H OHH H H oH OHH H H 0 I I I I I 1 2 2 H-� -?- ? -? -? -? -o-r - o - ;:::::=== H- ? -� -?I - ?- ?- ?I -o-rI - o OH 0 H OHOHH 0 o OH H OHOHH 0 1

pJw,p holw." '''

Glucose 6-phosphate

/:

(b)

")I

H

r,l -C-

-C 0 OH H I

Bz

G) @ @

l " OII I l'l'a:- t

B1 abstracts a proton. This allows the formation of a C = C double bond

Electrons from carbonyl form an 0-H bond with the hydrogen ion donated by B2•

FIGURE 1 3 - 6 Isomerization and elimination reactions. (a) The con­

1

Fructose 6-phosphate

�y H @

I

} dJH H -C=C-

.

Bz ·

J

An electron pair is displaced from the C = C bond to form a C - H bond with the proton donated by B1•

@

H I

-C-C-

----.

I OH 0I

B2 abstracts a proton, allowing the formation of a C = O bond.

Enediol intermediate

version of gl ucose 6-phosphate to fructose 6-phosphate, a reaction of

follow the path of oxidation from left to right. B 1 and B2 are ionizable groups on the enzyme; they are capable of donati ng and accepti ng

sugar metabolism catalyzed by phosphohexose isomerase. (b) Th i s

protons (acti ng as general acids or general bases) as the reaction pro­

reaction proceeds through an enediol intermediate. The curved b l ue

ceeds. P i n k screens i ndicate nucleophi l ic groups; b l ue, electroph i l ic.

arrows represent movement of bonding electron pairs. Pink screens

1 3 .2

ooc

Chem ical Logic a n d Common Biochemical Reactions

[499]

ooc

-x·� H�"'

a,c-r

CH3-C

Acetate

stabilization

Molecular Biology, 3rd edn (Fasman, G.D., ed.), Physical and Chemical Data, Vol. 1, pp.

.fo

on

o·'

Source: Data mostly from Jencks, W.P. (1976) in Handbook of Biochemistry and

I Thio

·

gen atom in oxygen esters. The complete structure of coenzyme A (CoA, or CoASH) is shown in Figure 8-3 8.

are resonance-stabilized, is greater for thioesters than for comparable oxygen esters (Fig. 1 3-1 7) . In both cases, hydrolysis of the ester generates a carboxylic acid, which can ionize and assume several resonance forms. Together, these factors result in the large, nega­ tive !::. G '0 ( - 3 1 .4 kJ/mol) for acetyl-GoA hydrolysis. To summarize, for hydrolysis reactions with large, negative, standard free-energy changes, the products are more stable than the reactants for one or more of the following reasons: (1) the bond strain in reactants due to electrostatic repulsion is relieved by charge separation, as for ATP; (2) the products are stabilized by ionization, as for ATP, acyl phosphates, and thioesters; (3) the prod­ ucts are stabilized by isomerization (tautomerization) , as

I

.' - R resonance

FIGURE 1 3-17 Free energy of hydrolysis for

stabilization

.!0 for thioester hydrolysis

0 -R I!.G for oxygen

ester hydrolysis

thioesters and oxygen esters. The products of

both types of hydrolysis reaction have about the same free-energy content (C), but the thioester has a higher free-energy content than the oxygen

ester. Orbital overlap between the 0 and C atoms + R-SH

+ R-OH

a l lows resonance stabilization in oxygen esters; orbital overlap between 5 and C atoms is poorer and provides l ittle resonance stabi l ization.

[soo]

Bioen ergetics a n d Biochemical Reaction Types

for PEP; and/or (4) the products are stabilized by reso­ nance, as for creatine released from phosphocreatine, carboxylate ion released from acyl phosphates and thioesters, and phosphate (Pi) released from anhydride or ester linkages. ATP Provides Energy by Group Transfers, Not by Simple Hydrolysis

Throughout this book you will encounter reactions or processes for which ATP supplies energy, and the con­ tribution of ATP to these reactions is commonly indi­ cated as in Figure 1 3-18a, with a single arrow showing the conversion of ATP to ADP and Pi (or, in some cases, of ATP to AMP and pyrophosphate, PP;) . When written this way, these reactions of ATP seem to be simple hy­ drolysis reactions in which water displaces Pi (or PPi) , and one is tempted to say that an ATP-dependent reac­ tion is "driven by the hydrolysis of ATP." This is not the case. ATP hydrolysis per se usually accomplishes noth­ ing but the liberation of heat, which cannot drive a chemical process in an isothermal system. A single re­ action arrow such as that in Figure 1 3-1 8a almost in­ variably represents a two-step process (Fig. 13-18b) in which part of the ATP molecule, a phosphoryl or (a) Written as a one-step reaction

� _/

ATP + 1\ti a

ADP + P.

+

coo­

I

H3N-CH I CH2 I CH2 I

c � " 0 NH2

Glutamate



Glutamine

c oo -

H8N-6R j

CHl!

I

CH2

)

, o�

o / 0

®

pI

.. P p9'

0

Enzyme-bound glutamyl phosphate

(b) Actual two-step reaction FIGURE 1 3-18 ATP hydrolysis in two steps. (a) The contribution of ATP to a reaction is often shown as a s i ngle step, but is a l most always a two­ step process. (b) Shown here is the reaction catalyzed by ATP-dependent gl utamine synthetase. to gl utamate, then released as P,.

(X)

CD

A phosphoryl group is transferred from ATP

the phosphoryl group is displaced by N H 3 and

pyrophosphoryl group or the adenylate moiety (AMP) , is first transferred to a substrate molecule or to an amino acid residue in an enzyme, becoming covalently attached to the substrate or the enzyme and raising its free-energy content. Then, in a second step, the phos­ phate-containing moiety transferred in the first step is displaced, generating Pi, PPi, or AMP. Thus ATP partic­ ipates covalently in the enzyme-catalyzed reaction to which it contributes free energy. Some processes do involve direct hydrolysis of ATP (or GTP) , however. For example, noncovalent binding of ATP (or GTP) , followed by its hydrolysis to ADP (or GDP) and Pi, can provide the energy to cycle some pro­ teins between two conformations, producing mechani­ cal motion. This occurs in muscle contraction (see Fig. 5-31), and in the movement of enzymes along DNA (see Fig. 25-35) or of ribosomes along messenger RNA (see Fig. 27-30) . The energy-dependent reactions cat­ alyzed by helicases, RecA protein, and some topoiso­ rnerases (Chapter 25) also involve direct hydrolysis of phosphoanhydride bonds. The AAA + ATPases involved in DNA replication and other processes described in Chapter 25 use ATP hydrolysis to cycle associated pro­ teins between active and inactive forms. GTP-binding proteins that act in signaling pathways directly hy­ drolyze GTP to drive conformational changes that termi­ nate signals triggered by hormones or by other extracellular factors (Chapter 1 2) . The phosphate compounds found in living organisms can be divided somewhat arbitrarily into two groups, based on their standard free energies of hydrolysis (Fig. 1 3-19). "High-energy" compounds have a 6.G'0 of hydrolysis more negative than - 25 kJ/rnol; "low-energy" compounds have a less negative 6.G'0. Based on this cri­ terion, ATP, with a 6.G'0 of hydrolysis of -30.5 kJ/rnol ( - 7.3 kcal/rnol) , is a high-energy compound; glucose 6-phosphate, with a 6.G'0 of hydrolysis of - 13.8 kJ/rnol ( -3.3 kcallrnol) , is a low-energy compound. The term "high-energy phosphate bond," long used by biochemists to describe the P-0 bond broken in hydrolysis reactions, is incorrect and misleading as it wrongly suggests that the bond itself contains the en­ ergy. In fact, the breaking of all chemical bonds re­ quires an input of energy. The free energy released by hydrolysis of phosphate compounds does not come from the specific bond that is broken; it results from the products of the reaction having a lower free-energy content than the reactants. For simplicity, we will sometimes use the term "high-energy phosphate corn­ pound" when referring to ATP or other phosphate compounds with a large, negative, standard free en­ ergy of hydrolysis. As is evident from the additivity of free-energy changes of sequential reactions (see Section 13.1), any phosphorylated compound can be synthesized by cou­ pling the synthesis to the breakdown of another phos­ phorylated compound with a more negative free energy of hydrolysis. For example, because cleavage of Pi from

1 3 .3 Phosphoryl Group Transfers a n d AlP

- 70

-60

- 50

coo-

-

3

0

II

CH2

0- P 0 � / c

I

HOH

1,3-Bisphosphoglycerate y

CH2-0

- 40

-

l

C-0- P •

--®

Phosphoenolpyruvate



":

I Adenine � P

-J Creatine '

/Phosphocreatine p

Glucose 6p

I

Glycerol-

P

Sum:

from high-energy phosphoryl group

cose and glycerol) to form their low-energy phos­ phate derivatives. This flow of phosphoryl groups, catalyzed by kinases, proceeds with an overal l loss of free energy under i ntrace l l u lar conditions. Hy­ drolysis of low-energy phosphate compounds re­ leases P;, which has an even lower phosphoryl group transfer potential (as defined in the text).

1

L

PEP ------+ pyruvate Pi -61.9 ADP + Pi ------+ ATP +30.5 PEP + ADP ------+ pyruvate + ATP - 1 + H20

®,

compounds

phosphoenolpyruvate releases more energy than is needed to drive the condensation of Pi with ADP, the di­ rect donation of a phosphoryl group from PEP to ADP is thermodynamically feasible:

(1) (2)

sented by

donors via ATP to acceptor molecules (such as glu­

/

-w

0

This shows the flow of phosphoryl groups, repre­

Lo w -energy

J

p

FIGURE 1 3 - 1 9 Ranking of biological phosphate compounds by standard free energies of hydrolysis.

High-energy compounds

ATP

- 20

[s o7]

+ H20

+

3 4 .

Notice that while the overall reaction is represented as the algebraic sum of the first two reactions, the overall reaction is actually a third, distinct reaction that does not involve Pi; PEP donates a phosphoryl group di­ rectly to ADP. We can describe phosphorylated com­ pounds as having a high or low phosphoryl group transfer potential, on the basis of their standard free en­ ergies of hydrolysis (as listed in Table 13-6). The phos­ phoryl group transfer potential of PEP is very high, that of ATP is high, and that of glucose 6-phosphate is low (Fig. 13-19) . Much of catabolism is directed toward the synthesis of high-energy phosphate compounds, but their forma­ tion is not an end in itself; they are the means of activat­ ing a very wide variety of compounds for further chemical transformation. The transfer of a phosphoryl group to a compound effectively puts free energy into that compound, so that it has more free energy to give up during subsequent metabolic transformations. We described above how the synthesis of glucose 6-phos­ phate is accomplished by phosphoryl group transfer from ATP. In the next chapter we see how this phospho­ rylation of glucose activates, or "primes," the glucose for catabolic reactions that occur in nearly every living cell. Because of its intermediate position on the scale of

group transfer potential, ATP can carry energy from high-energy phosphate compounds produced by catabo­ lism to compounds such as glucose, converting them into more reactive species. ATP thus serves as the uni­ versal energy currency in all living cells. One more chemical feature of ATP is crucial to its role in metabolism: although in aqueous solution ATP is thermodynamically unstable and is therefore a good phosphoryl group donor, it is kinetically stable. Because of the huge activation energies (200 to 400 kJ/mol) re­ quired for uncatalyzed cleavage of its phosphoanhy­ dride bonds, ATP does not spontaneously donate phosphoryl groups to water or to the hundreds of other potential acceptors in the cell. Only when specific en­ zymes are present to lower the energy of activation does phosphoryl group transfer from ATP proceed. The cell is therefore able to regulate the disposition of the energy carried by ATP by regulating the various enzymes that act on it. ATP Donates Phosphoryl, Pyrophosphoryl, and Adenylyl G roups

The reactions of ATP are generally SN2 nucleophilic displacements (see Section 13.2) in which the nucle­ ophile may be, for example, the oxygen of an alcohol or carboxylate, or a nitrogen of creatine or of the side chain of arginine or histidine. Each of the three phos­ phates of ATP is susceptible to nucleophilic attack (Fig. 13-20) , and each position of attack yields a dif­ ferent type of product. Nucleophilic attack by an alcohol on the 'Y phosphate (Fig. 13-20a) displaces ADP and produces a new phos­ phate ester. Studies with 1 8 0-labeled reactants have shown that the bridge oxygen in the new compound is

[sos]

Bioene rgetics a n d Biochemical Reaction Types

FIGURE 1 3-20 Nucleophilic displacement reactions of

ATP. Any of the three P atoms (a,

(3, or y) may serve as the

Three positions on ATP for attack by the nucleophile R180

may be an alcohol (ROH), a carboxyl group ( RCOO - ), or phate, for examp le)_ (a) When the oxygen of the nuc leo­ phile attacks the y position, the bri dge oxygen of the product is labeled, i n dicating that the group transferred (-OPO� -) . (b) Attack on the

(3 position displaces AMP

and leads to the transfer of a pyrophosphoryl (not py­ rophosphate) group to the nucleophile. (c) Attack on the

a

position displaces PP; and transfers the adenylyl group

to the nucleophi le.

(3

0

0

(b r:

0

a phosphoanhydride (a nuc leoside mono- or di phos­

from ATP is a phosphoryl (-PO� - ), not a phosphate

II

II

'Y

electrophilic target for nucleop h i l i c attack-in this case, by the labeled nuc leoph i l e R- 1 8 0:. The n uc l eoph i le

II

0

+

/

R 1 "0 - P -o-

I

o-

p

1

II

0

+

II

0

R 1 RO - P - O -P - O

I

o-

o-

II

0

+

R1HO - P-0

I



-

Rib H Adenine

o-

ADP

AMP

PP;

Phosphoryl transfer

Pyrophosphoryl transfer

Adenylyl transfer

(a)

(b)

(c)

derived from the alcohol, not from ATP; the group trans­ ferred from ATP is therefore a phosphoryl (-Po§ - ) , not a phosphate (- OPO§ - ) . Phosphoryl group transfer from ATP to glutamate (Fig. 13-18) or to glucose (p. 2 1 2) in­ volves attack at the I' position of the ATP molecule. Attack at the {3 phosphate of ATP displaces AMP and transfers a pyrophosphoryl (not pyrophosphate) group to the attacking nucleophile (Fig. 13-20b) . For example, the formation of 5-phosphoribosyl-1 -pyrophosphate (p. 861 ) , a key intermediate in nucleotide synthesis, results from attack of an -OH of the ribose on the {3 phosphate. Nucleophilic attack at the a position of ATP dis­ places PPi and transfers adenylate (5' -AMP) as an adenylyl group (Fig. 1 3-20c) ; the reaction is an adeny­ lylation (a-den ' -i-li-la'-shun, one of the most ungainly words in the biochemical language) . Notice that hydro­ lysis of the a-{3 phosphoanhydride bond releases con­ siderably more energy ( -46 kJ/mol) than hydrolysis of the {3-!' bond ( -31 kJ/mol) (Table 13-6). Furthermore, the PPi formed as a byproduct of the adenylylation is hy­ drolyzed to two Pi by the ubiquitous enzyme inorganic pyrophosphatase, releasing 1 9 kJ/mol and thereby providing a further energy "push" for the adenylylation reaction. In effect, both phosphoanhydride bonds of ATP are split in the overall reaction. Adenylylation reac­ tions are therefore thermodynamically very favorable. When the energy of ATP is used to drive a particularly unfavorable metabolic reaction, adenylylation is often the mechanism of energy coupling. Fatty acid activation is a good example of this energy-coupling strategy. The first step in the activation of a fatty acid­ either for energy-yielding oxidation or for use in the synthesis of more complex lipids-is the formation of its thiol ester (see Fig. 1 7-5) . The direct condensation of a fatty acid with coenzyme A is endergonic, but the formation of fatty acyl-CoA is made exergonic by step­ wise removal of two phosphoryl groups from ATP. First, adenylate (AMP) is transferred from ATP to the carboxyl group of the fatty acid, forming a mixed anhy-

� ·

dride (fatty acyl adenylate) and liberating PPi. The thiol group of coenzyme A then displaces the adenylyl group and forms a thioester with the fatty acid. The sum of these two reactions is energetically equivalent to the exergonic hydrolysis of ATP to AMP and PPi (!J.G ' 0 = - 45.6 kJ/mol) and the endergonic formation of fatty acyl-CoA (!J.G '0 = 3 1 .4 kJ/mol) . The formation of fatty acyl-CoA is made energetically favorable by hydrolysis of the PPi by inorganic pyrophosphatase. Thus, in the activation of a fatty acid, both phosphoan­ hydride bonds of ATP are broken. The resulting !J.G'o is the sum of the !J.G '0 values for the breakage of these bonds, or -45.6 kJ/mol + ( -19 .2) kJ/mol: t:.. G ' 0

= -64. 8 kJ/mol

The activation of amino acids before their polymer­ ization into proteins (see Fig. 27- 1 9) is accomplished by an analogous set of reactions in which a transfer RNA molecule takes the place of coenzyme A. An interesting use of the cleavage of ATP to AMP and PPi occurs in the firefly, which uses ATP as an energy source to produce light flashes (Box 1 3-1 ) . Assembly of I nformational Macromolecules Requires Energy

When simple precursors are assembled into high molec­ ular weight polymers with defined sequences (DNA, RNA, proteins) , as described in detail in Part III, energy is required both for the condensation of monomeric units and for the creation of ordered sequences. The precursors for DNA and RNA synthesis are nucleoside triphosphates, and polymerization is accompanied by cleavage of the phosphoanhydride linkage between the a and {3 phosphates, with the release of PPi (Fig. 13-20) . The moieties transferred to the growing polymer in these reactions are adenylate (AMP) , guanylate (GMP) , cytidylate (CMP) , or uridylate (UMP) for RNA synthe­ sis, and their deoxy analogs (with TMP in place of UMP)

1 3 . 3 Phosphoryl Group Transfers a n d ATP

BOX 1 3-1

[so9]

F i refly F l a s h e s · G l owing Reports of ATP

�------� L-

-------------� ---� � �

Bioluminescence requires considerable amounts of en­

ferin. This process is accompanied by emission of light.

ergy. In the firefly, ATP is used in a set of reactions that

The color of the light flash differs with the firefly species

converts chemical energy into light energy. In the 1 950s,

and seems to be determined by differences in the struc­

from many thousands of fireflies collected by children in

ture of the luciferase . Luciferin is regenerated from oxy­

and around Baltimore, William McElroy and his col­

luciferin in a subsequent series of reactions.

leagues at The Johns Hopkins University isolated the

In the laboratory, pure firefly luciferin and luciferase

principal biochemical components: luciferin, a complex

are used to measure minute quantities of ATP by the in­

carboxylic acid, and luciferase , an enzyme. The genera­

tensity of the light flash produced. As little as a few pica­ 12 moles ( 1 0 - mol) of ATP can be measured in this way.

tion of a light flash requires activation of luciferin by an enzymatic reaction involving pyrophosphate cleavage of

An enlightening extension of the studies in luciferase

ATP to form luciferyl adenylate (Fig. 1 ) . In the presence

was the cloning of the luciferase gene into tobacco

of molecular oxygen and luciferase, the luciferin under­

plants. When watered with a solution containing lu­

goes a multistep oxidative decarboxylation to oxyluci-

ciferin, the plants glowed in the dark (see Fig. 9-29) .

I C-0-P-O-j Rib H Adenine [ � X . H 0I 0II HO�S S H Luciferyl adenylate a

o-

1

AMP

ATP

The firefly, a beetle of the Lampyridae fam i ly.

�X HO�S S Luciferin

H

C02 + AMP

H

regen rating

FIGURE 1 I mportant components i n the firefly biolumi nescence cycle.

reattiona



�N>- J I

111!11 �

__ ___

C H3

R'

(TPP) (Fig. 14-14 ), a coenzyme derived from vitamin

B1. Lack of vitamin B1 in the human diet leads to the con­ dition known as beriberi, characterized by an accumula­ tion of body fluids (swelling) , pain, paralysis, and ultimately death. • Thiamine pyrophosphate plays an important role in the cleavage of bonds adjacent to a carbonyl group, such as the decarboxylation of a-keto acids, and in chemical rearrangements in which an activated acetaldehyde group is transferred from one carbon atom to another (Table 14-1) . The functional part of TPP, the thiazolium ring, has a relatively acidic proton at C-2. Loss of this proton produces a carbanion that is the active species in

TPP-dependent reactions (Fig. 14-14) . The carbanion readily adds to carbonyl groups, and the thiazolium ring is thereby positioned to act as an "electron sink" that greatly facilitates reactions such as the decarboxylation catalyzed by pyruvate decarboxylase. Fermentations Are Used to Produce Some Common Foods and Industrial Chemicals

Our progenitors learned millennia ago to use fermenta­ tion in the production and preservation of foods. Certain microorganisms present in raw food products ferment the carbohydrates and yield metabolic products that give the foods their characteristic forms, textures, and tastes. Yogurt, already known in Biblical times, is pro­ duced when the bacterium Lactobacillus bulgaricus ferments the carbohydrate in milk, producing lactic acid; the resulting drop in pH causes the milk proteins to precipitate, producing the thick texture and sour taste

1 4.4 G l u coneogenesis

TA B L E 1 4-1

0II

Enzyme

Pathway(s)

Bond cleaved

Pyruvate decarboxylase

Ethanol fermentation

R1 - - c 0

Synthesis of acetyl-GoA Citric acid cycle

Transketolase

Carbon-assimilation reactions Pentose phosphate pathway

propionic acid and C02 ; the propionic acid precipitates milk proteins, and bubbles of C02 cause the holes char­ acteristic of Swiss cheese. Many other food products are the result of fermentations: pickles, sauerkraut, sausage, soy sauce, and a variety of national favorites, such as kimchi (Korea) , tempoyak (Indonesia) , kefir (Russia) , dahi (India) , and pozol (Mexico) . The drop in pH associ­ ated with fermentation also helps to preserve foods, be­ cause most of the microorganisms that cause food spoilage cannot grow at low pH. In agriculture, plant byproducts such as corn stalks are preserved for use as animal feed by packing them into a large container (a silo) with limited access to air; microbial fermentation produces acids that lower the pH. The silage that results from this fermentation process can be kept as animal feed for long periods without spoilage. In 1 9 1 0 Chaim Weizmann (later to become the first president of Israel) discovered that the bac­ terium Clostridium acetobutyricum ferments starch to butanol and acetone. This discovery opened the field of industrial fermentations , in which some read­ ily available material rich in carbohydrate (corn starch or molasses, for example) is supplied to a pure culture of a specific microorganism, which ferments it into a product of greater commercial value. The ethanol used to make "gasohol" is produced by micro­ bial fermentation, as are formic, acetic, propionic, bu­ tyric, and succinic acids, and glycerol, methanol, isopropanol, butanol, and butanediol. These fermen­ tations are generally carried out in huge closed vats in which temperature and access to air are controlled to favor the multiplication of the desired microorganism and to exclude contaminating organisms. The beauty of industrial fermentations is that complicated, multi­ step chemical transformations are carried out in high yields and with few side products by chemical facto­ ries that reproduce themselves-microbial cells. For some industrial fermentations , technology has been

o-

4-o

II

Pyruvate dehydrogenase a - Ketoglutarate dehydrogenase

of unsweetened yogurt. Another bacterium, Propioni­ bacterium jreudenreichii, ferments milk to produce

�o

"o -

R2-C -C

0 OH II

H I

R3-C -C -R4

I

[ss1]

Bond formed / p R1- C,:r

'H

/ p R2- C,:r " S-CoA

0 OH II

H I

R3-C -C-R5

I

developed to immobilize the cells in an inert support, to pass the starting material continuously through the bed of immobilized cells, and to collect the desired product in the effluent-an engineer's dream! S U M M A RV 1 4 . 3







Fates of Pyru vate u n d e r A n a e ro b i c Co n d it i o n s : F e r m e n ta t i o n

The NADH formed in glycolysis must be recycled to regenerate NAD + , which is required as an electron acceptor in the first step of the payoff phase. Under aerobic conditions, electrons pass from NADH to 02 in mitochondrial respiration. Under anaerobic or hypoxic conditions, many organisms regenerate NAD+ by transferring electrons from NADH to pyruvate, forming lactate. Other organisms, such as yeast, regenerate NAD + by reducing pyruvate to ethanol and C02 . In these anaerobic processes (fermentations) , there is no net oxidation or reduction of the carbons of glucose. A variety of microorganisms can ferment sugar in fresh foods, resulting in changes in pH, taste, and texture, and preserving food from spoilage. Fermen­ tations are used in industry to produce a wide variety of commercially valuable organic compounds from inexpensive starting materials.

1 4.4 Gluconeogenesis The central role of glucose in metabolism arose early in evolution, and this sugar remains the nearly universal fuel and building block in modern organisms, from mi­ crobes to humans. In mammals, some tissues depend almost completely on glucose for their metabolic energy. For the human brain and nervous system, as well as the erythrocytes, testes, renal medulla, and embryonic tis­ sues, glucose from the blood is the sole or major fuel source. The brain alone requires about 120 g of glucose

[ss2]

Glycolysis, G l uconeogen esis, a n d t h e Pentose P h osphate Pathway

each day-more than half of all the glucose stored as glycogen in muscle and liver. However, the supply of glu­ cose from these stores is not always sufficient; between meals and during longer fasts, or after vigorous exercise, glycogen is depleted. For these times, organisms need a method for synthesizing glucose from noncarbohydrate precursors. This is accomplished by a pathway called gluconeogenesis ("new formation of sugar") , which converts pyruvate and related three- and four-carbon compounds to glucose. Gluconeogenesis occurs in all animals, plants , fungi, and microorganisms. The reactions are essen­ tially the same in all tissues and all species. The impor­ tant precursors of glucose in animals are three-carbon compounds such as lactate, pyruvate, and glycerol, as well as certain amino acids (Fig. 1 4-1 5 ) . In mammals,

Blood glucose

GlycoproLeins

Other monosaccharides

Sucrose

Glucose 6-phosphate Animals

Plants

� ;!� } ( �� Pyruvate Glucogenic Glycerol c

e

i

Lactate

amino acids

i

Triacyl­ glycerols

l

3-Phospho­ glycerate C02 fixation

FIGURE 1 4- 1 5 Carbohydrate synthesis from simple precursors. The pathway from phosphoenolpyruvate to gl ucose 6-phosphate is common to the b iosynthetic conversion of many different precursors of carbohy­ drates in a n i mals and plants. The path from pyruvate to phospho­ enolpyruvate leads through oxaloacetate, an intermediate of the citric acid cycle, which we discuss i n Chapter 1 6. Any compound that can be converted to either pyruvate or oxaloacetate can therefore serve as start­ i ng material for gluconeogenesis. This incl udes alanine and aspartate, which are convertible to pyruvate and oxaloacetate, respectively, and other amino acids that can also yield th ree- or four-carbon fragments, the so-called glucogenic amino acids (Table 1 4-4; see also Fig. 1 8-1 5). Plants and photosynthetic bacteria are uniquely able to convert C02 to carbohydrates, using the glyoxylate cycle (p. 639).

gluconeogenesis takes place mainly in the liver, and to a lesser extent in renal cortex and in the epithelial cells that line the inside of the small intestine. The glu­ cose produced passes into the blood to supply other tissues. After vigorous exercise, lactate produced by anaerobic glycolysis in skeletal muscle returns to the liver and is converted to glucose, which moves back to muscle and is converted to glycogen-a circuit called the Cori cycle (Box 1 4-2; see also Fig. 23-20) . In plant seedlings, stored fats and proteins are converted, via paths that include gluconeogenesis, to the disaccha­ ride sucrose for transport throughout the developing plant. Glucose and its derivatives are precursors for the synthesis of plant cell walls, nucleotides and coen­ zymes, and a variety of other essential metabolites. In many microorganisms, gluconeogenesis starts from simple organic compounds of two or three carbons, such as acetate, lactate, and propionate, in their growth medium. Although the reactions of gluconeogenesis are the same in all organisms, the metabolic context and the regulation of the pathway differ from one species to an­ other and from tissue to tissue. In this section we focus on gluconeogenesis as it occurs in the mammalian liver. In Chapter 20 we show how photosynthetic organisms use this pathway to convert the primary products of photosynthesis into glucose, to be stored as sucrose or starch. Gluconeogenesis and glycolysis are not identical pathways running in opposite directions, although they do share several steps (Fig. 1 4-16) ; 7 of the 1 0 enzymatic reactions of gluconeogenesis are the re­ verse of glycolytic reactions. However, three reactions of glycolysis are essentially irreversible in vivo and cannot be used in gluconeogenesis: the conversion of glucose to glucose 6-phosphate by hexokinase, the phosphorylation of fructose 6-phosphate to fructose 1 ,6-bisphosphate by phosphofructokinase- ! , and the conversion of phosphoenolpyruvate to pyruvate by pyruvate kinase (Fig. 14- 16) . In cells, these three re­ actions are characterized by a large negative free-en­ ergy change, whereas other glycolytic reactions have a !1G near 0 (Table 1 4-2) . In gluconeogenesis, the three irreversible steps are bypassed by a separate set of en­ zymes, catalyzing reactions that are sufficiently exer­ gonic to be effectively irreversible in the direction of glucose synthesis. Thus, both glycolysis and gluconeo­ genesis are irreversible processes in cells. In animals, both pathways occur largely in the cytosol, necessitat­ ing their reciprocal and coordinated regulation. Sepa­ rate regulation of the two pathways is brought about through controls exerted on the enzymatic steps unique to each. We begin by considering the three bypass reac­ tions of gluconeogenesis. (Keep in mind that "bypass" refers throughout to the bypass of irreversible glyco­ lytic reactions.)

1 4.4 G l u coneo g enesis

[s53]

TAB L E 1 4-2 !:lG'0 (kJ/mol) !:lG (kJ/mol)

Glycolytic reaction step CD Glucose + ATP � glucose 6-phosphate + ADP

@ Glucose 6-phosphate ==== fructose 6-phosphate @ Fructose 6-phosphate + ATP � fructose 1 ,6-bisphosphate + ADP @ Fructose 1 ,6-bisphosphate ==== dihydroxyacetone phosphate + glyceraldehyde 3-phosphate

® Dihydroxyacetone phosphate ==== glyceraldehyde 3-phosphate @ Glyceraldehyde 3-phosphate + Pi + NAD+ ==== 1 ,3-bisphosphoglycerate + NADH + H+ (j) 1 ,3-Bisphosphoglycerate + ADP ==== 3-phosphoglycerate + ATP @ 3-Phosphoglycerate ==== 2-phosphoglycerate ® 2-Phosphoglycerate ==== phosphoenolpyruvate + H 0 2 @ Phosphoenolpyruvate + ADP � pyruvate + ATP

?C

r.Jycoly,i

J y 3( �1:

ATP I

ATP 1

II

Glucose



" �UUI.· •·

ADP

fru
--
--< >-
Omnerase Glyceraldehyde 5C 3-phosphate

7�

[5 61]



SC

6C

(b)

to five hexoses (6C). Note that this involves two sets of the i nterconver­

14-22 Nonoxidative reactions of the pentose phosphate

pathway. (a) These reactions convert pentose phosphates to hexose

sions shown in (a). Every reaction shown here is reversi ble; unidirec­

phosphates, allowing the oxidative reactions (see Fig. 1 4-2 1 ) to con­

tional arrows are used only to make clear the direction of the reactions

tinue. Transketolase and transaldolase are specific to th is pathway; the

during continuous oxidation of g l ucose 6-phosphate. In the l i ght­

other enzymes also serve in the glycolytic or gluconeogenic pathways.

i ndependent reactions of photosynthesis, the direction of these reac­

(b) A schematic diagram showing the pathway from six pentoses (SC)

tions is reversed (see Fig. 2 0-1 0) .

CH :P H

+ pi

Ketose donor

0

� /

H

kz

r

TPP

" �

Aldose acceptor

0

/ ( I Rt

I

I

+

I

-

C=O

I

HO - C - H

�c I

H- C - OH

I

FIGURE 1 4-23

Ribose 5-phosphate

CH20H

I

C=O I HO - C - H

0 H � /

H- C - OH I + H- C - OH H - C - OH I I CH20POJ CH20POg-

Xylulose 5-phosphate

I

CHOH

�'J

(a)

CH,OH

(-()

TPP

transketolase

(b)

o � / c

I

H

I

H - C - OH I CH20POg

Glyceraldehyde 3-phosphate

+

H- C - OH I H- C - OH I H- C - OH

I

CH2 0POg-

Sedoheptulose 7-phosphate

The first reaction catalyzed by transketolase. (a) The general reaction catalyzed by transke­

tolase is the transfer of a two-carbon group, carried tempora ri ly on enzyme-bound TPP, from a ketose donor

to an aldose acceptor. (b) Conversion of two pentose phosphates to a triose phosphate and a seven-carbon sugar phosphate, sedoheptulose 7 -phosphate.

[} 62]

G l ycolysis, G l uconeogenes i s, a n d t h e Pentose Phosphate Pathway

FIGURE 1 4-24 The reaction catalyzed b

CII ,OII

I

-

C= O

Iran aldolase.

I

C H20H I

HO - C - H

I

H

C - OH

H

C - OH

H

C - OH

I

�c

+

CH

HO

o

I

H - C - OH

H- C - O H

I

ti·an�alc\ olnsc

H- C - OH

I

I

+

H - C - OH

I

.,

CH�OPO:i

CH20PO�-

I

H- C - OH I CHzOPOt Fructose 6-phosphate

Erythrose 4-phosphate

Glyceraldehyde 3-phosphate

Sedoheptulose 7-phosphate FIGURE 1 4-25 The second reaction cat­

I

HO - C - H

I

H 0 / �

C H10POj

alyzed by transketolase.

C=O

�c/H

0

I C=O I

CHoOH

OH

I C=O I

C-H

I

H -- C - O H

H 0 � / c

I

CH10PO}

Xylulose 5-phosphate

fructose 6-phosphate and the tetrose erythrose 4-phosphate (Fig. 14-24 ). Now transketolase acts again, forming fructose 6-phosphate and glyceraldehyde 3-phosphate from erythrose 4-phosphate and xylulose 5-phosphate ( Fig. 1 4-25 ) . Two molecules of glycer­ aldehyde 3-phosphate formed by two iterations of these reactions can be converted to a molecule of fructose 1 , 6bisphosphate as in gluconeogenesis (Fig. 14-16) , and fi­ nally FBPase- 1 and phosphohexose isomerase convert fructose 1 ,6-bisphosphate to glucose 6-phosphate. Overall, six pentose phosphates have been converted to five hexose phosphates (Fig. 14-22b)-the cycle is now complete! Transketolase requires the cofactor thiamine pyro­ phosphate (TPP) , which stabilizes a two-carbon carbanion in this reaction (Fig. 1 4-26a), just as it does in the pyruvate decarboxylase reaction (Fig. 14-14) . Transal­ dolase uses a Lys side chain to form a Schiff base with the carbonyl group of its substrate, a ketose, thereby stabilizing a carbanion (Fig. 14-26b) that is central to the reaction mechanism. The process described in Figure 14-2 1 is known as the oxidative pentose phosphate pathway. The first and third steps are oxidations with large, negative stan­ dard free-energy changes and are essentially irreversible in the cell. The reactions of the nonoxidative part of the pentose phosphate pathway (Fig. 14-22) are readily re­ versible and thus also provide a means of converting hexose phosphates to pentose phosphates. As we shall see in Chapter 20, a process that converts hexose phos­ phates to pentose phosphates is crucial to the photosyn­ thetic assimilation of C02 by plants. That pathway, the reductive pentose phosphate pathway, is essentially

I

�c/H

TPP

H- C - OH +

HO - C - H

0

I

H- C - OH

I

+

H - C - OH

H - C - OH

I

I

I

H - C - OH

I

2 C H 2 0P0:3 .

CH20PO�-

Glyceraldehyde 3-phosphate

Erythrose 4-phosphate

CHzOPO�Fructose 6-phosphate

(a) Transketolase

OH

OH

I

I

HOH2C-C

Y\�

HOH2 - 1 '

II

R _:N

c:r- s ·�

CH3

resonance stabilization

R'

TPP

/OH

/OR

c

c

H

H

I

I

Proton ated Schiff base FIGURE 1 4-26 Carbanion intermediates stabilized by covalent interac­ tions with transketolase and transaldolase. (a) The ring ofTPP stabilizes

the carbanion in the dihydroxyethyl group carried by transketolase; see Fig. 1 4-1 4 for the chemistry ofTPP action. (b) In the transaldolase reac­ tion, the protonated Schiff base formed between the E-amino group of a Lys side cha i n and the substrate stabil izes the C-3 carba n ion formed after aldol cleavage.

the reversal of the reactions shown in Figure 1 4-22 and employs many of the same enzymes. All the enzymes in the pentose phosphate pathway are located in the cytosol, like those of glycolysis and most of those of gluconeogenesis. In fact, these three pathways are connected through several shared interme­ diates and enzymes. The glyceraldehyde 3-phosphate formed by the action of transketolase is readily converted

1 4.5 Pentose Phosp hate Pathway of G l u cose Oxidation

to dihydroxyacetone phosphate by the glycolytic enzyme triose phosphate isomerase, and these two trioses can be joined by the aldolase as in gluconeogenesis , forming fructose 1 ,6-bisphosphate. Alternatively, the triose phos­ phates can be oxidized to pyruvate by the glycolytic reac­ tions. The fate of the trioses is determined by the cell's relative needs for pentose phosphates, NADPH, and ATP. Wernicke-Korsakoff Syndrome Is Exacerbated by a Defect in Transketolase

,

Wernicke-Korsakoff syndrome is a disorder caused by a severe deficiency of thiamine , a component of TPP. The syndrome is more common among people with alcoholism than in the general pop­ ulation, because chronic, heavy alcohol consumption interferes with the intestinal absorption of thiamine. The syndrome can be exacerbated by a mutation in the gene for transketolase that results in an enzyme with a lowered affinity for TPP-an affinity one-tenth that of the normal enzyme . This defect makes individuals much more sensitive to a thiamine deficiency: even a moderate thiamine deficiency (tolerable in individuals with an unmutated transketolase) can drop the level of TPP below that needed to saturate the enzyme. The re­ sult is a slowing down of the whole pentose phosphate pathway. In people with Wernicke-Korsakoff syndrome this results in a worsening of symptoms, which can in­ clude severe memory loss , mental confusion, and par­ tial paralysis. •

needs of the cell and on the concentration of NADP + in the cytosol. Without this electron acceptor, the first re­ action of the pentose phosphate pathway (catalyzed by G6PD) cannot proceed. When a cell is rapidly convert­ ing NADPH to NADP + in biosynthetic reductions, the level of NADP + rises, allosterically stimulating G6PD and thereby increasing the flux of glucose 6-phosphate through the pentose phosphate pathway ( Fig. 1 4-27 ). When the demand for NADPH slows, the level of ADP drops, the pentose phosphate pathway slows, and glu­ cose 6-phosphate is instead used to fuel glycolysis.

S U M M A RY 1 4 . 5





Gl ucose 6-Phosphate Is Partitioned between Glycolysis and the Pentose Phosphate Pathway



Whether glucose 6-phosphate enters glycolysis or the pentose phosphate pathway depends on the current

Glucose 1 Glucose 6-phosphate

��!��ate pathway

glycolysis

�+��p�- - - - - - - -,�

6-Phosphogluconolactone

l }-- NADPH

Pentose phosphates

ATP



Entry of glucose 6-phosphate either into glycolysis or into the pentose phosphate pathway is largely determined by the relative concentrations of NADP + and NADPH.

FIGURE 1 4-27 Role of NADPH in regulating the partitioning of glu­

rises and i n h ibits the first enzyme i n the pentose phosphate pathway. As a result, more gl ucose 6-phosphate is avai lable for glycolysis.

The first phase of the pentose phosphate pathway consists of two oxidations that convert glucose 6-phosphate to ribulose 5-phosphate and reduce NADP + to NADPH. The second phase comprises nonoxidative steps that convert pentose phosphates to glucose 6-phosphate , which begins the cycle again.

A genetic defect in transketolase that lowers its affinity for TPP exacerbates the Wernicke-Korsakoff syndrome.

!

biosynthesis and gl utathione reduction (see Fig. 1 4-20), [NADPH]

NADPH provides reducing power for biosynthetic reactions, and ribose 5-phosphate is a precursor for nucleotide and nucleic acid synthesis. Rapidly growing tissues and tissues carrying out active biosynthesis of fatty acids, cholesterol, or steroid hormones send more glucose 6-phosphate through the pentose phosphate pathway than do tissues with less demand for pentose phosphates and reducing power.



!

pathway. When NADPH is form i n g faster than it is being used for

The oxidative pentose phosphate pathway (phosphogluconate pathway, or hexose monophosphate pathway) brings about oxidation and decarboxylation at C-1 of glucose 6-phosphate, reducing NADP + to NADPH and producing pentose phosphates.

In the second phase, transketolase (with TPP as cofactor) and transaldolase catalyze the interconversion of three-, four-, five-, six-, and seven-carbon sugars, with the reversible conversion of six pentose phosphates to five hexose phosphates. In the carbon-assimilating reactions of photosynthesis , the same enzymes catalyze the reverse process, the reductive pentose phosphate pathway: conversion of five hexose phosphates to six pentose phosphates.

!

cose &-phosphate between glycolysis and the pentose phosphate

P e n t o s e P h o s p hate Pathway o f G l u co s e Oxidation



:I j

______________

[s63]

·

5 64

G l ycolysis, G l u coneogenesis, a n d the Pentose Phosphate Pathway

Knowles, J. & Albery, W.J. ( 1977) Perfection in enzyme catalysis:

Key Terms

the energetics of triose phosphate isomerase . Acc. Chem Res . 10,

Terms in bold are defined in the glossary.

glycolysis 528 fermentation 528 lactic acid fermentation 530 hypoxia 530 ethanol (alcohol) fermentation 530 isozymes 532 acyl phosphate 536 substrate-level phosphorylation respiration-linked phosphorylation phosphoenolpyruvate (PEP) 538

537 537

mutases 544 isomerases 544 lactose intolerance 545 galactosemia 545 thiamine pyrophosphate (TPP) 549 gluconeogenesis 552 biotin 554 pentose phosphate pathway 558 phosphogluconate pathway 558 hexose monophosphate pathway 558

105- 1 1 1 .

Kresge, N., Simoni, R.D., & Hill, R.L. (2005) Otto Fritz Meyerhof and the elucidation of the glycolytic pathway. J. Bioi. Chern. 280, 3 . Brief review o f classic papers, which are also available online

Kritikou, E. (2006) p53 turns on the energy switch. Nat Rev. Mol. Cell Biol. 7, 552-553.

Pelicano, H., Martin, D.S., Zu, R-H., & Huang, P. (2006) Glycoly­ sis inhibition for anticancer treatment. Oncogene 25, 4633-4646. Intermediate-level review.

Phillips, D., Blake, C.C.F., & Watson, H.C. (eds). ( 1 981) The Enzymes of Glycolysis: Structure, Activity and Evolution. Philos Trans R Soc Land. Ser: B Biol Sci. 293, 1-214. A collection of excellent reviews on the enzymes of glycolysis, written at a level challenging but comprehensible to a beginning student of biochemistry

Plaxton, W.C. ( 1 996) The organization and regulation of plant gly­ colysis Annu Rev. Plant Physiol. Plant Mol Biol. 47, 1 8 5-2 1 4. Very helpful review of the subcellular localization of glycolytic enzymes and the regulation of glycolysis in plants.

Further Reading General Fruton, J.S. ( 1 999) Proteins, Genes, and Enzymes: The Interplay of Chemistry and Biology, Yale University Press, New Haven. This text includes a detailed historical account of research on glycolysis.

Glycolysis Boiteux, A. & Hess, B. ( 1 98 1 ) Design of glycolysis. Philos. Trans R Soc Land Ser: B Biol Sci. 293, 5-22 . Intermediate-level review of the pathway and the classic view of its control

Dandekar, T. , Schuster, S., Snel, B., Huynen, M., & Bork, P. ( 1 999) Pathway alignment: application to the comparative analysis of glycolytic enzymes Biochem J. 343, 1 1 5- 124 .

Intermediate-level review of the bioinformatic view of the evolu­

tion of glycolysis.

Dang, C.V. & Semenza, G.L. ( 1 999) Oncogenic alterations of metabolism. Trends Biochem Sci 24, 68-72. Brief review of the molecular basis for increased glycolysis in tumors.

Erlandsen, H., Abola, E.E., & Stevens, R.C. (2000) Combining structural genomics and enzymology: completing the picture in metabolic pathways and enzyme active sites Curr: Opin. Struct Bioi. 1 0, 7 1 9-730 Intermediate-level review of the structures of the glycolytic enzymes.

Gatenby, R.A. & Gillies, R.J. (2004) Why do cancers have high aerobic glycolysis? Nat. Rev Cancer 4, 891-899.

Hardie, D.G. (2000) Metabolic control: a new solution to an old problem . Curr: Biol 1 0, R757-R759.

Harris, A.L. (2002) Hypoxia-a key regulatory factor in tumour growth. Nat Rev Cancer 2, 38-47.

Heinrich, R., Melendez-Hevia, E., Montero, F. , Nuno, J.C., Stephani, A., & Waddell, T.D. ( 1 999) The structural design of

Rose, I. ( 1 98 1 ) Chemistry of proton abstraction by glycolytic enzymes (aldolase, isomerases, and pyruvate kinase) . Philos. Trans R. Soc. Land. Ser: B Biol Sci. 293, 1 3 1-1 4 4. Intermediate-level review of the mechanisms of these enzymes.

Shirmer, T. & Evans, P.R. ( 1 990) Structural basis for the allosteric behavior of phosphofructokinase. Nature 343, 140-145.

Smith, T.A. (2000) Mammalian hexokinases and their abnormal expression in cancer Br: J. Biomed Sci. 57, 1 70-1 78.

A review of the four hexokinase isozymes of mammals: their

properties and tissue distributions and their expression during the development of tumors

Feeder Pathways for Glycolysis Elsas, L.J. & Lai, K. ( 1 998) The molecular biology of galactosemia . Genet. Med l, 40-48.

Novelli, G. & Reichardt, J.K. (2000) Molecular basis of disorders of human galactose metab olism: past, present, and future. Mol Genet Metab. 7 1 , 62-65.

Petry, K.G. & Reichardt, J.K. ( 1 998) The fundamental importance of human galactose metabolism: lessons from genetics and biochem­ istry. Trends Genet 14, 98-102

Van Beers, E.H., Buller, H.A., Grand, R.J., Einerhand, A.W.C.,

& Dekker, J. ( 1 995) Intestinal brush border glycohydrolases: structure, function, and development. Grit. Rev. Biochem Mol Biol. 30, 1 9 7-262 .

Fermentations Demain, A.L., Davies, J.E., Atlas, R.M., Cohen, G., Hershberger, C.L. , Hu, W.-S., Sherman, D.H., Willson, R.C., & Wu, J.H.D. (eds). ( 1 999) Manual of Industrial Microbiology and Biotechnology , American Society for Microbiology, Washington, D C. Classic introduction to all aspects of industrial fermentations.

Liese, A., Seelbach, K., & Wandrey, C. (eds). (2006) Industrial Biotransjormations , John Wiley & Sons, New York. The use of microorganisms in industry for the synthesis of

valuable products from inexpensive starting materials .

glycolysis: an evolutionary approach. Biochem. Soc Trans 27, 294-298.

Gluconeogenesis

Keith, B. & Simon, M.C. (2007) Hypoxia-inducible factors, stem

Gerich, J.E., Meyer, C., Woerle, H.J., & Stumvoll, M. (2001) Re­

cells, and cancer. Cell 129, 465-472.

nal gluconeogenesis: its importance in human glucose homeostasis .

Intermediate-level review.

Diabetes Care 24, 382-39 1 .

P ro b l e m s

Intermediate-level review of the conttibution of kidney tissue to

gluconeogenesis .

Gleeson, T. (1 996) Post-exercise lactate metabolism: a comparative review of sites, pathways, and regulation. Annu. Rev. Physiol. 58, 565-58 1 .

Hers, H.G. & Hue, L. ( 1 983) Gluconeogenesis and related aspects of glycolysis. Annu Rev. Biochem

5 2 , 6 1 7-653.

Matte, A., Tari, L.W., Goldie, H., & Delbaere, L.T.J. (1 997) Structure and mechanism of phosphoenolpyruvate carboxykinase. J Biol Chem.

272, 81 05-8 1 08.

Oxidative Pentose Phosphate Pathway Chayen, J., Howat, D.W., & Bitensky, L. (1 986) Cellular biochem­ istry of glucose 6-phosphate and 6-phosphogluconate dehydrogenase activities. CeU Biochem. Funct 4, 249-253.

Horecker, B.L. ( 1 976) Unraveling the pentose phosphate pathway. In Reflections on Biochemistry (Kornberg, A, Cornudella, 1. ,

Horecker, B .1. , & Oro, J. , eds), pp. 65-72, Pergamon Press, Inc.,

Oxford.

Kletzien, R.F., Harris, P.K., & Foellrni, L.A. ( 1 994) Glucose 6-phosphate dehydrogenase: a "housekeeping" enzyme subject to tissue-specific regulation by hormones, nutrients, and oxidant stress. FASEB J 8, 174-1 8 1 .

An intermediate-level review. Kresge, N., Simoni, R.D., & Hill, R.L. (2005) Bernard 1. Horecker's contributions to elucidating the pentose phosphate pathway. J Biol Chem.

2 80, 26 .

Brief review of classic papers, which are also available online.

Luzzato, 1., Mehta, A., & Vullia.my, T. (2001) Glucose 6-phosphate

dehydrogenase deficiency. In The Metabolic and Molecular Bases of Inherited Disease, 8th edn (Scriver, C.R. , Sly, W.S., Childs, B., Beaudet, A 1. , Valle, D., Kinzler, K . W., & Vogelstein, B. , eds), pp_ 451 7-4553, McGraw-Hill Inc., New York.

The four-volume treatise in which this article appears is filled with

fascinating information about the clinical and biochemical features of

hundreds of inherited diseases of metabolism

Martini, G. & Ursini, M.V. ( 1 996) A new lease on life for an old enzyme. BioEssays 18, 631-637.

An intermediate-level review of glucose 6-phosphate dehydro­

genase, the effects of mutations in this enzyme in humans, and the effects of knock-out mutations in mice

Notaro, R., Afolayan, A., & Luzzatto, L. (2000) Human mutations in glucose 6-phosphate dehydrogenase reflect evolutionary history. FASEB J. 14, 485-494.

Wood, T. ( 1 985) The Pentose Phosphate Pathway, Academic Press, Inc , Orlando, FL.

Wood, T. ( 1 986) Physiological functions of the pentose phosphate pathway. Cell Biochem Funct 4, 2 4 1-247.

Problems 1. Equation for the Preparatory Phase of Glycolysis Write balanced biochemical equations for all the reactions in the catabolism of glucose to two molecules of glyceraldehyde 3-phosphate (the preparatory phase of glycolysis) , including the standard free-energy change for each reaction. Then write the overall or net equation for the preparatory phase of glycol­ ysis, with the net standard free-energy change. 2. The Payoff Phase of Glycolysis in Skeletal Muscle In working skeletal muscle under anaerobic conditions, glycer-

[s 6s]

aldehyde 3-phosphate is converted to pyruvate (the payoff phase of glycolysis) , and the pyruvate is reduced to lactate. Write balanced biochemical equations for all the reactions in this process, with the standard free-energy change for each re­ action. Then write the overall or net equation for the payoff phase of glycolysis (with lactate as the end product) , including the net standard free-energy change. 3. GLUT Transporters Compare the localization of GLUT4 with that of GLUT2 and GLUT3, and explain why these local­ izations are important in the response of muscle, adipose tis­ sue, brain, and liver to insulin.

4. Ethanol Production in Yeast When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to ac­ etaldehyde, then reduces acetaldehyde to ethanol using elec­ trons from NADH. Write the equation for the second reaction, and calculate its equilibrium constant at 25 °C, given the stan­ dard reduction potentials in Table 1 3-7.

Fructose 1,6-bisphosphate glyceraldehyde 3-phosphate dihydroxyacetone phosphate

5. Energetics of the Aldolase Reaction Aldolase cat­ alyzes the glycolytic reaction �

+

The standard free-energy change for this reaction in the direction written is + 23.8 kJ/mol. The concentrations of the three interme­ diates in the hepatocyte of a mammal are: fructose 1 ,6-bisphos­ phate, 1.4 X 10- 5 M; glyceraldehyde 3-phosphate, 3 X 10- 6 M; and dihydroxyacetone phosphate, 1 .6 X 10- 5 M. At body temperature (37 °C), what is the actual free-energy change for the reaction? 6. Pathway of Atoms in Fermentation A "pulse-chase" experiment using 14C-labeled carbon sources is carried out on a yeast extract maintained under strictly anaerobic conditions to produce ethanol. The experiment consists of incubating a small amount of 1 4C-labeled substrate (the pulse) with the yeast extract just long enough for each intermediate in the fer­ mentation pathway to become labeled. The label is then "chased" through the pathway by the addition of excess unla­ beled glucose. The chase effectively prevents any further en­ try of labeled glucose into the pathway. (a) If [1-1 4C]glucose (glucose labeled at C-1 with 14C) is used as a substrate, what is the location of 14C in the product ethanol? Explain. (b) Where would 14C have to be located in the starting glucose to ensure that all the 1 4C activity is liberated as 14C0 2 during fermentation to ethanol? Explain.

7. Heat from Fermentations Large-scale industrial fer­ menters generally require constant, vigorous cooling. Why? 8. Fermentation to Produce Soy Sauce Soy sauce is pre­ pared by fermenting a salted mixture of soybeans and wheat with several microorganisms, including yeast, over a period of 8 to 12 months. The resulting sauce (after solids are removed) is rich in lactate and ethanol. How are these two compounds produced? To prevent the soy sauce from having a strong vine­ gary taste (vinegar is dilute acetic acid) , oxygen must be kept out of the fermentation tank. Why?

l566]

G l ycolysis, G l u coneogenesis, a n d the Pentose Phosp hate Pathway

9. Equivalence of Triose Phosphates 1 4C-Labeled glycer­ aldehyde 3-phosphate was added to a yeast extract. After a short time, fructose 1 ,6-bisphosphate labeled with 1 4C at C-3 and C-4 was isolated. What was the location of the 1 4C label in the starting glyceraldehyde 3-phosphate? Where did the second 1 4 C label in fructose 1 ,6-bisphosphate come from?

Explain. 10. Glycolysis Shortcut Suppose you discovered a mutant yeast whose glycolytic pathway was shorter because of the presence of a new enzyme catalyzing the reaction

NAD+ Glyceraldehyde 3-phosphate +

Hp

NADH

� /)

+

H+

3-phosphoglycerate

Would shortening the glycolytic pathway in this way ben­ efit the cell? Explain. 1 1 . Role of Lactate Dehydrogenase During strenuous activity, the demand for ATP in muscle tissue is vastly in­ creased. In rabbit leg muscle or turkey flight muscle, the ATP is produced almost exclusively by lactic acid fermentation. ATP is formed in the payoff phase of glycolysis by two reac­ tions, promoted by phosphoglycerate kinase and pyruvate ki­ nase. Suppose skeletal muscle were devoid of lactate dehydrogenase. Could it carry out strenuous physical activ­ ity; that is, could it generate ATP at a high rate by glycolysis? Explain. 12. Efficiency of ATP Production in Muscle The trans­ formation of glucose to lactate in myocytes releases only about 7% of the free energy released when glucose is completely ox­ idized to C0 and H 0. Does this mean that anaerobic glycoly­ 2 2 sis in muscle is a wasteful use of glucose? Explain. 13. Free-Energy Change for Triose Phosphate Oxida­ tion The oxidation of glyceraldehyde 3-phosphate to 1 ,3bisphosphoglycerate, catalyzed by glyceraldehyde 3-phosphate dehydrogenase, proceeds with an unfavorable equilibrium constant (K�q 0.08; t:iG'o 6.3 kJ/mol) , yet the flow through this point in the glycolytic pathway proceeds smoothly. How =

=

does the cell overcome the unfavorable equilibrium? 14. Arsenate Poisoning Arsenate is structurally and chemi­ cally similar to inorganic phosphate (Pi) , and many enzymes that require phosphate will also use arsenate. Organic com­ pounds of arsenate are less stable than analogous phosphate compounds, however. For example, acyl arsenates decom­ pose rapidly by hydrolysis:

0 0 II II R-C-0-As-o- + H2 0

I



o0

II

0

II

R -e- o- + HO-As-o- + H+ I o-

On the other hand, acyl phosphates, such as 1 ,3-bisphospho­ glycerate, are more stable and undergo further enzyme­ catalyzed transformation in cells . (a) Predict the effect on the net reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase if phosphate were replaced by arsenate. (b) What would be the consequence to an organism if ar­ senate were substituted for phosphate? Arsenate is very toxic to most organisms. Explain why. 15. Requirement for Phosphate in Ethanol Fermenta­ tion In 1906 Harden and Young, in a series of classic studies

on the fermentation of glucose to ethanol and C02 by extracts of brewer's yeast, made the following observations. (1) Inor­ ganic phosphate was essential to fermentation; when the sup­ ply of phosphate was exhausted, fermentation ceased before all the glucose was used. (2) During fermentation under these con­ ditions, ethanol, C02, and a hexose bisphosphate accumulated. (3) When arsenate was substituted for phosphate, no hexose bisphosphate accumulated, but the fermentation proceeded until all the glucose was converted to ethanol and C02. (a) Why did fermentation cease when the supply of phos­ phate was exhausted? (b) Why did ethanol and C02 accumulate? Was the con­ version of pyruvate to ethanol and C02 essential? Why? Iden­ tify the hexose bisphosphate that accumulated. Why did it accumulate? (c) Why did the substitution of arsenate for phosphate prevent the accumulation of the hexose bisphosphate yet allow fermentation to ethanol and C02 to go to completion? (See Problem 1 4.) 16. Role of the Vitamin Niacin Adults engaged in strenu­ ous physical activity require an intake of about 1 60 g of carbo­ hydrate daily but only about 20 mg of niacin for optimal nutrition. Given the role of niacin in glycolysis, how do you explain the observation? 1 7 . Synthesis of Glycerol Phosphate The glycerol 3phosphate required for the synthesis of glycerophospholipids can be synthesized from a glycolytic intermediate. Propose a reaction sequence for this conversion. 18. Severity of Clinical Symptoms Due to Enzyme Deficiency The clinical symptoms of two forms of galactosemia-deficiency of galactokinase or of UDP-glucose: galactose ! -phosphate uridylyltransferase-show radically dif­ ferent severity. Although both types produce gastric discom­

fort after milk ingestion, deficiency of the transferase also leads to liver, kidney, spleen, and brain dysfunction and even­ tual death. What products accumulate in the blood and tissues with each type of enzyme deficiency? E stimate the relative toxicities of these products from the above information. 19. Muscle Wasting in Starvation One consequence of starvation is a reduction in muscle mass. What happens to the muscle proteins? 20. Pathway of Atoms in Gluconeogenesis A liver extract capable of carrying out all the normal metabolic reactions of

Problems

the liver is briefly incubated in separate experiments with the following 14C-labeled precursors. o­ / (a) [14C] Bicarbonate, H0-14C



0

(b) [l-14C]Pyruvate, CH3-C-14Coo­

ll

Explain how this reaction inhibits the transformation of lactate to pyruvate. Why does this lead to hypoglycemia? 2 6 . Blood Lactate Levels during Vigorous Exer­ cise The c onc entrations of lactate in blood plasma be­ fore, during, and after a 400 m sprint are shown in the graph.

0

Trace the pathway of each precursor through gluconeogene­ sis. Indicate the location of 14C in all intermediates and in the product, glucose.

200



2 1 . Energy Cost of a Cycle of Glycolysis and Gluconeo­ genesis What is the cost (in ATP equivalents) of transforming glucose to pyruvate via glycolysis and back again to glucose via gluconeogenesis?

3 a) ..., (lj ..., "

� ..9 P=l

lysis Why is it important that gluconeogenesis is not the exact reversal of glycolysis?

150

100

50

23. Energetics of the Pyruvate Kinase Reaction Explain in bioenergetic terms how the conversion of pyruvate to phos­

24. Glucogenic Substrates A common procedure for de­ termining the effectiveness of compounds as precursors of glucose in mammals is to starve the animal until the liver glycogen stores are depleted and then administer the com­ pound in question. A substrate that leads to a net increase in liver glycogen is tenned glucogenic, because it must first be converted to glucose 6-phosphate. Show by means of known enzymatic reactions which of the following substances are glucogenic. (a) Succinate, -ooc - CH2-CH2- COo­

I

(b) Glycerol, OH

I

I

OH OH

CH 2 -C-CH 2

I

(c) Acetyl-CoA,

(d)

H

II

0 CH3-C-S-CoA

Pyruvate,

Run +Before_.., ' ..._---After ---�

"0 0

22. Relationship between Gluconeogenesis and Glyco­

phoenolpyruvate in gluconeogenesis overcomes the large, negative standard free-energy change of the pyruvate kinase reaction in glycolysis.

[s67]

o L---L---�---L----� 0 40 60 20 Time (min)

(a) What causes the rapid rise in lactate concentration? (b) What causes the decline in lactate concentration after completion of the sprint? Why does the decline occur more slowly than the increase? (c) Why is the concentration of lactate not zero during the resting state? 27. Relationship between Fructose 1 ,6-Bisphosphatase and Blood Lactate Levels A congenital defect in the liver enzyme fructose 1 ,6-bisphosphatase results in abnormally high levels of lactate in the blood plasma. Explain. , .,

28. Effect of Phloridzin on Carbohydrate Metabolism Phloridzin, a toxic glycoside from the bark of the pear tree, blocks the normal reabsorption of glucose from the kidney tubule, thus causing blood glucose to be almost completely ex­ creted in the urine. In an experiment, rats fed phloridzin and sodium succinate excreted about 0.5 mol of glucose (made by gluconeogenesis) for every 1 mol of sodium succinate in­ gested. How is the succinate transformed to glucose? Explain the stoichiometry.

0

II

CH3-c-coo-

(e) Butyrate, CH3-CH2-CH2-C00-

25. Ethanol Mfects Blood Glucose Levels The consumption of alcohol (ethanol) , especially after peri­ ods of strenuous activity or after not eating for several hours, results in a deficiency of glucose in the blood, a condition known as hypoglycemia. The first step in the metabolism of ethanol by the liver is oxidation to acetaldehyde, catalyzed by liver alcohol dehydrogenase:

Phloridzin

29. Excess 02 Uptake during Gluconeogenesis Lactate absorbed by the liver is converted to glucose, with the input of

[56s]

G l ycolysis, G l u coneogenesis, a n d the Pentose Ph osph ate Pathway

6 mol of ATP for every mole of glucose produced. The extent of

which interconverts L-arabinose and L-ribulose; araB, L-ribu­

this process in a rat liver preparation can be monitored by admin­ 14 4 istering [ C]lactate and measuring the amount of C]glucose

lokinase, which uses ATP to phosphorylate L-ribulose at C-5;

produced. Because the stoichiometry of

L-ribulose 5-phosphate and L-xylulose 5-phosphate; talE,

ATP production is known (about 5 ATP the extra

02

e

02 consumption and per 02) , we can predict

consumption above the normal rate when a given

amount of lactate is administered. However, when the extra

02

araD, L-ribulose 5-phosphate epimerase, which interconverts transaldolase; and tktA , transketolase .

(b) For each o f the three ara enzymes, briefly describe

the chemical transformation it catalyzes and, where possible,

used in the synthesis of glucose from lactate is actually measured,

name an enzyme discussed in this chapter that carries out an

it is always higher than predicted by known stoichiometric rela­

analogous reaction.

tionships. Suggest a possible explanation for this observation.

30. Role of the Pentose Phosphate Pathway If the oxida­ tion of glucose 6-phosphate via the pentose phosphate path­ way were being used primarily to generate NADPH for biosynthesis, the other product, ribose 5-phosphate, would ac­ cumulate . What problems might this cause?

The five E. coli genes inserted in Z. mobilis allowed the

entry of arabinose into the nonoxidative phase of the pentose

phosphate pathway (Fig. 1 4-22) , where it was converted to glucose 6-phosphate and fermented to ethanol. (c) The three ara enzymes eventually converted arabi­

nose into which sugar?

(d) The product from part (c) feeds into the pathway shown in Figure 14-22. Combining the five E. coli enzymes listed above with the enzymes of this pathway, describe the

Data Analysis Problem

overall pathway for the fermentation of 6 molecules of arabi­

31. Engineering a Fermentation System Fermentation of plant matter to produce ethanol for fuel is one potential method for reducing the use of fossil fuels and thus the

C02

emissions that lead to global warming . Many microorganisms can break down cellulose then ferment the glucose to ethanol. However, many potential cellulose sources, including agricul­ tural residues and switchgrass,

also

contain substantial

amounts of arabinose, which is not as easily fermented.

H " .f'o c I HO-C-H I H-C-OH I H-C-OH I CH20H D-Arabinose

nose to ethanol. (e) What is the stoichiometry of the fermentation of 6 mol­ ecules of arabinose to ethanol and

C02? How many ATP mole­

cules would you expect this reaction to generate? (f) Z. mobilis uses a slightly different pathway for ethanol

fermentation from the one described in this chapter. As a re­

sult, the expected ATP yield is only 1 ATP per molecule of ara­ binose. Although this is less beneficial for the bacterium, it is better for ethanol production. Why? Another sugar commonly found in plant matter is xylose .

H " .f'o c I H-C-OH I HO-C-H I H-C-OH I CH20H D-Xylose

Escherichia coli is capable of fermenting arabinose to ethanol, but it is not naturally tolerant of high ethanol levels, thus limiting its utility for commercial ethanol production. An­

(g) What additional enzymes would you need to introduce

other bacterium, Zymomonas mobilis, is naturally tolerant of

into the modified Z. mobilis strain described above to enable

high levels of ethanol but cannot ferment arabinose. Deanda,

it to use xylose as well as arabinose to produce ethanol? You

Zhang, E ddy, and Picataggio (1 996) described their efforts to

don't need to name the enzymes (they may not even exist in

combine the most useful features of these two organisms by

the real world!) ; just give the reactions they would need to

introducing the E. coli genes for the arabinose-metabolizing

catalyze .

enzymes into Z. mobilis.

(a) Why is this a simpler strategy than the reverse: engi­

neering E. coli to be more ethanol-tolerant? Deanda and colleagues inserted five E. coli genes into the

Z. mobilis genome: araA , coding for L-arabinose isomerase,

Reference Deanda, K., Zhang, M., Eddy, C., & Picataggio, S. ( 1 996) Devel­ opment of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering. Appl. Environ 4465-4470

Microbial. 6 2 ,

Formation of l iver g lycogen from lactic acid is thus seen to esta b l i s h a n i m portant connection between t h e metabol ism o f t h e muscle and that of the l iver. Muscle glycogen becomes ava i lable as blood sugar through the i ntervention of the l iver, and blood sugar in turn i s con­ verted i nto m uscle glycoge n . There ex i sts therefore a complete cyc le of the g l u cose molec u le i n the body . . . Epi neph r i ne was fou nd to accel e rate th i s cycl e i n the d i rection of m u s c l e glycogen to l iver glycogen . . . Insu l i n, on the other hand, was fou n d to accelerate the cycle in the d i rection of blood g l u cose to m uscle glycogen. -C. F. Cori and C. T. Cori, article in journal of Biological Chemi stry, 7 929

Principles of Metabolic Regulation 1 5.1

Regulation o f Metabolic Pathways

1 5.2

Analysis of Metabolic Control

1 5.3

Coordinated Regulation of Glycolysis and Gluconeogenesis

570

5 77

582 594

1 5 .4

The Metabolism of Glycogen in Animals

1 5.5

Coordi nated Regulation of Glycogen Synthesis and Breakdown

M

602

etabolic regulation, a central theme in biochem­ istry, is one of the most remarkable features of living organisms. Of the thousands of enzyme­ catalyzed reactions that can take place in a cell, there is probably not one that escapes some form of regulation. This need to regulate every aspect of cellular metabo­ lism becomes clear as one examines the complexity of metabolic reaction sequences. Although it is convenient for the student of biochemistry to divide metabolic processes into "pathways" that play discrete roles in the cell's economy, no such separation exists in the living cell. Rather, every pathway we discuss in this book is inextricably intertwined with all the other cellular pathways in a multidimensional network of reactions (Fig. 1 5-1 ) . For example, in Chapter 14 we discussed four possible fates for glucose 6-phosphate in a hepato­ cyte: breakdown by glycolysis for the production of ATP, breakdown in the pentose phosphate pathway for the production of NADPH and pentose phosphates, use in the synthesis of complex polysaccharides of the extra­ cellular matrix, or hydrolysis to glucose and phosphate to replenish blood glucose. In fact, glucose 6-phosphate has other possible fates in hepatocytes, too; it may, for example, be used to synthesize other sugars, such as glucosamine, galactose, galactosamine, fucose, and neu­ raminic acid, for use in protein glycosylation, or it may

be partially degraded to provide acetyl-GoA for fatty acid and sterol synthesis. And the bacterium Es­ cherichia coli can use glucose to produce the carbon skeleton of every one of its several thousand types of molecules. When any cell uses glucose 6-phosphate for one purpose, that "decision" affects all the other path­ ways for which glucose 6-phosphate is a precursor or in­ termediate: any change in the allocation of glucose 6-phosphate to one pathway affects, directly or indi­ rectly, the flow of metabolites through all the others. Such changes in allocation are common in the life of a cell. Louis Pasteur was the first to describe the more than 10-fold increase in glucose consumption by a yeast culture when it was shifted from aerobic to anaerobic conditions. This "Pasteur effect" occurs without a signif­ icant change in the concentrations of ATP or most of the hundreds of metabolic intermediates and products de­ rived from glucose. A similar effect occurs in the cells of skeletal muscle when a sprinter leaves the starting blocks. The ability of a cell to carry out all these inter­ locking metabolic processes simultaneously-obtaining every product in the amount needed and at the right time, in the face of major perturbations from outside, and without generating leftovers-is an astounding accomplishment. In this chapter we use the metabolism of glucose to illustrate some general principles of metabolic regula­ tion. First we look at the general roles of regulation in achieving metabolic homeostasis and introduce meta­ bolic control analysis, a system for analyzing complex metabolic interactions quantitatively. We then describe the specific regulatory properties of the individual en­ zymes of glucose metabolism; for glycolysis and gluco­ neogenesis, we described the catalytic activities of the enzymes in Chapter 14. Here we also discuss both the catalytic and regulatory properties of the enzymes of glycogen synthesis and breakdown, one of the best­ studied cases of metabolic regulation. Note that in

[s7o]

Principles of Meta b o l i c Regu lation

M ETABOLJ

P T HW A Y

G lyrnn Bios} nthesi\ and Mel:.�bnlism

Bio�) nl h!.'sis of Sccond a r� :\ Jetuholitcs

FIGURE 1 5-1 Metabolism as a three-dimensional meshwork. A typical

( Kyoto Encyclopedia of Genes and Genomes) PATHWAY database

eukaryotic cell has the capacity to make about 30,000 different pro­

(www.genome.ad .j p/kegg/pathway/map/mapO l l OO.htm l ) . Each area

teins, which cata lyze thousands of different reactions involving many

can be further expanded for i ncreas ingly deta i l ed information, to the

hundreds of metabolites, most shared by more than one "pathway."

level of specific enzymes and i ntermediates.

This overview i mage of metabolic pathways is from the online KEGG

selecting carbohydrate metabolism to illustrate the prin­ ciples of metabolic regulation, we have artificially sepa­ rated the metabolism of fats and carbohydrates . In fact, these two activities are very tightly integrated, as we shall see in Chapter 23.

1 5 . 1 Regu lation of Meta bolic Pathways The pathways of glucose metabolism provide , in the catabolic direction, the energy essential to oppose the forces of entropy and, in the anabolic direction, biosyn­ thetic precursors and a storage form of metabolic en­ ergy. These reactions are so important to survival that very complex regulatory mechanisms have evolved to

ensure that metabolites move through each pathway in the correct direction and at the correct rate to match exactly the cell's or the organism's changing circum­ stances. By a variety of mechanisms operating on differ­ ent time scales, adjustments are made in the rate of metabolite flow through an entire pathway when exter­ nal circumstances change. Circumstances do change, sometimes dramatically. For example, the demand for ATP in insect flight muscle increases 1 00-fold in a few seconds when the insect takes flight. In humans, the availability of oxygen may decrease due to hypoxia (diminished delivery of oxygen to tissues) or ischemia (diminished flow of blood to tis­ sues) . The relative proportions of carbohydrate, fat, and

1 5 . 1 Regu lation of Meta b o l i c Pathways

protein in the diet vary from meal to meal, and the sup­ ply of fuels obtained in the diet is intermittent, requiring metabolic adjustments between meals and during peri­ ods of starvation. Wound healing requires huge amounts of energy and biosynthetic precursors. Cells and Organisms Maintain a Dynam i c Steady State

Fuels such as glucose enter a cell, and waste products such as C02 leave, but the mass and the gross composi­ tion of a typical cell, organ, or adult animal do not change appreciably over time; cells and organisms exist in a dynamic steady state . For each metabolic reaction in a pathway, the substrate is provided by the preceding reaction at the same rate at which it is converted to product. Thus, although the rate (v) of metabolite flow, or flux, through this step of the pathway may be high and variable, the concentration of substrate, S, remains constant. So, for the two-step reaction A

u1

---+

S

---+ Vz

P

when v 1 = v2, [S] is constant. For example, changes in v 1 for the entry of glucose from various sources into the blood are balanced by changes in v2 for the uptake of glucose from the blood into various tissues, so the con­ centration of glucose in the blood ([S]) is held nearly constant at 5 mM. This is homeostasis at the molecular level. The failure of homeostatic mechanisms is often at the root of human disease. In diabetes mellitus, for ex­ ample, the regulation of blood glucose concentration is defective as a result of the lack of or insensitivity to in­ sulin, with profound medical consequences. When the external perturbation is not merely tran­ sient, or when one kind of cell develops into another, the adjustments in cell composition and metabolism can be more dramatic and may require significant and lasting changes in the allocation of energy and synthetic pre­ cursors to bring about a new dynamic steady state . Con­ sider, for example, the differentiation of stem cells in the bone marrow into erythrocytes. The precursor cell contains a nucleus, mitochondria, and little or no hemo­ globin, whereas the fully differentiated erythrocyte con­ tains prodigious amounts of hemoglobin but has neither nucleus nor mitochondria; the cell's composition has permanently changed in response to external develop­ mental signals , with accompanying changes in metabo­ lism. This cellular differentiation requires precise regulation of the levels of cellular proteins. In the course of evolution, organisms have acquired a remarkable collection of regulatory mechanisms for main­ taining homeostasis at the molecular, cellular, and organis­ mal levels, as reflected in the proportion of genes that encode regulatory machinery. In humans, about 4,000 genes C� 12% of all genes) encode regulatory proteins, in­ cluding a variety of receptors, regulators of gene expres­ sion, and more than 500 different protein kinases! In many cases, the regulatory mechanisms overlap: one enzyme is subject to regulation by several different mechanisms.

[571]

Both the Amount a n d the Catalytic Activity of an Enzyme Can Be Regu lated

The flux through an enzyme-catalyzed reaction can be modulated by changes in the number of enzyme mole­ cules or by changes in the catalytic activity of each enzyme molecule already present. Such changes occur on time scales from milliseconds to many hours, in re­ sponse to signals from within or outside the cell. Very rapid allosteric changes in enzyme activity are generally triggered locally, by changes in the local concentration of a small molecule-a substrate of the pathway in which that reaction is a step (say, glucose for glycoly­ sis) , a product of the pathway (ATP from glycolysis) , or a key metabolite or cofactor (such as NADH) that indi­ cates the cell's metabolic state. Second messengers (such as cyclic AMP and Ca2+) generated intracellularly in response to extracellular signals (hormones, cy­ tokines, and so forth) also mediate allosteric regulation, on a slightly slower time scale set by the rate of the signal-transduction mechanism (see Chapter 12). Extracellular signals (Fig. 15-2 (D) may be hormonal (insulin or epinephrine, for example) or neuronal (acetyl­ choline) , or may be growth factors or cytokines. The num­ ber of molecules of a given enzyme in a cell is a fimction of the relative rates of synthesis and degradation of that en­ zyme. The rate of synthesis can be adjusted by the activa­ tion (in response to some outside signal) of a transcription factor (Fig. 1 5-2, @; described in more detail in Chapter 28) . Transcription factors are nuclear proteins that, when activated, bind specific DNA regions (response ele­ ments) near a gene's promoter (its transcriptional starting point) and activate or repress the transcription of that gene, leading to increased or decreased synthesis of the encoded protein. Activation of a transcription factor is sometimes the result of its binding of a specific ligand and sometimes the result of its phosphorylation or dephosphorylation. Each gene is controlled by one or more response elements that are recognized by specific transcription factors. Some genes have several response elements and are therefore controlled by several different transcription factors, re­ sponding to several different signals. Groups of genes en­ coding proteins that act together, such as the enzymes of glycolysis or gluconeogenesis, often share common re­ sponse element sequences, so that a single signal, acting through a particular transcription factor, turns all of these genes on and off together. The regulation of carbohydrate metabolism by specific transcription factors is described in Section 15.3. The stability of messenger RNAs-their resistance to degradation by cellular ribonucleases (Fig. 15-2, @)­ varies, and the amount of a given mRNA in the cell is a function of its rates of synthesis and degradation (Chap­ ter 26) . The rate at which an mRNA is translated into a protein by ribosomes (Fig. 15-2, @) is also regulated, and depends on several factors described in detail in Chapter 27. Note that an n-fold increase in an mRNA does not always mean an n-fold increase in its protein product.

Lsn�

P r i nciples of Metabo l i c Reg u l a t i o n



1



Receptor



(,) Extracellular

ignal

l

fc;\, Enzyme undergoes

\V pho phorylation/dephosphorylation

� Transcription of \.!:.J pecific genets

®

Enzyme binds ligand allosteric effector)

Nucleus

G)

..� �!� .... � ... . ...�... ;, �

FIGURE 15-2 Factors affecting the activity of enzymes. The total activity of an enzyme can be changed by altering the number of its molecules in the cell, or its effective activity in a subcellular compartment (G)

Once synthesized, protein molecules have a finite lifetime, which may range from minutes to many days (Table 1 5-1). The rate of protein degradation (Fig. 15-2, @) differs from one enzyme to another and depends on the conditions in the cell. Some proteins are tagged by the covalent attachment of ubiquitin for degradation in proteasomes, as discussed in Chapter 28 (see, for example, the case of cyclin, in Fig. 12-46) . Rapid turnover (synthesis followed by degradation) is energetically expensive, but proteins with a short half­ life can reach new steady state levels much faster than those with a long half-life, and the benefit of this quick responsiveness must balance or outweigh the cost to the cell.

Tissue

Average Half-life of Proteins In Mammalian---Tissues ----� Half-life (days)

Liver

0.9

Kidney

1.7

Heart

4.1

Brain

4.6

Muscle

En do pia mic reticulum

{;\ Protein degradation \.V (ubiquitin; proteasome)

mRNA translation on ribosome

TABLE 15-1

(";;\. Enzyme sequeste-red \!V in ubcellula.r organelle

10.7

through @l, or by modulating the activity of existing molecules (Q) through @l, as detailed in the text. An enzyme may be influenced by a combination of such factors.

Yet another way to alter the effective activity of an enzyme is to sequester the enzyme and its substrate in different compartments (Fig. 15-2, @). In muscle, for example, hexokinase cannot act on glucose until the sugar enters the myocyte from the blood, and the rate at which it enters depends on the activity of glucose trans­ porters (see Table 1 1-3) in the plasma membrane. Within cells, membrane-bounded compartments segre­ gate certain enzymes and enzyme systems, and the transport of substrate across these intracellular mem­ branes may be the limiting factor in enzyme action. By these several mechanisms for regulating enzyme level, cells can dramatically change their complement of enzymes in response to changes in metabolic circum­ stances. In vertebrates, liver is the most adaptable tis­ sue; a change from a high-carbohydrate to high-lipid diet, for example, affects the transcription of hundreds of genes and thus the levels of hundreds of proteins. These global changes in gene expression can be quanti­ fied by the use of DNA microarrays (see Fig. 9-22) that display the entire complement of mRNAs present in a given cell type or organ (the transcriptome) or by two­ dimensional gel electrophoresis (see Fig. 3-2 1 ) that displays the protein complement of a cell type or organ (its proteome) . Both techniques offer great insights into metabolic regulation. The effect of changes in the

1 5 . 1 Regul ation of Metabolic Pathways

proteome is often a change in the total ensemble of low molecular weight metabolites, the metabolome . Once the regulatory mechanisms that involve pro­ tein synthesis and degradation have produced a certain number of molecules of each enzyme in a cell, the activity of those enzymes can be further regulated in several other ways: by the concentration of substrate, the presence of allosteric effectors, covalent modifica­ tions, or binding of regulatory proteins-all of which can change the activity of an individual enzyme molecule (Fig. 1 5-2, (j) to @). All enzymes are sensitive to the concentration of their substrate(s) (Fig. 15-2, (j)). Recall that in the sim­ plest case (an enzyme that follows Michaelis-Menten ki­ netics), the initial rate of the reaction is half-maximal when the substrate is present at a concentration equal to Km (that is, when the enzyme is half-saturated with substrate) . Activity drops off at lower [S] , and when [S] < < Km, the reaction rate is linearly dependent on [S]. This is important because intracellular concentrations of substrate are often in the same range as, or lower than, Km. The activity of hexokinase, for example, changes with [glucose], and intracellular [glucose] varies with the concentration of glucose in the blood. As we will see, the different forms (isozymes) of hexokinase have different Km values and are therefore differently affected by changes in intracellular [glucose], in ways that make sense physiologically. - WORKED EXAMPLE 1 S-1

Activity of a Glucose Transporter

If Kt (the equivalent of Km) for the glucose transporter in liver (GLUT2) is 40 mM, calculate the effect on the rate of glucose flux into a hepatocyte of increasing the blood glucose concentration from 3 mM to 10 mM. Solution: We use Equation 1 1-1 (p. 393) to find the ini­

tial velocity (flux) of glucose uptake.

At 3 mM glucose Vo

= =

Vmax ( 3 mM)/(40 mM

Vmax (3 mM/43 mM)

3 mM)

+ =

0.07 Vmax

At 10 mM glucose Vo

=

=

Vmax (10 mM)/(40 mM

Vmax (10 mM/50 mM)

+

=

[s73]

Required change in [S] to increase V0 from 10% to 90% Vmax

Hill coefficient

(nn) 0.5

X6,600

1.0

X81

2.0

X9

3.0

X4.3

4.0

X3

to sigmoid kinetics, or vice versa (see Fig. 1 5-14b, for example) . In the steepest part of the sigmoid curve, a small change in the concentration of substrate, or of allosteric effector, can have a large impact on reaction rate. Recall from Chapter 5 (p. 1 64) that the cooperativ­ ity of an allosteric enzyme can be expressed as a Hill coefficient, with higher coefficients meaning greater cooperativity. For an allosteric enzyme with a Hill coefficient of 4, activity increases from 10% vmax to 90% Vrnax with only a 3-fold increase in [S], compared with the 8 1 -fold rise in [S] needed by an enzyme with no cooperative effects (Hill coefficient of 1 ; Table 15-2) . Covalent modifications of enzymes or other proteins (Fig. 15-2, @) occur within seconds or minutes of a reg­ ulatory signal, typically an extracellular signal. By far the most common modifications are phosphorylation and de­ phosphorylation (Fig. 1 5-3 ) ; up to half the proteins in a eukaryotic cell are phosphorylated under some circum­ stances. Phosphorylation by a specific protein kinase may alter the electrostatic features of an enzyme's active site cause movement of an inhibitory region of the en­ z e protein out of the active site, alter the enzyme's in­ teraction with other proteins, or force conformational changes that translate into changes in Vmax or Km. For



Protein ---- -�ubstrate .... 1Sertrhrtryr-;-oH "

�......._�

�"

10 mM) 0.20 Vmax

So a rise in blood glucose from 3 mM to 1 0 mM increases the rate of glucose influx into a hepatocyte by a factor of 0.20/0.07 = 3. FIGURE 1 5-3 Protein phosphorylation and dephosphorylation. Pro­

Enzyme activity can be either increased or decreased by an allosteric effector (Fig. 1 5-2, @; see Fig. 6-34) . Allosteric effectors typically convert hyperbolic kinetics

te in kinases transfer a phosphoryl group from ATP to a Ser, Thr, or Tyr residue in an enzyme or other prote i n substrate . Prote in phosphatases remove the phosphoryl group as P; .

[574]

Principles of Meta b o l i c Regul ation

covalent modification to be useful in regulation, the cell must be able to restore the altered enzyme to its original activity state. A family of phosphoprotein phosphatases, at least some of which are themselves under regulation, catalyzes the dephosphorylation of proteins. Finally, many enzymes are regulated by association with and dissociation from another, regulatory protein (Fig. 1 5-2, @) . For example, the cyclic AMP-dependent protein kinase (PKA; see Fig. 12-6) is inactive until cAMP binding separates catalytic from regulatory subunits. These several mechanisms for altering the flux through a step in a metabolic pathway are not mutually exclusive. It is very common for a single enzyme to be regulated at the level of transcription and by both al­ losteric and covalent mechanisms. The combination provides fast, smooth, effective regulation in response to a very wide array of perturbations and signals. In the discussions that follow, it is useful to think of changes in enzymatic activity as serving two distinct though complementary roles. We use the term metabolic regulation to refer to processes that serve to maintain homeostasis at the molecular level-to hold some cellular parameter (concentration of a metabolite, for example) at a steady level over time, even as the flow of metabolites through the pathway changes. The term metabolic con­ trol refers to a process that leads to a change in the out­ put of a metabolic pathway over time, in response to some outside signal or change in circumstances. The distinc­ tion, although useful, is not always easy to make. Reactions Fa r from Equilibrium in Cel ls Are Com m on Points of Regulation

For some steps in a metabolic pathway the reaction is close to equilibrium, with the cell in its dynamic steady state (Fig. 15-4). The net flow of metabolites through these steps is the small difference between the rates of the forward and reverse reactions, rates that are very similar when a reaction is near equilibrium. Small changes in substrate or product concentration can produce large

CD

�A

net rate:

10.01

v=

0.01 10

v=

® B

V=

200

190 10

v=

® c

V=

500

490 10

V=

D

FIGURE 15-4 Near-equilibrium and nonequilibrium steps in a meta­

bolic pathway. Steps (I) and

Q) of this pathway are near equi l ibrium i n the cell; for each step, the rate (V) of the forward reaction is only sl ightly greater than the reverse rate, so the net forward rate (1 0) is rel­ atively low and the free-energy change, D.C', is close to zero. An in­ crease in [C] or [D] can reverse the di rection of these steps. Step G) is mai ntained in the cell far from equ i l ibrium; its forward rate greatly ex­ ceeds its reverse rate. The net rate of step G) (1 0) is much larger than the reverse rate (0.01 ) and is identical to the net rates of steps (I) and Q) when the pathway is operating in the steady state. Step G) has a large, negative D.C'.

changes in the net rate, and can even change the direc­ tion of the net flow. We can identify these near-equilib­ rium reactions in a cell by comparing the mass action ratio, Q, with the equilibrium constant for the reaction, K�q- Recall that for the reaction A + B � C + D, Q [C] [D]/[A] [B]. When Q and K�q are within 1 to 2 orders of magnitude of each other, the reaction is near equilibrium. This is the case for 6 of the 10 steps in the glycolytic path­ way (Table 15-3). Other reactions are far from equilibrium in the cell. For example, K�q for the phosphofructokinase-! (PFK-1) reaction is about 1,000, but Q ([fructose 1,6bisphosphate] [ADP]/[fructose 6-phosphate] [ATP]) in a hepatocyte in the steady state is about 0. 1 (Table 15-3) . It is because the reaction is so far from equilibrium that the process is exergonic under cellular conditions and tends to go in the forward direction. The reaction is held far from equilibrium because, under prevailing cellular conditions of substrate, product, and effector concen­ trations, the rate of conversion of fructose 6-phosphate to fructose 1 ,6-bisphosphate is limited by the activity of PFK-1, which is itself limited by the number of PFK-1 molecules present and by the actions of allosteric effec­ tors. Thus the net forward rate of the enzyme-catalyzed reaction is equal to the net flow of glycolytic intermedi­ ates through other steps in the pathway, and the reverse flow through PFK- 1 remains near zero. The cell cannot allow reactions with large equilib­ rium constants to reach equilibrium. If [fructose 6-phos­ phate], [ATP] , and [ADP] in the cell were held at typical levels (low millimolar concentrations) and the PFK-1 re­ action were allowed to reach equilibrium by an increase in [fructose 1,6-bisphosphate] , the concentration of fructose 1 ,6-bisphosphate would rise into the molar range, wreaking osmotic havoc on the cell. Consider an­ other case: if the reaction ATP � ADP + Pi were al­ lowed to approach equilibrium in the cell, the actual free-energy change (LlG') for that reaction (LlGP; see Worked Example 1 3-2, p. 503) would approach zero, and ATP would lose the high phosphoryl group transfer potential that makes it valuable to the cell. It is therefore essential that enzymes catalyzing ATP breakdown and other highly exergonic reactions in a cell be sensitive to regulation, so that when metabolic changes are forced by external circumstances, the flow through these en­ zymes will be adjusted to ensure that [ATP] remains far above its equilibrium level. When such metabolic changes occur, the activities of enzymes in all intercon­ nected pathways adjust to keep these critical steps away from equilibrium. Thus, not surprisingly, many enzymes (such as PFK-1) that catalyze highly exergonic reac­ tions are subject to a variety of subtle regulatory mech­ anisms. The multiplicity of these adjustments is so great that we cannot predict by examining the properties of any one enzyme in a pathway whether that enzyme has a strong influence on net flow through the entire path­ way. This complex problem can be approached by meta­ bolic control analysis, as described in Section 15.2. =

15.1 Regul ation of Metabolic Pathways

[s7s]

TABLE 15-3

Mass action ratio, Q

K�q

Enzyme

Aldolase

Liver

Heart

-27

No

-14

-23

9 X 10-6

Yes

+24

2.4 x 10-1

Yes

2 x 10-2

8 X 10-2

No

1.0 X 103

9 x 10-2

3 X 10-2

1.2 x 10-6

1.0 X 10-4 4 x w-2

Triose phosphate isomerase

!!.G' (kJ/mol) in heart

!!.G'o (kJ/mol) -17

1 X 103

Hexokinase PFK-1

Reaction near equilibrium in vivo?*

-6.0

+7.5

+3.8

Glyceraldehyde 3-phosphate dehydrogenase + phosphoglycerate kinase Phosphoglycerate mutase Enolase

2 X 103

6 X 102

1 X 10-1

1 x w-1 2.9

3

Pyruvate kinase

2 X 104

Phosphoglucose isomerase

4 X 10-1

7 x w-1 3.1 X 10-1

1.2 X 10-1 1.4

Yes

+4.4

+0.6

Yes

-3.2

-0.5 -17

-31

No

40 2.4 X 10-1

+3.5

-13

Yes

9.0

Yes

+2.2

No

-5.0

-1.4

Pyruvate carboxylase + PEP carboxykinase Glucose 6-phosphatase

Source: K�q

and Q from Newsholme,

7

1 X 10-3

E.A. & Start, C. (1973)

Regulation in Metabolism, Wiley Press, New York, pp. 97,263.

*For simplicity, any reaction for which the absolute value of the calculated

llG'

After the protection of its DNA from damage, perhaps nothing is more important to a cell than maintaining a constant supply and concentration of ATP. Many ATP ­ using enzymes have Km values between 0.1 and 1 mM, and the ATP concentration in a typical cell is about 5 mM. If [ATP ] were to drop significantly, these enzymes would be less than fully saturated by their substrate (ATP) , and the rates of hundreds of reactions that involve ATP would decrease (Fig. 1 5-5 ) ; the cell would probably not survive this kinetic effect on so many reactions. There is also an important thermodynamic effect of lowered [ATP]. Because ATP is converted to ADP or AMP when "spent" to accomplish cellular work, the [ATP ]/[ADP ] ratio profoundly affects all reactions that employ these cofactors. (The same is true for other important cofactors, such as NADH/NAD + and NADPH/NADP + .) For example, consider the reaction catalyzed by hexokinase:

K�

data.

11G'

=

11G'• + RT ln

[ADP] (glucose 6-phosphate] [ATP][glucose]

Because an alteration of this driving force profoundly influences every reaction that involves ATP, organ­ isms have evolved under strong pressure to develop regulatory mechanisms responsive to the [ATP ]/[ADP ] ratio. AMP concentration is an even more sensitive indi­ cator of a cell's energetic state than is [ATP ] . Normally

Vmax

---------------- -------- -- -----

ADP + glucose 6-phosphate

[ADPl.q[glucose 6-phosphateleq =

llG'0 were calculated from these

determines the magnitude and sign of !!.G' and therefore the driving force, !!.G', of the reaction:

Metabolic Regulation

------+

and

is less than 6 is considered near equilibrium.

Adenine N ucleotides Play Special Roles in

ATP + glucose

llG'

-5.0

-17

Yes

1.2 X 102

8.5 X 102

- 23

[ATP]eq[glucoseleq

=

2 X 103

Note that this expression holds true only when reac­ tants and products are at their equilibrium concentra­ tions, where !!.G' = 0. At any other set of concentrations, !!.G' is not zero. Recall (from Chapter 1 3) that the ratio of products to substrates (the mass action ratio, Q)

5

10

15

20

25

30

35

40

ATP concentration [mM]

FIGURE 15-5 Effect of ATP concentration on the initial velocity of a typical AlP-dependent enzyme. These experi mental data y ield a Km for

ATP of 5 mM. The concentration of ATP in animal tissues is -5 mM.

[Y76=

Prin ciples of Metabo lic Regu lation

TABLE lS-4 Concentration after ATP depletion

Concentration before ATP depletion

Adenine nucleotide

(mM)

(mM)

Relative change 10%

ATP

5. 0

4.5

ADP

1.0

1.0

0

0.6

600%

AMP

0. 1

by a reduced nutrient supply or by increased exercise. The action of AMPK (not to be confused with the cycl ic AMP-dependent protein kinase; see Section 15.5) in­ creases glucose transport and activates glycolysis and fatty acid oxidation, while suppressing energy-requiring processes such as the synthesis of fatty acids, choles­ terol, and protein (Fig. 1 5-6) . We discuss AMPK fur­ ther, and the detailed mechanisms by which it effects these changes, in Chapter 23. In addition to ATP, hundreds of metabolic interme­ diates also must be present at appropriate concentra­ tions in the cell. To take just one example: the glycolytic intermediates dihydroxyacetone phosphate and 3phosphoglycerate are precursors of triacylglycerols and serine, respectively. When these products are needed, the rate of glycolysis must be adjusted to provide them without reducing the glycolytic production of ATP. The

cells have a far higher concentration of ATP (5 to 10 mM) than of AMP ( AMP + ATP

If ATP is consumed such that its concentration drops 10%, the relative increase in [AMP] is much greater than that of [ADP] (Table 15-4). It is not surprising, therefore, that many regulatory processes are keyed to changes in [AMP]. Probably the most important media­ tor of regulation by AMP is AMP-activated protein kinase (AMPK) , which responds to an increase in [AMP] by phosphorylating key proteins and thus regu­ lating their activities. The rise in [AMP] may be caused Brain (hypothalamus)

Leptin, adiponectin \

__

t

t[AMP] -1-[ATP]

Food intake

\

\

\

EJNS

\

Exercise

'

'' '

/

/ / /

/

/

/

/

Fatty acid uptake, oxidation Glucose uptake Mitochondrial biogenesis

Heart -... - - -

--

Fatty acid oxidation Glucose uptake Glycolysis

Fatty acid synthesis

Lipolysis

FIGURE 1 5-6 Role of AMP-activated protein kinase (AMPK) in carbo­ hydrate and fat metabolism. AMPK is activated by elevated [AMP] or

decreased [ATP], by exercise, by the sympathetic nervous system (SNS), or by peptide hormones produced in adipose tissue (/eptin and adiponectin, described in more deta i l in Chapter 23). When activated, AMPK phosphorylates target proteins and shifts metabol ism in a

_

\ \ \ \ \ \

I I \

Skeletal muscle

Pancreatic fJ cell

---���

secretion

Fatty acid synthesis Cholesterol synthesis variety of tissues away from energy-consu ming processes such as the synthesis of glycogen, fatty acids, and cholesterol; shifts metabol ism in extrahepatic tissues to the use of fatty acids as a fuel; and triggers gluconeogenesis in the l iver to provide glucose for the brain. In the hypothalamus, AMPK sti m u lates feeding behavior to provide more dietary fuel.

1 5.2 A n a lysis of Meta b o l i c Control

same is true for maintaining the levels of other impor­ tant cofactors, such as NADH and NADPH: changes in their mass action ratios (that is, in the ratio of reduced to oxidized cofactor) have global effects on metabolism. Of course, priorities at the organismal level have also driven the evolution of regulatory mechanisms. In mammals, the brain has virtually no stored source of energy, depending instead on a constant supply of glu­ cose from the blood. If blood glucose drops from its nor­ mal concentration of 4 to 5 mM to half that level, mental confusion results, and a fivefold reduction in blood glu­ cose can lead to coma and death. To buffer against changes in blood glucose concentration, release of the hormones insulin and glucagon, elicited by high or low blood glucose, respectively, triggers metabolic changes that tend to return the blood glucose concentration to normal. Other selective pressures must also have operated throughout evolution, selecting for regulatory mecha­ nisms that accomplish the following: 1. Maximize the efficiency of fuel utilization by preventing the simultaneous operation of pathways in opposite directions (such as glycolysis and gluconeogenesis). 2. Partition metabolites appropriately between alternative pathways (such as glycolysis and the pentose phosphate pathway). 3.

Draw on the fuel best suited for the immediate needs of the organism (glucose, fatty acids, glycogen, or amino acids).

4. Slow down biosynthetic pathways when their products accumulate. The remaining chapters of this book present many ex­ amples of each kind of regulatory mechanism.

S U M M A RY 1 5 . 1 •





Regulation of Metabolic Pathways

In a metabolically active cell in a steady state, intermediates are formed and consumed at equal rates. When a transient perturbation alters the rate of formation or consumption of a metabolite, compensating changes in enzyme activities return the system to the steady state. Cells regulate their metabolism by a variety of mechanisms over a time scale ranging from less than a millisecond to days, either by changing the activity of existing enzyme molecules or by changing the number of molecules of a specific enzyme. Various signals activate or inactivate transcription factors, which act in the nucleus to regulate gene expression. Changes in the transcriptome lead to changes in the proteome, and ultimately in the metabolome of a cell or tissue.







[sn]

In multistep processes such as glycolysis, certain reactions are essentially at equilibrium in the steady state; the rates of these reactions rise and fall with substrate concentration. Other reactions are far from equilibrium; these steps are typically the points of regulation of the overall pathway. Regulatory mechanisms maintain nearly constant levels of key metabolites such as ATP and NADH in cells and glucose in the blood, while matching the use or production of glucose to the organism's changing needs. The levels of ATP and AMP are a sensitive reflection of a cell's energy status, and when the [ATP]/[AMP] ratio decreases, the AMP-activated protein kinase (AMPK) triggers a variety of cellular responses to raise [ATP] and lower [AMP].

15.2 Analysis of Metabolic Control Detailed studies of metabolic regulation were not feasible until the basic chemical steps in a pathway had been clarified and the responsible enzymes characterized. Beginning with Eduard Buchner's discovery (c. 1900) that an extract of broken yeast cells could con­ vert glucose to ethanol and C02, a major thrust of bio­ chemical research was to deEduard Buchner, duce the steps by which this 1860-1917 transformation occurred and to purify and characterize the enzymes that catalyzed each step. By the middle of the twentieth century, all 10 enzymes of the glycolytic pathway had been purified and characterized. In the next 50 years much was learned about the regulation of these enzymes by intra­ cellular and extracellular signals, through the kinds of allosteric and covalent mechanisms described in this chapter. The conventional wisdom was that in a linear pathway such as glycolysis, catalysis by one enzyme must be the slowest and must therefore determine the rate of metabolite flow, or flux, through the whole path­ way. For glycolysis, PFK- 1 was considered the rate-lim­ iting enzyme, because it was known to be closely regulated by fructose 2 ,6-bisphosphate and other al­ losteric effectors. With the advent of genetic engineering technology, it became possible to test this "single rate-determining step" hypothesis by increasing the concentration of the enzyme that catalyzes the "rate-limiting step" in a path­ way and determining whether flux through the pathway increases proportionally. Most often it does not; the sim­ ple solution (a single rate-determining step) is wrong. It has now become clear that in most pathways the control of flux is distributed among several enzymes, and the

[578]

Prin ciples of Meta b o l i c Regulation

extent to which each contributes to the control varies with metabolic circumstances-the supply of the start­ ing material (say, glucose) , the supply of oxygen, the need for other products derived from intermediates of the pathway (say, glucose 6-phosphate for the pentose phosphate pathway in cells synthesizing large amounts of nucleotides), the effects of metabolites with regula­ tory roles, and the hormonal status of the organism (such as the levels of insulin and glucagon) , among other factors. Why are we interested in what limits the flux through a pathway? To understand the action of hor­ mones or drugs, or the pathology that results from a fail­ ure of metabolic regulation, we must know where control is exercised. If researchers wish to develop a drug that stimulates or inhibits a pathway, the logical target is the enzyme that has the greatest impact on the flux through that pathway. And the bioengineering of a microorganism to overproduce a product of commercial value (p. 312) requires a knowledge of what limits the flux of metabolites toward that product. The Contribution of Each Enzyme to Flux through a Pathway Is Experimentally Measurable

There are several ways to determine experimentally how a change in the activity of one enzyme in a pathway affects metabolite flux through that pathway. Consider the experimental results shown in Figure 15-7. When a sample of rat liver was homogenized to release all solu­ ble enzymes, the extract carried out the glycolytic con­ version of glucose to fructose 1 ,6-bisphosphate at a measurable rate. (This experiment, for simplicity, fo­ cused on just the first part of the glycolytic pathway.)

0.10 0.08

1> P1

-

\

cose 6-phosphate by glucose 6-

Capillary

l

GLUT2

P; transporter (T3) Increased blood glucose concentration

phosphatase of the ER. The catalytic site of glucose 6-phosphatase faces the lumen of the ER. A glucose 6phosphate (G6P) transporter (Tl ) carries the substrate from the cy­ tosol to the lumen, and the prod­ ucts glucose and P, pass to the cytosol on specific transporters (T2 and T3). G lucose leaves the cel l via the G LUT2 transporter in the plasma membrane.

CR20H 0

o- Glucosyl group

Luis Lelo i r, 1 906-1 987

starch, cellulose, and more com­ plex extracellular polysaccharides. They are also key intermediates in the production of the aminohex­ oses and deoxyhexoses found in some of these polysaccharides, and in the synthesis of vitamin C (1-ascorbic acid) . The role of sugar nucleotides in the biosyn­ thesis of glycogen and many other carbohydrate derivatives was dis­ covered in 1 953 by the Argentine biochemist Luis Leloir.

H

Uridine

HO ?



-o-P-O-P-o-

1

0

I

O- C H2

UDP-glucose (a sugar nucleotide)

[s98]

P r i n c i ples of Meta b o l i c Reg u l ation

B OX 1 5 -4

Much of what is written in present-day biochemistry text­ books about the metabolism of glycogen was discovered between about 1 925 and 1 950 by the remarkable husband and wife team of Carl F. Cori and Gerty T. Cori. Both trained in medicine in Europe at the end of World War I (she completed premedical studies and medical school in one year!) . They left Europe together in 1922 to establish research laboratories in the United States, first for nine years in Buffalo, New York, at what is now the Roswell Park Memorial Institute, then from 1931 until the end of their lives at Washington University in St. Louis. In their early physiological studies of the origin and fate of glycogen in animal muscle , the Goris

The Caris i n Gerty Cori's laboratory, around 1 947.

The suitability of sugar nucleotides for biosynthetic reactions stems from several properties : 1.

Their formation is metabolically irreversible, contributing to the irreversibility of the synthetic pathways in which they are intermediates. The condensation of a nucleoside triphosphate with a hexose ! -phosphate to form a sugar nucleotide has a small positive free-energy change , but the reaction releases PPi, which is rapidly hydrolyzed by inorganic pyrophosphatase (Fig. 15-29), in a reaction that is strongly exergonic (�G '0 - 19.2 kJ/mol) . This keeps the cellular concentration of PPi low, ensuring that the =

demonstrated the conversion of glycogen to lactate in tissues, movement of lactate in the blood to the liver, and, in the liver, reconversion of lactate to glycogen­ a pathway that came to be known as the Cori cycle (see Fig. 23-20) . Pursuing these observations at the bio­ chemical level, they showed that glycogen was mobi­ lized in a phosphorolysis reaction catalyzed by the enzyme they discovered, glycogen phosphorylase. They identified the product of this reaction (the "Cori ester") as glucose 1 -phosphate and showed that it could be reincorporated into glycogen in the reverse reaction. Although this did not prove to be the reaction by which glycogen is synthesized in cells, it was the first in vitro demonstration of the synthesis of a macro­ molecule from simple monomeric subunits, and it in­ spired others to search for polymerizing enzymes. Arthur Kornberg, discoverer of the first DNA poly­ merase, said of his experience in the Goris' lab, "Glyco­ gen phosphorylase , not base pairing, was what led me to DNA polymerase." Gerty Cori became interested in human genetic diseases in which too much glycogen is stored in the liver. She was able to identify the biochemical defect in several of these diseases and to show that the diseases could be diagnosed by assays of the en­ zymes of glycogen metabolism in small samples of tis­ sue obtained by biopsy. Table 1 summarizes what we now know about 13 genetic diseases of this sort. • Carl and Gerty Cori shared the Nobel Prize in Phys­ iology or Medicine in 1 94 7 with Bernardo Houssay of Ar­ gentina, who was cited for his studies of hormonal regulation of carbohydrate metabolism. The Cori labora­ tories in St. Louis became an international center of bio­ chemical research in the 1 940s and 1 950s, and at least six scientists who trained with the Goris became Nobel laureates: Arthur Kornberg (for DNA synthesis, 1 959) , Severo Ochoa (for RNA synthesis , 1959) , Luis Leloir (for the role of sugar nucleotides in polysaccharide syn­ thesis, 1 970) , Earl Sutherland (for the discovery of

actual free-energy change in the cell is favorable. In effect, rapid removal of the product, driven by the large, negative free-energy change of PPi hydrolysis, pulls the synthetic reaction forward, a common strategy in biological polymerization reactions. 2 . Although the chemical transformations o f sugar nucleotides do not involve the atoms of the nucleotide itself, the nucleotide moiety has many groups that can undergo noncovalent interactions with enzymes; the additional free energy of binding can contribute significantly to catalytic activity (Chapter 6; see also p . 297) .

15.4 The Meta bo l i s m of G l ycogen i n A n i m a l s

cAMP in the regulation of carbohydrate metabolism, 1971) , Christian de Duve (for subcellular fractionation,

[:;9

D-glucose 6-phosphate + ADP

Glucose 6-phosphate � glucose 1-phosphate

[6oo]

Principles of Meta bolic Regulation

FIGURE 1 5-29 Formation of a sugar nucleotide. A con­ densation reaction occurs between a nucleoside triphos­ phate (NTP) and a sugar phosphate. The negatively charged oxygen on the sugar phosphate serves as a nucle­ oph i le, attack i ng the a phosphate of the nucleoside triphosphate and displacing pyrophosphate. The reaction is pulled in the forward di rection by the hydrolysis of PP, by i norganic pyrophosphatase.

� 0 0 II / '11 ·�� · � II lsugar �O-P-0- + 0-P-0 P 0-P-O�llibose HBase l i0 I I I I oo o oSugar phosphate

NTP

�I

NDP·>- ugar

p)TOpho;phoJ-yl as

0 0 II II l sugar � O-P-0-P-O �llibose H Base l I I ao-

0 0 II II 0-P--0-P-0 6

te l

6

sugar nucleotide (NDP-sugar)

Pyrophosphate (PP;) inorg

pyrophosphal

2

e

0 I -o-P-OH I

-o Phosphate (P;)

Net reaction: Sugar phosphate + NTP

+

UTP



NDP-sugar + 2P;

glucose formation, because pyrophosphate is rapidly hy­ drolyzed by inorganic pyrophosphatase (Fig. 1 5-29) . UDP-glucose is the immediate donor of glucose residues in the reaction catalyzed by glycogen syn­ thase, which promotes the transfer of the glucose residue from UDP-glucose to a nonreducing end of a branched glycogen molecule (Fig. 15-30). The overall

The product of this reaction is converted to UDP-glucose by the action of UDP-glucose pyrophosphorylase, in a key step of glycogen biosynthesis:

Glucose 1-phosphate



UDP-glucose + PP;

Notice that this enzyme is named for the reverse reaction; in the cell, the reaction proceeds in the direction of UDP-

6CH20H 15 0 H H H ��� H�

FIGURE 1 5-30 Glycogen synthesis. A glycogen chain is elongated by glycogen synthase. The enzyme transfers the glucose residue of UDP­ glucose to the nonreducing end of a glycogen branch (see Fig. 7-1 4) to make a new (al --?4) l inkage.

H HO

0 II -o-P-0-P-0 II I 0 O-CH2

-o

C'H 0 11

-- n . u 11

. , �·

UDP-glucose

OH

H

0

OH

Nonreducing end of a glycogen chain with n residues

(n > 4)

�Q H H HI 4� OH H / 1 HO ""'--/ -=! � v c , 8-CoA cis-D.3-

Dodecenoyl-CoA

..\ J.

Oxidation of Unsaturated Fatty Acids Requires

un

(

A '

mrr t "

Two Additional Reactions

The fatty acid oxidation sequence just described is typi­ cal when the incoming fatty acid is saturated (that is, has only single bonds in its carbon chain) . However, most of the fatty acids in the triacylglycerols and phos­ pholipids of animals and plants are unsaturated, having one or more double bonds. These bonds are in the cis configuration and cannot be acted upon by enoyl-CoA hydratase, the enzyme catalyzing the addition of H20 to 2 the trans double bond of the A -enoyl-CoA generated during f3 oxidation. 1\vo auxiliary enzymes are needed for f3 oxidation of the common unsaturated fatty acids: an isomerase and a reductase. We illustrate these auxil­ iary reactions with two examples.



0

t li

0

H I'

/j

c, H

trans-D.2-

Dodecenoyl-CoA

{j oxidnuon ::-
c-IJ-yhyrdrgo0xnyabsuety.-atc Acetoacetate

Acetone

NADH + H+

aceloac • · � • l dt>carbox ,.· l ..ua:.

OH I

�o

CH3-C-CH2-C



'o-

n-.B-Hydroxybutyrate

Ketone Bodies, Formed i n the liver, Are Exported to Other Organs as Fuel

The first step in the formation of acetoacetate, occur­ ring in the liver (Fig. 1 7-18), is the enzymatic conden­ sation of two molecules of acetyl-GoA, catalyzed by thiolase; this is simply the reversal of the last step of ,B oxidation. The acetoacetyl-GoA then condenses with acetyl-GoA to form /3-hydroxy-p-methylglutaryl-CoA (HMG-CoA), which is cleaved to free acetoacetate and acetyl-GoA. The acetoacetate is reversibly reduced by D-,(3-hydroxybutyrate dehydrogenase, a mitochondrial enzyme, to D-,(3-hydroxybutyrate . This enzyme is spe­ cific for the D stereoisomer; it does not act on L-,(3hydroxyacyl-GoAs and is not to be confused with L-,(3-hydroxyacyl-GoA dehydrogenase of the ,(3-oxidation pathway. In healthy people, acetone is formed in very small amounts from acetoacetate, which is easily de­ carboxylated, either spontaneously or by the action of

0

II

,_

CH:l -C-CHa

Acetone

::; (' ( )2

NAD+ o



OH I

/C-CH2 -CH-CHa

()

D-,8-Hydroxybutyrate

FIGURE 1 7-1 8 Formation of ketone bodies from acetyi-CoA. Healthy, wel l-nourished individuals produce ketone bodies at a relatively low rate. When acetyi-CoA accumulates (as in starvation or untreated dia­ betes, for example), thiolase catalyzes the condensation of two acetyi­ CoA molecules to acetoacetyi-CoA, the parent compound of the three ketone bodies. The reactions of ketone body formation occur in the matrix of l iver mitochondria. The six-carbon compound !3-hydroxy-/3methylglutaryi-CoA (HMG-CoA) is also an intermediate of sterol biosynthesis, but the enzyme that forms HMG-CoA in that pathway is cytosolic. HMG-CoA lyase is present only in the mitochondrial matrix.

acetoacetate decarboxylase (Fig. 1 7-18). Because individuals with untreated diabetes produce large quan­ tities of acetoacetate, their blood contains significant amounts of acetone, which is toxic. Acetone is volatile and imparts a characteristic odor to the breath, which is sometimes useful in diagnosing diabetes. • In extrahepatic tissues, D-,(3-hydroxybutyrate is oxi­ dized to acetoacetate by D-,8-hydroxybutyrate dehydro­ genase (Fig. 1 7-19). The acetoacetate is activated to its coenzyme A ester by transfer of GoA from succinyl-GoA,

1 7. 3 Ketone Bod ies

D-,8-Hydroxybutyrate

Acetoacetate

0

II

0 /

C H3 - C- CH2- C

/0

CH3-c ,

rCoA

"-

Acetoacetyl-CoA

S-CoA

SH

/0

CHa-c "'-r't.A

,

S-C•1A

2 Acetyl-CoA

FIGURE 1 7- 1 9 o-{j-Hydroxybutyrate as a fuel. o-,8-Hydroxybutyrate, synthesized in the l iver, passes into the blood and thus to other tissues, where it is converted in three steps to acetyi-CoA. It is first oxidized to acetoacetate, which is activated with coenzyme A donated from suc­ ci nyi-CoA, then split by thiolase. The acetyi-CoA thus formed is used for energy production.

an intermediate of the citric acid cycle (see Fig. 1 6-7) , in a reaction catalyzed by P-ketoacyl-CoA trans­ ferase, also called thiophorase. The acetoacetyl-GoA is then cleaved by thiolase to yield two acetyl-GoAs, which enter the citric acid cycle. Thus the ketone bodies are used as fuels in all tissues except liver, which lacks thio­ phorase. The liver is therefore a producer of ketone bod­ ies for the other tissues, but not a consumer. The production and export of ketone bodies by the liver allows continued oxidation of fatty acids with only minimal oxidation of acetyl-GoA. When intermediates of the citric acid cycle are being siphoned off for glucose synthesis by gluconeogenesis, for example, oxidation of cycle intermediates slows-and so does acetyl-GoA oxi­ dation. Moreover, the liver contains only a limited amount of coenzyme A, and when most of it is tied up in acetyl-GoA, {3 oxidation slows for want of the free coen­ zyme. The production and export of ketone bodies frees coenzyme A, allowing continued fatty acid oxidation.

[667]

diverting acetyl-GoA to ketone body production ( Fig. 1 7-20) . In untreated diabetes, when the insulin level is insufficient, extrahepatic tissues cannot take up glucose efficiently from the blood, either for fuel or for conversion to fat . Under these conditions , levels of malonyl-GoA (the starting material for fatty acid syn­ thesis) fall, inhibition of carnitine acyltransferase I is relieved, and fatty acids enter mitochondria to be de­ graded to acetyl-GoA-which cannot pass through the citric acid cycle because cycle intermediates have been drawn off for use as substrates in gluconeogene­ sis . The resulting accumulation of acetyl-GoA acceler­ ates the formation of ketone bodies beyond the capacity of extrahepatic tissues to oxidize them. The increased blood levels of acetoacetate and D-{3-hy­ droxybutyrate lower the blood pH, causing the condi­ tion known as acidosis. Extreme acidosis can lead to coma and in some cases death. Ketone bodies in the blood and urine of individuals with untreated diabetes can reach extraordinary levels-a blood concentration of 90 mg/1 00 mL (compared with a normal level of d-chain

H3N-C-H

CH2

CH2

CH3

CHs

I

I

Ull l n otntnsf(• ra::;:;e

I

coo-

>I

I

C=O

I

I

CH2

CH2

I

I

CH3-CH

CH3-CH

I

I

CHs

CHs

Leucine

FIGURE 1 8-28

I

I

CH3-CH

CHz

If

8-CoA 0� / c �

I

C=O

CH3-CH

�:

CHs

coo-

I

H3N-C-H

+

I

I

coo-

coo-

CH3-CH

CHs

Valine

Isoleucine

I

I

CH3-CH

CHs

I

8-CoA 0� / c

C=O

I

CH3-CH

CHs

The carbon skeletons of asparagine and aspartate ul­ timately enter the citric acid cycle as oxaloacetate. The

I

H3N-C-H

+

Asparagine and Aspartate Are Degraded to Oxaloacetate

coo-

I

a-Keto acids Catabolic pathways for the three branched­

All three pathways occur i n extrahepatic tissues and share the first two enzymes, as shown here. The branched-chain a-keto acid dehydrogenase chain amino acids: valine, isoleucine, and leucine.

[7o1]

( [ c l l _v d r ngl·na�(' con1ple.x

I

Maple syrup urine disease

.,.

8-CoA 0� / � c

I

CH2

I

CH3-CH

I

CH3

Acyl-CoA derivatives

complex is analogous to the pyruvate and a-ketogl utarate dehydro­ genase complexes and requi res the same five cofactors (some not shown here). Th is enzyme is defective in people with maple syrup urine disease.

[7o2]

A m i n o Acid Oxidation a n d the Production of U rea

and tetrahydrobiopterin in the oxidation of phenylalanine by phenylalanine hydroxylase. •

'"l amm ot1 an

rt " n1

f

l

"

-

IAspartate I



a-Ketoglutarate

>LP

� Glutamate •

Oxaloacetate

FIGURE 1 8-29

Catabolic pathway for asparagine and aspartate.

Both amino acids are converted to oxaloacetate.



enzyme asparaginase catalyzes the hydrolysis of as­ paragine to aspartate, which undergoes transamination with a-ketoglutarate to yield glutamate and oxaloac­ etate (Fig. 1 8 -29). We have now seen how the 20 common amino acids, after losing their nitrogen atoms, are degraded by de­ hydrogenation, decarboxylation, and other reactions to yield portions of their carbon backbones in the form of six central metabolites that can enter the citric acid cycle. Those portions degraded to acetyl-CoA are completely oxidized to carbon dioxide and water, with generation of ATP by oxidative phosphorylation. As was the case for carbohydrates and lipids, the degradation of amino acids results ultimately in the gen­ eration of reducing equivalents (NADH and FADH2 ) through the action of the citric acid cycle. Our survey of catabolic processes concludes in the next chapter with a discussion of respiration, in which these reducing equiv­ alents fuel the ultimate oxidative and energy-generating process in aerobic organisms.

S U M M A R Y 18. 3

Path ways of Amino Acid Deg radation



After the removal of amino groups , the carbon skeletons of amino acids undergo oxidation to compounds that can enter the citric acid cycle for oxidation to C02 and H20 . The reactions of these pathways require several cofactors, including tetrahydrofolate and S-adenosyl­ methionine in one-carbon transfer reactions





Depending on their degradative end product, some amino acids can be converted to ketone bodies, some to glucose, and some to both. Thus amino acid degradation is integrated into intermediary metabolism and can be critical to survival under conditions in which amino acids are a significant source of metabolic energy. The carbon skeletons of amino acids enter the citric acid cycle through five intermediates: acetyl-CoA, a-ketoglutarate, succinyl-CoA, fumarate, and oxaloacetate. Some are also degraded to pyruvate, which can be converted to either acetyl-CoA or oxaloacetate. The amino acids producing pyruvate are alanine, cysteine, glycine, serine, threonine, and tryptophan. Leucine, lysine, phenylalanine, and tryptophan yield acetyl-CoA via acetoacetyl-GoA. Isoleucine, leucine, threonine, and tryptophan also form acetyl-CoA directly. Arginine, glutamate, glutamine, histidine, and proline produce a-ketoglutarate; isoleucine, methionine, threonine, and valine produce succinyl-CoA; four carbon atoms of phenylalanine and tyrosine give rise to fumarate; and asparagine and aspartate produce oxaloacetate. The branched-chain amino acids (isoleucine, leucine, and valine), unlike the other amino acids, are degraded only in extrahepatic tissues. Several serious human diseases can be traced to genetic defects in the enzymes of amino acid catabolism.

Key Terms Terms in bold are defined in the glossary.

aminotransferases 677 transaminases 677 transamination 6 7 7 pyridoxal phosphate (PLP) 677 creatine kinase 678 oxidative deamination 679 L-glutarnate dehydrogenase

679

glutamine synthetase glutaminase 680 glucose-alanine cycle ammonotelic 682 ureotelic 682 uricotelic 682 urea cycle 682

680 681

urea 684 essential amino acids 686 ketogenic 688 glucogenic 688 tetrahydrofolate 689 S -adenosylmethionine ( adoMet) 689 tetrahydrobiopterin 692 phenylketonuria (PKU) 697 mixed-function oxidases 697 alkaptonuria 698 maple syrup urine disease 7 01

Further Read ing

[7o3]

Further Reading

This review details what is known about some levels of regulation not covered in the chapter, such as hormonal and nutritional regulation.

General

Disorders of Amino Acid Degradation

Arias, I.M., Boyer, J.L., Chisari, F.V., Fausto, N., Schachter, D., & Shafritz, D.A. (2001) The Liver: Biology and Pathobiology, 4th

Ledley, F.D., Levy, H.L., & Woo, S.L.C. (1 986) Molecular analysis

Bender, D.A. ( 1 985) Amino Acid Metabolism, 2nd edn, Wiley­

Nyhan, W.L. ( 1984) Abnormalities in Amino Acid Metabolism in

edn, Lippincott Williams & Wilkins, Philadelphia.

of the inheritance of phenylketonuria and mild hyperphenylalanine­ mia in families with both disorders. N. Engl. J Med. 314, 1276-1280 .

Interscience, Inc., New York

Clinical Medicine, Appleton-Century-Crofts, Norwalk, CT.

Brosnan, J.T. (2001) Amino acids, then and now-a reflection on

Scriver, C.R., Beaudet, A.L., Sly, W.S., Valle, D., Childs, B., Kinzler, A.W., & Vogelstein, B. (eds) (2001) The Metabolic and

Sir Hans Krebs' contribution to nitrogen metabolism. IUBMB Life 52, 265-270. An interesting tour through the life of this important biochemist.

Campbell, J.W. (1991) Excretory nitrogen metabolism. In Environ­ mental and Metabolic Animal Physiology, 4th edn (Prosser, C .L , ed.) , pp. 277-324, John Wiley & Sons, Inc., New York. Coomes, M.W. ( 1 997) Amino acid metabolism In Textbook of Biochemistry with Clinical Correlations, 5th edn (Devlin, T.M., ed.) , pp 779-823, Wiley-Liss, New York Frey, P.A. & Hegeman, A.D. (2006) Enzymatic Reaction Mechanisms , Oxford University Press, New York. A good source for in-depth discussion of the classes of enzymatic reaction mechanisms described in the chapter. uniformity. J Biochem. ll8, 463-4 73.

Hayashi, H. ( 1 995) Pyridoxal enzymes: mechanistic diversity and Mazelis, M. (1 980) Amino acid catabolism. In The Biochemistry of Plants: A Comprehensive Treatise (Stumpf, P.K. & Conn, E.E . , eds), Vol. 5: Amino Acids and Derivatives (Miflin, B.J., ed.), pp 541-567, Academic Press, Inc., New York . A discussion of the various fates of amino acids in plants.

Amino Acid Metabolism Christen, P. & Metzler, D.E. ( 1 985) Transaminases, Wiley­ Interscience, Inc. , New York.

Curthoys, N.P. & Watford, M. (1 995) Regulation of glutaminase activity and glutamine metabolism. Annu. Rev. Nutr. 15, 133-159. hydroxylases. Annu. Rev. Biochem 68, 355-382.

Fitzpatrick, P.F. (1 999) Tetrahydropterin-dependent amino acid

Eliot, A.C. & Kirsch, J.F. (2004) Pyridoxal phosphate enzymes: mechanistic, structural and evolutionary considerations. Annu. Rev. Biochem 73, 383-4 1 5 .

Pencharz, P.B. & Ball, R.O. (2003) Different approaches t o define individual amino acid requirements. Annu Rev_ Nutr. 23, 1 0 1-1 1 6. Determination of which amino acids are essential in the human diet is not a trivial problem, as this review relates.

The Urea Cycle Brusilow, S.W. & Horwich, A.L. (2001) Urea cycle enzymes. In

The Metabolic Bases of Inherited Disease, 8th edn (Scriver, C.R . , Beaudet, A . C. , Sly, WS. , Valle, D . , Childs, B., Kinzler, K . , & Vogelstein, B , eds), pp 1 909-1963, McGraw-Hill Companies, Inc. , New York. An authoritative source on this pathway.

Holmes, F.L. (1 980) Hans Krebs and the discovery of the ornithine cycle. Fed Proc 39, 2 1 6-225. A medical historian reconstructs the events leading to the discovery of the urea cycle.

Kirsch, J.F., Eiche1e, G., Ford, G.C., Vincent, M.G., Jansonius, J.N., Gehring, H., & Christen, P. ( 1 984) Mechanism of action of aspartate aminotransferase proposed on the basis of its spatial structure. J Mol. Biol. 174, 497-525_

Morris, S.M. (2002) Regulation of enzymes of the urea cycle and arginine metabolism. Annu Rev. Nutr. 22, 87-105.

Molecular Bases of Inherited Disease, 8th edn, Part 5: Amino Acids, McGraw-Hill, Inc., New York

Scriver, C.R., Kaufinan, S., & Woo, S.L.C. ( 1988) Mendelian hyperphenylalaninernia. Annu. Rev. Genet 22, 301-321.

Problems 1 . Products of Amino Acid Transamination Name and draw the structure of the a-keto acid resulting when each of the following amino acids undergoes transamination with a­ ketoglutarate: (a) aspartate, (b) glutamate, (c) alanine, (d) phenylalanine. 2. Measurement of Alanine Aminotransferase Activity The activity (reaction rate) of alanine aminotransferase is usu­ ally measured by including an excess of pure lactate dehydro­ genase and NADH in the reaction system. The rate of alanine disappearance is equal to the rate of NADH disappearance measured spectrophotometrically. Explain how this assay works. 3. Alanine and Glutamine in the Blood Normal human blood plasma contains all the amino acids required for the syn­ thesis of body proteins, but not in equal concentrations. Ala­ nine and glutamine are present in much higher concentrations than any other amino acids. Suggest why. 4. Distribution of Amino Nitrogen If your diet is rich in alanine but deficient in aspartate, will you show signs of aspar­ tate deficiency? Explain. 5. Lactate versus Alanine as Metabolic Fuel: The Cost of Nitrogen Removal The three carbons in lactate and ala­ nine have identical oxidation states, and animals can use ei­ ther carbon source as a metabolic fuel. Compare the net ATP yield (moles of ATP per mole of substrate) for the complete oxidation (to C02 and H20) of lactate versus alanine when the cost of nitrogen excretion as urea is included.

coo ­ l HO-C-H I H-C-H I H Lactate

coo ­ I H3 N-C-H +

I

H-C-H I H

Alanine

6. Ammonia Toxicity Resulting from an Arginine­ Deficient Diet In a study conducted some years ago, cats were fasted overnight then given a single meal complete in all

[7o4�

A m i n o Acid Oxidation a n d the Prod u ction of U rea

amino acids except arginine. Within 2 hours, blood ammonia levels increased from a normal level of 18 p,g/1 to 1 40 p,g/1, and the cats showed the clinical symptoms of ammonia toxic­ ity. A control group fed a complete amino acid diet or an amino acid diet in which arginine was replaced by ornithine showed no unusual clinical symptoms. (a) What was the role of fasting in the experiment? (b) What caused the ammonia levels to rise in the experi­ mental group? Why did the absence of arginine lead to ammonia toxicity? Is arginine an essential amino acid in cats? Why or why not? (c) Why can ornithine be substituted for arginine? 7. Oxidation of Glutamate Write a series of balanced equa­ tions, and an overall equation for the net reaction, describing the oxidation of 2 mol of glutamate to 2 mol of a-ketoglutarate and 1 mol of urea. 8. Transamination and the Urea Cycle Aspartate amino­ transferase has the highest activity of all the mammalian liver aminotransferases. Why? 9. The Case against the Liquid Protein Diet A ' " weight-reducing diet heavily promoted some years ago required the daily intake of "liquid protein" (soup of hy­ drolyzed gelatin) , water, and an assortment of vitamins. All other food and drink were to be avoided. People on this diet typically lost 10 to 1 4 lb in the first week. (a) Opponents argued that the weight loss was almost en­ tirely due to water loss and would be regained very soon after a normal diet was resumed. What is the biochemical basis for this argument? (b) A few people on this diet died. What are some of the dangers inherent in the diet, and how can they lead to death? 10. Ketogenic Amino Acids Which amino acids are exclu­ sively ketogenic? 1 1 . A Genetic Defect in Amino Acid Metabolism: A Case History A two-year-old child was taken to the hos­ pital. His mother said that he vomited frequently, especially after feedings. The child's weight and physical development were be­ low normal. His hair, although dark, contained patches of white. A urine sample treated with ferric chloride (FeCl3) gave a green color characteristic of the presence of phenylpyruvate. Quantita­ tive analysis of urine samples gave the results shown in the table.

Concentration (mM) Substance Phenylalanine Phenylpyruvate Phenyllactate

Patient's urine

Normal urine

7.0 4.8 1 0.3

0.01 0 0

(d) Why does the boy's hair contain patches of white? "

12. Role of Cobalamin in Amino Acid Catabolism Pernicious anemia is caused by impaired absorption of vitamin Biz· What is the effect of this impairment on the catabolism of amino acids? Are all amino acids equally affected? (Hint: See Box 1 7-2.) 13. Vegetarian Diets Vegetarian diets can provide high levels of antioxidants and a lipid profile that can help prevent coronary disease. However, there can be some associated problems. Blood samples were taken from a large group of volunteer subjects who were vegans (strict vegetari­ ans: no animal products) , lactovegetarians (vegetarians who eat dairy products) , or omnivores (individuals with a normal, varied diet including meat) . In each case, the volunteers had followed the diet for several years. The blood levels of both ho­ mocysteine and methylmalonate were elevated in the vegan group, somewhat lower in the lactovegetarian group, and much lower in the omnivore group. Explain. 14. Pernicious Anemia Vitamin BI2 deficiency can arise from a few rare genetic diseases that lead to low Biz levels despite a normal diet that includes Biz-rich meat and dairy sources. These conditions cannot be treated with dietary Biz supplements. Explain. 15. Pyridoxal Phosphate Reaction Mechanisms Threo­ nine can be broken down by the enzyme threonine dehy­ dratase, which catalyzes the conversion of threonine to a-ketobutyrate and ammonia. The enzyme uses P1P as a co­ factor. Suggest a mechanism for this reaction, based on the mechanisms in Figure 1 8-6. Note that this reaction includes an elimination at the f3 carbon of threonine. OH

I

+

NH3

I

CH 3- CH -CH-COO -

Threonine

PLP

-o th -' r'-" ca= m :. ne----+ dehydratase

0

II

CH3-CH2-C -COOa-

NH3

+ H20

Ketobutyrate

16. Pathway of Carbon and Nitrogen in Glutamate Me­ tabolism When [2-I4C , I 5N] glutamate undergoes oxidative degradation in the liver of a rat, in which atoms of the follow­ ing metabolites will each isotope be found: (a) urea, (b) succi­ nate, (c) arginine, (d) citrulline, (e) ornithine, (f) aspartate? H

coo ­

kI �tI -H

H�

H

(a) Suggest which enzyme might be deficient in this child. Propose a treatment. (b) Why does phenylalanine appear in the urine in large amounts? (c) What is the source of phenylpyruvate and phenyllac­ tate? Why does this pathway (normally not functional) come into play when the concentration of phenylalanine rises?

+

CH2

I

CH2

I coo Labeled glutamate 17. Chemical Strategy of Isoleucine Catabolism Isoleucine is degraded in six steps to propionyl-CoA and acetyl-CoA.

Pro b l e m s

+

0 � � c/

� / c

o



I

+

S-CoA

H NH3 I I CHa-C-CH2-c-cool I CH3 H Leucine

I

H3N-C-H I H-C-CH3 I CH2 I CH3 Isoleucine

CH2 I CH3 Propionyl-CoA

6 steps

+

S-CoA

H 0 II I CHa -C-CH2-C-COO­ I CH3 a-Ketoisocaproate CoA-SH

I

CH3 Acetyl-CoA

(a) The chemical process of isoleucine degradation in­ cludes strategies analogous to those used in the citric acid cycle and the f3 oxidation of fatty acids. The intermediates of isoleucine degradation (I to V) shown below are not in the proper order. Use your knowledge and understanding of the citric acid cycle and {3-oxidation pathway to arrange the intermediates in the proper metabolic sequence for isoleucine degradation. 0 ��c /

(b)

H

o

I

CH3-C-CH2-C-8-CoA I CH3 Isovaleryl-CoA

o-

(c)

I

§C-CH3 H-Cr' I CH3

C=O I H-C-CH3 I CH2 I CH3

I

II

0� � / c

0 ��c /

S-CoA

0 II

I

� / c

S-CoA

I

(d)

I

r

HC03

0 II

OH 0 I II -OOC-CH2-C-CH2-C-8-CoA I CH3 {3-Hydroxy-{3-methylglutaryl-CoA

/ -CoA 0 ��c /H

H" / " HO - C CH3 I CH3 v

any necessary cofactors.

II

r

IV

(b) For each step you propose, describe the chemical process, provide an analogous example from the citric acid cycle or {3-oxidation pathway (where possible) , and indicate

0

-ooC-CH2-C=C-C-8-CoA I I H3C H {3-Methylglutaconyl-CoA (e) H20

H-C-CH3 I CH2 I CH3

III

l

CH3-C=C-C-8-CoA I I H3C H {3-Methylcrotonyl-CoA

S-CoA

H-C-CH3 I C=O I CH3

l

(a)

� / c

0

[los]

0 II

(f)l

0

II

-ooC-CH2-C-CH3 + CH3-C-8-CoA Acetyl-CoA Acetoacetate Data Analysis Problem

19. Parallel Pathways for Amino Acid and Fatty Acid Degradation The carbon skeleton of leucine is degraded by a series of reactions closely analogous to those of the citric acid cycle and f3 oxidation. For each reaction, (a) through (f) , shown at right, indicate its type, provide an analogous exam­

20. Maple Syrup Urine Disease Figure 1 8-28 shows the pathway for the degradation of branched-chain amino acids and the site of the biochemical defect that causes maple syrup urine disease. The initial findings that eventually led to the discovery of the defect in this disease were presented in three papers published in the late 1950s and early 1960s. This problem traces the history of the findings from initial clin­ ical observations to proposal of a biochemical mechanism. Menkes, Hurst, and Craig ( 1954) presented the cases of four siblings, all of whom died following a similar course of symptoms. In all four cases, the mother's pregnancy and the

ple from the citric acid cycle or {3-oxidation pathway (where possible) , and note any necessary cofactors.

birth had been normal. The first 3 to 5 days of each child's life were also normal. But soon thereafter each child began having

18. Role of Pyridoxal Phosphate in Glycine Metabolism The enzyme serine hydroxymethyltransferase requires pyridoxal phosphate as cofactor. Propose a mechanism for the reaction cat­ alyzed by this enzyme, in the direction of serine degradation (glycine production) . (Hint: See Figs 18-19 and 18-20b.)

.. ..



[7o6]

A m i n o Acid Oxidation a n d the Prod uction of U rea

(b) The table includes taurine, an amino acid not nor­

convulsions, and the children died between the ages of 11 days and 3 months. Autopsy showed considerable swelling of the brain in all cases. The children's urine had a strong, unusual "maple syrup" odor, starting from about the third day of life. Menkes (1959) reported data collected from six more chil­ dren. All showed symptoms similar to those described above, and died within 15 days to 20 months of birth. In one case, Menkes was able to obtain urine samples during the last months of the in­ fant's life. When he treated the urine with 2,4-dinitrophenylhy­ drazone, which forms colored precipitates with keto compounds, he found three a-keto acids in unusually large amounts:

coo� I C=O I CH2 I

CH3-CH I CH3 a-Ketoisocaproate

coo� I C=O I CH3-CH I CH3 a-Ketoisovalerate

mally found in proteins. Taurine is often produced as a by­ product of cell damage. Its structure is: 0

+

II

H3N- CH2- CH2-S-O� II

0

Based on its structure and the information in this chapter, what is the most likely amino acid precursor of taurine? Ex­ plain your reasoning. (c) Compared with the normal values given in the table, which amino acids showed significantly elevated levels in the pa­ tient's blood in January 1 957? Which ones in the patient's urine? Based on their results and their knowledge of the path­ way shown in Figure 18-28, Dancis and coauthors concluded: "although it appears most likely to the authors that the pri­

coo­ l C=O I CH3-CH I

CH2 I CH3 a-Keto-f3-methyl-n-valerate

mary block is in the metabolic degradative pathway of the branched-chain amino acids, this cannot be considered estab­ lished beyond question." (d) How do the data presented here support this con­ clusion? (e) Which data presented here do not fit this model of

(a) These a-keto acids are produced by the deamination of amino acids. For each of the a-keto acids above, draw and name the amino acid from which it was derived.

maple syrup urine disease? How do you explain these seem­ ingly contradictory data? (f) What data would you need to collect to be more secure in your conclusion?

Dancis, Levitz, and Westall ( 1960) collected further data that led them to propose the biochemical defect shown in Fig­ ure 18-28. In one case, they examined a patient whose urine first showed the maple syrup odor when he was 4 months old. At the age of 10 months (March 1 956) , the child was admitted

References

to the hospital because he had a fever, and he showed grossly retarded motor development. At the age of 20 months (Janu­ ary 1957), he was readmitted and was found to have the de­ generative neurological symptoms seen in previous cases of maple syrup urine disease; he died soon after. Results of his blood and urine analyses are shown in the table below, along

Dancis, J., Levitz, M., & Westall , R. (1960) Maple syrup urine dis­ ease: branched-chain keto-aciduria. Pediatrics 25, 72�79. Menkes, J.H. (1959) Maple syrup disease: isolation and identification of organic acids in the urine. Pediatrics 23, 348�353. Menkes, J.H., Hurst, P.L., & Craig J.M. (1954) A new syndrome: progressive familial infantile cerebral dysfunction associated with an unusual urinary substance. Pediatrics 14, 462-466.

with normal values for each component.

Urine (mg/24 h) Normal Amino acid(s) Alanine Asparagine and glutamine Aspartic acid Arginine Cystine Glutamic acid Glycine Histidine Isoleucine Leucine Lysine Methionine Ornithine Phenylalanine Proline Serine Taurine Threonine Tryptophan Tyrosine Valine

5-15 5-15 1-2 1 . 5-3 2-4 1 . 5-3 20-40 8-15 2-5 3-8 2-12 2-5 1-2 2-4 2-4 5-15 1-10 5-10 3-8 4-8 2-4

Plasma (mg/ml)

Patient

Normal

Mar. 1956

Jan. 1957

0.2 0.4 0.2 0.3 0.5 0.7 4.6 0.3 2.0 2 .7 1 .6

0.4 0 1 .5 0.7 0.3 1.6 20.7 4.7 13.5 39 .4 4.3 14 1 .3 2.6 0.3 0 18.7 0 2.3 3.7 15.4

1.4 0 0.4 0.5 1 .2 0.2 0.6 0.9 0.3 1 .6

.

Patient Jan. 1957

3.0-4.8 3.0-5.0 0.1-0.2 0.8-1 .4 1 .0-1.5 1 .0-1 .5 1 .0-2.0 1 .0-1 . 7 0.8-1 .5 1 . 7-2.4 1 . 5-2.7 0.3-0.6 0.6-0.8 1 .0-1 . 7 1 .5-3.0 1 .3-2.2 0.9-1 .8 1 .2-1 .6

Not measured 1 .5-2.3 2.0-3.0

0.6 2.0 0.04 0.8 0 0.9 1 .5 0.7 2.2 14 .5 1 .1 2.7 0 .5 0 .8 0.9 0.9

0.4 0.3 0 0.7

13.1

If an idea presents itself to us, we m ust not rej ect it s i m p l y because it does not agree with the logical deductions of a rei gn i n g theory.

-Claude Bernard, An Introduction to the Study of Experimental

Med i c i ne, 1 8 13

The aspect of the present position of consensus that I fi nd most remark­ able and adm i rable, is the a ltru ism and generosi ty with which former opponents of the chem iosmotic hypothesis have not on ly come to accept i t, but have actively promoted it to the status of a theory.

-Peter Mitchell, Nobel Address,

1978

Oxidative hosphory af on and Photophosphorylation OXIDATIVE PHOSPHORYLATION

708

1 9. 1

Electron-Transfer Reactions i n Mitochondria

1 9.2

ATP Synthesis

1 9.3

Regulation of Oxidative Phosphorylation

1 9.4

Mitochondria in Thermogenesis, Steroid Synthesis,

723

and Apoptosis

1 9.5

732

735

Mitochondrial Genes: Their Origin and the Effects of Mutations

738

PHOTOSYNTHESIS: HARVESTING LIGHT ENERGY

1 9.6

General Features of Photophosphorylation

1 9.7

light Absorption

1 9.8

The Central Photochemical Event: light-Driven Electron Flow

1 9.9

744

749

ATP Synthesis by Photophosphorylation

1 9. 1 0 The Evolution of Oxygenic Photosynthesis

0

742

759 761

xidative phosphorylation is the culmination of energy-yielding metabolism in aerobic organ­ isms. All oxidative steps in the degradation of carbohydrates , fats, and amino acids converge at this fi­ nal stage of cellular respiration, in which the energy of oxidation drives the synthesis of ATP. Photophosphory­ lation is the means by which photosynthetic organisms

capture the energy of sunlight-the ultimate source of energy in the biosphere-and harness it to make ATP. Together, oxidative phosphorylation and photophospho­ rylation account for most of the ATP synthesized by most organisms most of the time. In eukaryotes, oxidative phosphorylation occurs in mitochondria, photophosphorylation in chloroplasts. Oxidative phosphorylation involves the reduction of 02 to H20 with electrons donated by NADH and FADH2; it occurs equally well in light or darkness. Photophospho­ rylation involves the oxidation of H20 to 02, with NADP + as ultimate electron acceptor; it is absolutely dependent on the energy of light. Despite their differ­ ences, these two highly efficient energy-converting processes have fundamentally similar mechanisms. Our current understanding of ATP synthesis in mi­ tochondria and chloroplasts is based on the hypothesis, introduced by Peter Mitchell in 1961, that transmem­ brane differences in proton concentration are the reser­ voir for the energy extracted from biological oxidation reactions. This chemiosmotic theory has been ac­ cepted as one of the great unifying principles of twenti­ eth century biology. It provides insight into the processes of oxidative phosphorylation and photophosphorylation, and into such apparently disparate energy transduc­ tions as active transport across membranes and the motion of bacterial flagella. Oxidative phosphorylation and photophosphoryla­ tion are mechanistically similar in three respects. (1) Both processes involve the flow of electrons through a chain of membrane-bound carriers. (2) The free energy made available by this "downhill" (exergonic) electron flow is coupled to the "uphill" transport of protons

[!o7]

[?ot�j

Oxid ative Phosphorylation a n d Photop hosphorylation

across a proton-impermeable membrane, conserving the free energy of fuel oxidation as a transmembrane elec­ trochemical potential (p . 390) . (3) The transmembrane flow of protons down their concentration gradient through specific protein channels provides the free en­ ergy for synthesis of ATP, catalyzed by a membrane pro­ tein complex (ATP synthase) that couples proton flow to phosphorylation of ADP. The chapter begins with oxidative phosphorylation. We first describe the components of the electron-trans­ fer chain, their organization into large functional com­ plexes in the inner mitochondrial membrane, the path of electron flow through them, and the proton move­ ments that accompany this flow. We then consider the remarkable enzyme complex that, by "rotational cataly­ sis , " captures the energy of proton flow in ATP, and the regulatory mechanisms that coordinate oxidative phos­ phorylation "'ith the many catabolic pathways by which fuels are oxidized. We also describe the roles that mito­ chondria play in thermogenesis, steroid synthesis, and apoptosis. With this understanding of mitochondrial ox­ idative phosphorylation, we turn to photophosphoryla­ tion, looking first at the absorption of light by photosynthetic pigments, then at the light-driven flow of electrons from H 2 0 to NADP+ and the molecular ba­ sis for coupling electron and proton flow. We also con­ sider the similarities of structure and mechanism between the ATP synthases of chloroplasts and mito­ chondria, and the evolutionary basis for this conserva­ tion of mechanism.

( F oF l)

ATP synthase

1 9. 1 Electron-Tra nsfer Reactions in

Mitochondria The discovery in 1948 by Eugene Kennedy and Albert Lehninger that mitochondria are the site of oxidative phos­ phorylation in eukaryotes marked the beginning of the modern phase of studies in biological energy transductions. Mitochondria, like gram-negative bacteria, have two membranes (Fig. 19-1). The outer mitochondrial mem­ brane is readily permeable to small molecules CMr 90% efficiency. Within 3 ps of the excitation of P870, pheophytin has re­ ceived an electron and become a negatively charged radi­ cal; less than 200 ps later, the electron has reached the quinone Q8 (Fig. 1 9-55b). The electron-transfer reactions not only are fast but are thermodynamically "downhill" ; the excited special pair (Chi) � is a very good electron donor (E'o - 1 V) , and each successive electron transfer is to an acceptor of substantially less negative E'0. The standard free-energy change for the process is therefore negative and large; recall from Chapter 1 3 that t!..G 'o -nJt!..£ ' 0; here, t!..£ ' 0 is the difference between the stan­ dard reduction potentials of the two half-reactions =

=

----+

+

(Chi)� "(Chl):7 e­ (2) Q + 2H+ + 2e- QH2 (1)

Thus tlE'o =

----+

-0.045 V -

( - 1.0 V)

E ' o = - l.O V E'0 = =

-0.045 V

and

!lG'0

=

-2(96.5 kJN mol)(0.95 V) -180 kJ/mol ·

=

The combination of fast kinetics and favorable thermody­ namics makes the process virtually irreversible and highly efficient. The overall energy yield (the percentage of the photon's energy conserved in QH2) is >30% , with the re­ mainder of the energy dissipated as heat and entropy. I n Plants, Two Reaction Centers Act i n Ta ndem

The photosynthetic apparatus of modern cyanobacte­ ria, algae , and vascular plants is more complex than the one-center bacterial systems, and it seems to have evolved through the combination of two simpler bacte­ rial photocenters. The thylakoid membranes of chloro­ plasts have two different kinds of photosystems, each with its own type of photochemical reaction center and set of antenna molecules. The two systems have dis­ tinct and complementary functions ( Fig. 1 H-56 ) Pho­ tosystem II (PSII) is a pheophytin-quinone type of

.

0.95 V

Photosystem I

Photosystem II - 1.0 -

Pheo p

A

Fd:NADP+ oxidoreductase

p

Light

0Plastocyan j n

Proton grarueni

(

NADP+ NADPH



plastoquinone = second quinone Ao = electron acceptor chlorophyll A1 = phylloquinone

PQA

=

PQB

FIGURE 19-56 Integration of photosystems I and II in chloroplasts. This "Z scheme" shows the pathway of electron transfer from H20 (lower left) to NADP+ (far right) in noncyclic photosynthesis. The position on the vertical scale of each electron carrier reflects its standard reduction po· tential. To raise the energy of electrons derived from H20 to the energy level required to reduce NADP + to NADPH, each electron must be "lifted" twice (heavy arrows) by photons absorbed in PSI I and PSI. One photon is required per electron in each photosystem. After excitation,

the high-energy electrons flow "downhill" through the carrier chains shown. Protons move across the thylakoid membrane during the water· spl itting reaction and during electron transfer through the cytochrome b6f complex, producing the proton gradient that is essential to ATP for­ mation. An alternative path of electrons is cyclic electron transfer, in which electrons move from ferredoxin back to the cytochrome b6f com­ plex, instead of reducing NADP+ to NADPH. The cyclic pathway pro· duces more ATP and less NADPH than the noncyclic.

1 9.8

system (like the single photosystem of purple bacte­ ria) containing roughly equal amounts of chlorophylls a and b. Excitation of its reaction-center P680 drives electrons through the cytochrome b6f complex with concomitant movement of protons across the thy­ lakoid membrane . Photosystem I (PSI) is struc­ turally and functionally related to the type I reaction center of green sulfur bacteria. It has a reaction center designated P700 and a high ratio of chlorophyll a to chlorophyll b. Excited P700 passes electrons to the Fe-S protein ferredoxin, then to NADP + , producing NADPH. The thylakoid membranes of a single spinach chloroplast have many hundreds of each kind of pho­ tosystem. These two reaction centers in plants act in tandem to catalyze the light-driven movement of electrons from H20 to NADP + (Fig. 1 9-56) . Electrons are carried be­ tween the two photosystems by the soluble protein plastocyanin, a one-electron carrier functionally simi­ lar to cytochrome c of mitochondria. To replace the elec­ trons that move from PSII through PSI to NADP + , cyanobacteria and plants oxidize H20 (as green sulfur bacteria oxidize H2S) , producing 02 (Fig. 1 9-56, bottom left) . This process is called oxygenic photosynthesis to distinguish it from the anoxygenic photosynthesis of purple and green sulfur bacteria. All 02-evolving photo­ synthetic cells-those of plants, algae , and cyanobacte­ ria- contain both PSI and PSII; organisms with only one photosystem do not evolve 02. The diagram in Fig­ ure 1 9-56, often called the Z scheme because of its overall form, outlines the pathway of electron flow be­ tween the two photosystems and the energy relation­ ships in the light reactions. The Z scheme thus describes the complete route by which electrons flow from H20 to NADP + , according to the equation 2H20 + 2NADP+ + 8

photons �

02 + 2NADPH + 2 H +

For every two photons absorbed (one by each photosys­ tem), one electron is transferred from H20 to NADP + . To form one molecule of 02, which requires transfer of four electrons from two H20 to two NADP + , a total of eight photons must be absorbed, four by each photosystem. The mechanistic details of the photochemical reac­ tions in PSII and PSI are essentially similar to those of the two bacterial photosystems, with several important additions . In PSII, two very similar proteins , D 1 and D2, form an almost symmetric dimer, to which all the electron-carrying cofactors are bound (Fig. 1 9-5 7 ) . Excitation of P680 in PSII produces P680*, an excellent electron donor that, within picoseconds, transfers an electron to pheophytin, giving it a negative charge C Pheo -) . With the loss of its electron, P680* is trans­ formed into a radical cation, P680 + . · Pheo - very rapidly passes its extra electron to a protein-bound plasto­ quinone, PQA (or QA) , which in turn passes its electron to another, more loosely bound plastoquinone, PQB (or Qg) . When PQB has acquired two electrons in two such transfers from PQA and two protons from the solvent

The Central P h otochem ical Event: Li g ht-Driven Electro n Flow

Stroma (N side)

FIGURE 1 9-57

elongates.

[}s 3]

Photosystem II of the cyanobacterium Synechococcus

The monomeric form of the complex shown here has two major transmembrane proteins, D1 and D2, each with its set of cofac­ tors. Although the two subunits are nearly symmetric, electron flow oc­ curs through only one of the two branches of cofactors, that on the right (on D1 ) . The arrows show the path of electron flow from the Mn ion cluster (Mn4) of the water-spl itting enzyme to the qui none PQ8 . The photochemical events occur in the sequence indicated by the step numbers . Notice the close simi larity between the positions of cofactors here and the positions in the bacterial photoreaction center shown in Figure 1 9-55 . The role of the Tyr residues is d iscussed later in the text.

water, it is in its fully reduced quinol form, PQ8H2 • The overall reaction initiated by light in PSII is 4 P680 + 4H+ + 2 PQ8 + 4

photons �

4 P680+ + 2 PQ8H2

( 19-12)

Eventually, the electrons in PQgH2 pass through the cy­ tochrome b6j complex (Fig. 1 9-56) . The electron ini­ tially removed from P680 is replaced with an electron obtained from the oxidation of water, as described below. The binding site for plastoquinone is the point of action of many commercial herbicides that kill plants by block­ ing electron transfer through the cytochrome b6f com­ plex and preventing photosynthetic ATP production. The photochemical events that follow excitation of PSI at the reaction-center P700 are formally similar to those in PSII. The excited reaction-center P700* loses an electron to an acceptor, A0 (believed to be a special form of chlorophyll, functionally homologous to the pheophytin of PSII) , creating A0 and P700 + (Fig. 1 9-56, right side) ; again, excitation results in charge separation at the photochemical reaction center. P700 + is a strong oxidizing agent, which quickly acquires an electron from plastocyanin, a soluble Cu-containing electron-transfer protein. A0 is an exceptionally strong reducing agent that passes its electron through a chain of carriers that leads to NADP + . First, phylloquinone (A1 ) accepts an electron and passes it to an iron-sulfur protein (through three Fe-S centers in PSI) . From here, the electron moves to ferredoxin (Fd) , another iron-sulfur protein loosely associated with the thylakoid membrane. Spinach ferredoxin CMr 1 0,700) contains a 2Fe-2S cen­ ter (Fig. 1 9-5) that undergoes one-electron oxidation and reduction reactions. The fourth electron carrier in

[7s4]

Oxi dative Phosp horylation a n d Photophosph orylation

the chain is the flavoprotein ferredoxin:NADP + oxi­ doreductase, which transfers electrons from reduced ferredoxin (Fdrect) to NADP + : 2 Fdred + 2 H + + NADP +



Antenna Chlorophylls Are Tightly I ntegrated with Electron Carriers The electron-carrying cofactors of PSI and the light­ harvesting complexes are part of a supramolecular com­ plex (Fig. 1 9-58a) , the structure of which has been solved crystallographically. The protein consists of three

2Fdox + NADPH + H +

This enzyme is homologous to the ferredoxin:NAD re­ ductase of green sulfur bacteria (Fig. 1 9-54b) . (a)

Light

\

Subunit B

\

-/

/--..( CWl2 ��Jf Ch( P

Ex�n

transfer

Lumen (P side)

PlasUx:yanin[



70°

ubunit. A Chi



PSI

c

Subunit



I

FB ..

F

Stroma (N side)

A

Ferredoxin

(b)

FIGURE 1 9-58

The supramolecular complex o f PSI a n d its associated

Schematic drawing of the essential proteins and cofactors in a single unit of PSI. A large number of antenna chloro­ phylls surround the reaction center and convey to it (red arrows) the energy of absorbed photons. The result is excitation of the pai r of chlorophyll molecules that constitute P700, greatly decreasing its re­ duction potential; P700 then passes an electron through two nearby chlorophylls to phylloqui none (QK; also called A1). Reduced phyllo­ quinone is reoxidized as it passes two electrons, one at a time (blue arrows), to an Fe-S protein (Fx) near the N side of the membrane. From Fx, electrons move through two more Fe-S centers (FA and F6) to the Fe-5 protein ferredoxin in the stroma. Ferredoxin then donates electrons antenna chlorophylls. (a)

to NADP + (not shown), reducing it to NADPH, one of the forms i n which the energy of photons is trapped in chloroplasts. (b) The trimeric structure (derived from PDB ID l ) B O), viewed from the thylakoid l umen perpendicular to the membrane, showing all protein subunits (gray) and cofactors. (c) A monomer of PSI with all the proteins omitted, revea l i ng the antenna and reaction-center chlorophy l l s (green with dark green Mg2 + ions in the center), carotenoids (yellow), and Fe-5 centers of the reaction center (space­ fi ll ing red and orange structures). The proteins in the complex hold the components rigidly i n orientations that maximize effic ient exci­ ton transfers between excited antenna molecules and the reaction center.

1 9.8

identical complexes, each composed of 1 1 different pro­ teins (Fig. 1 9-58b) . In this remarkable structure the many antenna chlorophyll and carotenoid molecules are pre­ cisely arrayed around the reaction center (Fig. 1 9-58c) . The reaction center's electron-carrying cofactors are therefore tightly integrated with antenna chlorophylls. This arrangement allows very rapid and efficient exciton transfer from antenna chlorophylls to the reaction center. In contrast to the single path of electrons in PSII, the electron flow initiated by absorption of a photon is be­ lieved to occur ttu·ough both branches of carriers in PSI. '.

The Centra l Photchemical Event: lig ht-Driven Electron Flow

[!ss]

The Cytochrome blComplex links Photosystems II and I Electrons temporarily stored in plastoquinol as a result of the excitation of P680 in PSII are carried to P700 of PSI via the cytochrome b6f complex and the soluble protein plastocyanin (Fig. 1 9-56, center) . Like Complex III of mi­ tochondria, the cytochrome b6f complex (Fig. 1 9-59) contains a b-type cytochrome with two heme groups (designated bH and bL) , a Rieske iron-sulfur protein (M,. 20,000) , and cytochrome f (named for the Latin frons, "leaf') . Electrons flow through the cytochrome b6j

.

-+- Plastocyanin

et'·. �

_ _ _ . .-'

Heme f

(P

Lumen side)

Stroma (N side)

(b)

(a)

FIGURE 1 9-59

tochrome b6f complex. (a)

Rieske iron­ sulfur protein :

. . ' '

Pla to- ',

Thylakoid lumen (p side)

I

ubunit IV

Stroma (N side) (c)

Electron and proton flow through the cy­

The crystal structure of the complex (PDB ID 1 UM3) reveals the positions of the cofactors involved in electron transfers. In addition to the hemes of cytochrome b (heme bH and bL; also cal led heme bN and br, respectively, be­ cause of their proximity to the N and P sides of the bilayer) and cytochrome f (heme f), there is a fourth (heme x) near heme bH; there is also a {3-carotene of unknown function. Two sites bind plastoqui none: the PQH2 site near the P side of the bilayer, and the PQ site near the N side. The Fe-5 center of the Rieske protei n l ies just outside the bilayer o n the P side, and the heme f site is on a protei n domain that extends wel l i nto the thylakoid lumen. (b) The complex is a homodimer arranged to create a cavern connecting the PQH 2 and PQ sites (compare this with the struc­ ture of mitochondrial Complex Ill in Fig. 1 9-1 1 ). Th is cavern al­ lows plastoquinone to move between the sites of its oxidation and reduction. (c) Plastoqu inol (PQH 2 ) formed in PSI I is oxidized by the cytochrome b6f complex in a series of steps l ike those of the Q cycle in the cytochrome be, complex (Complex I l l ) of mito­ chondria (see Fig. 1 9-1 2). One electron from PQH 2 passes to the Fe-5 center of the Rieske protein, the other to heme bL of cytochrome b6. The net effect is passage of electrons from PQH2 to the soluble protein plastocyanin, which carries them to PSI .

[!so]

Oxidative Phosph orylation a n d Photophosphorylation

complex from PQ8H2 to cytochrome f, then to plasto­ cyanin, and finally to P700, thereby reducing it. Like Complex III of mitochondria, cytochrome b 6f conveys electrons from a reduced quinone-a mobile, lipid-soluble carrier of two electrons (Q in mitochondria, PQ8 in chloroplasts)-to a water-soluble protein that carries one electron (cytochrome c in mitochondria, plastocyanin in chloroplasts) . As in mitochondria, the function of this complex involves a Q cycle (Fig. 1 9-12) in which electrons pass, one at a time, from PQ8H2 to cy­ tochrome b 6 . This cycle results in the pumping of pro­ tons across the membrane; in chloroplasts, the direction of proton movement is from the stromal compartment to the thylakoid lumen, up to four protons moving for each pair of electrons. The result is production of a proton gradient across the thylakoid membrane as electrons pass from PSII to PSI. Because the volume of the flat­ tened thylakoid lumen is small, the influx of a small number of protons has a relatively large effect on lume­ nal pH. The measured difference in pH between the stroma (pH 8) and the thylakoid lumen (pH 5) repre­ sents a 1 ,000-fold difference in proton concentration-a powerful driving force for ATP synthesis. Cyclic Electron Flow between PSI and the Cytochrome b/ Complex Increases the Produ ction of ATP Relative to NADPH

Electron flow from PSII through the cytochrome b 6f complex, then through PSI to NADP+ , is sometimes called noncyclic electron flow, to distinguish it from cyclic electron flow, which occurs to varying degrees depending primarily on the light conditions. The non­ cyclic path produces a proton gradient, which is used to drive ATP synthesis, and NADPH, which is used in re­ ductive biosynthetic processes. Cyclic electron flow in­ volves only PSI, not PSII (Fig. 1 9-56) . Electrons passing from P700 to ferredoxin do not continue to NADP+ , but move back through the cytochrome b6 f complex to plas­ tocyanin. (This electron path parallels that in green sulfur bacteria, shown in Fig. 19-54b.) Plastocyanin then donates electrons to P700, which transfers them to ferredoxin. In this way, electrons are repeatedly recy­ cled through the cytochrome b6f complex and the reac­ tion center of PSI, each electron propelled around the cycle by the energy of one photon. Cyclic electron flow is not accompanied by net formation of NADPH or evo­ lution of 02. However, it is accompanied by proton pumping by the cytochrome b6f complex and by phos­ phorylation of ADP to ATP, referred to as cyclic pho­ tophosphorylation. The overall equation for cyclic electron flow and photophosphorylation is simply ADP + Pi

light

ATP + H 2 0

By regulating the partitioning of electrons between NADP+ reduction and cyclic photophosphorylation, a plant adjusts the ratio of ATP to NADPH produced in the light-dependent reactions to match its needs for these products in the carbon-assimilation reactions and other

biosynthetic processes. As we shall see in Chapter 20, the carbon-assimilation reactions require ATP and NADPH in the ratio 3:2. This regulation of electron-transfer pathways is part of a short-term adaptation to changes in light color (wave­ length) and quantity (intensity), as further described below. State Transitions Change the Distribution of LHCII between the Two Photosystems

The energy required to excite PSI (P700) is less (light of longer wavelength, lower energy) than that needed to ex­ cite PSII (P680) . If PSI and PSII were physically contigu­ ous, excitons originating in the antenna system of PSII would migrate to the reaction center of PSI, leaving PSII chronically underexcited and interfering with the opera­ tion of the two-center system. This imbalance in the sup­ ply of excitons is prevented by separation of the two photosystems in the thylakoid membrane (Fig. 1 9-60) . PSII is located almost exclusively in the tightly appressed membrane stacks of thylakoid grana; its associated light­ harvesting complex (LHCII) mediates the tight associa­ tion of adjacent membranes in the grana. PSI and the ATP synthase complex are located almost exclusively in the nonappressed thylakoid membranes (the stromal lamel­ lae) , where they have access to the contents of the stroma, including ADP and NADP+ . The cytochrome b6f complex is present primarily in the grana. The association of LHCII with PSI and PSII depends on light intensity and wavelength, which can change in the short term, leading to state transitions in the chloroplast. In state 1 , a critical Ser residue in LCHII is not phosphorylated, and LHCII associates with PSII. Under conditions of intense or blue light, which favor absorption by PSII, that photosystem reduces plasto­ quinone to plastoquinol (PQH2) faster than PSI can oxi­ dize it. The resulting accumulation of PQH2 activates a protein kinase that triggers the transition to state 2 by phosphorylating a Thr residue on LHCII (Fig. 1 9-6 1 ). Phosphorylation weakens the interaction of LHCII with PSII, and some LHCII dissociates and moves to the stro­ mal lamellae; here it captures photons (excitons) for PSI, speeding the oxidation of PQH2 and reversing the imbalance between electron flow in PSI and PSII. In less intense light (in the shade, with more red light) , PSI ox­ idizes PQH2 faster than PSII can make it, and the result­ ing increase in [PQ] triggers dephosphorylation of LHCII, reversing the effect of phosphorylation. The state transition in LCHII localization is mutually regulated with the transition from cyclic to noncyclic photophosphorylation, described above; the path of electrons is primarily noncyclic in state 1 and primarily cyclic in state 2 . Water Is Split b y t h e Oxygen-Evolving Complex

The ultimate source of the electrons passed to NADPH in plant (oxygenic) photosynthesis is water. Having given up an electron to pheophytin, P680+ (of PSII) must acquire

1 9.8

The Central Photochem ical Event: Lig ht-Driven Electron Flow

[7 s 7]

Ferredoxin: NADP+

oxidoreductase



(a) Stroma

Appressed membranes (grana! lamellae)

-
@

j

j

Acetyl-CoA ----? ----? ----? Ketone bodies increased ( acetoacetate, in diabetes D-,8-hydroxybutyrate, \ - - - - - ->@ acetone) Fatty acids

j

Triacylglycerols FIGURE 2 1 -1 9 Regulation of triacylglycerol synthesis by in­

Triacylglycerol Biosynthesis i n Animals Is Regulated by Hormones

In humans, the amount of body fat stays relatively con­ stant over long periods , although there may be minor short-term changes as caloric intake fluctuates. Carbo­ hydrate, fat, or protein consumed in excess of energy

Insulin stimulates conversion of dietary carbohydrates and proteins to fat. I ndividuals with diabetes mell itus lack insulin; in uncontrolled disease, th is results i n diminished fatty acid synthesis, and the acetyi-CoA arising from catabol ism of carbohydrates and pro­ teins is shunted instead to ketone body production. People in severe ketosis smell of acetone, so the condition is sometimes mistaken for drunkenness (p. 929). sulin.

�822]

Lipid Biosynthesis

Adipose tissue

Glycerol

Lipoprotein lipase

Blood

Liver

Glycerol

Triacylglycerol

Triacylglycerol Fatty acid

Glycerol 3-phosphate

Fuel for

tiss ues

FIGURE 2 1 -20 The triacylglycerol cycle. In mammals, triacylglycerol molecules are broken down and resynthesized in a triacylglycerol cycle during starvation. Some of the fatty acids released by lipolysis of triacyl­ glycerol in adipose tissue pass i nto the bloodstream, and the remainder are used for resynthesis of triacylglycerol . Some of the fatty acids re­ leased into the blood are used for energy (in muscle, for example), and some are taken up by the liver and used in triacylglycerol synthesis. The triacylglycerol formed in the l iver is transported in the blood back to adi­ pose tissue, where the fatty acid is released by extracellular lipoprotein l ipase, taken up by adipocytes, and reesterified i nto triacylglycerol.

2 1 .4) , and taken up again by adipose tissue after release from triacylglycerol by extracellular lipoprotein lipase (Fig. 2 1 -2 0; see also Fig. 1 7-1) . Flux through this triacylglycerol cycle between adipose tissue and liver may be quite low when other fuels are available and the release of fatty acids from adipose tissue is limited, but as noted above, the proportion of released fatty acids that are reesterified remains roughly constant at 75% under all metabolic conditions. The level of free fatty acids in the blood thus reflects both the rate of release of fatty acids and the balance between the synthesis and breakdown of triacylglycerols in adipose tissue and liver. When the mobilization of fatty acids is required to meet energy needs, release from adipose tissue is stimu­ lated by the hormones glucagon and epinephrine (see Figs 1 7-3, 1 7-12) . Simultaneously, these hormonal sig­ nals decrease the rate of glycolysis and increase the rate of gluconeogenesis in the liver (providing glucose for the brain, as further elaborated in Chapter 23) . The released fatty acid is taken up by a number of tissues, including muscle, where it is oxidized to provide energy. Much of the fatty acid taken up by liver is not oxidized but is re­ cycled to triacylglycerol and returned to adipose tissue. The function of the apparently futile triacylglycerol cycle (futile cycles are discussed in Chapter 1 5) is not well understood. However, as we learn more about how the triacylglycerol cycle is sustained via metabolism in two separate organs and is coordinately regulated, some possibilities emerge. For example, the excess capacity in the triacylglycerol cycle (the fatty acid that is eventu­ ally reconverted to triacylglycerol rather than oxidized

as fuel) could represent an energy reserve in the blood­ stream during fasting, one that would be more rapidly mobilized in a "fight or flight" emergency than would stored triacylglycerol. The constant recycling of triacylglycerols in adipose tissue even during starvation raises a second question: what is the source of the glycerol 3-phosphate required for this process? As noted above, glycolysis is suppressed in these conditions by the action of glucagon and epineph­ rine, so little DHAP is available, and glycerol released dur­ ing lipolysis cannot be converted directly to glycerol 3-phosphate in adipose tissue, because these cells lack glycerol kinase (Fig. 21-17) . So, how is sufficient glycerol 3-phosphate produced? The answer lies in a pathway dis­ covered more than three decades ago and given little at­ tention until recently, a pathway intimately linked to the triacylglycerol cycle and, in a larger sense, to the balance between fatty acid and carbohydrate metabolism. Adipose Tissue Generates Glycerol 3-phosphate by Glyceroneogenesis

Glyceroneogenesis is a shortened version of gluco­ neogenesis, from pyruvate to DHAP (see Fig. 1 4-1 6) , followed by conversion of the DHAP to glycerol 3-phos­ phate by cytosolic NAD-linked glycerol 3-phosphate de­ hydrogenase ( Fig. 2 1-2 1 ) . Glycerol 3-phosphate is subsequently used in triacylglycerol synthesis. Glycero­ neogenesis was discovered in the 1 960s by Lea Reshef, Richard Hanson, and John Ballard, and simultaneously by Eleazar Shafrir and his coworkers, who were in­ trigued by the presence of two gluconeogenic enzymes, pyruvate carboxylase and phosphoenolpyruvate (PEP)

1

Pyruvate pyruvate car boxylase

Oxaloacetate

1 1

PEP carboxy kinase

Phosphoenolpyruvate

l

multistep

Dihydroxyacetone phosphate

CH20H

glycerol 3 phosphate

dehydrogenase

FIGURE 2 1 -2 1 Glyceroneo­ genesis. The

I

CHOH

0

II

I

CH2 - o -p - o-

l

o-

Glycerol 3-phosphate

1

Triacylglycerol synthesis

pathway is essen­ tia l ly an abbreviated version of gluconeogenesis, from pyruvate to dihydroxyacetone phosphate (DHAP), fol lowed by conversion of DHAP to glycerol 3-phosphate, which is used for the synthesis of tri­ acylglycerol.

2 1 . 2 Biosynthesis of Triacylg lycerols

carboxykinase , in adipose tissue, where glucose is not synthesized. After a long period of inattention, interest in this pathway has been renewed by the demonstration of a link between glyceroneogenesis and late-onset (type 2) diabetes, as we shall see. Glyceroneogenesis has multiple roles. In adipose tissue, glyceroneogenesis coupled with reesterification of free fatty acids controls the rate of fatty acid release to the blood. In brown adipose tissue, the same pathway may control the rate at which free fatty acids are deliv­ ered to mitochondria for use in thermogenesis (see Fig. 1 9-34) . And in fasting humans , glyceroneogenesis in the liver alone supports the synthesis of enough glycerol 3phosphate to account for up to 65% of fatty acids reesterified to triacylglycerol. Flux through the triacylglycerol cycle between liver and adipose tissue is controlled to a large degree by the activity of PEP carboxykinase, which limits the rate of both gluconeogenesis and glyceroneogenesis. Gluco­ corticoid hormones such as cortisol (a biological steroid derived from cholesterol; see Fig. 2 1-45) and dexa­ methasone (a synthetic glucocorticoid) regulate the levels of PEP carboxykinase reciprocally in the liver and adipose tissue. Acting through the glucocorticoid receptor, these steroid hormones increase the expression of the gene encoding PEP carboxykinase in the liver, thus increasing gluconeogenesis and glyceroneogenesis (Fig. 2 1-22 ) .

(a)

"'

Trio y0. � , ,

I

Lipoprotein lipase

Glycerol



"

..

ac1

..

.. _,. ... M

/



Glycerol 3-phosphate

..

:

glycero- I neogenesis

PEP CK

Pyruvate

(b)

f

n " F:C�

tissues

Triacylglycerol

J ...... .... JJt'



l

Fuel for tisl,'lue

Fatty � acid I "

Glycerol

3-phosphate

� e- t-- 1

DNA 1\::D...

Stimulation of glyceroneogenesis leads to an in­ crease in the synthesis of triacylglycerol molecules in the liver and their release into the blood. At the same time, glucocorticoids suppress the expression of the gene encoding PEP carboxykinase in adipose tissue. This results in a decrease in glyceroneogenesis in adi­ pose tissue ; recycling of fatty acids declines as a result, and more free fatty acids are released into the blood. Thus glyceroneogenesis is regulated reciprocally in the liver and adipose tissue, affecting lipid metabolism in opposite ways: a lower rate of glyceroneogenesis in adi­ pose tissue leads to more fatty acid release (rather than recycling) , whereas a higher rate in the liver leads to more synthesis and export of triacylglycerols. The net result is an increase in flux through the triacylglycerol cycle. When the glucocorticoids are no longer present, flux through the cycle declines as the expression of PEP carboxykinase increases in adipose tissue and decreases in the liver.

.. .... ....'

.... ....

... ..

Triacy lglycerol

Pyruvate

Dexamethasone

G l ycerol

3-phos_phate



.....

.,._,

glyc�o-t I

0

Fuel for

aeid

Glycerol

neogenesis PEP( K

Cortisol

l

, � . .-----r

Tr�acylglyce1·ol 'Fatty/\..

DNA 'R!iA

Glycerol 3-phosphate

0

Liver

Blood

Adipose tissue

[a2 3]

!

Thiazolidinedione$1

Gl uco­ corticoid hormones stimu late glyceroneogenesis and gluco­ neogenesis in the l iver, while suppressing glyceroneogenesis in the adipose tissue (by reciprocal regu lation of the gene expressi ng PEP carboxyki nase (PEPCK) in the two tissues); this increases the flux through the triacylglycerol cycle. The glycerol freed by the breakdown of triacylglycerol in adipose tissue is released to the blood and trans­ ported to the liver, where it is primari ly converted to glucose, although some is converted to glycerol 3-phosphate by glycerol ki nase. (b) A class of drugs cal led thiazolidinediones are now used to treat type 2 di­ abetes. I n this disease, high levels of free fatty acids in the blood inter­ fere with glucose util ization in muscle and promote insulin resistance. Thiazolidi nediones activate a nuclear receptor cal led peroxisome prol iferator-activated receptor 1' (PPARy), which induces the activity of PEP carboxykinase. Therapeutically, thiazolidi nediones i ncrease the rate of glyceroneogenesis, thus i ncreasing the resynthesis of triacyl­ glycerol in adipose tissue and reducing the amount of free fatty acid in the blood. FIGURE 2 1 -22 Regulation of glyceroneogenesis. (a)

[s24]

Lipid Biosynthesis

21 .3 Biosynthesis of

Thiazolidinediones Treat Type 2 Diabetes by I ncreasing Glyceroneogenesis

The recent attention to glyceroneogenesis has arisen in part from the connection between this pathway and diabetes. High levels of free fatty acids in the blood interfere with glucose utilization in muscle and promote the insulin resistance that leads to type 2 diabetes. A new class of drugs called thiazol­ idinediones reduce the levels of fatty acids circulat­ ing in the blood and increase sensitivity to insulin. Thiazolidinediones promote the induction in adipose tissue of PEP carboxykinase (Fig. 2 1-22), leading to increased synthesis of the precursors of glyceroneoge­ nesis. The therapeutic effect of thiazolidinediones is thus due, at least in part, to the increase in glycero­ neogenesis, which in turn increases the resynthesis of triacylglycerol in adipose tissue and reduces the re­ lease of free fatty acid from adipose tissue into the blood. The benefits of one such drug, rosiglitazone (Avandia) , are countered in part by an increased risk of heart attack, for reasons not yet clear. Assessment of this drug is continuing. •

�NH (l c H, N Nl�o 0

� 0

Rosiglitazone (Avandia)

Membrane Phospholipids In Chapter 10 we introduced two major classes of mem­ brane phospholipids: glycerophospholipids and sphin­ golipids. Many different phospholipid species can be constructed by combining various fatty acids and polar head groups with the glycerol or sphingosine backbone (see Figs 10-9, 1 0-13) . All the biosynthetic pathways follow a few basic patterns. In general, the assembly of phospholipids from simple precursors requires (1) syn­ thesis of the backbone molecule (glycerol or sphingo­ sine); (2) attachment of fatty acid(s) to the backbone through an ester or amide linkage; (3) addition of a hydrophilic head group to the backbone through a phos­ phodiester linkage; and, in some cases, (4) alteration or exchange of the head group to yield the final phospho­ lipid product. In eukaryotic cells, phospholipid synthesis occurs primarily on the surfaces of the smooth endoplasmic reticulum and the mitochondrial inner membrane. Some newly formed phospholipids remain at the site of syn­ thesis, but most are destined for other cellular locations. The process by which water-insoluble phospholipids move from the site of synthesis to the point of their eventual function is not fully understood, but we con­ clude this section by discussing some mechanisms that have emerged in recent years. Cells Have Two Strategies for Attaching Phospholipid Head Groups

Pioglitazone (Actos) Thiazolidinediones

S U M M A RY 2 1 . 2 •

• •

B i o s y n t h e s i s of Tri a c y l g lyce ro l s

Triacylglycerols are formed by reaction of two molecules of fatty acyl-CoA with glycerol 3-phosphate to form phosphatidic acid; this product is dephosphorylated to a diacylglycerol, then acylated by a third molecule of fatty acyl-CoA to yield a triacylglycerol. The synthesis and degradation of triacylglycerol are hormonally regulated. Mobilization and recycling of triacylglycerol molecules results in a triacylglycerol cycle. Triacylglycerols are resynthesized from free fatty acids and glycerol 3-phosphate even during starvation. The dihydroxyacetone phosphate precursor of glycerol 3-phosphate is derived from pyruvate via glyceroneogenesis.

The first steps of glycerophospholipid synthesis are shared with the pathway to triacylglycerols (Fig. 2 1-1 7): two fatty acyl groups are esterified to C-1 and C-2 of L-glycerol 3-phosphate to form phosphatidic acid. Com­ monly but not invariably, the fatty acid at C-1 is saturated and that at C-2 is unsaturated. A second route to phos­ phatidic acid is the phosphorylation of a diacylglycerol by a specific kinase. The polar head group of glycerophospholipids is at­ tached through a phosphodiester bond, in which each of two alcohol hydroxyls (one on the polar head group and one on C-3 of glycerol) forms an ester with phosphoric acid (Fig. 2 1-23). In the biosynthetic process, one of the hydroxyls is first activated by attachment of a nucleotide cytidine diphosphate (CDP) . Cytidine monophosphat� (CMP) is then displaced in a nucleophilic attack by the other hydroxyl (Fig. 2 1-24). The CDP is attached either to the diacylglycerol, forming the activated phosphatidic acid CDP-diacylglycerol (strategy 1 ) , or to the hy­ droxyl of the head group (strategy 2) . Eukaryotic cells employ both strategies, whereas bacteria use only the first. The central importance of cytidine nucleotides in lipid biosynthesis was discovered by Eugene P. Kennedy in the early 1960s.

2 1 . 3 Biosynthesis of M e m brane Phospholipids

II

0 CH2-0-C-R

I



Phospholipid Synthesis in f. coli Employs CDP­

1

Diacylglyceroi

Diacylglycerol CH- O-C-R 2 0

I Ho-011 - c..:.:.J

H20

alcohol




) . Displacement of CMP through nucleophilic at­ tack by the hydroxyl group of serine or by the C-1 hy­ droxyl of glycerol 3-phosphate yields phosphatidyl­ serine or phosphatidylglycerol 3-phosphate, respec­ tively. The latter is processed further by cleavage of the phosphate monoester (with release of Pi) to yield phos­ phatidylglycerol. Phosphatidylserine and phosphatidylglycerol can serve as precursors of other membrane lipids in bacteria (Fig. 2 1-25) . Decarboxylation of the serine moiety in phosphatidylserine, catalyzed by phosphatidylserine decarboxylase, yields phosphatidylethanolamine. In E. coli, condensation of two molecules of phosphati­ dylglycerol, with elimination of one glycerol, yields cardiolipin, in which two diacylglycerols are j oined through a common head group.

1

� � �

2 CH - 0-C-R CH2 -0-P-0

oI

H ead group

phosphodiester

Glycerophospholipid

FIGURE 2 1 -23 Head-group attachment. The phospholipid head group is attached to a d iacylglycerol by a phosphodiester bond, formed when phosphoric acid condenses with two alcohols, elimi nating two mole­ cules of H20.

Strategy 2 Head group activated with CDP

Strategy 1 Diacylglycerol activated with CDP

0

II

CH2 -0 -C-R

I I



C H - 0 -C-R

1

2

�'-----· 0-.,._:� .CH2 - 0 H 196 1,2-Diacylglycerol

Eugene P. Kennedy

0

.--·

I

o

--m;]

O=P-0-

CDP-cliacylglycerol

CMP

.J

0

II

CH2-0-C-R

I I

1



2 CH - 0-C-R

9

CH2 -0-P-0

I

o-

/ CMP

� Head group

Glycerophospholipid

FIGURE 2 1 -24 Two general strategies for forming the phosphodiester bond of phospholipids. In both cases, CDP

supplies the phosphate group of the phosphodiester bond.

1

0

ead group

[s26]

lipid Biosynthesis

0 H2-0- -R I � CH-0-C-R' � I CH2-0-P-o­ oII

II

I

2

r-:J=:, 0

cTP

PP ,

:.-.. _.:::..c__ _�

_

I

� ? I Hz-o-r-o-r-o-i_!!!�J-1 C

o- o-

l

ytosi ne 1

coP-diacyigiyceroi

Pho phatidate

G1ycerol 3pbo phate

0 CH2-0- -R I �-R CH-00 ?! ICH2-0-P-O H2-CH-CH2-0-P-O0 OH oCMP

I

I

2

II

I

I

I

Phosphatidylserine

Phosphatidylglycerol 3-phosphate

PS decarboxylase

PG 3-phosphate phosphatase

0 Hz-0-C-R II

I



0 CH2-0- -R1 ?! 2 I CH-0-C-R ? I CH2-0-P-O-CH2-CH2--NH3

1



l:,=:=t:�CH,-CH-CH,OH oOH �

I

I o-

I

Phosphatidyiethanoiamine

Phosphatidylglycerol

I

Phosphatidylglycerol

, j ,. ,J ,

(bacterial I

0 CH2-0-C-R ? 2 I CH-0-C-R ? I CH2-0-P-0-CH2 6- dHOH 0 CH2-0-P-O-CH2 0 2 CH-0-G-R ? I CH2-0-C-R Glycerol

II

1

I

FIGURE

II

I o-

Cardiolipin

I

21-25 Origin of the polar head groups of

phospholipids in f. coli. Initial ly, a head group (either

serine or glycerol 3-phosphate) is attached via a COP­ diacylglycerol intermediate (strategy 1 in Fig. 2 1 -24).

II

For

phospholipids other than phosphatidylserine, the head

1

group is further modified, as shown here. In the enzyme names, PG represents phosphatidylglycerol; PS, phos­ phatidylserine.

2 1 .3 Biosynthesis of Membra n e Phospholipids

FIGURE 2 1 -26 Synthesis of cardiolipin and phos-

0



These glycerophosphol ipids are synthesized using strategy 1 in Figure 2 1 -24. Phosphatidylglycerol is synthesized as in bacteria (see Fig. 2 1 -25). PI represents phosphatidylinositol.

phatidylinositol in eukaryotes.

CH2-0- -R1

1 I

0

11 2 CH - 0-C-R





CH2-0-P-O-P-O

I

o-

Laz7J

I

� Cytosine j

o-

CDP-diacylglycerol Phosphatidylglycerol G.MP

Inositol

nt

GMP 0

II

CH2-0-C-R 1

I I

� �

CH-0-C-R

2

CH2-0-P-O-

I

0 OH

Cardiolipin

OH

OH

H

These -OH groups can also be esterified with -Po � - .

Phosphatidylinositol

Eu karyotes Synthesize Anionic Phospholipids from COP-Diacylglycerol

In eukaryotes, phosphatidylglycerol, cardiolipin, and the phosphatidylinositols (all anionic phospholipids; see Fig. 1 0-9) are synthesized by the same strategy used for phospholipid synthesis in bacteria. Phosphatidylglycerol is made exactly as in bacteria. Carcliolipin synthesis in eu­ karyotes differs slightly: phosphatidylglycerol condenses with CDP-cliacylglycerol ( Fig. 2 1 -2fi ), not another mol­ ecule of phosphatidylglycerol as in E. coli (Fig. 2 1-25) . Phosphatidylinositol is synthesized by condensation of CDP-diacylglycerol with inositol (Fig. 2 1-26) . Specific phosphatidylinositol kinases then convert phos­ phatidylinositol to its phosphorylated derivatives. Phos­ phatidylinositol and its phosphorylated products in the plasma membrane play a central role in signal transduc­ tion in eukaryotes (see Figs 1 2-1 0, 1 2-16). Eu karyotic Pathways to Phosphatidylserine, Phosphatidylethanolamine, a n d Phosphatidylcholine A re I nterrelated

Yeast, like bacteria, can produce phosphatidylserine by condensation of CDP-diacylglycerol and serine, and can

synthesize phosphatidylethanolamine from phosphatidyl­ serine in the reaction catalyzed by phosphatidylserine decarboxylase ( Fig. 2 1-27). Phosphatidylethanolamine may be converted to phosphatidylcholine (lecithin) by the addition of three methyl groups to its amino group; S-adenosylmethionine is the methyl group donor (see Fig. 18-18) for all three methylation reac­ tions. These paths are the major sources of phos­ phatidylethanolamine and phosphatidylcholine in all eukaryotic cells. In mammals, phosphatidylserine is not synthe­ sized from CDP-diacylglycerol; instead, it is derived from phosphatidylethanolamine or phosphatidyl­ choline via one of two head-group exchange reac­ tions carried out in the endoplasmic reticulum ( Fig. 2 l -2 8 a ) . Synthesis of phosphatidylethanolamine and phosphatidylcholine in mammals occurs by strategy 2 of Figure 2 1-24 : phosphorylation and ac­ tivation of the head group, followed by condensation with diacylglycerol. For example, choline is reused ("salvaged") by b eing phosphorylated then con­ verted to CDP-choline by condensation with CTP. A diacylglycerol displaces CMP from CDP-choline, producing phosphatidylcholine (Fig . 2 1 -28b) . An analogous salvage pathway converts ethanolamine

[82 8]

Lipid Biosynthesis

0

II

0

1

I I



2 CH- 0-C-R

I I

Ha

I

oI

Phosphatidylcholine

Phosphatidylethanolamine

Phosphatidylserine II

+

CH2-0-P-0-CHz-CHz-NHa

CH2-0-P-O-CH2-CH-COO­

o-

� �

2 CH- 0-C-R

f



II

1

II

CH2-0-C-R

CH2-0-C-R

j��

Serine

I I

..

hol�ne

Ethanolamine

0

II

CH2-0-C-R

I I

serine

1



2 CH- 0-C-R



+

(a)

CH2-0-P-O-CH2-CH2-NH3

o-

+

Phosphatidyiethanoiamine

HO-CH2-CH2 -N(CH3)a

V 3 adoMet I � a a d oHcy 0

II

CH2-0-C-R

l I

Phosphatidylserine

I

� ·

V ATP �ADP

� v

0

+

-o-P-O-CH2-CH2 - N(CH3)a II

1

-o I



I I ' ·. < I 1. 1 1 I .1 1 )(' I ''" 1 \ I Hh h i

2 H-0- -R



: d('J : 1 :-'(' l l 111-

+

CH2-0-P-0-CH2-CH2 -N (CH3)a

0

oI

II I

0

I

O=P-0 major

path

Phosphocholine

CTP

ppi +

-o-P-O-CH2-CHz - N(CH3)3

Phosphatidyichoiine

FIGURE 2 1 -2 7 The

. .

Choline

from

oI

phos­

phatidylserine to phosphatidylethanolamine and

\.'.�:_:_·;,.·_,·:_':;',' ;.,1

phosphatidylcholine in all eukaryotes. AdoMet is 5-adenosylmethionine; adoHcy, 5-adenosylhomo­ cystei ne.

J l i J I J c; ) J i w c h l l l l n l ' I J d l l � l l 'l"

FIGURE 2 1 -28 Pathways for phosphatidylserine and phosphatidyl­ choline synthesis in mammals. (a) Phosphatidylserine is synthesized by Ca2 + -dependent head-group exchange reactions promoted by phosphatidylserine synthase 1 (PSS1 ) or phosphatidylseri ne synthase 2 (PSS2). PSS1 can use either phosphatidylethanolamine or phos­ phatidylcholine as a substrate. The pathways used by bacteria and yeast correspond to those shown in Figure 2 1 -2 7 . (b) The same strategy shown here for phosphatidylchol i ne synthesis (strategy 2 in Fig. 2 1 -24) is also used for salvaging ethanolamine in phos­ phatidylethanolamine synthesis.

(b)



� Rib H Cyto in I

>(

s

e

Diacylglycerol CMP

Phosphatidylcholine

CDP-choline

2 1 .3 Biosynthesis of M e mbrane Phospholipids

obtained in the diet to phosphatidylethanolamine. In the liver, phosphatidylcholine is also produced by methylation of phosphatidylethanolamine (with S­ adenosylmethionine, as described above) , but in all other tissues phosphatidylcholine is produced only by condensation of diacylglycerol and CDP-choline. The pathways to phosphatidylcholine and phos­ phatidylethanolamine in various organisms are sum­ marized in Figure 2 1-29 . Although the role of lipid composition in membrane function is not entirely understood, changes in composi­ tion can produce dramatic effects. Researchers have

Mammals Ethanolamine

Choline

CDP-ethanolamine

CDP-choline

\C02 \carboxylation 3 adoMet

Phosphatidyl-

cthanolamine

erine

Ethanolamine

)

choline

Serine

Bacteria and yeast

FIGURE 21 -29 Summary of the pathways for synthesis of major phos­

The pathways vary in different classes of organ isms. In this diagram, pathways used by mammals are highlighted in yellow; those used by bacteria and yeast are highl ighted in pink. Orange highl ighting shows where the paths overlap. In mammals, phosphatidylethanola­ mine and phosphatidylcholine are synthesized by a pathway employ­ ing diacylglycerol and the COP-derivative of the appropriate head group. Conversion of phosphatidylethanolamine to phosphatidyl­ choline in mammals takes place only in the l iver. The pathways for phosphatidylserine synthesis for various classes of organisms are de­ tailed in Figures 2 1 -2 7 and 2 1 -2 8. pholipids.

Plasmalogen Synthesis Requ i res Formation of an Ether-linked Fatty Alcohol

The biosynthetic pathway to ether lipids, including plasmalogens and the platelet-activating factor (see Fig. 1 0-1 0) , involves the displacement of an es­ terified fatty acyl group by a long-chain alcohol to form the ether linkage (Fig. 2 1-30) . Head-group attach­ ment follows , by mechanisms essentially like those used in formation of the common ester-linked phos­ pholipids. Finally, the characteristic double bond of plasmalogens (shaded blue in Fig. 2 1-30) is introduced by the action of a mixed-function oxidase similar to that responsible for desaturation of fatty acids (Fig. 2 1-1 3 ) . The peroxisome is the primary site of plas­ malogen synthesis.

Share Precursors a n d Some Mechanisms

Phosphatidyl-

Pho phatidyl­ serine

CDP-diacylgl cerol

isolated fruit flies with mutations in the gene that en­ codes ethanolamine kinase (analogous to choline ki­ nase; Fig. 2 1-28b) . Lack of this enzyme eliminates one pathway for phosphatidylethanolamine synthesis, thereby reducing the amount of this lipid in cellular membranes. Flies with this mutation-those with the genotype easily shocked-exhibit transient paralysis following electrical stimulation or mechanical shock that would not affect wild-type flies.

Sphingolipid a n d Glycerophospholipid Synthesis

3 adoHcy

\. /

[s29]

The biosynthesis of sphingolipids takes place in four stages: (1) synthesis of the 1 8-carbon amine sphinga­ nine from palmitoyl-CoA and serine; (2) attachment of a fatty acid in amide linkage to yield N-acylsphin­ ganine; (3) desaturation of the sphinganine moiety to form N-acylsphingosine (ceramide); and (4) attach­ ment of a head group to produce a sphingolipid such as a cerebroside or sphingomyelin (Fig. 2 1-3 1 ) . The first few steps of this pathway occur in the endo­ plasmic reticulum, while the attachment of head groups in stage 4 occurs in the Golgi complex. The pathway shares several features with the pathways leading to glycerophospholipids: NADPH provides re­ ducing power, and fatty acids enter as their activated CoA derivatives. In cerebroside formation, sugars en­ ter as their activated nucleotide derivatives. Head­ group attachment in sphingolipid synthesis has several novel aspects. Phosphatidylcholine, rather than CDP­ choline, serves as the donor of phosphocholine in the synthesis of sphingomyelin. In glycolipids-the cerebrosides and gangliosides (see Fig. 1 0-13)-the head-group sugar is attached di­ rectly to the C-1 hydroxyl of sphingosine in glycosidic linkage rather than through a phosphodiester bond. The sugar donor is a UDP-sugar (UDP-glucose or UDP­ galactose) .

[s3o]

Lipid Biosynthesis

o ,;R1- C"

8-CoA

Fatty acyl-CoA +

CH20H I 0 C=O II I CH2 -0-P-ol o-

-"'\-4� CoA-SH

\

2 0 C H2-0- H2-CHz -R II I CH2 -0- -R t .:..._ fatty acyl L long-chain alcohol =O 0 0 group ---,.---«---� II I 1 -alkyldihydroxyCH2 -0-P-OCH2 -0- -oacetone I 1-Alkyldihydroxyacetone 3-phosphate 0o3-phosphate





r

l

1-Acyldihydroxyacetone 3-phosphate

synthase

I

II

'.l·l>h , pi

Dihydroxyacetone phosphate

r -{

Saturated fatty alcohol

2

NADPH

2 'ADP -

The newly formed ether l i n kage is shaded pink. The i ntermediate 1 al kyl-2-acylglycerol 3-phosphate is the ether analog of phospha­ tidic acid. Mechan isms for attaching head groups to ether l ipids are essentially the same as for thei r ester- l i nked analogs. The character­ istic double bond of plasmalogens (shaded bl ue) is i ntroduced in a final step by a m ixed-function oxidase system similar to that shown in Figure 2 1 -1 3 .

h

'

l't t• m

luci.Jt

2 CH2 -O-CH2 -CH2 -R I CHOH 0 II I CH2 -0-P-ol o1-Alkylglycerol 3-phosphate 1

oA- H

F I G U R E 2 1 -30 Synthesis of ether lipids and plasmalogens.

hid" lrox\

a

lk lui ,. r< •l 3·pllo:,pll.tfc \ l lntn� h_or I'"

oA-SH

2 CHz-O-CH2 -CH2 -R

I � I � CH2-0-P-O3

CH-0-C-R

I

o-

head-group attachment

1-Alkyl-2-acylglycerol 3-phosphate

Ethanolamine

Polar Lipids Are Targeted to Specific Cellular Membranes

After synthesis on the smooth ER, the polar lipids, in­ cluding the glycerophospholipids, sphingolipids, and glycolipids, are inserted into specific cellular mem­ branes in specific proportions, by mechanisms not yet understood. Membrane lipids are insoluble in water, so they cannot simply diffuse from their point of synthesis (the ER) to their point of insertion. Instead, they are transported from the ER to the Golgi complex, where additional synthesis can take place. They are then deliv­ ered in membrane vesicles that bud from the Golgi com­ plex then move to and fuse with the target membrane (see Fig. 1 1-22) . These pathways are not completely understood, but progress is being made. A 68 kDa protein called CERT (for ceramide transport) trans­ ports ceramide from the ER to the Golgi complex. Cytosolic proteins also bind phospholipids and sterols and transport them between cellular membranes. These mechanisms contribute to the establishment of the characteristic lipid compositions of organelle mem­ branes (see Fig. 1 1-2) .

+ H' mixed-function

oxidase

CH2-0- H CH-R2

I ?! � I CHz-O-r--O-GH 2 -CH 2 3

CH-0-C-R

o-

A plasmalogen

+

-NHa

2 1 . 4 Biosynthesis of Cholesterol, Steroids, a n d Isoprenoids

0� C-(CH2h4-CH3 CoA-S / lr� O� )CHzh4-CH3 C H3N-C-H CH2-0H �.r- ADPH � NADP' HO-CH-(CHz)I4 -CH3 21 H3N-C-H CH2-0H lr1� 0 HO-CH-(CHzh4-CH3 R-C-NH-C-H CH2-0H

S U M MARY 2 1 . 3

Palmitoyl-CoA



Serine



CoA-SH. C02

+

I

{3-Ketosphinganine

I



+ H.

3

+



Sphinganine

I I

Fatly acyl- oA CoA-SH

I

II

N-acylsphinganine

I

1

m





u

tanimalsl

0 HO-CH-CH=CH-(CH2h2-CH3 R-C-NH-C-H CH2-0H II

I

I



UDP-Glc

UDP

____: _ :o, ""--�

_ _

attachment

Phosphatidylcholine

0 HO-CH-CH=CH-(CH2h2-CH3 R-C-NH-C-H 0 CHz -0-P-O-CH2 -CH2 -N(CH3)a II

Diacylglycerol

I

I

II

B i os y n t h e s i s of M e m b r a n e Phospholipids

Diacylglycerols are the principal precursors of glycerophospholipids. In bacteria, phosphatidylserine is formed by the condensation of serine with CDP-diacylglycerol; decarboxylation of phosphatidylserine produces phosphatidylethanolamine. Phosphatidylglycerol is formed by condensation of CDP-diacylglycerol with glycerol 3-phosphate, followed by removal of the phosphate in monoester linkage. Yeast pathways for the synthesis of phosphatidylserine , phosphatidylethanolamine, and phosphatidylglycerol are similar to those in bacteria; phosphatidylcholine is formed by methylation of phosphatidylethanolamine . Mammalian cells have some pathways similar to those in bacteria, but somewhat different routes for synthesizing phosphatidylcholine and phosphatidylethanolamine. The head-group alcohol (choline or ethanolamine) is activated as the CDP derivative , then condensed with diacylglycerol. Phosphatidylserine is derived only from phosphatidylethanolamine. Synthesis of plasmalogens involves formation of their characteristic double bond by a mixed-function oxidase. The head groups of sphingolipids are attached by unique mechanisms. Phospholipids travel to their intracellular destinations via transport vesicles or specific proteins.

0 HO-CH-CH=CH-(CH2hz-CH3 R-C-NH-C-H CH2-0-Glc II

I

I

Cerebroside

Ceramide, containing sphingosine head-group

[8 31]

+

I

o�

Sphingomyelin

F I G U R E 2 1 -3 1 Biosynthesis of sphingolipids. Condensation of palm itoyl-CoA and serine (forming {3-ketosphi ngan ine) followed by reduction with NADPH yields sphi ngan ine, wh ich is then acylated to N-acylsph ingan ine (a ceramide)_ I n animals, a double bond (shaded pi nk) is created by a mixed-fu nction oxidase before the final addition of a head group: phosphatidylcholi ne, to form sph i ngomyelin, or glucose, to form a cerebroside.

21 .4 Biosynthesis of Cholesterol,

Steroids, and Isoprenoids Cholesterol is doubtless the most publicized lipid, notori­ ous because of the strong correlation between high levels of cholesterol in the blood and the incidence of human cardiovascular diseases. Less well advertised is choles­ terol's crucial role as a component of cellular membranes and as a precursor of steroid hormones and bile acids . Cholesterol is an essential molecule in many animals, in­ cluding humans, but is not required in the mammalian diet-all cells can synthesize it from simple precursors. The structure of this 27 -carbon compound suggests a complex biosynthetic pathway, but all of its carbon atoms are provided by a single precursor-acetate. The isoprene units that are the essential intermediates in

[8 32]

Lipid Biosynthesis

3 CH3 -coo-

the pathway from acetate to cholesterol are also precur­ sors to many other natural lipids, and the mechanisms by which isoprene units are polymerized are similar in all these pathways.

Acetate

CH3

I

CH2 = C - CH=CH2 Isoprene

We begin with an account of the main steps in the biosynthesis of cholesterol from acetate, then discuss the transport of cholesterol in the blood, its uptake by cells, the normal regulation of cholesterol synthesis, and its regulation in those with defects in cholesterol uptake or transport. We next consider other cellular compo­ nents derived from cholesterol, such as bile acids and steroid hormones. Finally, an outline of the biosynthetic pathways to some of the many compounds derived from isoprene units, which share early steps with the path­ way to cholesterol, illustrates the extraordinary versatil­ ity of isoprenoid condensations in biosynthesis.

®1

CH 3

1

0

II

0

II

CH2 =C-CH2 - CH2-0-P-0- P-oisoprene

l

o-

I

a-

Activated isoprene

Cholesterol Is Made from Acetyi-CoA in Four Stages

Cholesterol, like long-chain fatty acids, is made from acetyl-GoA, but the assembly plan is quite different. In early experiments, animals were fed acetate labeled with 14C in either the methyl carbon or the carboxyl car­ bon. The pattern of labeling in the cholesterol isolated from the two groups of animals (Fig. 2 1-32) provided the blueprint for working out the enzymatic steps in cholesterol biosynthesis. Synthesis takes place in four stages, as shown in Figure 2 1 -33: CD condensation of three acetate units to form a six-carbon intermediate, mevalonate; ® con­ version of mevalonate to activated isoprene units; ® polymerization of six 5-carbon isoprene units to form the 30-carbon linear squalene; and ® cyclization of squalene to form the four rings of the steroid nucleus, with a further series of changes (oxidations, removal or migration of methyl groups) to produce cholesterol. crra - coo­ Acetate

Cholesterol FIGURE 2 1 -32 Origin of the carbon atoms of cholesterol. This can be deduced from tracer experiments with acetate labeled in the methyl carbon (black) or the carboxyl carbon (red). The individual rings in the fused-ring system are designated A through D.

HO Cholesterol FIGURE 2 1 -33 Summary of cholesterol biosynthesis. The four stages are discussed in the text. Isoprene units in squalene are set off by red dashed I ines.

Stage CD Synthesis of Mevalonate from Acetate The first stage in cholesterol biosynthesis leads to the intermediate mevalonate (Fig. 2 1-34 ) . Two mole­ cules of acetyl-GoA condense to form acetoacetyl-GoA, which condenses with a third molecule of acetyl-GoA to yield the six-carbon compound f3-hydroxy-f3methy1glutaryl-CoA (HMG-CoA). These first two reactions are catalyzed by thiolase and HMG-CoA synthase, respectively. The cytosolic HMG-CoA syn­ thase in this pathway is distinct from the mitochondrial isozyme that catalyzes HMG-CoA synthesis in ketone body formation (see Fig. 1 7-18) . The third reaction is the committed and rate-limiting step: reduction of HMG-CoA to mevalonate, for which each of two molecules of NADPH donates two electrons. HMG-CoA reductase, an integral membrane protein of the smooth ER, is the major point of regulation on the pathway to cholesterol, as we shall see.

2 1 .4 Biosynthesis of Cholesterol, Steroids, a n d Isoprenoids

"' ' " ' �

[833]

o ,f'

2 CH3-C

"

0

S-CoA

Acetyl-GoA

CoA-SH

Mevalonate mevalonate

0 II ,?' CH3 -C-CHz -c



"": f �I\ -

H IJ

��

>

,

5-phosphotran sferase

S-CoA

Acetoacetyl-CoA

CH3-c�0 CoA

coo­ l

H

I

yHs

I

/3-Hydroxy-{3-methylglutaryl-CoA (HMG-CoA)

l

oH

I 2 CH2 I . a C H 3 -C -O H 4 I CH, I 5

CH20H



I

I

o-

o-

5-Pyrophosphomevalona te

pvrupbo phu

rHP\-,I{l t natf'

rh·t'lu·!• ••vln,•·

H

CH3

1 I

1 COO�

t



- OOC-CH2 -C-CH2 -CH2 -0-P-0-P-o-

2 NADPH + 2H+

CoA-

I

phq phurnP'>''tJun.Ht ku1.1�•

CH2

S-CoA

o5-Phosphomevalonate

I

,f' "

OH

l

-CoA

CH3 -C-OH

0



- OOC-CH2 -C-CH2 -CH2 -0-P-o-

CH2

c

yH s

ATP

ADP 0

0

1II

r II

OO C-C H2 -C - CH2 - C H2 - 0- -o- -o-

?! o-P-o1

o-

o-

o-

3-Phospho-5pyrophosphomevalonate

Mevalonate

FIGURE 21-34 Formation of mevalonate from acetyi-CoA. The origin of C-1 and C-2 of mevalonate from acetyi-CoA is shown i n pink.

Stage @ Conversion of Mevalonate to Two Acti­ vated lsoprenes In the next stage of cholesterol syn­ thesis, three phosphate groups are transferred from three ATP molecules to mevalonate (Fig. 2 1-35 ) . The phosphate attached to the C-3 hydroxyl group of meval­ onate in the intermediate 3-phospho-5-pyrophospho­ mevalonate is a good leaving group; in the next step, both this phosphate and the nearby carboxyl group leave, producing a double bond in the five-carbon prod­ uct, .13-isopentenyl pyrophosphate. This is the first of the two activated isoprenes central to cholesterol for­ mation. Isomerization of .:13-isopentenyl pyrophosphate yields the second activated isoprene , dimethylallyl py­ rophosphate . Synthesis of isopentenyl pyrophosphate in the cytoplasm of plant cells follows the pathway de­ scribed here. However, plant chloroplasts and many bacteria use a mevalonate-independent pathway. This alternative pathway does not occur in animals, so it is an attractive target for the development of new antibiotics.

Activated isoprenes

yHs





o-

o-

CH3 -C=CH-CH2 -0-P-0-P-o-

l

I

Dimethylallyl pyrophosphate FIGURE 21 -35 Conversion of mevalonate to activated isoprene units.

Six of these activated un its combine to form squalene (see Fig. 2 1 -36). The leaving groups of 3-phospho-5-pyrophosphomevalonate are shaded pink. The bracketed intermediate is hypothetical. Stage @ Condensation of Six Activated Isoprene Units to Form Squalene Isopentenyl pyrophos­ phate and dimethylallyl pyrophosphate now undergo a head-to-tail condensation, in which one pyrophosphate

[83 4]

lipid Biosynthesis

Stage @ Conversion of Squalene to the Four-Ring Steroid Nucleus When the squalene molecule is rep­ resented as in Figure 2 1-37, the relationship of its linear

group is displaced and a 10-carbon chain, geranyl py­ rophosphate, is formed (Fig. 2 1-36). (The "head" is the end to which pyrophosphate is joined.) Geranyl pyrophosphate

structure to the cyclic structure of the sterols becomes apparent. All sterols have the four fused rings that form the steroid nucleus, and all are alcohols, with a hydroxyl group at C-3-thus the name "sterol." The action of squalene monooxygenase adds one oxygen atom from 02 to the end of the squalene chain, forming an epoxide. This enzyme is another mixed-function oxidase (Box 2 1-1 ) ; NADPH reduces the other oxygen atom of 02 to H20. The double bonds of the product, squalene 2,3epoxide, are positioned so that a remarkable concerted reaction can convert the linear squalene epoxide to a cyclic structure. In animal cells, this cyclization results in the formation of lanosterol, which contains the four rings characteristic of the steroid nucleus. Lanosterol is

illldergoes another head-to-tail condensation with isopen­ tenyl pyrophosphate, yielding the 15-carbon intermediate farnesyl pyrophosphate. Finally, two molecules of fame­ syl pyrophosphate join head to head, with the elintination of both pyrophosphate groups, to form squalene. The common names of these intermediates derive from the sources from which they were first isolated. Geraniol, a component of rose oil, has the aroma of gera­ niums, and farnesol is an aromatic compound found in the flowers of the Farnese acacia tree. Many natural scents of plant origin are synthesized from isoprene units. Squalene, first isolated from the liver of sharks (genus Squalus) , has 30 carbons, 24 in the main chain and 6 in the form of methyl group branches. I �

o

11

o

I

o-

I

o-

11

0-P-0-P-o-



+

Dimethylallyl pyrophosphate

� �

� I

0-P- 0-P-o-

1

o-

o-

!13-Isopentenyl pyrophosphate

fll t'tl.Y l t ran:·di·rcb t'

(head·to·tail

condensation)

PP;

� �

Geranyl pyrophosphate

0- -0- -o-

I

I

o-

p

o-

I �

I II ,

lbead·to-Laill

0

o 11

o

6-

6-

11

0-P-O-P--o-

!13-l open tenyl pyrophosphate

0

II

II

0-P-0-P- 0-

1

I

o-

o-

II

0

I

II

Famesyl pyrophosphate

0

- 0-P-0- P-0

Famesyl pyrophosphate

0

ADP '

Squalene

FIGURE 2 1 -36 Formation of squalene. Th is 3 0-carbon structure arises through successive condensations of activated isoprene (five-carbon) units.

2 1 . 4 Biosynthesis of Cho lesterol, Stero id s, a n d Isoprenoids

finally converted to cholesterol in a series of about 20 re­ actions that include the migration of some methyl groups and the removal of others. Elucidation of this extraordi-

Konrad B loch, 1 9 1 2-2000

Feodor Lynen, 1 9 1 1 -1 979

[83.5]

nary biosynthetic pathway, one of the most complex known, was accomplished by Konrad Bloch, Feodor Ly­ nen, John Cornforth, and George Popjak in the late 1 950s.

George Popja k, 1 91 4-1 998

l ohn Cornforth

Squalene

qualene 2,3-epoxide

:/ ( pi:/

mulU "

HO

multist p

(f�Tj)



HO

HO multistep

HO

HO

1

Stigmasterol

Ergosterol

F I G U R E 2 1 -37 Ring closure converts linear

1

squalene to the condensed steroid nucleus.

Cholesterol

The first step in this sequence is catalyzed by a mixed-function oxidase (a monooxygenase), for which the cosubstrate is NADPH . The product is an epoxide, which in the next step is cyclized to the steroid nucleus. The final prod­ uct of these reactions in animal cel ls is choles­ terol; in other organisms, sl ightly different: sterols are produced, as shown.

[836]

lipid Biosynthesis

Cholesterol is the sterol characteristic of animal cells; plants, fungi, and protists make other, closely related sterols instead. They use the same synthetic pathway as far as squalene 2,3-epoxide, at which point the pathways diverge slightly, yielding other sterols, such as stigmas­ terol in many plants and ergosterol in fungi (Fig. 2 1-37) . - WORKED EXAMPLE 2 1 -1

HO

Energetic Cost of Squalene Synthesis

acyl·CoA-cholesterol acyl transfera,.;e I ACATI

What is the energetic cost of the synthesis of squalene from acetyl-CoA, in number of ATPs per molecule of squalene synthesized? In the pathway from acetyl-CoA to squalene, ATP is consumed only in the steps that convert meval­ onate to the activated isoprene precursors of squalene. Three ATP molecules are used to create each of the six activated isoprenes required to construct squalene, for a total cost of 18 ATP molecules.



Cholesterol Fatty acyl-CoA CoA-SH

Solution:

0

II

R-C-0 Cholesteryl ester FIGURE 21-38 Synthesis of cholesteryl esters. Esterification converts cholesterol to an even more hydrophobic form for storage and transport.

Cholesterol Has Several Fates

Much of the cholesterol synthesis in vertebrates takes place in the liver. A small fraction of the cholesterol made there is incorporated into the membranes of hepa­ tocytes, but most of it is exported in one of three forms: biliary cholesterol, bile acids, or cholesteryl esters. Bile acids and their salts are relatively hydrophilic choles­ terol derivatives that are synthesized in the liver and aid in lipid digestion (see Fig. 1 7-1) . Cholesteryl esters are formed in the liver through the action of acyl­ CoA-cholesterol acyl transferase (ACAT). This enzyme catalyzes the transfer of a fatty acid from coen­ zyme A to the hydroxyl group of cholesterol (Fig. 2 1-38), converting the cholesterol to a more hydropho­ bic form. Cholesteryl esters are transported in secreted lipoprotein particles to other tissues that use choles­ terol, or they are stored in the liver. All growing animal tissues need cholesterol for membrane synthesis, and some organs (adrenal gland and gonads, for example) use cholesterol as a precursor for steroid hormone production (discussed below) . Cho­ lesterol is also a precursor of vitamin D (see Fig. 1 0-20) . TA B LE 2 1 - 1

Cholesterol and Other Lipids Are Carried on Plasma lipoproteins

Cholesterol and cholesteryl esters, like triacylglycerols and phospholipids, are essentially insoluble in water, yet must be moved from the tissue of origin to the tissues in which they will be stored or consumed. They are carried in the blood plasma as plasma lipoproteins, macromole­ cular complexes of specific carrier proteins, apolipopro­ teins, with various combinations of phospholipids, cholesterol, cholesteryl esters, and triacylglycerols. Apolipoproteins ("apo" designates the protein in its lipid-free form) combine with lipids to form several classes of lipoprotein particles, spherical complexes with hydrophobic lipids in the core and hydrophilic amino acid side chains at the surface (Fig. 2 1 -39a) . Different combinations of lipids and proteins produce particles of different densities, ranging from chylomi­ crons to high-density lipoproteins. These particles can be separated by ultracentrifugation (Table 2 1-1) and visualized by electron microscopy (Fig. 2 1-39b) .

Major Oasses of Human Plasma Upoproteins: Some Properties Composition (wt %)

Lipoprotein

Density (g/mL)

Chylomicrons VLDL

Protein

Phospholipids

Free cholesterol

Cholesteryl esters

Triacylgl.ycerols

< 1 . 006

2

9

1

3

85

0.95-1 .006

10

18

7

12

50

LDL

1 . 006-1.063

23

20

8

37

10

HDL

1 .063-1 . 2 1 0

55

24

2

15

4

Source: M odified from

Kritchevsky,

D. ( 1986) Atherosclerosis

and nutrition. Nutr. lnt.

2. 290-297.

2 1 .4 Biosynthesis of Cholesterol, Steroids, a n d Isoprenoids

[s37]

\

Phospholipid monolayer

Free (unesterified) cholesterol Cholesteryl esters

Chylomicrons ( X 60,000)

VLDL ( X 180,000)

LDL ( X 180,000)

HDL ( X l80,000)

(b)

(a) FIGURE 2 1 -39 lipoproteins. (a) Structure of a low-density lipoprotein (LDL). Apolipoprotein B-1 00 (apoB-1 00) is one of the largest single polypeptide chai ns known, with 4,636 amino acid residues (M, 5 1 3,000). One particle of LDL contains a core with about 1 ,500 mol­ ecules of cholesteryl esters, surrounded by a shell composed of about 500 more molecules of cholesterol, 800 molecules of phospholipids, and one molecule of apoB-1 00. (b) Four classes of lipoproteins, visu­ alized in the electron microscope after negative staining. Clockwise from top left: chylomicrons, 50 to 200 nm in diameter; VLDL, 28 to 70 nm; H DL, 8 to 1 1 nm; and LDL, 20 to 25 nm. For properties of l ipopro­ teins, see Table 2 1 -1 .

TA B L E 2 1 -2 Apolipoprotein

Each class of lipoprotein has a specific function, determined by its point of synthesis, lipid composition, and apolipoprotein content. At least ten different apolipoproteins are found in the lipoproteins of human plasma (Table 2 1-2) , distinguishable by their size, their reactions with specific antibodies, and their characteris­ tic distribution in the lipoprotein classes. These protein components act as signals, targeting lipoproteins to specific tissues or activating enzymes that act on the lipoproteins.

A poll pop roteins of the Human Plasma U poproteins

------

Molecular weight

Lipoprotein association

Function (if known)

ApoA-I

28,331

HDL

Activates LCAT; interacts with

ApoA-II

1 7,380

HDL

Inhibits LCAT

ApoA-IV

44,000

Chylomicrons, HDL

Activates LCAT; cholesterol

ApoB-48

240,000

Chylomicrons

Cholesterol transport/clearance

ApoB-100

5 1 3 ,000

VLDL, LDL

Binds to LDL receptor

7,000

VLDL, HDL

ApoC-II

8,837

Chylomicrons, VLDL, HDL

Activates lipoprotein lipase

ApoC-III

8 , 75 1

Chylomicrons, VLDL, HDL

Inhibits lipoprotein lipase

ABC transporter

transport/clearance

ApoC-I

ApoD

32,500

HDL

ApoE

34, 145

Chylomicrons, VLDL, HDL

Triggers clearance of VLDL and chylomicron rerrmants

Source: Modified from Vance, D. E. & Vance, J.E. (eds) ( 1985) Biochemistry of Lipids and Membranes. The Benjamin/Cummings Publishing Company, Menlo Park, CA.

=838J

Lipid Biosynthesis

Chylomicrons, discussed in Chapter 17 in connec­ tion with the movement of dietary triacylglycerols from the intestine to other tissues, are the largest of the lipoproteins and the least dense, containing a high pro­ portion of triacylglycerols (see Fig. 1 7-2) . Chylomi­ crons are synthesized in the ER of epithelial cells that line the small intestine, then move through the lym­ phatic system and enter the bloodstream via the left subclavian vein. The apolipoproteins of chylomicrons in­ clude apoB-48 (unique to this class of lipoproteins) , apoE, and apoC-II (Table 2 1-2) . ApoC-II activates lipoprotein lipase in the capillaries of adipose, heart, skeletal muscle, and lactating mammary tissues, allow­ ing the release of free fatty acids to these tissues. Chy­ lomicrons thus carry dietary fatty acids to tissues where they will be consumed or stored as fuel (Fig. 2 1 -40) . The remnants of chylomicrons (depleted of most of their triacylglycerols but still containing cholesterol,

apoE , and apoB-48) move through the bloodstream to the liver. Receptors in the liver bind to the apoE in the chylomicron remnants and mediate their uptake by en­ docytosis. In the liver, the remnants release their cho­ lesterol and are degraded in lysosomes. When the diet contains more fatty acids than are needed immediately as fuel, they are converted to tria­ cylglycerols in the liver and packaged with specific apolipoproteins into very-low-density lipoprotein (VLDL) . Excess carbohydrate in the diet can also be converted to triacylglycerols in the liver and exported as VLDLs (Fig. 2 1 -40a) . In addition to triacylglycerols, VLDLs contain some cholesterol and cholesteryl esters, as well as apoB-1 00, apoC-I, apoC-II, apoC-III, and apoE (Table 2 1-2) . These lipoproteins are transported in the blood from the liver to muscle and adipose tissue, where activation of lipoprotein lipase by apoC-II causes the re­ lease of free fatty acids from the VLDL triacylglycerols.

Reverse cholesterol

Intestine

Extrahepatic tissues

J

HDL precursors (from liver and intestine)

Free fatty acids Mammary, muscle, or adipose tissue (a) FIGURE 2 1 -40 Lipoproteins and lipid transport. (a) Lipids are trans­ ported in the bloodstream as l ipoproteins, which exist as several vari­ ants that have different functions, different protein and lipid compositions (see Tables 2 1 - 1 , 21 -2), and thus different densities. Di­ etary l ipids are packaged into chylomicrons; much of their triacylglyc­ erol content is released by l ipoprotein lipase to adipose and muscle tissues during transport through capillaries. Chylomicron remnants (containing largely protein and cholesterol) are taken up by the liver. Endogenous lipids and cholesterol from the liver are del ivered to adi­ pose and muscle tissue by VLDL. Extraction of l ipid from VLDL (along

Blood plasma after meal

Blood plasma after fast (b)

with loss of some apolipoproteins) gradually converts some of it to LDL, which del ivers cholesterol to extrahepatic tissues or returns to the l iver. The l iver takes up LDL, VLDL remnants (called intermediate density l ipoprotein, or I DL), and chylomicron remnants by receptor­ mediated endocytosis. Excess cholesterol i n extrahepatic tissues is transported back to the l iver as HDL. In the liver, some cholesterol is converted to bile salts. (b) Blood plasma samples collected after a fast (left) and after a h igh-fat meal (right). Chylomicrons produced after a fatty meal give the plasma a milky appearance.

21 . 4 Biosynthesis of Cholesterol, Steroids, a n d Isoprenoids

[839]

TM E O I C I N E In the human population there are three common vari­ ants, or alleles, of the gene encoding apolipoprotein E . The most common, accounting for about 78% o f human apoE alleles, is APOE3; alleles APOE4 and APOE2 ac­ count for 1 5% and 7% , respectively. The APOE4 allele is particularly common in humans with Alzheimer's dis­ ease, and the link is highly predictive. Individuals who inherit APOE4 have an increased risk of late-onset Alzheimer's disease. Those who are homozygous for APOE4 have a 1 6-fold increased risk of developing the disease; for those who do, the mean age of onset is just under 70 years. For people who inherit two copies of APOE3, by contrast, the mean age of onset of Alzheimer's disease exceeds 90 years.

Adipocytes take up these fatty acids, reconvert them to triacylglycerols, and store the products in intracellular lipid droplets; myocytes, in contrast, primarily oxidize the fatty acids to supply energy. Most VLDL remnants are removed from the circulation by hepatocytes. The uptake, like that for chylornicrons, is receptor-mediated and depends on the presence of apoE in the VLDL rem­ nants . Box 2 1-2 describes a link between apoE and Alzheimer's disease. The loss of triacylglycerol converts some VLDL to VLDL remnants (also called intermediate density lipoprotein, IDL) ; further removal of triacylglycerol from VLDL produces low-density lipoprotein (LDL) (Table 2 1- 1 ) . Very rich in cholesterol and cholesteryl esters and containing apoB-100 as their maj or apolipoprotein, LDLs carry cholesterol to extrahepatic tissues that have specific plasma membrane receptors that recognize apoB-1 00. These receptors mediate the uptake of cholesterol and cholesteryl esters in a process described below. The fourth major lipoprotein type, high-density lipoprotein (HDL), originates in the liver and small intestine as small, protein-rich particles that contain relatively little cholesterol and no cholesteryl esters (Fig. 2 1 -40) . HDLs contain apoA-I, apoC-I, apoC-II, and other apolipoproteins (Table 2 1 -2) , as well as the enzyme lecithin-cholesterol acyl transferase (LCAT), which catalyzes the formation of cholesteryl esters from lecithin (phosphatidylcholine) and choles­ terol (Fig. 2 1-4 1 ) . LCAT on the surface of nascent (newly forming) HDL particles converts the cholesterol and phosphatidylcholine of chylomicron and VLDL remnants to cholesteryl esters, which begin to form a core, transforming the disk-shaped nascent HDL to a mature , spherical HDL particle. This cholesterol-rich lipoprotein then returns to the liver, where the choles­ terol is unloaded; some of this cholesterol is converted to bile salts.

The molecular basis for the association between apoE-4 and Alzheimer's disease is not yet known. It is also not clear how apoE-4 might affect the growth of the amyloid fibers that appear to be the primary causative agents of Alzheimer's (see Fig. 4-3 1 ) . Speculation has focused on a possible role for apoE in stabilizing the cy­ toskeletal structure of neurons. The apoE-2 and apoE-3 proteins bind to a number of proteins associated with neuronal microtubules, whereas apoE-4 does not. This may accelerate the death of neurons. Whatever the mechanism proves to be, these observations promise to expand our understanding of the biological functions of apolipoproteins.

0

II

CH2-0-C-R

I I

?J

1

:.� CH- 0 -C-R

+

HO

Cholesterol

?J

j

+

CH2 -0- P-O-CH2-CH2-N(CHala

I o-

Phosphatidylcholine (lecithin)

lt • tllun chulc• lr rul n \ l luut r.. r.��

! l l \T

0 / 2 --c R �

0

+

Cholesteryl ester

Lysolecithin

FIGURE 2 1 -41 Reaction catalyzed by lecithin-cholesterol acyl trans­

This enzyme is present on the surface of HDL and is stimulated by the HDL component apoA-1. Cholesteryl esters accumu­ late within nascent HDLs, converti ng them to mature H DLs.

ferase (LCAT).

[s4o]

Lipid Biosynthesis

HDL may be taken up in the liver by receptor­ mediated endocytosis, but at least some of the choles­ terol in HDL is delivered to other tissues by a novel mechanism. HDL can bind to plasma membrane recep­ tor proteins called SR-BI in hepatic and steroidogenic tissues such as the adrenal gland. These receptors me­ diate not endocytosis but a partial and selective transfer of cholesterol and other lipids in HDL into the cell. De­ pleted HDL then dissociates to recirculate in the blood­ stream and extract more lipids from chylomicron and VLDL remnants. Depleted HDL can also pick up choles­ terol stored in extrahepatic tissues and carry it to the liver, in reverse cholesterol transport pathways (Fig. 21-40) . In one reverse transport path, interaction of nascent HDL with SR-BI receptors in cholesterol-rich cells triggers passive movement of cholesterol from the cell surface into HDL, which then carries it back to the liver. In a second pathway, apoA-I in depleted HDL in­ teracts with an active transporter, the ABC 1 protein, in a cholesterol-rich cell. The apoA-I (and presumably the HDL) is taken up by endocytosis, then resecreted with a load of cholesterol, which it transports to the liver. The ABC1 protein is a member of a large family of multidrug transporters, sometimes called ABC trans­ porters because they all have ATP-binding cassettes;

they also have two transmembrane domains with six transmembrane helices (Chapter 1 1) . These proteins actively transport a variety of ions, amino acids, vita­ mins, steroid hormones, and bile salts across plasma membranes. The CFTR protein that is defective in cys­ tic fibrosis (see Box 1 1-3) is another member of this ABC family of multidrug transporters. Cholesteryl Esters Enter Cells by Receptor-Mediated Endocytosis Each LDL particle in the bloodstream contains apoB-100, which is recognized by specific surface receptor proteins, LDL receptors, on cells that need to take up cholesterol. The binding of LDL to an LDL receptor initiates endocy­ tosis, which conveys the LDL and its receptor into the cell within an endosome (Fig. 2 1-42). The endosome even­ tually fuses with a lysosome, which contains enzymes that hydrolyze the cholesteryl esters, releasing cholesterol and fatty acid into the cytosol. The apoB-100 of LDL is also degraded to amino acids that are released to the cy­ tosol, but the LDL receptor escapes degradation and is returned to the cell surface, to function again in LDL uptake. ApoB-100 is also present in VLDL, but its recep­ tor-binding domain is not available for binding to the

LDL particle

)

receptor-mediated endocyw i.a

Endosome

Lysosome

FIGURE 21 -42 Uptake of cholesterol by receptor-mediated endocytosis.

[841]

2 1 .4 Biosynthesis of Cholesterol, Steroids, a n d Isoprenoids

LDL receptor; conversion ofVLDL to LDL exposes the re­ ceptor-binding domain of apoB-100. This pathway for the transport of cholesterol in blood and its receptor-medi­ ated endocytosis by target tissues was elucidated by Michael Brown and Joseph Goldstein.

Cholesterol Biosynthesis I s Regulated at Several levels

Cholesterol synthesis is a complex and energy-expensive process, so it is clearly advantageous to an organism to regulate the biosynthesis of cholesterol to complement dietary intake. In mammals, cholesterol production is reg­ ulated by intracellular cholesterol concentration and by the hormones glucagon and insulin. The rate-limiting step in the pathway to cholesterol (and a major site of regula­ tion) is the conversion of HMG-CoA to mevalonate (Fig. 2 1-34) , the reaction catalyzed by HMG-CoA reductase. Regulation in response to cholesterol levels is medi­ ated by an elegant system of transcriptional regulation of the gene encoding HMG-CoA reductase. This gene, along with more than 20 other genes encoding enzymes that mediate the uptake and synthesis of cholesterol and unsaturated fatty acids, is controlled by a small fam­ ily of proteins called sterol regulatory element-binding proteins (SREBPs) . When newly synthesized, these proteins are embedded in the ER. Only the soluble amino-terminal domain of an SREBP functions as a tran­ scriptional activator, using mechanisms discussed in Chapter 28. However, this domain has no access to the nucleus and cannot participate in gene activation while it remains part of the SREBP molecule. To activate tran­ scription of the HMG-CoA reductase gene and other genes, the transcriptionally active domain is separated from the rest of the SREBP by proteolytic cleavage. When cholesterol levels are high, SREBPs are inactive, secured to the ER in a complex with another protein called SREBP cleavage-activating protein (SCAP) (Fig. 2 1-43). It is SCAP that binds cholesterol and a number of other sterols, thus acting as a sterol sensor. When sterol levels are high, the SCAP-SREBP complex proba­ bly interacts with another protein that retains the entire complex in the ER. When the level of sterols in the cell declines, a conformational change in SCAP causes release of the SCAP-SREBP complex from the ER-retention ac­ tivity, and the complex migrates within vesicles to the

Michael Brown and Joseph Goldstein

Cholesterol that enters cells by this path may be in­ corporated into membranes or reesterified by ACAT (Fig. 2 1-38) for storage within cytosolic lipid droplets. Accu­ mulation of excess intracellular cholesterol is prevented by reducing the rate of cholesterol synthesis when suffi­ cient cholesterol is available from LDL in the blood. The LDL receptor also binds to apoE and plays a significant role in the hepatic uptake of chylomicrons and VLDL remnants. However, if LDL receptors are un­ available (as, for example, in a mouse strain that lacks the gene for the LDL receptor) , VLDL remnants and chylomicrons are still taken up by the liver even though LDL is not. This indicates the presence of a back-up system for receptor-mediated endocytosis of VLDL remnants and chylomicrons. One back-up receptor is lipoprotein receptor-related protein (LRP) , which binds to apoE as well as to a number of other ligands.

Golgi complex

Golgi complex

Cytosol N

Endoplasmic reticulum

' �N SREBP

AP

Nucleus released

domain of

SREBP

migration Lo

Oolgi comple.� I I I

!

Sterol (binds SCAP, prevents release of SREBP)

FIGURE 2 1 -43 SREBP activation. Sterol regulatory element-binding proteins (SREBPs, shown in green) are embedded in the ER when first synthesized, in a complex with the protein SREBP cleavage-activating protein (SCAP, red). (N and C represent the amino and carboxyl termini of the protei ns.) When bound to SCAP, SREBPs are inactive. When

�N

Cleavage

by first

protease

.ltJtr N

c

C\t>av:�g•

by ,.,umd

prot cas{•

migrates to nucleus

DNA

I

[



c:;� c�

Transcription of target genes is activated

sterol levels decline, the complex m igrates to the Golgi complex, and SREBP is cleaved by two different proteases in succession. The liber­ ated ami no-termi nal domain of SREBP migrates to the nucleus, where it activates transcription of sterol-regu Iated genes.

[842]

Lipid Biosynthesis

H�IC:-Coi\ 1

1

Acetyl-CoA

Golgi complex. In the Golgi complex, SREBP is cleaved twice by two different proteases, the second cleavage releasing the amino-terminal domain into the cytosol. This domain travels to the nucleus and activates tran­ scription of its target genes. The amino-terminal domain of SREBP has a short half-life and is rapidly degraded by proteasomes (see Fig. 27-48) . When sterol levels in­ crease sufficiently, the proteolytic release of SREBP amino-terminal domains is again blocked, and protea­ some degradation of the existing active domains results in a rapid shut-down of the gene targets. Several other mechanisms also regulate cholesterol synthesis ( Fig. 2 1-44 ) . Hormonal control is mediated by covalent modification of HMG-CoA reductase itself. The enzyme exists in phosphorylated (inactive) and de­ phosphorylated (active) forms. Glucagon stimulates phosphorylation (inactivation) , and insulin promotes dephosphorylation, activating the enzyme and favoring cholesterol synthesis. High intracellular concentrations of cholesterol activate ACAT, which increases esterifi­ cation of cholesterol for storage. Finally, a high cellular

multistep

{3-Hydroxy-{3-methyl­ glutaryl-CoA J'('ducta.-;(•

@+--- - - - - insulin

�{;>+. ' Oz

Dopamine

·1-

NHa

Tetrahydrobiopterin 02 H20 Dihydrobiopte1in

� ��

ru,mntlr mmonvrl dt.carbox ·I o

+

NHa I CH2-CH-Coo-

H

5-Hydroxy­ try ptophan

••

erotonin

Epinephrine FIGURE 22-29 Biosynthesis of some neurotransmitters from amino acids. The key step is the same in each

case: a PLP-dependent decarboxylation (shaded in pink).

designed to interfere with either the synthesis or the ac­ tion of histamine. A prominent example is the histamine receptor antagonist cimetidine (Tagamet), a structural analog of histamine:

It promotes the healing of duodenal ulcers by inhibiting secretion of gastric acid. Polyamines such as spermine and spermidine, in­ volved in DNA packaging, are derived from methionine and ornithine by the pathway shown in Figure 22-30 . The first step is decarboxylation of ornithine, a precursor of arginine (Fig. 22-10) . Ornithine decarboxylase, a PLP-requiring enzyme, is the target of several powerful inhibitors used as pharmaceutical agents (Box 22-3) . •

[ss o]

Biosynthesis of A m i n o Acids, N u cleotid es, a n d Rel ated Molecules

ATP

I Methionine 1 --\,. __o,.--/ '----� --"'

coo I

H3N-C-H +

I

CH 2

S-Adenosylmethionine

I

CHz

I

+s

I

---0deno ine I

CHa

Hs



NHa +

+

I

H3N-CHz-CHz-CH2-CH -COO-

-�::

.,.

Putrescine

CH3-S--i Adenosine

CH2

'



H3N-(CH:.!)4-NH3

Ornithine

-,Ad nos�

tHa

Decarboxylated adoMet

Methylthioadenosine +

prop)'laminotransl(>ra"Se Il

FIGURE 22-30 Biosynthesis of spermidine and spermine. The PLP­

dependent decarboxylation steps are shaded in pink. In these reac­ tions, 5-adenosyl meth ionine (in its decarboxylated form) acts as a source of propylamino groups (shaded blue).

+

H3N-(CH2)a -NH-(CH2)4 -NH3

I

Spermidine

CH3-S--i Adenosine +

+

I

H3N-(CH2h -NH-(CHz)4 -NH-(CHz)a-NH3 Spermine

Curing African Sleeping Sickness with a Biochemical Tro an Horse African sleeping sickness, or African trypanosomiasis, is caused by protists (single-celled eukaryotes) called trypanosomes (Fig. 1 ). This disease (and related try­ panosome-caused diseases) is medically and economi­ cally significant in many developing nations. Until the late twentieth century, the disease was virtually incur­ able. Vaccines are ineffective because the parasite has a novel mechanism to evade the host immune system. The cell coat of trypanosomes is covered with a sin­ gle protein, which is the antigen to which the immune system responds. Every so often, however, by a process of genetic recombination (see Table 28-1), a few cells in the population of infecting trypanosomes switch to a new protein coat, not recognized by the immune system. This process of "changing coats" can occur hundreds of times. The result is a chronic cyclic infection: the human host develops a fever, which subsides as the immune system beats back the first infection; trypanosomes with changed coats then become the seed for a second infec­ tion, and the fever recurs. This cycle can repeat for weeks, and the weakened person eventually dies. Some modern approaches to treating African sleep­ ing sickness have been based on an understanding of enzymology and metabolism. In at least one such approach, this involves pharmaceutical agents designed as mechanism-based enzyme inactivators (suicide

FIGURE 1 Trypanosoma brucei rhodesiense, one of several try­ panosomes known to cause African sleeping sickness.

inactivators; p. 204). A vulnerable point in trypanosome metabolism is the pathway of polyamine biosynthesis. The polyamines spermine and spermidine, involved in DNA packaging, are required in large amounts in rap­ idly dividing cells. The first step in their synthesis is cat­ alyzed by ornithine decarboxylase, a PLP-requiring enzyme (see Fig. 22-30). In mammalian cells, ornithine decarboxylase undergoes rapid turnover-that is, a constant round of enzyme degradation and synthesis. In some trypanosomes, however, the enzyme (for rea­ sons not well understood) is stable, not readily replaced by newly synthesized enzyme. An inhibitor of ornithine

22.3 Molecules Derived from A m i no Acids

[ss1]

Ornithine

Putrescine

FIGURE 2 Mechanism of ornithine decarboxylase reaction.

decarboxylase that binds permanently to the enzyme

putrescine is produced (see

would thus have little effect on human cells, which

mechanism, several suicide inactivators have been de­

could rapidly replace inactivated enzyme, but would

signed,

adversely affect the parasite.

(DFMO). DFMO

The first few steps of the normal reaction catalyzed by ornithine decarboxylase are shown in Figure

2.

of

which

is

Based on this

difluoromethylornithine

is relatively inert in solution. When it

binds to ornithine decarboxylase, however, the enzyme

Once

is quickly inactivated

C02 is released, the electron movement is reversed and

(Fig. 3).

The inhibitor acts by

providing an alternative electron sink in the form of two strategically placed fluorine atoms, which are ex­

DFMO

cellent leaving groups. Instead of electrons moving into

F"- /F

the ring structure of PLP, the reaction results in dis­

CH o I // H2N-CCH1 3-C1

(?� Vv

®--o-c

one

Fig. 22-30).

CH

placement of a fluorine atom. The

S

of a Cys residue at

the enzyme's active site then forms a covalent complex

0

with the highly reactive PLP-inhibitor adduct in an es­ sentially irreversible reaction. In this way, the inhibitor makes use of the enzyme's own reaction mechanisms to kill it.

oH

DFMO

l_+N _lCH3 H

treat African sleeping sickness caused by Trypanosoma

_

Pyridoxal phosphate

has proved highly effective against African

sleeping sickness in clinical trials and is now used to

brucei gambiense. Approaches such as this show great promise for treating a wide range of diseases. The

Schiff base

design of drugs based on enzyme mechanism and struc­ ture can complement the more traditional trial-and­ error methods of developing pharmaceuticals.

F

FIGURE 3 Inhibition of ornithine decarboxylase by DFMO.

additional rearrangements

)

Stuck!

[ss2�

Biosynthesis of Amino Acids, N ucl eotides, a n d Re lated Molecules

+

coo-

I HN-C-H 3

I

CH2

I

CH2 I CH2 I NH I + C=NH2

I

C

NADP

NJ

+

coo-

I HN-C-H 3 I CH2

,

1

I

CH2 I CH2 I NH I C=N-OH

H20

\.�

2NADPH,02

coo-

+

I HN-C-H 3

I

ADP ,fl,O

J

I

CH2



CH2 I CH2 + NO' I NH Nitric I oxide C=O

I

I

NH2

NH2

NH2 Arginine

Citrulline

Hydroxyarginine

FIGURE 22-31 Biosynthesis of nitric oxide. Both steps are catalyzed by nitric oxide synthase. The ni­ trogen of the NO is derived from the guan idinium group of arginine.

phosphate. D-Amino acids are commonly found in certain bacterial walls and certain antibiotics.

Arginine Is the Precursor for Biological Synthesis of N itric Oxide A surprise finding in the mid-1980s was the role of nitric oxide (NO)-previously known mainly as a component of smog-as an important biological messenger. This simple gaseous substance diffuses readily through mem­ branes, although its high reactivity limits its range of dif­ fusion to about a 1 mm radius from the site of synthesis. In humans NO plays a role in a range of physiological processes, including neurotransmission blood clotting and the control of blood pressure. Its �ode of action i� described in Chapter 12 (p. 446). Nitric oxide is synthesized from arginine in an NADP H-dependent reaction catalyzed by nitric oxide synthase (Fig. 22-3 1 ) , a dimeric enzyme structurally related to NADPH cytochrome P -450 reductase (see Box 21-1). The reaction is a five-electron oxidation. Each subunit of the enzyme contains one bound mole­ cule of each of four different cofactors: FMN, FAD, tetrahydrobiopterin, and Fe:J+ heme. NO is an unstable molecule and cannot be stored. Its synthesis is stimu­ lated by interaction of nitric oxide synthase with Ca2+­ calmodulin (see Fig. 12-11).

S U M M A R Y 2 2 .3 •





Molecules Derived from Amino Acids

Many important biomolecules are derived from amino acids. Glycine is a precursor of porphyrins. Degradation of iron-porphyrin (heme) generates bilirubin, which is converted to bile pigments, with several physiological functions. Glycine and arginine give rise to creatine and phosphocreatine, an energy buffer. Glutathione, formed from three amino acids, is an important cellular reducing agent. Bacteria synthesize D-amino acids from L-amino acids in racemization reactions requiring pyridoxal





The aromatic amino acids give rise to many plant substances. The PLP -dependent decarboxylation of some amino acids yields important biological amines, including neurotransmitters. Arginine is the precursor of nitric oxide, a biological messenger.

22.4 Biosynthesis a nd Degradation of Nudeotides As discussed in Chapter 8, nucleotides have a variety of important functions in all cells. They are the precursors of DNA and RNA. They are essential carriers of chemical energy-a role primarily of ATP and to some extent GTP. They are components of the cofactors NAD FAD S-adenosylmethionine, and coenzyme A, as well as of activated biosynthetic intermediates such as UDP­ glucose and CDP-diacylglycerol. Some, such as cAMP and cGMP, are also cellular second messengers. Two types of pathways lead to nucleotides: the de novo pathways and the salvage pathways. De novo synthesis of nucleotides begins with their metabolic pre­ cursors: amino acids, ribose 5-phosphate, C02, and NH3. Salvage pathways recycle the free bases and nucleo­ sides released from nucleic acid breakdown. Both types of pathways are important in cellular metabolism and both are discussed in this section. The de novo pathways for purine and pyrimidine biosynthesis seem to be nearly identical in all living or­ ganisms. Notably, the free bases guanine adenine thymine, cytidine, and uracil are not inten� ediates i� these pathways; that is, the bases are not synthesized and then attached to ribose, as might be expected. The purine ring structure is built up one or a few atoms at a time, attached to ribose throughout the process. The pyrimidine ring is synthesized as orotate , attached to

22.4 B i osynth es i s a n d Deg radation of Nucleotides

ribose phosphate, and then converted to the common pyrimidine nucleotides required in nucleic acid synthe­ sis. Although the free bases are not intermediates in the de novo pathways, they are intermediates in some of the salvage pathways. Several important precursors are shared by the de novo pathways for synthesis of pyrimidines and purines. Phosphoribosyl pyrophosphate (PRPP) is important in both, and in these pathways the structure of ribose is retained in the product nucleotide, in contrast to its fate in the tryptophan and histidine biosynthetic pathways dis­ cussed earlier. An amino acid is an important precursor in each type of pathway: glycine for purines and aspartate for pyrimidines. Glutamine again is the most important source of amino groups-in five clifferent steps in the de novo pathways. Aspartate is also used as the source of an amino group in the purine pathways, in two steps. 1\vo other features deserve mention. First, there is evidence, especially in the de novo purine pathway, that the enzymes are present as large, multienzyme com­ plexes in the cell, a recurring theme in our discussion of metabolism. Second, the cellular pools of nucleotides (other than ATP) are quite small, perhaps 1% or less of the amounts required to synthesize the cell's DNA. Therefore, cells must continue to synthesize nu­ cleotides during nucleic acid synthesis, and in some cases nucleotide synthesis may limit the rates of DNA replication and transcription. Because of the impor­ tance of these processes in dividing cells, agents that in­ hibit nucleotide synthesis have become particularly important in medicine. We examine here the biosynthetic pathways of purine and pyrimidine nucleotides and their regulation, the formation of the deoxynucleotides, and the degrada­ tion of purines and pyrimidines to uric acid and urea. We end with a discussion of chemotherapeutic agents that affect nucleotide synthesis.

De N ovo Purine N ucleotide Synthesis Begins with PRPP The two parent purine nucleotides of nucleic acids are adenosine 5'-monophosphate (AMP; adenylate) and guanosine 5'-monophosphate (GMP; guanylate), contain­ ing the purine bases adenine and guanine. Figure 22-32 shows the origin of the carbon and ni­ trogen atoms of the purine ring system, as determined by John Buchanan using isotopic tracer experiments in birds. The de­ tailed pathway of purine biosyn­ thesis was worked out primarily by Buchanan and G. Robert Greenberg in the 1950s. In the first committed step of the pathway, an amino group John Buchanan

Aspartate

[ss3]

Glycine

Formate

Formate

FIGURE 22-32 Origin of the ring atoms of purines. Th is i nformation was obtained from isotopic experiments with 1 4C- or 15 N-Iabeled pre­ cursors. Formate is supplied in the form of N10-formyltetrahydrofolate.

donated by glutamine is attached at C-1 of PRPP ( Fig 22-33). The resulting 5-phosphoribosylamine is highly unstable, with a half-life of 30 seconds at pH 7.5. The purine ring is subsequently built up on this struc­ ture. The pathway described here is identical in all organisms, with the exception of one step that differs in higher eukaryotes as noted below. The second step is the addition of three atoms from glycine (Fig. 22-33, step @). An ATP is consumed to ac­ tivate the glycine carboxyl group (in the form of an acyl phosphate) for this condensation reaction. The added glycine amino group is then formylated by N10-formylte­ trahydrofolate (step @), and a nitrogen is contributed by glutamine (step @), before dehydration and ring clo­ sure yield the five-membered imidazole ring of the purine nucleus, as 5-aminoimidazole ribonucleotide (AIR; step @). At this point, three of the six atoms needed for the second ring in the purine structure are in place. To complete the process, a carboxyl group is first added (step @). This carboxylation is unusual in that it does not require biotin, but instead uses the bicarbonate gen­ erally present in aqueous solutions. A rearrangement transfers the carboxylate from the exocyclic amino group to position 4 of the imidazole ring (step (f)). Steps @ and (f) are found only in bacteria and fungi. In higher eukaryotes, including humans, the 5-aminoimidazole ri­ bonucleotide product of step @ is carboxylated directly to carboxyaminoimidazole ribonucleotide in one step in­ stead of two (step IQ§)). The enzyme catalyzing this re­ action is AIR carboxylase. Aspartate now donates its amino group in two steps c® and @): formation of an amide bond, followed by elimination of the carbon skeleton of aspartate (as fumarate). (Recall that aspartate plays an analogous role in two steps of the urea cycle; see Fig. 18-10.) The final carbon is contributed by N10-formyltetrahydrofo­ late (step @), and a second ring closure takes place to yield the second fused ring of the purine nucleus (step @). The first intermediate with a complete purine ring is inosinate (IMP). .

[aa4]

Biosynthesis of A m i n o Acids, N u c l eotides, and Related Molecules

�O-CH2

0

AIR

p -ixo--®-® 1'H'



H

5-Phosphoribosyl 1-pyrophosphate (PRPP)

OH OH CD

�- H2

HC0 :3 ATP

ADP + P;

Gl utamine

H

G lutamate

ppl

H

0

l

N5-Carboxyaminoimidazole ribonucleotide (N5-CAIR)

R

5-Phospho-.B­ n-ribosylamine

H

OH OH

@

Glycine

ATP ADP

+

P,

Glycinamide ribonucleotide (GAR)

� N10-Formyl H4 folate � H4 folate

R

®

H N H2c"" 'c-H I II O=C O



Formylglycinamide ribonucleotide (FGAR)

R

r

Carboxyamino­ imidazole ribonucleotide (CAIR) R Aspartate..

coo­

l CH2

I

ATP AD P + P;

0

H I HC- ­

cooH2 I

G lu tam ine

, e-ll 'cB

C

N

N -Succi nyl-5-aminoi.m.idazole-4-

carbox�ide ribonucleotide SAICAR)

R

®� Fumarate

Glutamate

5-Aminoimidazole-4-catboxamide

ATP ADP

H N H. c"" 'c-H 2

I

HN=C

II

0

+

ribon ucleotide !AlGAR!

P;

@ � N10-Formyl H4 folate � H4 folate

Formylglycinamidine ribonucleotide (FGAM)

0

II

N""0' ...-\_ H

H2

II

C O=C-N"" :N

H H

R



amidotransferase GAR transformylase

FGAR amidotransferase FGAM cyclase (AIR synthetase)

@ N5-CAIR synthetase � AIR carboxylase G) N5-CAIR mutase

De novo synthesis of purine nucleotides: construction

of the purine ring of inosinate (IMP).

Each addition to the puri ne ring is shaded to match Figure 22-32. After step (I), R symbolizes the 5-phospho-o-ribosyl group on which the purine ring is bui lt. Formation of 5-phosphoribosylamine (step G)J is the first committed step in purine synthesis. Note that the product of step @, AICAR, is the rem­ nant of ATP released during h istidine biosynthesis (see Fig. 22-20, step �)J. Abbreviations are given for most i ntermediates to simpl ify the naming of the enzymes. Step � is the alternative path from AIR to CAIR occurring i n h igher eukaryotes.

CD glutamine-PRPP

@ GAR synthetase

5-Aminoimidazole ribonucl otide (AIR I

FIGURE 22-33

N-Formylaminoimidazole4-carboxamide ribonucleotide (FAICARl

Inosinate (IMP)



SAlCAR synthetase SAICAR lyase

AICAR transformylase

@ IMP synthase

[BBsJ

22.4 B i osynthesis a n d D e g radation of Nucleotides

- OOC-CH2

GTP

GOP + P,

Aspartate II •

Inosinate (IMP)

H

i._�N> N

FIGURE 22-34 Biosynthesis of

Fumarate ---,d:::._ 0> N

� �-I:)

N

l

HN�N'

'l-):_N> NH2

Adenylosuccinate

0

AMP and GMP from IMP.

c-c oo-

�H

-

H20

XMP-glutamine

amidotransferasc

AMP + PPi

J

�)

Guanylate (GMP)

Xanthylate CXMP)

As in the tryptophan and histidine biosynthetic pathways, the enzymes of IMP synthesis seem to be or­ ganized as large, multienzyme complexes in the cell. Once again, evidence comes from the existence of single polypeptides with several functions, some catalyzing nonsequential steps in the pathway. In eukaryotic cells ranging from yeast to fruit flies to chickens, steps (D, @, and @ in Figure 22-33 are catalyzed by a multifunc­ tional protein. An additional multifunctional protein cat­ alyzes steps ® and @. In humans, a multifunctional enzyme combines the activities of AIR carboxylase and SAICAR synthetase (steps @ and @). In bacteria, these activities are found on separate proteins, but the pro­ teins may form a large noncovalent complex. The chan­ neling of reaction intermediates from one enzyme to the next permitted by these complexes is probably espe­ cially important for unstable intermediates such as 5phosphoribosylamine. Conversion of inosinate to adenylate requires the insertion of an amino group derived from aspartate (Fig. 22-34) ; this takes place in two reactions similar to those used to introduce N-1 of the purine ring (Fig. 22-33, steps @ and @). A crucial difference is that GTP rather than ATP is the source of the high-energy phos­ phate in synthesizing adenylosuccinate. Guanylate is formed by the NAD + -requiring oxidation of inosinate at C-2, followed by addition of an amino group derived from glutamine. ATP is cleaved to AMP and PPi in the final step (Fig. 22-34). Pu rine N ucleotide Biosynthesis Is Regulated by Feedback I nhibition

Three major feedback mechanisms cooperate in regu­ lating the overall rate of de novo purine nucleotide synthesis and the relative rates of formation of the two end products, adenylate and guanylate (Fig. 2 2-3 5 ) .

1

Ribose 5-phosphate ribose phosphate pyrophosphokinase (PRPP synthetase)

®

vntheta�·w

" - Cytidine 5'-triphos phate (CTP) phosphoribosyltransferase. The first step in this pathway (not shown here; see Fig. 1 8-1 1 a) i s the synthesis of carbamoyl phosphate from C02 and N H!, catalyzed in eukaryotes by carbamoyl phosphate synthetase I I .

22.4 Bio synthesis a n d Degradation of Nucleotides

[ss7]

identical polypeptide chains (each of Mr 230,000), each with active sites for all three reactions. This suggests that large, multienzyme complexes may be the rule in this pathway. Once orotate is formed, the ribose 5-phosphate side chain, provided once again by PRPP, is attached to yield orotidylate (Fig.

22-36).

Orotidylate is then decarboxy­

lated to uridylate, which is phosphorylated to UTP. CTP is formed from UTP by the action of cytidylate syn­ thetase , by way of an acyl phosphate intermediate (consuming one ATP) . The nitrogen donor is normally glutamine, although the cytidylate synthetases in many species can use NH� directly.

Pyrimidine N ucleotide Biosynthesis Is Regulated by Feedback Inhibition Regulation of the rate of pyrimidine nucleotide synthe­ sis in bacteria occurs in large part through aspartate transcarbamoylase (ATCase) , which catalyzes the first reaction in the sequence and is inhibited by CTP, the end product of the sequence (Fig.

22-36). The bacterial

ATCase molecule consists of six catalytic subunits and

6-32).

six regulatory subunits (see Fig.

The catalytic

subunits bind the substrate molecules , and the allosteric subunits bind the allosteric inhibitor, CTP. The entire ATCase molecule, as well as its subunits, exists in two FIGURE 22-37 Channeling of intermediates in bacterial carbamoyl phosphate synthetase.

(Derived from PDB ID 1 M6V) The reaction cat­ alyzed by this enzyme is i l l ustrated in Figure 1 8-1 1 a. The large and small subun its are shown in gray and blue, respectively; the channel between active sites (almost 1 00 A long) is shown as a yellow mesh. A glutamine molecule (green) binds to the small subun it, donating its amido n itrogen as N H; in a glutam ine amidotransferase-type reac­ tion. The NH; enters the channel, which takes it to a second active site, where it combines with bicarbonate in a reaction requ iring ATP (bound ADP in bl ue). The carbamate then reenters the channel to reach the third active site, where it is phosphorylated to carbamoyl phos­ phate (bound ADP in red).

conformations, active and inactive. When CTP is not bound to the regulatory subunits, the enzyme is maxi­ mally active. As CTP accumulates and binds to the regu­ latory subunits, they undergo a change in conformation. This change is transmitted to the catalytic subunits, which then also shift to an inactive conformation. ATP prevents the changes induced by CTP. activity of ATCase.

Normal activity ......__ TP ( ·no TP) � "' - u- + 11.

omn �

Carbamoyl phosphate reacts with aspartate to yield

// � '/______ "-cTP

N-carbamoylaspartate in the first committed step of pyrimidine biosynthesis (Fig. catalyzed by

22-36).

Figure 2 2-38

shows the effects of the allosteric regulators on the

This reaction is

aspartate transcarbamoylase. In bacte­

ria, this step is highly regulated, and bacterial aspartate transcarbamoylase is one of the most thoroughly stud­ ied allosteric enzymes (see below) . By removal of water

di­ hydroorotase , the pyrimidine ring is closed to form L­ from N-carbamoylaspartate, a reaction catalyzed by

10 K0_5

dihydroorotate . This compound is oxidized to the

=

1

30

20

12 mM

K0_5

=

23 mM

[Aspartate] (mM)

pyrimidine derivative orotate, a reaction in which NAD + is the ultimate electron acceptor. In eukaryotes, the first

FIGURE 22-38 Allosteric regulation of aspartate transcarbamoylase

three enzymes in this pathway-carbamoyl phosphate

by CTP and ATP.

synthetase II, aspartate transcarbamoylase, and dihy­ droorotase-are part of a single trifunctional protein. The protein, known by the acronym CAD, contains three

Addition of 0.8 mM CTP, the al losteric inhi bitor of ATCase, increases the K0 _5 for aspartate (lower curve) and the rate of conversion of aspartate to N-carbamoylaspartate. ATP at 0.6 mM fully reverses this effect (middle curve).

[ass]

B i osynthes i s of A m i n o Acids, Nucleotides, a n d Related Molecules

N u cl eoside Mono phosphates Are Converted

dNDP

NDP

to N u cleoside Triphosphates

Nucleotides to be used in biosynthesis are generally converted to nucleoside triphosphates. The conversion pathways are common to all cells. Phosphorylation of AMP to ADP is promoted by adenylate kinase, in the reaction

ATP + AMP � 2 ADP The ADP so formed is phosphorylated to ATP by the gly­ colytic enzymes or through oxidative phosphorylation. ATP also brings about the formation of other nucle­ oside diphosphates by the action of a class of enzymes called nucleoside monophosphate kinases. These enzymes, which are generally specific for a particular base but nonspecific for the sugar (ribose or deoxyri­ bose), catalyze the reaction

ATP + NMP



ADP + NDP

The efficient cellular systems for rephosphorylating ADP to ATP tend to pull this reaction in the direction of products. Nucleoside diphosphates are converted to triphos­ phates by the action of a ubiquitous enzyme, nucleoside diphosphate kinase, which catalyzes the reaction

NTPn + NDPA



NDPn + NTPA

This enzyme is notable in that it is not specific for the base (purines or pyrimidines) or the sugar (ribose or de­ oxyribose). This nonspecificity applies to both phos­ phate acceptor (A) and donor (D), although the donor (NTPD) is almost invariably ATP because it is present in higher concentration than other nucleoside triphos­ phates nnder aerobic conditions. Ribonu cleotides Are the Precursors of Deoxyribonucleotides

Deoxyribonucleotides, the building blocks of DNA, are derived from the corresponding ribonucleotides by direct reduction at the 2 '-carbon atom of the D-ribose to form the 2 ' -deoxy derivative. For example, adenosine diphosphate (ADP) is reduced to 2 ' -deoxyadenosine diphosphate (dADP), and GDP is reduced to dGDP. This reaction is somewhat unusual in that the reduction occurs at a nonactivated carbon; no closely analogous chemical reactions are known. The reaction is catalyzed by ribonucleotide reductase , best characterized in E. coli, in which its substrates are ribonucleoside diphosphates. The reduction of the D-ribose portion of a ribonu­ cleoside diphosphate to 2 ' -deoxy-D-ribose requires a pair of hydrogen atoms, which are ultimately donated by NADPH via an intermediate hydrogen-carrying protein, thioredoxin. This ubiquitous protein serves a similar redox function in photosynthesis (see Fig. 20-19) and other processes. Thioredoxin has pairs of -SH groups that carry hydrogen atoms from NADPH to the ribonu-

NADPH + H+

NADPH + W

(a)

(b)

FIGURE 22-39 Reduction of ribonucleotides to deoxyribonucleotides by ribonucleotide reductase.

Electrons are transmitted (blue arrows) to the enzyme from NADPH via (a) glutaredoxi n or (b) thioredoxi n . The sulfide groups in glutaredoxin reductase are contributed by two molecules of bound glutathione (GSH; GSSG i ndicates oxidized glu­ tathione). Note that thioredoxin reductase is a flavoenzyme, with FAD as prosthetic group.

cleoside diphosphate. Its oxidized (disulfide) form is reduced by NADPH in a reaction catalyzed by thiore­ doxin reductase (Fig. 2 2-39 ), and reduced thiore­ doxin is then used by ribonucleotide reductase to reduce the nucleoside diphosphates (NDPs) to deoxyri­ bonucleoside diphosphates (dNDPs). A second source of reducing equivalents for ribonucleotide reductase is glutathione (GSH). Glutathione serves as the reductant for a protein closely related to thioredoxin, glutare­ doxin, which then transfers the reducing power to ribonucleotide reductase (Fig. 22-39). Ribonucleotide reductase is notable in that its reac­ tion mechanism provides the best-characterized exam­ ple of the involvement of free radicals in biochemical transformations, once thought to be rare in biological systems. The enzyme in E. coli and most eukaryotes is a dimer, with subunits designated R l and R2 (Fig. 22-40). The Rl subunit contains two kinds of regulatory sites, as described below. The two active sites of the enzyme are formed at the interface between the Rl and R2 subunits. At each active site, Rl contributes two sulfhydryl groups required for activity and R2 contributes a stable tyrosyl radical. The R2 subunit also has a binuclear iron (Fe3+ ) cofactor that helps generate and stabilize the tyrosyl radicals (Fig. 22-40). The tyrosyl radical is too far from the active site to interact directly with the site, but it

22.4 Biosynthesis a n d Degradation of N ucleotides

Regulatory sites

Allosteric effectors

Substrate specificity it,e

Pri mary r gulation ite

·v

I

�) r'

Active site

[ss9]

I

ATP. dATP, dGTP, dTTP

Rl ubunit

ATP, dATP

(b) (c)

-Q-o·+-XH

-o-OH+ -X'

FIGURE 22-40 Ribonucleotide reductase. (a) Subunit structure. The

(a) generates another radical at the active site that func­ tions in catalysis. A likely mechanism for the ribonu­ cleotide reductase reaction is illustrated in Figure 22-4 1 . In E. coli, likely sources o f the required reducing equivalents

for this

reaction are

thioredoxin

glutaredoxin, as noted above.

and

functions of the two regulatory sites are explained in Figure 22-42. Each active site contains two thiols and a group (-XH) that can be converted to an active-site radical; this group is probably the -SH of Cys439, which functions as a thiyl radical. (b) The R2 subunits of E. coli ribonu­ cleotide reductase (PDB ID 1 PF R) . The Tyr residue that acts as the tyrosyl radical is shown in red; the binuclear iron center is orange. (c) The tyro­ syl radical functions to generate the active-site radical (-X \ which is used in the mechanism shown in Figure 22--41 .

Rl subunit

A 3 '-ribonucleotide radical is formed,

Ribonucleotide

R2 subunit

reductase

The enzyme dithiol is

®

reduced to complete the cycle.



I

(i)

tep Is r v rsed, re�nerntlng a tyrosyl raaiaa] on Lh enzyme.

The 2'-bydruJC;YI i8

p:rotonated.

dNDP

H20 is eliminated to form a radical�

®

stabilized carbocation.

MECHAN I SM

FIGURE

22-41

Proposed mechanism for ri­ bonucleotide reductase.

Dithiol is oxidized on the enzyme; two electrons are trans­ ferred to the 2' -carbon.

X- H I

In the enzyme of E. coli and most eu­ karyotes, the active thiol groups are on the R1 subunit; the ac­ tive-site radical (-X') is on the R2 subunit and in E. coli is prob­ ably a thiyl radical of Cys4 39 (see Fig. 22-40).

[s9o]

B iosynthesis of Amino Acid s, N ucleotides, a n d Related Molecules

Regulation at primary regulatory sites

Regulation at substratespecificity sites

! ,.... - - ...... �



....... - -

®

®



®

®



ATP

...... ,

(d)ATP

-- dCDP +-------- CDP -------.... ,dCD P -----+ dCTP dCTP +---



dTfP \� - � � � �� � -� � -� �- �- �- � � � � � � � � - / � -\

dTTP +--�-+--d UDP 1---------------· UDP -------+ dUDP

®..-- �@y



-d ;;, .,;,;;;_ ;o _ _ GDP ----------+ dGDP -----+ dGTP , GDP +--..,;;;dGTP +----



®

,.... - - - - - - - - - - - - - - - - - �

dA TP +------ dADP +-------'"---ADP --------+ dADP -----+ dATP I

'

r ucts

P od

-

- --

...

Substrates

FIGURE 22-42 Regulation of ribonucleotide reductase by deoxynu­ cleoside triphosphates.

The overall activity of the enzyme is affected by binding at the primary regulatory site (left). The substrate specificity of the enzyme is affected by the nature of the effector molecule bound

Three classes of ribonucleotide reductase have been reported. Their mechanisms (where known) generally conform to the scheme in Figure 22--41, but they differ in the identity of the group supplying the active-site radical and in the cofactors used to generate it. The E. coli en­ zyme (class I) requires oxygen to regenerate the tyrosyl radical if it is quenched, so this enzyme functions only in an aerobic environment. Class II enzymes, found in other microorganisms, have 5'-deoxyadenosylcobalamin (see Box 17 -2) rather than a binuclear iron center. Class III enzymes have evolved to function in an anaerobic envi­ ronment. E. coli contains a separate class III ribonu­ cleotide reductase when grown anaerobically; this enzyme contains an iron-sulfur cluster (structurally dis­ tinct from the binuclear iron center of the class I enzyme) and requires NADPH and S-adenosylmethionine for ac­ tivity. It uses nucleoside triphosphates rather than nucle­ oside diphosphates as substrates. The evolution of different classes of ribonucleotide reductase for produc­ tion of DNA precursors in different environments reflects the importance of this reaction in nucleotide metabolism. Regulation of E. coli ribonucleotide reductase is un­ usual in that not only its activity but its substrate speci­ ficity is regulated by the binding of effector molecules. Each R 1 subunit has two types of regulatory site (Fig. 22--40). One type affects overall enzyme activity and binds either ATP, which activates the enzyme, or dATP, which inactivates it. The second type alters substrate specificity in response to the effector molecule-ATP, dATP, dTIP, or dGTP-that is bound there (Fig. 22-42). When ATP or dATP is bound, reduction of UDP and CDP is favored. When dTTP or dGTP is bound, reduction of GDP or ADP, respectively, is stimulated. The scheme is designed to provide a balanced pool of precursors for

Prod

ucts

at the second type of regulatory site, the substrate-specificity site (right). The diagram indicates inhibition or stimulation of enzyme ac­ tivity with the four d ifferent substrates. The pathway from dUDP to dTTP is described later (see Figs 22�43, 22�44).

DNA synthesis. ATP is also a general activator for biosynthesis and ribonucleotide reduction. The pres­ ence of dATP in small amounts increases the reduction of pyrimidine nucleotides. An oversupply of the pyrimi­ dine dNTPs is signaled by high levels of dTTP, which shifts the specificity to favor reduction of GDP. High lev­ els of dGTP, in turn, shift the specificity to ADP reduc­ tion, and high levels of dATP shut the enzyme down. These effectors are thought to induce several distinct enzyme conformations with altered specificities.

Thymidylate Is Derived from dCDP a nd d U M P DNA contains thymine rather than uracil, and the d e novo pathway to thymine involves only deoxyribonu­ cleotides. The immediate precursor of thymidylate (dTMP) is dUMP. In bacteria, the pathway to dUMP begins with formation of dUTP, either by deamination of dCTP or by phosphorylation of dUDP ( Fig. 22-43 ) . The dUTP is converted to dUMP by a dUTP­ ase. The latter reaction must be efficient to keep dUTP pools low and prevent incorporation of uridy­ late into DNA. Conversion of dUMP to dTMP is catalyzed by thymidylate synthase. A one-carbon unit at the hydrox­ ymethyl (-CH20H) oxidation level (see Fig. 18-1 7) is transferred from .I'?,N10-methylenetetrahydrofolate to dUMP, then reduced to a methyl group (Fig. 22-44 ). The reduction occurs at the expense of oxidation of tetrahy­ drofolate to dihydrofolate, which is unusual in tetrahydro­ folate-requiring reactions. (The mechanism of this reaction is shown in Fig. 22-50.) The dihydrofolate is re­ duced to tetrahydrofolate by dihydrofolate reductase­ a regeneration that is essential for the many processes that

22.4 B i osynthesis a n d Degradation of N ucleotides

DP

----- >

ribonucleotide

UDP

reductase ----- >

dCDP

nucleoside diphosphate

dUDP

kinase

------c>

dCTP

1

dcaminase

dUTP

1

dUTPasc

dUMP

1

ll1ymidy laLe nthasc'

dTMP FIGURE 22-43 Biosynthesis of thymidylate (dTMP). The pathways are shown beginning with the reaction catalyzed by ribonucleotide reduc­ tase. Figure 22-44 gives details of the thymidylate synthase reaction.

require tetrahydrofolate. In plants and at least one protist, thymidylate synthase and dihydrofolate reductase reside on a single bifimctional protein. About 1 0% of the human population (and up to , 50% of people in impoverished communities) suf­ fers from folic acid deficiency. When the deficiency is se­ vere, the symptoms can include heart disease, cancer, and some types of brain dysfunction. At least some of these symptoms arise from a reduction of thymidylate synthesis, leading to an abnormal incorporation of uracil into DNA. Uracil is recognized by DNA repair pathways (described in Chapter 25) and is cleaved from the DNA. The presence of high levels of uracil in DNA leads to strand breaks that can greatly affect the function and regulation of nuclear DNA, ultimately causing the ob­ served effects on the heart and brain, as well as in­ creased mutagenesis that leads to cancer. •

l

H2 yN HN

N5,N10-Methylene­ telrahydrofolate

Glycine

[s91]

H Nl I A C H2 N

I BN-R

7,8-Dihydrofolate

....

N ADPH + H+ NADP '

Serine

CH:t

I l:IN-R Tetrahydrofolate FIGURE 22-44 Conversion of dUMP to dTMP by thymidylate syn­ thase and dihydrofolate reductase.

Serine hydroxymethyltransferase is required for regeneration of the N5,N1 0-methylene form of tetrahydro-

folate. In the synthesis of dTMP, all three hydrogens of the added methyl group are derived from N5,N1 0-methylenetetrahydrofolate (pink and gray).

\ 892 _]

B i o synthesis of A m i n o Acids, N u c l eotides, a n d Related Molecules

converted to uric acid by xanthine oxidase (Fig.

Degradation of Pu rines a nd Pyrimidines Produces

22-45).

Uric acid is the excreted end product of purine ca­

Uric Add a nd U rea, Respectively

tabolism in primates, birds, and some other animals. A

P urine nucleotides are degraded by a pathway in which they lose their phosphate through the action of

5'-nu­

cleotidase (Fig. 2 2-4!'> ) . Adenylate yields adenosine, which is deaminated to inosine by adenosine deami­ nase, and inosine is hydrolyzed to hypoxanthine (its

healthy adult human excretes uric acid at a rate of about

0.6 g/24

h; the excreted product arises in part from in­

gested purines and in part from turnover of the purine nucleotides of nucleic acids. In most mammals and many other vertebrates, uric acid is further degraded to

purine base) and D-ribose. Hypoxanthine is oxidized suc­

allantoin by the action of urate oxidase. In other or­

cessively to xanthine and then uric acid by xanthine ox­

ganisms the pathway is further extended, as shown in

idase, a fiavoenzyme with an atom of molybdenum and

Figure

four iron-sulfur centers in its prosthetic group. Molecular

22-45.

The pathways for degradation of pyrimidines gener­

oxygen is the electron acceptor in this complex reaction.

ally lead to NH t production and thus to urea synthesis.

GM P catabolism also yields uric acid as end product.

Thymine, for example, is degraded to methylmalonylsemi­

GM P is first hydrolyzed to guanosine, which is then

aldehyde

cleaved to free guanine. Guanine undergoes hydrolytic

olism. It is further degraded through propionyl-CoA and

removal of its amino group to yield xanthine, which is

methylmalonyl-CoA to succinyl-CoA (see Fig.

(Fig. 22-46), an intermediate of valine catab­

18-27).

Excreted

by:

Primates, birds, reptiles, insects unllt u uf t-_



C02

H N NH2 C _...... C=O I I O=C ..._ _...... C ..._ I N H N H H

Allantoin

Most mammals

Allantoate

Bony fishes

Guanine

guani1w

ch·am i l l i l.->c·

d luntrqt':l"'�"

H20

cool CHO

Glyoxylate Urea

Uric acid FIGURE 22-45 Catabolism of purine nucleotides. Note that primates ex­ crete much more nitrogen as urea via the urea cycle (Chapter 1 8) than as

4NH;

Amphibians, cartilaginous fishes Marine invertebrates

uric acid from purine degradation. Similarly, fish excrete much more nitrogen as N H! than as urea produced by the pathway shown here.

22.4 B i osynthesis a n d D e g radation of Nucleotides

0 II

c

/ "

HN

1

C

0? "'-N/

C-CH3

Thymine

11

CH

lated in a sterile "bubble" environment. ADA deficiency was one of the first targets of human gene therapy trials (see Box 9-2). • Purine and Pyrimidine Bases Are Recycled

H

by Salvage Pathways H�

NADPH NADP'

Free purine and pyrimidine bases are constantly released in cells during the metabolic degradation of nucleotides. Free purines are in large part salvaged and reused to make nucleotides, in a pathway much simpler than the de novo synthesis of purine nucleotides described earlier. One of the primary salvage pathways consists of a single reaction catalyzed by adenosine phosphoribosyltrans­ ferase, in which free adenine reacts with PRPP to yield the corresponding adenine nucleotide: Adenine

-f'o H2N-C-NH-CH2 -CH-C

II

I CH

o

3

NH;

"-0 -

{3-Ureidoisobutyrate

+ HCO:J {3-Aminoisobutyrate

a- l{etoglutarate

" f.

lil

" Glutamate

0

0



,f'

C-CH-C

/

H

I

CHs

[893]

"-

o-

Methylmalonyl­ semialdehyde FIGURE 22-46 Catabolism of a pyrimidine. Shown here is the pathway for thymine. The methylmalonylsemialdehyde is further degraded to succinyi-CoA.

Genetic aberrations in human purine metabolism have been found, some with serious conse­ quences. For example, adenosine deaminase (ADA) deficiency leads to severe immunodeficiency disease in which T lymphocytes and B lymphocytes do not de­ velop properly. Lack of ADA leads to a 100-fold increase in the cellular concentration of dATP, a strong inhibitor of ribonucleotide reductase (Fig. 22-42). High levels of dATP produce a general deficiency of other dNTPs in T lymphocytes. The basis for B-lymphocyte toxicity is less clear. Individuals with ADA deficiency lack an ef­ fective immune system and do not survive unless iso-

+ PRPP

_____,.

AMP + PPi

Free guanine and hypoxanthine (the deamination prod­ uct of adenine; Fig. 22--45) are salvaged in the same way by hypoxanthine-guanine phosphoribosyltrans­ ferase. A similar salvage pathway exists for pyrimidine bases in microorganisms, and possibly in mammals. A genetic lack of hypoxanthine-guanine phospho­ ribosyltransferase activity, seen almost exclusively in male children, results in a bizarre set of symptoms called Lesch-Nyhan syndrome. Children with this ge­ netic disorder, which becomes manifest by the age of 2 years, are sometimes poorly coordinated and mentally re­ tarded. In addition, they are extremely hostile and show compulsive self-destructive tendencies: they mutilate themselves by biting off their fingers, toes, and lips. The devastating effects of Lesch-Nyhan syndrome il­ lustrate the importance of the salvage pathways. Hypox­ anthine and guanine arise constantly from the breakdown of nucleic acids. In the absence of hypoxanthine-guanine phosphoribosyltransferase, PRPP levels rise and purines are overproduced by the de novo pathway, resulting in high levels of uric acid production and goutlike damage to tissue (see below). The brain is especially dependent on the salvage pathways, and this may account for the cen­ tral nervous system damage in children with Lesch-Ny­ han syndrome. This syndrome was another target of early trials in gene therapy (see Box 9-2). • Excess Uric Acid Causes Gout

Long thought, erroneously, to be due to "high liv­ ing," gout is a disease of the joints caused by an elevated concentration of uric acid in the blood and tissues. The joints become inflamed, painful, and arthritic, owing to the abnormal deposition of sodium urate crys­ tals. The kidneys are also affected, as excess uric acid is deposited in the kidney tubules. Gout occurs predomi­ nantly in males. Its precise cause is not known, but it of­ ten involves an underexcretion of urate. A genetic deficiency of one or another enzyme of purine metabo­ lism may also be a factor in some cases. I ..

f894 L

B i o synthesis of A m i n o Acids, N u c leotides, a n d Rel ated M o l e c u l e s

Many Chemothera peutic Agents Target Enzymes

OH

I

N'-"'c......_c _..

I

RC

""'-

II

N



.,.... C --. 1 N N R

Hypoxanthine (enol form)

Oxypurinol F I G U R E 22-47 Allopurinol, an inhibitor of xanthine oxidase. Hypo­ xanth i ne is the normal substrate of xanth i ne oxidase. Only a slight al­ teration i n the structure of hypoxanthine (shaded pi n k) yields the medically effective enzyme inhibitor al lopurinol . At the active site, al­ lopurinol is converted to oxypurinol, a strong competitive inhibitor that remains tightly bound to the reduced form of the enzyme.

Gout is effectively treated by a combination of nu­ tritional and drug therapies. Foods especially rich in nucleotides and nucleic acids, such as liver or glandular products, are withheld from the diet. Major alleviation of the symptoms is provided by the drug allopurinol ( Fig. 22-4 7 ) , which inhibits xanthine oxidase, the en­ zyme that catalyzes the conversion of purines to uric acid. Allopurinol is a substrate of xanthine oxidase, which converts allopurinol to oxypurinol (alloxanthine). Oxypurinol inactivates the reduced form of the enzyme by remaining tightly bound in its active site. When xan­ thine oxidase is inhibited, the excreted products of purine metabolism are xanthine and hypoxanthine, which are more water-soluble than uric acid and less likely to form crystalline deposits. Allopurinol was de­ veloped by Gertrude Elion and George Hitchings, who also developed acyclovir, used in treating people with genital and oral herpes infections, and other purine analogs used in cancer chemotherapy. •

i n the N ucleotide Biosynthetic Pathways The growth of cancer cells is not controlled in the same way as cell growth in most normal tissues. Cancer cells have greater requirements for nucleotides as precursors of DNA and RNA, and consequently are generally more sensitive than normal cells to inhibitors of nucleotide biosynthesis. A growing array of important chemotherapeutic agents-for cancer and other dis­ eases-act by inhibiting one or more enzymes in these pathways. We describe here several well-studied exam­ ples that illustrate productive approaches to treatment and help us understand how these enzymes work. The first set of agents includes compounds that in­ hibit glutamine amidotransferases. Recall that gluta­ mine is a nitrogen donor in at least half a dozen separate reactions in nucleotide biosynthesis. The binding sites for glutamine and the mechanism by which NH ; is ex­ tracted are quite similar in many of these enzymes. Most are strongly inhibited by glutamine analogs such as aza­ serine and acivicin ( Fig. 22-48). Azaserine, charac­ terized by John Buchanan in the 1950s, was one of the first examples of a mechanism-based enzyme inactivator (suicide inactivator; p. 204 and Box 22-3). Acivicin shows promise as a cancer chemotherapeutic agent. Other useful targets for pharmaceutical agents are thymidylate synthase and dihydrofolate reductase, en­ zymes that provide the only cellular pathway for thymine synthesis ( Fig. 22-49) . One inhibitor that acts on thymidylate synthase, fluorouracil, is an important chemotherapeutic agent. Fluorouracil itself is not the enzyme inhibitor. In the cell, salvage pathways convert it to the deoxynucleoside monophosphate FdUMP, which binds to and inactivates the enzyme. Inhibition by FdUMP ( Fig. 2 2-50 ) is a classic example of mecha­ nism-based enzyme inactivation. Another prominent chemotherapeutic agent, methotrexate, is an inhibitor of dihydrofolate reductase. This folate analog acts as a competitive inhibitor; the enzyme binds methotrexate with about 100 times higher affinity than dihydrofolate. Aminopterin is a related compound that acts similarly.

NHz

I

#

I

I

CHz-c-coo-

C- CHz

0{"

+

NH3

I

H

Glutamine

Azaserine ,.

NH"

o I N....- "CH-C-COO

II

I

I

c --CH2 H c( Acivicin FIGURE 22-48 Azaserine and acivicin, inhibitors of glutamine amido­

Gertrude El ion ( 1 9 1 8-1 999) and George H i tchi ngs ( 1 905-1 998)

transferases.

These analogs of glutamine i nterfere in several amino acid and nucleotide biosynthetic pathways.

22.4 Bi osynthesis a n d Degradation of N u c leotides

FdUMP dUMP

FdUMP

dUMP

dTMP

[s9s]

�.N10-Methylene H4 folate

7 ,8-Dihydrofolate

N 5 ,N10 -Methylene H4 folate

Enzyme thiolate adds at C-6 of dUMP, a Michael­ type addition; N 10 is protonated and N5-iminium ion is formed from methylene-H4 folate.

Glycine

�..,

I, I



H4 folate

Methotrexate Aminopterin Trime!.hoprim

Serine

\

F HN Oj__ NH J Fluorouracil

( a)



H3CO ,. (Ni(NH2 H3CO�N NH� -CRa

C-5 carbanion

adds lo N5-irniniurn ion.

Trimethoprim

S

R

Methylidene is formed at C-5 of pyrimidine; N5 is eliminated to form H4 folate.

Methotrexate

(b) FIGURE 22-49 Thymidylate synthesis and folate metabolism

Dead-end covalent complex

as targets of chemotherapy. (a)

During thymidylate synthesis, N5 ,N 1 0-methylenetetrahydrofolate is converted to 7,8-di hydrofolate; the N5,N 1 0-methylenetetrahydrofolate is regenerated in two steps (see Fig. 2 2-44) . This cycle is a major target of several chemothera­ peutic agents. (b) Fluorouracil and methotrexate are i mportant chemotherapeutic agents. In cells, fluorouraci l is converted to FdUMP, which inhibits thymidylate synthase. Methotrexate, a structural analog of tetrahydrofolate, inhibits di hydrofolate reductase; the shaded amino and methyl groups replace a carbonyl oxygen and a proton, respec­ tively, in folate (see Fig. 2 2-44). Another i mportant folate analog, ami nopterin, is identical to methotrexate except that it lacks the shaded methyl group. Trimethoprim, a tight-binding inh ibitor of bacte­ rial dihydrofolate reductase, was developed as an antibiotic.

HN

H I

O)._l'i/ ·-H ,\ ""-

HB

1,3 hydride shift generates dTMP and dihydrofolate.

dTMP

MECHANISM FIGURE 22-50 Conversion of dUMP to dTMP and its in­ hibition by FdUMP.

The left side is the normal reaction mechanism of thymidylate synthase. The nucleophilic su lfhydryl group contributed by the enzyme in step CD and the ring atoms of d U M P taking part i n the reaction are shown in red; : B denotes a n amino acid side chain that acts as a base to abstract a proton after step ® The hydrogens derived from the methylene group of N5,N1 0-methylenetetrahydrofo-

late are shaded in gray. The 1 ,3 hydride shift (step Q)J, moves a hydride ion (shaded pink) from C-6 of H4 folate to the methyl group of thymi­ dine, resulting in the oxidation of tetrahydrofolate to dihydrofolate. This hydride shift is blocked when FdUMP is the substrate (right). Steps CD and 0 proceed normally, but result in a stable complex-consisting of FdUMP linked covalently to the enzyme and to tetrahydrofolate-that Thymidylate Synthase Mechanism inactivates the enzyme

.•

L89 6_]

Biosynthesis of A m i n o Acids, Nucl eotides, a n d Rel ated Molecules

The medical potential of inhibitors of nucleotide biosynthesis is not limited to cancer treatment. All fast-growing cells (including bacteria and protists) are potential targets. Trimethoprim, an antibiotic developed by Hitchings and Elion, binds to bacterial dihydrofolate reductase nearly 100,000 times better than to the mammalian enzyme. It is used to treat certain urinary and middle-ear bacterial infections. Parasitic protists, such as the trypanosomes that cause African sleeping sickness (African trypanoso­ miasis) , lack pathways for de novo nucleotide biosyn­ thesis and are particularly sensitive to agents that interfere with their scavenging of nucleotides from the surrounding environment using salvage path­ ways. Allopurinol (Fig. 22-4 7) and several similar purine analogs have shown promise for the treatment of African trypanosomiasis and related afflictions. See Box 22-3 for another approach to combating African trypanosomiasis, made possible by advances in our understanding of metabolism and enzyme mechanisms . •

SUMMA RV 2 2 .4

Biosynthesis and Degradation of Nucleotides







• •





The purine ring system is built up step-by-step beginning with 5-phosphoribosylamine. The amino acids glutamine, glycine, and aspartate furnish all the nitrogen atoms of purines. Two ring-closure steps form the purine nucleus. Pyrimidines are synthesized from carbamoyl phosphate and aspartate, and ribose 5-phosphate is then attached to yield the pyrimidine ribonucleotides. Nucleoside monophosphates are converted to their triphosphates by enzymatic phosphorylation reactions. Ribonucleotides are converted to deoxyribonucleotides by ribonucleotide reductase, an enzyme with novel mechanistic and regulatory characteristics. The thymine nucleotides are derived from dCDP and dUMP. Uric acid and urea are the end products of purine and pyrimidine degradation. Free purines can be salvaged and rebuilt into nucleotides. Genetic deficiencies in certain salvage enzymes cause serious disorders such as Lesch-Nyhan syndrome and ADA deficiency.

Key Terms Terms in bold are defined in the glossary.

nitrogen cycle 852 nitrogen fixation 852 anammox 852 symbionts 852 nitrogenase complex 854

spermidine 879 ornithine decarboxylase 879 de novo pathway 882 salvage pathway 882

leghemoglobin 856 glutamine synthetase 857 glutamate synthase 857 glutamine amidotransferases 859 5-phosphoribosyl-1 pyrophosphate (PRPP) 86 1 tryptophan synthase 868 porphyrin 873 porphyria 873 bilirubin 875 phosphocreatine 876 creatine 876 glutathione (GSH) 876 auxin 878 dopamine 878 norepinephrine 878 epinephrine 878 y-aminobutyrate (GABA) 878 serotonin 878 histamine 878 cimetidine 879 spermine 879

inosinate (IMP) 883 carbamoyl phosphate synthetase II 886 aspartate transcarbamoylase

887

nucleoside mono­ phosphate kinase 888 nucleoside diphosphate kinase 888 ribonucleotide reductase 888 thioredoxin 888 thymidylate synthase dihydrofolate reductase 890 adenosine deaminase deficiency 893 Lesch-Nyhan syndrome 893 allopurinol 894 azaserine 894 acivicin 894 fluorouracil 894

890

methotrexate 894 aminopterin 894

Further Reading Nitrogen Fixation

Arp, D.J. & Stein, L.Y. (2003) Metabolism of inorganic N com­ pounds by ammonia-oxidizing bacteria. Grit Rev Biochem Mol

Biol. 38, 491-495.

Burris,

R.H.

(1 995) Breaking the N-N bond. Annu. Rev Plant

Physiol Plant Mol Biol . 46, 1-19.

Fuerst, J.A. (2005) Intracellular compartmentation in plancto­ mycetes. Annu. Rev. Microbial. 59, 299-328.

Igarishi, R.Y. & Seefeldt, L.C. (2003) Nitrogen fixation: the mech­ anism of the Mo-dependent nitrogenase . Grit. Rev. Biochem. Mol

Biol 38, 35 1-384

Patriarca, E.J., Tate,

R., & Iaccarino, M.

(2002) Key role of bac­

terial NH; metabolism in rhizobium-plant symbiosis. Microbial. Mol.

Biol. Rev 66, 203-222.

A good overview of ammonia assimilation in bacterial systems

Accumulation of uric acid crystals in the joints, possibly caused by another genetic deficiency, results in gout.

and its regulation.

Enzymes of the nucleotide biosynthetic pathways are targets for an array of chemotherapeutic agents used to treat cancer and other diseases.

rhizobia! bacteria and their hosts.

Prell, J. & Poole, P. (2006) Metabolic changes of rhizobia in legume nodules. Trends Microbial 14, 161-168. A good summary of the intricate symbiotic relationship between Sinha, S.C. & Smith, J.L. (2001) The PRT protein family. Gurr: Opin. Struct. Biol. 1 1 , 733-739.

Problems

Description of a protein family that includes many arnidotrans­ ferases, with channels for the movement of NH3 from one active site to another.

[897]

Molecular Bases of Inherited Disease, 8th edn, McGraw-Hill Profes­ sional, New York. This four-volume set has good chapters on disorders of amino

Amino Acid Biosynthesis

acid, porphyrin, and heme metabolism. See also the chapters on

in­

born errors of purine and pyrimidine metabolism.

Frey, P.A. & Hegeman, A.D. (2007) Enzymatic Reaction Mecha­ nisms, Oxford University Press, New York.

An updated summary of reaction mechanisms, including one­

Problems

carbon metabolism and pyridoxal phosphate enzymes.

Neidhardt, F.C. (ed.). ( 1 996) Escherichia coli and Salmonella: Cel­ lular and Molecular Biology, 2nd edn, ASM Press, Washington, DC . Volume 1 of this two-volume set has 13 chapters devoted to de­ tailed descriptions of amino acid and nucleotide biosynthesis in bac­ teria. The web-based version at www.ecosaL org is updated regularly. A valuable resource .

Pan P., Woehl, E., & Dunn, M.F. (1 997) Protein architecture, dy­ namics and allostery in tryptophan synthase channeling. Trends

Biochem Sci. 22, 22-27.

Richards, N.G.J. & Kilberg, M.S. (2006) Asparagine synthetase chemotherapy. Annu Rev Biochem 75, 629-654.

Compounds Derived from Amino Acids

Ajioka R.S., Phillips, J.D., & Kushner, J.P. (2006) Biosynthesis of heme in mammals Biochim Biophys Acta Mol Cell Res. 1763,

723-736, Bredt, D.S. & Snyder, S.H. (1 994) Nitric oxide: a physiologic mes­ senger molecule. Annu Rev Biochem 63, 1 75-195.

Meister, A. & Anderson, M.E. ( 1 983) Glutathione Annu_ Rev. Biochem 52, 7 1 1-760

Morse, D. & Choi, A.M.K. (2002) Herne oxygenase-1-the "emerg­ ing molecule" has arrived. Am.

J. Resp. Cell Mol Biol. 2 7 , 8-16 .

Rondon, M.R., Trzebiatowski, J.R., & Escalante-Semerena, J.C. (1 997) Biochemistry and molecular genetics of cobalamin biosynthesis. Frog. Nucleic Acid Res Mol Biol 56, 347-384.

Stadtman, T.C. (1 996) Selenocysteine. Annu. Rev Biochem. 65, 83-100.

1 . ATP Consumption by Root Nodules in Legumes Bac­

teria residing in the root nodules of the pea plant consume more than 20% of the ATP produced by the plant. Suggest why these bacteria consume so much ATP.

2 . Glutamate Dehydrogenase and Protein Synthesis The bacterium Methylophilus methylotrophus can synthe­ size protein from methanol and ammonia. Recombinant DNA techniques have improved the yield of protein by introducing into M. methylotrophus the glutamate dehydrogenase gene from E. coli. Why does this genetic manipulation increase the protein yield?

3. PLP Reaction Mechanisms Pyridoxal phosphate can help catalyze transformations one or two carbons removed from the a carbon of an amino acid. The enzyme threonine synthase (see Fig. 22-15) promotes the PLP-dependent con­ version of phosphohomoserine to threonine . Suggest a mecha­ nism for this reaction. 4. Transformation of Aspartate to Asparagine There are two routes for transforming aspartate to asparagine at the ex­ pense of ATP. Many bacteria have an asparagine synthetase that uses ammonium ion as the nitrogen donor. Mammals have an asparagine synthetase that uses glutamine as the nitrogen donor. Given that the latter requires an extra ATP (for the syn­ thesis of glutamine) , why do mammals use this route?

Nucleotide Biosynthesis

Carreras, C.W. & Santi, D.V. ( 1995) The catalytic mechanism and

structure of thyrnidylate synthase . Annu Rev Biochem 64, 721-762

Holmgren, A. ( 1 989) Thioredoxin and glutaredoxin systems. J. Biol. Chem 264, 1 3,963-13,966.

Kappock, T.J., Ealick, S.E., & Stubbe, J. (2000) Modular evolu­ tion of the purine biosynthetic pathway. Curr: Opin. Chem Biol 4,

567-572. Kornberg, A. & Baker, T.A. ( 1 99 1 ) DNA Replication, 2nd edn,

W. H. Freeman and Company, New York.

This text includes a good summary of nucleotide biosynthesis.

Licht, S., Gerfen, G.J., & Stubbe, J. (1 996) Thiyl radicals in ri­ bonucleotide reductases_ Science 2 7 1 , 4 77-481 .

Nordlund, P. & Reichard, P. (2006) Ribonucleotide reductases. Annu. Rev. Biochem 75, 681-706.

5. Equation for the Synthesis of Aspartate from Glu­ cose Write the net equation for the synthesis of aspartate (a nonessential amino acid) from glucose, carbon dioxide, and ammoma. 6. Asparagine Synthetase Inhibitors in Leukemia Therapy Mammalian asparagine synthetase is a glutamine-dependent amidotransferase. Efforts to identify an effective inhibitor of human asparagine synthetase for use in chemotherapy for patients with leukemia has focused not on the amino-terminal glutaminase domain but on the carboxyl­ terminal synthetase active site. Explain why the glutaminase domain is not a promising target for a useful drug.

accompanied by delightful tales of science and politics

7. Phenylalanine Hydroxylase Deficiency and Diet Tyro­ sine is normally a nonessential amino acid, but individuals with a genetic defect in phenylalanine hydroxylase require tyrosine in their diet for normal growth. Explain.

Stubbe, J. & Riggs-Gelasco, P. (1 998) Harnessing free radicals:

8. Cofactors for One-Carbon Transfer Reactions Most

Schachman, H.K. (2000) Still looking for the ivory tower. Annu Rev Biochem 69, 1-29. A lively description of research on aspartate transcarbarnoylase,

formation and function of the tyrosyl radical in ribonucleotide reduc­ tase. Trends Biochem Sci 23, 438-443_

Genetic Diseases

Scriver, C.R., Beaudet, A.L., Valle, D., Sly, W.S., Childs, B., Kin­ zler, L.W., & Vogelstein, B. (eds). (2001) The Metabolic and

one-carbon transfers are promoted by one of three cofactors: biotin, tetrahydrofolate, or S-adenosylmethionine (Chapter 18). S-Adenosylmethionine is generally used as a methyl group donor; the transfer potential of the methyl group in ff-methyl­ tetrahydrofolate is insufficient for most biosynthetic reactions.

[a9 al

Biosynthesis of A m i n o Acids, N u c l eotides, a n d Related M o l e c u l e s

However, one example o f the u s e o f N' -methyltetrahydrofolate

14. Pathway of Carbon in Pyrimidine Biosynthesis Pre­

in methyl group transfer is in methionine formation by the me­

dict the locations of 14C in orotate isolated from cells grown on

of Fig. 22- 1 5) ; methionine

a small amount of uniformly labeled e4c]succinate . Justify

thionine synthase reaction (step

®

is the immediate precursor of S-adenosylmethionine (see Fig. 18-18) . Explain how the methyl group of S-adenosylmethion­ ine can be derived from N"-methyltetrahydrofolate , even

though the transfer potential of the methyl group in tf'-methyl­

tetrahydrofolate is one one-thousandth of that in S-adenosyl­ methionine.

your prediction.

15. Nucleotides

as

Poor Sources of Energy Under

starva­

tion conditions, organisms can use proteins and amino acids as sources of energy. Deamination of amino acids produces carbon skeletons that can enter the glycolytic pathway and the citric acid cycle to produce energy in the form of ATP. Nucleotides, on

9. Concerted Regulation in Amino Acid Biosynthesis

the other hand, are not similarly degraded for use as energy­

The glutamine synthetase of E coli is independently modulated

yielding fuels. What observations about cellular physiology sup­

by various products of glutamine metabolism (see Fig. 22-6) . In

port this statement? What aspect of the structure of nucleotides

this concerted inhibition, the extent of enzyme inhibition is

makes them a relatively poor source of energy?

greater than the sum of the separate inhibitions caused by each product. For E coli grown in a medium rich in histidine, what would be the advantage of concerted inhibition?

16. Treatment of Gout Allopurinol

(see Fig. 22-4 7) ,

an inhibitor of xanthine oxidase, is used to treat chronic gout. Explain the biochemical basis for this treatment .

10. Relationship between Folic Acid Deficiency

Patients treated with allopurinol sometimes develop xanthine

Folic acid deficiency, believed to be the

stones in the kidneys, although the incidence of kidney dam­

most common vitamin deficiency, causes a type of anemia in

age is much lower than in untreated gout. Explain this obser­

which hemoglobin synthesis is impaired and erythrocytes do

vation in the light of the following solubilities in urine: uric

not mature properly. What is the metabolic relationship be­

acid, 0 . 1 5 g/L; xanthine, 0 . 05

and Anemia

tween hemoglobin synthesis and folic acid deficiency?

1 1 . Nucleotide Biosynthesis in Amino Acid Auxotrophic

giL;

and hypoxanthine, 1 . 4 g/1 .

1 7. Inhibition of Nucleotide Synthesis by Azaserine The diazo compound 0- (2-diazoacetyl) -L-serine, known also as

cells can synthesize all 20 common

azaserine (see Fig. 22-48) , is a powerful inhibitor of glutamine

amino acids, but some mutants, called amino acid auxotrophs,

amidotransferases. If growing cells are treated with azaserine,

are unable to synthesize a specific amino acid and require its

what intermediates of nucleotide biosynthesis will accumu­

addition to the culture medium for optimal growth. Besides

late? Explain.

Bacteria Wild-type E coli

their role in protein synthesis, some amino acids are also pre­ cursors for other nitrogenous cell products. Consider the three amino acid auxotrophs that are unable to synthesize glycine, glutamine , and aspartate, respectively. For each mutant, what nitrogenous products other than proteins would the cell fail to synthesize?

12. Inhibitors of Nucleotide Biosynthesis

Suggest mecha­

nisms for the inhibition of (a) alanine racemase by L-fiuoroalanine and (b) glutamine amidotransferases by azaserine.

13. Mode of Action of Sulfa Drugs

Some bacteria

require p-aminobenzoate in the culture medium for normal growth, and their growth is severely inhibited by the addition of sulfanilamide, one of the earliest sulfa drugs. More­ over, in the presence of this drug, 5-aminoimidazole-4-carbox­ amide ribonucleotide (AICAR; see Fig. 22-33) accumulates in the culture medium. These effects are reversed by addition of excess p-aminobenzoate.

18. Use of Modern Molecular Techniques to Determine the Synthetic Pathway of a Novel Amino Acid Most of the biosynthetic pathways described in this chapter were deter­ mined before the development of recombinant DNA technology and genomics, so the techniques were quite different from those that researchers would use today. Here we explore an ex­ ample of the use of modern molecular techniques to investigate the pathway of synthesis of a novel amino acid, (2S)-4-amino-2hydroxybutyrate (AHBA) . The techniques mentioned here are described in various places in the book; this problem is designed to show how they can be integrated in a comprehensive study. AHBA is a y-amino acid that is a component of some aminoglycoside antibiotics, including the antibiotic bu­ tirosin. Antibiotics modified by the addition of an AHBA residue are often more resistant to inactivation by bacterial

0

H2N

p-Aminobenzoate

Data Analysis Problem

r\. \J _ - 0£-NH2 II ·

Sulfanilamide

(a) What is the role of p-aminobenzoate in these bacteria?

antibiotic-resistance enzymes. As a result, understanding how AHBA is synthesized and added to antibiotics is useful in the design of pharmaceuticals. In an article published in 2005, Li and coworkers describe how they determined the synthetic pathway of AHBA from glutamate .

(Hint: See Fig. 18-16.) (b) Why does AICAR accumulate in the presence of sul­ fanilamide? (c) Why are the inhibition and accumulation reversed by addition of excess p-aminobenzoate?

T

-o"

NHa

� c 7o c II

o

I

a-

Glutamate

+

OH



NHa

C I

70

o-

AHBA

Problems

(a) Briefly describe the chemical transformations needed to convert glutamate to AHBA. At this point, don't be con­ cerned about the order of the reactions. Li and colleagues began by cloning the butirosin biosynthetic gene cluster from the bacterium Bacillus circulans , which makes large quantities ofbutirosin. They identified five genes that are essential for the pathway: btrl, btrJ, btrK, btrO, and btrV.

They cloned these genes into E. coli plasmids that allow overex­ pression of the genes, producing proteins with "histidine tags" (see p. 3 14) fused to their amino termini to facilitate purification. The predicted amino acid sequence of the Btrl protein showed strong homology to known acyl carrier proteins (see

Fig. 2 1-5) . Using mass spectrometry (see Box 3-2) , Li and col­ leagues found a molecular mass of 1 1 ,812 for the purified Btri protein (including the His tag) . When the purified Btri was in­ cubated with coenzyme A and an enzyme known to attach CoA to other acyl carrier proteins, the majority molecular species had an Mr of 1 2 , 1 53. (b) How would you use these data to argue that Btri can function as an acyl carrier protein with a CoA prosthetic group? Using standard terminology, Li and coauthors called the form of the protein lacking CoA apo-Btri and the form with CoA (linked as in Fig. 2 1-5) holo-Btri. When holo-Btri was incu­ bated with glutamine, ATP, and purified BtrJ protein, the holo­ Btrl species of Mr 12, 1 53 was replaced with a species of M, 12,28 1 , corresponding to the thioester of glutamate and holo­ Btri. Based on these data, the authors proposed the following structure for the Mr 12,281 species ( y-glutamyl-S-Btri) :

NHa '

c

�!

?0

Btrl y-Glutarnyl-S-Btrl

[899]

(c) What other structure(s) is (are) consistent with the data above? (d) Li and coauthors argued that the structure shown here ( y-glutamyl-S-Btri) is likely to be correct because the a­ carboxyl group must be removed at some point in the syn­ thetic process. Explain the chemical basis of this argument. (Hint: See Fig. 1 8-6c.) The BtrK protein showed significant homology to PLP-de­ pendent amino acid decarboxylases, and BtrK isolated from E. coli was found to

contain tightly bound PLP. When y-glutamyl­ S-Btrl was incubated with purified BtrK, a molecular species of Mr 1 2,240 was produced. (e) What is the most likely structure of this species? (f) Interestingly, when the investigators incubated gluta­

mate and ATP with purified Btri, BtrJ, and BtrK, they found a molecular species of M, 12,370. What is the most likely struc­ ture of this species? Hint: Remember that BtrJ can use ATP to y-glutamylate nucleophilic groups. Li and colleagues found that BtrO is homologous to monooxygenase enzymes (see Box 21-1) that hydroxylate alkanes, using FMN as a cofactor, and BtrV is homologous to an NAD(P)H oxidoreductase . Two other genes in the cluster, btrG and btrH, probably encode enzymes that remove the y-glutamyl group and attach AHBA to the target antibiotic molecule. (g) Based on these data, propose a plausible pathway for the synthesis of AHBA and its addition to the target antibiotic. Include the enzymes that catalyze each step and any other substrates or cofactors needed (ATP, NAD, etc.) . Reference

Li, Y., Llewellyn, N.M., Giri, R., Huang, F., & Spencer, J.B. (2005) Biosynthesis of the unique amino acid side chain of

bu­

tirosin: possible protective-group chemistry in an acyl carrier pro­ tein-mediated pathway. Chem.

Biol. 1 2 , 665-675 .

We recognize that each tissue a nd, more genera l ly, each cel l of the or­ ga n i sm secretes . . . spec i a l products or ferments i nto the blood which thereby i nfluence a l l the other cel ls thus i ntegrated with each other by a mechanism other than the nervous system.

- Charles Edouard Brown-Sequard and }. d'Arsonval, article in Com ptes Rend us de Ia Societe de B iologie, 7 89 7

Hormonal Regulation and I ntegration of Mammalian Metabolism 23.1

Hormones: Diverse Structures for Diverse Functions

23.2

hormones and hormonal mechanisms, then tum to the

901

tissue-specific functions regulated by these mecha­

Tissue-Specific Metabolism: The Division of labor

23.3

Hormonal Regulation of Fuel Metabolism

922

23.4

Obesity and the Regulation of Body Mass

930

23.5

Obesity, the Metabolic Syndrome, and Type 2 Dia betes

912

938

nisms. We discuss the distribution of nutrients to vari­ ous organs-emphasizing the central role played by the liver-and the metabolic cooperation among these or­ gans. To illustrate the integrative role of hormones, we describe the interplay of insulin, glucagon, and epineph­ rine in coordinating fuel metabolism in muscle, liver, and adipose tissue. The metabolic disturbances in diabetes further illustrate the importance of hormonal regulation of metabolism. We discuss the long-term hormonal reg­

I

n Chapters

1 3 through 22 we have discussed metabo­

lism at the level of the individual cell, emphasizing central pathways common to almost all cells, bacter­

ulation of body mass and, finally, the role of obesity in development of the metabolic syndrome and diabetes.

ial, archaeal, and eukaryotic . We have seen how meta­

23.1 Hormones: Diverse Structures for

bolic processes within cells are regulated at the level of

Diverse Functions

individual enzyme reactions, by substrate availability, by allosteric mechanisms, and by phosphorylation or other

Virtually every process in a complex organism is regu­

covalent modifications of enzymes.

lated by one or more hormones: maintenance of blood

To appreciate fully the significance of individual meta­

pressure, blood volume, and electrolyte balance; em­

bolic pathways and their regulation, we must view these

bryogenesis; sexual differentiation, development, and

pathways in the context of the whole organism. An essen­

tial characteristic of multicellular organisms is cell differ­

reproduction; hunger, eating behavior, digestion, and fuel allocation-to name but a few. We examine here the

entiation and division of labor. The specialized functions of

methods for detecting and measuring hormones and

the tissues and organs of complex organisms such as hu­

their interaction with receptors, and consider a repre­

mans impose characteristic fuel requirements and patterns

sentative selection of hormone types.

of metabolism. Hormonal signals integrate and coordinate

The coordination of metabolism in mammals is

neuroendocrine system. Individual

the metabolic activities of different tissues and optimize

achieved by the

the allocation of fuels and precursors to each organ.

cells in one tissue sense a change in the organism's cir­

In this chapter we focus on mammals, looking at the

cumstances and respond by secreting a chemical mes­

specialized metabolism of several major organs and tis­

senger that passes to another cell in the same or

sues and the integration of metabolism in the whole or­

different tissue, where the messenger binds to a recep­

ganism. We begin by examining the broad range of

tor molecule and triggers a change in this second cell. In

[9o 1]

[902]

H o r m o n a l Regulation a n d I ntegration of M a m m a l i a n Meta b o l i s m

neuronal signaling (Fig. 23-la) , the chemical messenger (neurotransmitter; acetylcholine, for example) may travel only a fraction of a micrometer, across the synaptic cleft to the next neuron in a network. In hormonal signaling, the messengers-hormones-are carried in the bloodstream to neighboring cells or to distant organs and tissues; they may travel a meter or more before encountering their

(a) Neuronal signaling

target cell (Fig. 23-1b). Except for this anatomic differ­ ence, these two chemical signaling mechanisms are re­ markably similar. Epinephrine and norepinephrine, for example, serve as neurotransmitters at certain synapses of the brain and neuromuscular junctions of smooth mus­ cle, and as hormones that regulate fuel metabolism in liver and muscle. The following discussion of cellular signaling emphasizes hormone action, drawing on discussions of fuel metabolism in earlier chapters, but most of the funda­ mental mechanisms described here also occur in neuro­ transmitter action.

The Detection a nd Purification of Hormones Requires a Bioassay

Target cells 3

• • •

••

.

( i

'

;J / impul

erve

e

Contraction •

'

Secretion

/

Metabolic • change

(b)

Endocrine signaling

FIGURE 23-1 Signaling by the neuroendocrine system. (a) In neuronal signal ing, electrical signals (nerve impu lses) originate in the cell body of a neuron and travel very rapidly over long distances to the axon tip, where neurotransmitters are released and diffuse to the target cel l . The target cell (another neuron, a myocyte, or a secretory cell) is only a fraction of a micrometer or a few micrometers away from the site of neurotransmitter release. (b) In the endocrine system, hormones are secreted i nto the bloodstream, which carries them throughout the body to target tissues that may be a meter or more away from the secreti ng cel l . Both neurotransm itters a n d hormones interact with specific receptors on or in their target cells, triggering responses.

How is a hormone detected and isolated? First, re­ searchers find that a physiological process in one tis­ sue depends on a signal that originates in another tissue. Insulin, for example, was first recognized as a substance that is produced in the pancreas and affects the volume and composition of urine (Box 23-1). Once a physiological effect of the putative hormone is discovered, a quantitative bioassay for the hormone can be developed. In the case of insulin, the assay con­ sisted of injecting extracts of pancreas (a crude source of insulin) into experimental animals deficient in insulin, then quantifying the resulting changes in glucose concentration in blood and urine. To isolate a hormone, the biochemist fractionates extracts con­ taining the putative hormone, with the same tech­ niques used to purify other biomolecules (solvent fractionation, chromatography, and electrophoresis), and then assays each fraction for hormone activity. Once the chemical has been purified, its composition and structure can be determined. This protocol for hormone characterization is de­ ceptively simple. Hormones are extremely potent and are produced in very small amounts. Obtaining suffi­ cient hormone to allow its chemical characterization often involves biochemical isolations on a heroic scale. When Andrew Schally and Roger Guillemin independ­ ently purified and characterized thyrotropin-releasing hormone (TRH) from the hypothalamus, Schally's group processed about 20 tons of hypothalamus from nearly two million sheep, and Guillemin's group ex­ tracted the hypothalamus from about a million pigs! TRH proved to be a simple derivative of the tripeptide Glu-His-Pro (Fig. 2 3-2 ) . Once the structure of the hormone was known, it could be chemically synthe­ sized in large quantities for use in physiological and biochemical studies. For their work on hypothalamic hormones, Schally and Guillemin shared the Nobel Prize in Physiology or Medicine in 1 977, along with Rosalyn Yalow, who (with Solomon A Berson) developed the extraordinarily sen­ sitive radioimmunoassay (RIA) for peptide hormones and used it to study hormone action. RIA revolutionized

2 3 . 1 Hormones: Diverse Structures for Diverse F u n ctions

B O X 23 - 1

[9o3]

;,; ��...��"K·�,r�u How Is a Hormone Discovered ? The Arduous Path to ··;,;.r:. Purified I nsulin

Millions of people with type 1 diabetes mellitus inject themselves daily with pure insulin to compensate for the lack of production of this critical hormone by their own pancreatic f3 cells. Insulin injection is not a cure for dia­ betes, but it allows people who otherwise would have died young to lead long and productive lives. The dis­ covery of insulin, which began with an accidental obser­ vation, illustrates the combination of serendipity and careful experimentation that led to the discovery of many of the hormones. In 1 889, Oskar Minkowski, a young assistant at the Medical College of Strasbourg, and Josef von Mer­ ing, at the Hoppe-Seyler Institute in Strasbourg, had a friendly disagreement about whether the pancreas, known to contain lipases, was important in fat diges­ tion in dogs . To resolve the issue, they began an ex­ periment on the digestion of fats. They surgically removed the pancreas from a dog, but before their ex­ periment got any farther, Minkowski noticed that the dog was now producing far more urine than normal (a common symptom of untreated diabetes) . Also , the dog's urine had glucose levels far above normal (an­ other symptom of diabetes ) . These findings sug­ gested that lack of some pancreatic product caused diabetes. Minkowski tried unsuccessfully to prepare an ex­ tract of dog pancreas that would reverse the effect of re­ moving the pancreas-that is, would lower the urinary or blood glucose levels . We now know that insulin is a protein, and that the pancreas is very rich in proteases (trypsin and chymotrypsin) , normally released directly into the small intestine to aid in digestion. These pro­ teases doubtless degraded the insulin in the pancreatic extracts in Minkowski's experiments. Despite considerable effort, no significant progress was made in the isolation or characterization of the "antidiabetic factor" until the summer of 1 92 1 , when Frederick G. Banting, a young scientist working in the

Frederick G. Banti ng, 1 89 1 -1 941

J. j .

R. Macleod, 1 876-1 935

laboratory of J. J. R. MacLeod at the University of Toronto, and a student assistant, Charles Best, took up the problem. By that time, several lines of evidence pointed to a group of specialized cells in the pancreas (the islets of Langerhans ; see Fig. 23-27) as the source of the antidiabetic factor, which carne to be called in­ sulin (from Latin insula, "island"). Taking precautions to prevent proteolysis, Banting and Best (later aided by biochemist J. B. Collip) suc­ ceeded in December 1 92 1 in preparing a purified pan­ creatic extract that cured the symptoms of experimental diabetes in dogs. On January 25, 1 922 (just one month later!) , their insulin preparation was inj ected into Leonard Thompson, a 1 4-year-old boy severely ill with diabetes mellitus. Within days, the levels of ketone bodies and glucose in Thompson's urine dropped dra­ matically; the extract saved his life . In 1 923, Banting and MacLeod won the Nobel Prize for their isolation of insulin. Banting immediately announced that he would share his prize with Best; MacLeod shared his with Collip . By 1 923, pharmaceutical companies were supply­ ing thousands of patients throughout the world with insulin extracted from porcine pancreas. With the de­ velopment of genetic engineering techniques in the 1 980s (Chapter 9) , it became possible to produce un­ limited quantities of human insulin by inserting the cloned human gene for insulin into a microorganism, which was then cultured on an industrial scale. Some patients with diabetes are now fitted with implanted insulin pumps, which release adjustable amounts of insulin on demand to meet changing needs at meal times and during exercise. There is a reasonable prospect that, in the future, transplantation of pan­ creatic tissue will provide diabetic patients with a source of insulin that responds as well as normal pan­ creas , releasing insulin into the bloodstream only when blood glucose rises.

Charles Best, 1 899-1 978

].

B. Col l i p, 1 892-1 965

904

J

H o r m o n a l Reg u l ation a n d I nte g ration of M a m m a lian Meta bo lism

CH., O = C/ 'CH., Q

I

- II

I

/

l C H2

0

II

II

NH - CH - C --I NH - CH - C --1

I

I I

I

I

:

Hz



I I

-.....:

CH2

I

- CH -

.f'o NH ,

C - NH

I

CH

HC - N

Pyroglutamate

Histidine

Radiolabeled hormone

(a)

CH2

l

0)0)� 0�0) 0)�� 0)

F I G U R E 23-2 The structure of thyrotropin-releasing hormone (TRH).

Purified (by heroic efforts) from extracts of hypothalamus, TRH proved to be a derivative of the tripeptide G lu-H is-Pro. The side-chain car­ boxyl group of the a m i no-term inal Glu forms an amide (red bond) with the residue's a-amino group, creating pyroglutamate, and the carboxyl group of the carboxyl-terminal Pro is converted to an am ide (red -NH2). Such modifications are common among the sma l l pep­ tide hormones. In a typical protein of M, -50,000, the charges on the amino- and carboxyl-term inal groups contribute relatively l ittle to the overal l charge on the molecule, but in a tripeptide these two charges domi nate the properties of the molecule. Formation of the am ide derivatives removes these cha rges.

Rosalyn S. Yalow

CD

� (!)(!)(!)

,. ,. ,. ,. T T ,. TT TT TTTTTT

hormone research by making possible the rapid, quantitative, and specific measurement of hormones in minute amounts. Hormone-specific antibod­ ies are the key to the radio-im­ munoassay. Purified hormone, injected into rabbits, elicits an­ tibodies that bind to the hor­ mone with very high affinity and specificity. When a con­ stant amount of isolated anti­ body is incubated with a fixed amount of the radioactively la­ beled hormone, a certain frac­ tion of the radioactive hormone binds to the antibody ( Fig. 2 :3-!l ) . If, in addition to the ra­ diolabeled hormone, unlabeled hormone is also present, the un­ labeled hormone competes with and displaces some of the la­ beled hormone from its binding site on the antibody. This bind­ ing competition can be quanti­ fied by reference to a standard curve obtained with known amounts of unlabeled hormone. The degree to which labeled hor­ mone is displaced from antibody is a measure of the amount of (unlabeled) hormone in a sam­ ple of blood or tissue extract. By using very highly radioactive hormone, researchers can make

(!)(!)(!) (!)(!) 0)

Radiolabeled and unlabeled hormone

(b)

tJ ..Q

..9 0

:.a

J!

TT T T T TT T T T

0)

1.2

/ Standard

...-----...

-81 ...

< ----::: "C

"C QJ

Qj

Roger Guillemin

(!)(!)(!) T (!)(!)(!) (!)(!) � �

Antibody

Prolylamide

pyroGlu-His-Pro-NH2

Andrew V. Schal l y

TTT TTT TTT

::c

j

0 :;::; Ol ...

g

.0

3

0.

curve

0.6

0.4 0.2

0

1

100

10

1000

Unlabeled ACTH added (pg)

(T )

FIGURE 23-3 Radioimmunoassay (RIA). (a)

A low concentration of radiolabeled hormone (red) is incubated with CD a fixed amount of anti­ body specific for that hormone or (1) a fixed amount of antibody and various concentrations of unlabeled hormone (blue). I n the latter case, unlabeled hormone competes with labeled hormone for binding to the antibody; the amount of labeled hormone bound varies inversely with the concentration of unlabeled hormone present. (b) A radioim­ munoassay for adrenocorticotropic hormone (ACTH; also called corticotropin). A standard curve of the ratio [bound]/[unbound] radio­ labeled ACTH vs. [unlabeled ACTH added] (on a logarithmic scale) is constructed and used to determine the amount of (unlabeled) ACTH in an unknown sample. If an al iquot conta i n i ng an unknown quantity of unlabeled hormone gives, say, a val ue of 0.4 for the ratio [bound]/[un­ bound] (see arrow), the al iquot must contain about 20 pg of ACTH .

the assay sensitive t o picograms o f hormone in a sample. A newer variation of this technique, enzyme-linked im­ munosorbent assay (ELISA) , is illustrated in Figure 5-26b. Hormones Act through Specific High-Affinity Cellular Receptors As we saw in Chapter 12, all hormones act through highly specific receptors in hormone-sensitive target cells, to which the hormones bind with high affinity (see

2 3 . 1 Hormones: Dive rse Structu res for Diverse F u nctions

Fig. 12-la). Each cell type has its own combination of hor­ mone receptors, which define the range of its hormone re­ sponsiveness. Moreover, two cell types with the same type of receptor may have different intracellular targets of hor­ mone action and thus may respond differently to the same hormone. The specificity of hormone action results from structural complementarity between the hormone and its receptor; this interaction is extremely selective, so struc­ turally similar hormones can have different effects. The high affinity of the interaction allows cells to respond to very low concentrations of hormone. In the design of drugs intended to intervene in honnonal regulation, we need to know the relative specificity and affinity of the drug and the natural hormone. Recall that hormone-receptor in­ teractions can be quantified by Scatchard analysis (see Box 12-1 ) , which, under favorable conditions, yields a quantitative measure of affinity (the dissociation constant for the complex) and the number of hormone-binding sites in a preparation of receptor. The locus of the encounter between hormone and receptor may be extracellular, cytosolic, or nuclear, depending on the hormone type. The intracellular consequences of hormone-receptor interaction are of at least six general types : (1) a second messenger (such as cAMP or inositol trisphosphate) generated inside the cell acts as an allosteric regulator of one or more enzymes; (2) a receptor tyrosine kinase is activated by the extra­ cellular hormone; (3) a receptor guanylyl cyclase is acti­ vated and produces the second messenger cGMP; (4) a change in membrane potential results from the opening or closing of a hormone-gated ion channel; (5) an adhe­ sion receptor on the cell surface interacts with molecules in the extracellular matrix and conveys information to the cytoskeleton; or (6) a steroid or steroidlike molecule causes a change in the level of expression (transcription of DNA into mRNA) of one or more genes, mediated by a nuclear hormone receptor protein (see Fig. 1 2-2) . Water-soluble peptide and amine hormones (insulin and epinephrine, for example) act extracellularly by binding to cell surface receptors that span the plasma membrane ( Fig. 23-4). When the hormone binds to its extracellular domain, the receptor undergoes a confor­ mational change analogous to that produced in an al­ losteric enzyme by binding of an effector molecule . The conformational change triggers the downstream effects of the hormone. A single hormone molecule, in forming a hormone­ receptor complex, activates a catalyst that produces many molecules of second messenger, so the receptor serves not only as a signal transducer but also as a signal amplifier. The signal may be further amplified by a signal­ ing cascade, a series of steps in which a catalyst activates a catalyst, resulting in very large amplifications of the original signal. A cascade of this type occurs in the regu­ lation of glycogen synthesis and breakdown by epinephrine (see Fig. 12-7) . Epinephrine activates (through its receptor) adenylyl cyclase, which produces many molecules of cAMP for each molecule of receptor­ bound hormone. Cyclic AMP in turn activates cAMP-

Peptide or amine hormone binds to receptor on the outside of the cell; acts through receptor without entering the cell.

[9os]

Steroid or thyroid hormone enters the cell; hormone­ receptor complex acts in the nucleus.

econd messenger (e.g. cAMP) --'!'"""� ofsp cific genes

Altered transcription

Altered activity of preexisting enzyme

Altered amount of newly synthesized proteins

F IGURE 23-4 Two general mechanisms of hormone action. The pep­ tide and amine hormones are faster acting than steroid and thyroid hormones.

dependent protein kinase (protein kinase A) , which acti­ vates glycogen phosphorylase b kinase, which activates glycogen phosphorylase b. The result is signal amplifica­ tion: one epinephrine molecule causes the production of many thousands of molecules of glucose 1-phosphate from glycogen. Water-insoluble hormones (steroid, retinoid, and thyroid hormones) readily pass through the plasma membrane of their target cells to reach their receptor proteins in the nucleus (Fig. 23-4) . With this class of hormones , the hormone-receptor complex itself carries the message; it interacts with DNA to alter the expres­ sion of specific genes, changing the enzyme complement of the cell and thereby changing cellular metabolism (see Fig. 1 2-29) . Hormones that act through plasma membrane re­ ceptors generally trigger very rapid physiological or bio­ chemical responses. Just seconds after the adrenal medulla secretes epinephrine into the bloodstream, skeletal muscle responds by accelerating the breakdown of glycogen. By contrast, the thyroid hormones and the sex (steroid) hormones promote maximal responses in their target tissues only after hours or even days. These differences in response time correspond to different modes of action. In general, the fast-acting hormones lead to a change in the activity of one or more preexist­ ing enzymes in the cell, by allosteric mechanisms or

[9 o6]

H ormonal Regu lation a n d I ntegration of M a m m a l i a n Meta bolism

covalent modification. The slower-acting hormones gen­ erally alter gene expression, resulting in the synthesis of more (upregulation) or less (downregulation) of the regulated protein(s) . Hormones Are Chemically Diverse Mammals have several classes of hormones, distinguish­ able by their chemical structures and their modes of action (Table 23-1 ) . Peptide, amine, and eicosanoid hormones act from outside the target cell via surface re­ ceptors. Steroid, vitamin D, retinoid, and thyroid hor­ mones enter the cell and act through nuclear receptors. Nitric oxide also enters the cell, but activates a cytosolic enzyme , guanylyl cyclase (see Fig. 1 2-20) . Hormones can also be classified by the way they get from their point of release to their target tissue. En­ docrine (from the Greek endon, "within," and krinein, "to release") hormones are released into the blood and carried to target cells throughout the body (insulin and glucagon are examples) . Paracrine hormones are re­ leased into the extracellular space and diffuse to neigh­ boring target cells (the eicosanoid hormones are of this type) . Autocrine hormones affect the same cell that re­ leases them, binding to receptors on the cell surface. Mammals are hardly unique in possessing hormonal signaling systems. Insects and nematode worms have highly developed systems for hormonal regulation, with fundamental mechanisms similar to those in mammals. Plants, too, use hormonal signals to coordinate the ac­ tivities of their tissues (Chapter 1 2) . The study of hor­ mone action is not as advanced in plants as in animals, but we do know that some mechanisms are shared. To illustrate the structural diversity and range of ac­ tion of mammalian hormones , we consider representa­ tive examples of each major class listed in Table 23- 1 . Peptide Hormones Peptide hormones may have from 3 to 200 or more amino acid residues. They in­ clude the pancreatic hormones insulin, glucagon, and

TAB L E 2 3 - 1

somatostatin; the parathyroid hormone calcitonin; and all the hormones of the hypothalamus and pituitary (de­ scribed below) . These hormones are synthesized on ribo­ somes in the form of longer precursor proteins (prohormones) , then packaged into secretory vesicles and proteolytically cleaved to form the active peptides. Insulin is a small protein (Mr 5,800) with two polypeptide chains, A and B, joined by two disulfide bonds. It is syn­ thesized in the pancreas as an inactive single-chain pre­ cursor, preproinsulin (Fig. 23-5 ) , with an amino-terminal "signal sequence" that directs its passage into secretory vesicles. (Signal sequences are discussed in Chapter 27; see Fig. 27-38.) Proteolytic removal of the signal se­ quence and formation of three disulfide bonds produces proinsulin, which is stored in secretory granules in pan­ creatic {3 cells. When blood glucose is elevated sufficiently to trigger insulin secretion, proinsulin is converted to ac­ tive insulin by specific proteases, which cleave two pep­ tide bonds to form the mature insulin molecule. In some cases, prohormone proteins , rather than yielding a single peptide hormone, produce several active hormones. Pro-opiomelanocortin (POMC) is a spectacu­ lar example of multiple hormones encoded by a single gene. The POMC gene encodes a large polypeptide that is progressively carved up into at least nine biologically ac­ tive peptides (Fig. 23-6 ) . In many peptide hormones the terminal residues are modified, as in TRH (Fig. 23-2) . The concentration of peptide hormones in secretory granules is so high that the vesicle contents are virtually crystalline; when the contents are released by exocyto­ sis, a large amount of hormone is released suddenly. The capillaries that serve peptide-producing endocrine glands are fenestrated (and thus permeable to pep­ tides) , so the hormone molecules readily enter the bloodstream for transport to target cells elsewhere. As noted earlier, all peptide hormones act by binding to re­ ceptors in the plasma membrane. They cause the gener­ ation of a second messenger in the cytosol, which changes the activity of an intracellular enzyme , thereby altering the cell's metabolism.

Classes of Hormones

Type

Example

Synthetic path

Peptide

Insulin, glucagon

Proteolytic processing of prohormone

Catecholamine

Epinephrine

From tyrosine

Eicosanoid

PGE1

From arachidonate (20:4 fatty acid)

Steroid

Testosterone

From cholesterol

Vitamin D

1 ,25-Dihydroxycholecalciferol

From cholesterol

Retinoid

Retinoic acid

From vitamin A

Thyroid

Triiodothyronine (T3)

From Tyr in thyroglobulin

Nitric oxide

Nitric oxide

From arginine + 02

Mode of action

Plasma membrane receptors; second messengers

Nuclear receptors; transcriptional regulation

Cytosolic receptor (guanylyl cyclase) and second messenger (cGMP)

23 . 1 Hormones: Diverse Structures for Diverse Fu nctions

Preproinsulin

Proinsulin

Signal

Ha.,. _

equence

c

A

FIGURE 23-5

Mature insulin

t

NHa

, - ·S-S

B

I

,s-s

s

A chain I

s-

[9o7]

B ch ain

Insulin. Mature insulin is formed from its larger precursor preproinsu l i n by proteolytic pro­ cessing. Removal of a 23 amino acid segment (the signal sequence) at the amino terminus of preproin­ sulin and formation of three disulfide bonds produces proinsu l i n. Further proteolytic cuts remove the C pep­ tide from proinsulin to produce mature i nsulin, com­ posed of A and B chains. The amino acid sequence of bovine i nsul i n is shown in Figure 3-24.

I

coo

ignal equenc

peptide



Pro-opiomelanocortin (POMC) gene

I

----------------------------------� DNA

i i

5' ------

Signal peptide

3'

mRNA

y-MSH

FIGURE 23-6

Proteolytic processing of the pro-opiomelanocortin

(POMC) precursor. The

i nitial gene product of the POMC gene is a long polypeptide that undergoes cleavage by a series of specific proteases to produce ACTH, /3- and y-l ipotropin, a-, /3-, and y­ MSH (melanocyte-stimulating hormone, or melanocortin), CLIP (corticotropin-like intermediary peptide), f3-endorphin, and Met­ enkephal in. The points of cleavage are paired basic residues, Arg-Lys, Lys-Arg, or Lys-Lys.

Catecholamine Hormones The water-soluble com­ pounds epinephrine (adrenaline) and norepineph­ rine (noradrenaline) are catecholamines, named for the structurally related compound catechol. They are synthesized from tyrosine. Tyrosine � L-Dopa



Dopamine �

Norepinephrine � Epinephrine

Catecholamines produced in the brain and in other neural tissues function as neurotransmitters, but epinephrine

y-Lipotl'opin

i

i

f3 -Endorphin

D

Met-enk.ephalin

and norepinephrine are also hormones, synthesized and secreted by the adrenal glands. Like the peptide hor­ mones, catecholamines are highly concentrated in secre­ tory vesicles and released by exocytosis, and they act through surface receptors to generate intracellular sec­ ond messengers. They mediate a wide variety of physio­ logical responses to acute stress (see Table 23-6) .

Eicosanoid Hormones

The eicosanoid hormones (prostaglandins, thromboxanes, and leukotrienes) are

[9os]

H o r m o n a l Regu lation a n d I ntegration of M a m m a l i a n Meta b o l i s m

derived from the 20-carbon polyunsaturated fatty acid arachidonate. Phospholipids

1

Arachidonate (20:4)

Prostaglandins

Thromboxanes

Leukotrienes

Unlike the hormones described above, they are not syn­ thesized in advance and stored; they are produced, when needed, from arachidonate enzymatically released from membrane phospholipids by phospholipase A2 . The enzymes of the pathway leading to prostaglandins and thromboxanes (see Fig. 2 1-15) are very widely dis­ tributed in mammalian tissues ; most cells can produce these hormone signals, and cells of many tissues can respond to them through specific plasma membrane receptors. The eicosanoid hormones are paracrine hor­ mones, secreted into the interstitial fluid (not primarily into the blood) and acting on nearby cells. Prostaglandins promote the contraction of smooth muscle , including that of the intestine and uterus (and can therefore be used medically to in­ duce labor) . They also mediate pain and inflammation in all tissues. Many antiinflammatory drugs act by inhibit­ ing steps in the prostaglandin synthetic pathway (see Fig. 2 1-15) . Thromboxanes regulate platelet function and therefore blood clotting. Leukotrienes LTC4 and LTD4 act through plasma membrane receptors to stimu­ late contraction of smooth muscle in the intestine, pul­ monary airways, and trachea. They are mediators of anaphylaxis, a severe, detrimental immune response. • Steroid Hormones The steroid hormones (adreno­ cortical hormones and sex hormones) are synthesized from cholesterol in several endocrine tissues. Cholesterol

1

/

j

Vitamin D Hormone Calcitriol (1 ,25-dihydroxy­ cholecalciferol) is produced from vitamin D by enzyme­ catalyzed hydroxylation in the liver and kidneys (see Fig. 1 0-20a) . Vitamin D is obtained in the diet or by photolysis of 7 -dehydrocholesterol in skin exposed to sunlight. 7-Dehydrocholesterol

1

UV light

Vitamin D3 (cholecalciferol)

1

25-Hydroxycholecalciferol

1

1 ,25- Dihydroxycholecalciferol

Calcitriol works in concert with parathyroid hor­ mone in Ca2+ homeostasis, regulating [Ca2+ ] in the blood and the balance between Ca2+ deposition and Ca2+ mobilization from bone. Acting through nuclear re­ ceptors, calcitriol activates the synthesis of an intestinal Ca2 + -binding protein essential for uptake of dietary Ca2+ . Inadequate dietary vitamin D or defects in the biosynthesis of calcitriol result in serious diseases such as rickets, in which bones are weak and malformed (see Fig. 1 0-20b). •

Testosterone

Retinoid Hormones Retinoids are potent hormones that regulate the growth, survival, and differentiation of cells via nuclear retinoid receptors. The prohormone retinol is synthesized from /3-carotene, primarily in liver (see Fig. 1 0-2 1 ) , and many tissues convert retinol to the hormone retinoic acid (RA) .

Estradiol (sex hormones)

13-Carotene

Progesterone

Cortisol (glucocorticoid)

hydroxyl groups. Many of these reactions involve cy­ tochrome P-450 enzymes (see Box 2 1-1) . The steroid hormones are of two general types. Glucocorticoids (such as cortisol) primarily affect the metabolism of car­ bohydrates; mineralocorticoids (such as aldosterone) regulate the concentrations of electrolytes in the blood. Androgens (testosterone) and estrogens (such as estra­ diol; see Fig. 1 0-1 9) are synthesized in the testes and ovaries. Their synthesis also involves cytochrome P-450 enzymes that cleave the side chain of cholesterol and in­ troduce oxygen atoms. These hormones affect sexual development, sexual behavior, and a variety of other re­ productive and nonreproductive functions. All steroid hormones act through nuclear recep­ tors to change the level of expression of specific genes (p . 456) . They can also have more rapid effects, prob­ ably mediated by receptors in the plasma membrane.

Aldosterone (mineralocorticoid)

1

They travel to their target cells through the blood­ stream, bound to carrier proteins. More than 50 corti­ costeroid hormones are produced in the adrenal cortex by reactions that remove the side chain from the D ring of cholesterol and introduce oxygen to form keto and

1

Vitamin A1 (retinol)

1

Retinoic acid

2 3 . 1 Hormones: Diverse Structures for Diverse F u n ctions

All

tissues are retinoid targets, as all cell types have at least one form of nuclear retinoid recep­ tor. In adults, the most significant targets include cornea, skin, epithelia of the lungs and trachea, and the immune system. RA regulates the synthesis of proteins essential for growth or differentiation. Excessive vita­ min A can cause birth defects, and pregnant women are advised not to use the retinoid creams that have been developed for treatment of severe acne. • Thyroid Hormones The thyroid hormones T4 (thy­ roxine) and T3 (triiodothyronine) are synthesized from the precursor protein thyroglobulin CMr 660,000) . Up to 20 Tyr residues in thyroglobulin are enzymatically iodi­ nated in the thyroid gland, then two iodotyrosine residues condense to form the precursor to thyroxine. When needed, thyroxine is released by proteolysis. Con­ densation of monoiodotyrosine with diiodothyronine produces T3, which is also an active hormone released by proteolysis. Thyroglobulin-Tyr

1

Thyroglobulin -Tyr- I (iodinated Tyr residues)

1

proteolysis

Thyroxine (T4), triiodothyronine (T3 )

The thyroid hormones act through nuclear receptors to stimulate energy-yielding metabolism, especially in liver and muscle, by increasing the expression of genes en­ coding key catabolic enzymes. Nitric Oxide (NO) Nitric oxide is a relatively stable free radical synthesized from molecular oxygen and the guanidinium nitrogen of arginine (see Fig. 22-31) in a reaction catalyzed by NO synthase.

+

Arginine + 1! NADPH

202

NO

+

----t

citrulline

+

2H20 +

signals by the endocrine tissues. For a more complete answer, we must look at the hormone-producing systems of the human body and some of their functional interrelationships. Figure 23-7 shows the anatomic location of the major endocrine glands in humans, and Figure 2 3-8 represents the "chain of command" in the hormonal sig­ naling hierarchy. The hypothalamus, a small region of the brain ( Fig. 23-9 ), is the coordination center of the endocrine system; it receives and integrates messages from the central nervous system. In response to these messages, the hypothalamus produces regulatory hor­ mones (releasing factors) that pass directly to the nearby pituitary gland, through special blood vessels and neurons that connect the two glands (Fig. 23-9b) . The pituitary gland has two functionally distinct parts. The posterior pituitary contains the axonal endings of many neurons that originate in the hypothalamus . These neurons produce the short peptide hormones oxytocin and vasopressin (Fig. 23-1 0 ), which move down the axon to the nerve endings in the pituitary, where they are stored in secretory granules to await the signal for their release. The anterior pituitary responds to hypothalamic hormones carried in the blood, producing tropic hormones, or tropins (from the Greek tropos, "turn") . These relatively long polypeptides activate the next rank of endocrine glands (Fig. 23-8) , which includes the adrenal cortex, thyroid gland, ovaries, and testes. These glands in turn secrete their specific hormones, which are carried in the bloodstream to the target tissues. For

._------- Hypothalamus ------ Pituitary

------- Thyroid

1! NADP +

This enzyme is found in many tissues and cell types: neu­ rons, macrophages, hepatocytes, myocytes of smooth muscle , endothelial cells of the blood vessels, and ep­ ithelial cells of the kidney. NO acts near its point of re­ lease, entering the target cell and activating the cytosolic enzyme guanylyl cyclase, which catalyzes the formation of the second messenger cGMP (see Fig. 12-20) .

[9o9]

�--7---

Parathyroids (behind the thyroid)

f -7:---:--- Adipose tissue

--�--:1-----:---- Adrenals �:.......Jt--...L,_-;---- Pancreas ___, &.--,--:- Kidneys Ovaries

it'-=::.._

_

Hormone Release Is Regulated by a Hierarchy of Neuronal and Hormonal Signals The changing levels of specific hormones regulate spe­ cific cellular processes, but what regulates the level of each hormone? The brief answer is that the central nervous system receives input from many internal and external sensors-signals about danger, hunger, dietary intake, blood composition and pressure, for example­ and orchestrates the production of appropriate hormonal

'----- Testes (male)

FIGURE 23-7 The major endocrine glands. The glands are shaded pink.

1 91 OJ

H o r m o n a l Regu lation a n d I ntegrati o n of M a m m a l i a n Meta b o l i s m

9 entraJfl!rl\l!

Sensory inp

Neuroendocrine origins of signals

FIGURE 23-8 The major endocrine systems and their target

nvironment

tissues.

Signals originating in the central nervous system (top) pass via a series of relays to the ultimate target tissues (bottom). In addition to the systems shown, the thymus, pineal gland, and groups of cells in the gastrointestinal tract also secrete hormones.

S)«l.etn

Hypothalamus

111

Hypothalamic hormones

( releasing factors)

First targets

l

I

Anterior pituit.ary

1

Corticotropin

Thyrotropin

(ACTH)

M, 28,000

M, 4 .500

Second targets

Adrenal corte�

Thyroid

Cortisol,

Thyroxine

hormone

M, 24,000

Ultimate targets

!

Many tissues

Luteinizing

Somatotropin

Prolactin

Oxytocin

Vasopressin

M, 20,500

(growth hormone)

M, 22,000

M, 1,007

(antidiuretic

hormon e

!

hormone! M, 1 .040

M, 2 1 ,500

Ovaries/testes

corticosterone, (T4J, triiodoaldosterone

Follicle·

stimulating

thyronine (Tal

l

Muscles, liver

l

Progesteron e, estradiOl

Blood glucose

lrvel

I

IRiet celb of

prcrr !

Adrenal medulla

Insulin,

glucagon,

Testostel'one

somatostatin

Liver, bone

Reproductive organs

example, corticotropin-releasing hormone from the hy­ pothalamus stimulates the anterior pituitary to release ACTH, which travels to the zona fasciculata of the adre­ nal cortex and triggers the release of cortisol. Cortisol, the ultimate hormone in this cascade, acts through its

Mammary glands

Smooth muscle, mammary glands

Arteriole .

kidney

!ll Liver, muscles

Epinephrine

Liver, muscles, heart

receptor in many types of target cells to alter their metabolism. In hepatocytes, one effect of cortisol is to increase the rate of gluconeogenesis. Hormonal cascades such as those responsible for the release of cortisol and epinephrine result in large

Afferent nerve signals to hypothalamus

� .::: :... :; _ ._ ::..:. _ .._ _ _ _ _



Hypothalamus Anterior pituitary Posterior pituitary

(a)

FIGURE 23-9 Neuroendocrine origins of hormone signals. (a) Location of the hy­

pothalamus and pituitary gland. (b) Details of the hypothalamus-pituitary system. Signals from connecting neurons stimu late the hypothalamus to secrete releasing factors i nto a blood vessel that carries the hormones directly to a capil lary net­ work in the anterior pituitary. In response to each hypothalamic releasing factor, the anterior pituitary releases the appropriate hormone into the general circula­ tion. Posterior pituitary hormones are synthesized i n neurons arising i n the hypo­ thalamus, transported along axons to nerve endings in the posterior pituitary, and stored there until released into the blood in response to a neuronal signal .

Anterior pituitary \\11..-- Capillary , network

Posterior pituitary

--

Release of posterior pituitary hormones (vasopressin, oxytocin) Veins carry hormones to systemic blood

(b)

Release of anterior pituitary hormones (tropins)

2 3 . 1 H o rmones: Diverse Structu res for Dive rse F u n ctions

+

I

Infection

+

NH

l

3

ys

? Tyr

I

Ile I Gln

S I S

tJ sn

Cys

I

Pro

I

ru Gly I

NHa

I

ys ? Tyr

NH2 Human oxytocin

Fear

S

I

S

Cys

I

Pro

I

rg

,,. - - �

C=O

I I

I I I

Gly

I

I

I

NH2

H ormones: Diverse Structures for Diverse

Hormones are chemical messengers secreted by certain tissues into the blood or interstitial fluid, serving to regulate the activity of other cells or tissues.

+--- Hypoglycemia

®

"' @

Hypothalamus

1 I I

f --

-?

®

"' @

Anterior pituitary

1

Adrenocorticotropic hormone (ACTH) (f.Lg)

I I

I I I I I I I I I I I

"' @

' - - - - - - - - - - Cortisol (mg)

/ 1 "-.

FIGURE 23-1 1 Cascade of hormone release following central nervous system input to the hypothalamus.

In each endocrine tissue along the pathway, a sti mulus from the level above is received, amplified, and transduced into the release of the next hormone in the cascade. The cascade is sensitive to regulation at several levels through feedback inhibition by the u ltimate hormone (in this case, cortisol). The product therefore regulates its own production, as in feedback inhibition of biosynthetic pathways with in a single cel l . •

Functions •

/

Corticotropin-releasing hormone (CRH) (ng)

Human vasopressin (antidiuretic hormone)

amplifications of the initial signal and allow exquisite fine-tuning of the output of the ultimate hormone (Fig. 23-1 1 ) . At each level in the cascade, a small signal elicits a larger response. For example, the ini­ tial electrical signal to the hypothalamus results in the release of a few nanograms of corticotropin-releasing hormone, which elicits the release of a few micrograms of corticotropin. Corticotropin acts on the adrenal cor­ tex to cause the release of milligrams of cortisol, for an overall amplification of at least a millionfold. At each level of a hormonal cascade, feedback inhi­ bition of earlier steps in the cascade is possible; an un­ necessarily elevated level of the ultimate hormone or of an intermediate hormone inhibits the release of earlier hormones in the cascade. These feedback mechanisms accomplish the same end as those that limit the output of a biosynthetic pathway (compare Fig. 23-1 1 with Fig. 6-33) : a product is synthesized (or released) only until the necessary concentration is reached.

1

Hemorrhage

I I

sn

FIGURE 23-10 Two hormones of the posterior pituitary gland. The carboxyl-terminal residue of both peptides is glyci nam ide, - N H-CH 2 -CONH2 (as noted in Fig. 2 3-2 , amidation of the car­ boxyl terminus is common in short peptide hormones). These two hor­ mones, identical in all but two residues (shaded), have very different biological effects. Oxytocin acts on the smooth muscle of the uterus and mammary gland, causing uterine contractions during labor and promoting m i l k release during lactation. Vasopressi n (also called an­ tidiuretic hormone) increases water reabsorption in the kidney and promotes the constriction of blood vessels, thereby increasing blood pressure.

S U MMARY 2 3 . 1

'

Central Pain _..... nervous system

tJ

C=O

I

l

I Phe I Gln

[911�



Radioimmunoassay and ELISA are two very sensitive techniques for detecting and quantifying hormones. Peptide, amine, and eicosanoid hormones act outside the target cell on specific receptors in the plasma membrane, altering the level of an intracellular second messenger.

[?1 2] •





Hormonal Regu lation a n d I ntegration of M a m m a l i a n Meta b o l i s m

Steroid, vitamin D, retinoid, and thyroid hormones enter target cells and alter gene expression by interacting with specific nuclear receptors. Hormonal cascades, in which catalysts activate catalysts, amplify the initial stimulus by several orders of magnitude, often in a very short time (seconds) . Nerve impulses stimulate the hypothalamus to send specific hormones to the pituitary gland, thus stimulating (or inhibiting) the release of tropic hormones. The anterior pituitary hormones in turn stimulate other endocrine glands (thyroid, adrenals, pancreas) to secrete their characteristic hormones, which in turn stimulate specific target tissues.

fats, which serve as fuel throughout the body; in the brain, cells pump ions across their plasma membranes to pro­ duce electrical signals. The liver plays a central processing and distributing role in metabolism and furnishes all other organs and tissues with an appropriate mix of nutrients via the bloodstream. The functional centrality of the liver is indicated by the common reference to all other tissues and organs as "extrahepatic" or "peripheral." We therefore begin our discussion of the division of metabolic labor by considering the transformations of carbohydrates, amino acids, and fats in the mammalian liver. This is followed by brief descriptions of the primary metabolic functions of adipose tissue, muscle, brain, and the medium that inter­ connects all others: the blood. The Liver Processes a nd Distributes N utrients

23.2 Tissue-Specific Metabolism: The Division of labor Each tissue of the human body has a specialized func­ tion, reflected in its anatomy and metabolic activity ( Fig. 23-1 2 ) . Skeletal muscle allows directed motion; adipose tissue stores and releases energy in the form of

During digestion in mammals, the three main classes of nutrients (carbohydrates, proteins, and fats) undergo enzymatic hydrolysis into their simple constituents. This breakdown is necessary because the epithelial cells lining the intestinal lumen absorb only relatively small molecules. Many of the fatty acids and monoacylglyc­ erols released by digestion of fats in the intestine are Brain

Secretes insulin and glucagon in response to changes in blood glucose concentration.

Processes fats, carbohydrates, proteins from diet; synthesizes and distributes lipids, ketone bodies, and glucose for other tissues; converts excess nitrogen to urea.

Pancreas

Transports ions to maintain membrane potential; integrates inputs from body and surroundings; sends signals to other organs.

Lymphatic system

Liver Carries lipids from intestine to liver.

Portal vein Carries nutrients from intestine to liver.

Absorbs nutrients from the diet, moves them into blood or lymphatic system.

Synthesizes, stores, and mobilizes triacylglycerols. (Brown adipose tissue: carries out thermogenesis.)

ses ATP to do mechanical work.

Skeletal muscle FIGURE 23- 1 2 Specialized metabolic functions of mammalian tissues.

23.2 Tissue-Specific Metabolism: The Division of labor

reassembled within these epithelial cells into triacyl­ glycerols (TAGs) .

[?1 3]

To meet these changing circumstances, the liver has remarkable metabolic flexibility. For example, when the

After being absorbed, most sugars and amino acids

diet is rich in protein, hepatocytes supply themselves

and some reconstituted TAGs pass from intestinal ep­

with high levels of enzymes for amino acid catabolism and

ithelial cells into blood capillaries, and travel in the

gluconeogenesis. Within hours after a shift to a high­

bloodstream to the liver; the remaining TAGs enter adi­

carbohydrate diet, the levels of these enzymes begin to

pose tissue via the lymphatic system. The portal vein is

drop and the hepatocytes increase their synthesis of en­

a direct route from the digestive organs to the liver, and

zymes essential to carbohydrate metabolism and fat syn­

liver therefore has first access to ingested nutrients. The

thesis. Liver enzymes turn over (are synthesized and

liver has two main cell types. Kupffer cells are phago­

degraded) at

cytes, important in immune function.

other tissues, such as muscle. Extrahepatic tissues also

Hepatocytes, of

5 to 1 0 times the rate of enzyme turnover in

primary interest here, transform dietary nutrients into

can adjust their metabolism to prevailing conditions, but

the fuels and precursors required by other tissues, and

none is as adaptable as the liver, and none is so central to

export them via the blood. The kinds and amounts of nu­

the organism's overall metabolism. What follows is a

trients supplied to the liver vary with several factors, in­

survey of the possible fates of sugars, amino acids, and

cluding the diet and the time between meals. The

lipids that enter the liver from the bloodstream. To help

demand of extrahepatic tissues for fuels and precursors

you recall the metabolic transformations discussed here,

varies among organs and with the level of activity and

Table

overall nutritional state of the individual.

indicates by figure number where each pathway is

TA BLE 23-2 Pathway

23-2 shows the major pathways and processes and

Pathways of Carbohydrate, Amino Add, and Fat Metabolism Illustrated In Earlier Chapters -1 � Figure reference

Citric acid cycle:

1 6-7

acetyl-GoA � 2C02

Oxidative phosphorylation:

1 9-20

ATP synthesis

Carbohydrate catabolism Glycogenolysis:

glycogen � glucose ! -phosphate � blood glucose

Hexose entry into glycolysis: Glycolysis:

fructose, mannose, galactose � glucose 6-phosphate

Lactic acidfermentation:

pyruvate � acetyl-GoA

glucose � lactate + 2ATP

Pentose phosphate pathway:

14-10 14-2

glucose � pyruvate

Pyruvate dehydrogenase reaction:

1 5-25; 1 5-26

glucose 6-phosphate � pentose phosphates + NADPH

16-2 14-3 14-21

Carbohydrate anabolism Gluconeogenesis:

citric acid cycle intermediates � glucose

Glucose-alanine cycle: Glycogen synthesis:

glucose � pyruvate � alanine � glucose

glucose 6-phosphate � glucose ! -phosphate � glycogen

14-16 18-9 15-30

Amino acid and nucleotide metabolism Amino acid degradation:

amino acids � acetyl-GoA, citric acid cycle intermediates

22-9

Amino acid synthesis Urea cycle:

18-10

NH3 � urea

Glucose-alanine cycle: Nucleotide synthesis:

18-15

alanine � glucose

amino acids � purines, pyrimidines

18-9 22-33; 22-36 22-29

Hormone and neurotransmitter synthesis

Fat catabolism {3 Oxidation offatty acids: fatty acid � acetyl-GoA

1 7-8

Oxidation of ketone bodies:

1 7-19

{3-hydroxybutyrate � acetyl-GoA � C02 via citric acid cycle

Fat anabolism Fatty acid synthesis:

acetyl-GoA � fatty acids

Triacylglycerol synthesis: Ketone body formation:

acetyl-GoA � fatty acids � triacylglycerol

acetyl-GoA � acetoacetate, {3-hydroxybutyrate

Cholesterol and cholesteryl ester synthesis: Phospholipid synthesis:

acetyl-GoA � cholesterol � cholesteryl esters

fatty acids � phospholipids

2 1-6 2 1-18; 2 1-19 1 7-18 21-33 to 2 1-37 2 1-17; 2 1-23 to 2 1-28

[914]

H o r m o n a l Regulation a n d I n tegration of M a m m a l i a n Meta b o l i s m

presented in detail. Here, we provide surrunaries of the

needs of the organism. By the action of various alloster­

pathways, referring to the numbered pathways and reac­

ically regulated enzymes , and through hormonal regula­

tions in Figures 23-13 to 23-15.

tion of enzyme synthesis and activity, the liver directs the flow of glucose into one or more of these pathways.

Sugars

The

glucose

transporter

of

CD

hepatocytes

Glucose 6-phosphate is dephosphorylated by

(GLUT2) is so effective that the concentration of glu­

glucose 6-phosphatase to yield free glucose

cose in a hepatocyte is essentially the same as that in the

Fig. 1 5-28) , which is exported to replenish blood glu­

(see

blood. Glucose entering hepatocytes is phosphorylated

cose. Export is the predominant pathway when glucose

by hexokinase IV (glucokinase) to yield glucose 6-phos­

6-phosphate is in limited supply, because the blood

phate . Glucokinase has a much higher K111 for glucose

glucose concentration must be kept sufficiently high

( 1 0 mM) than do the hexokinase isozymes in other cells

( 4 mM) to provide adequate energy for the brain and

(p. 584) and, unlike these other isozymes, it is not inhib­

other tissues.

ited by its product, glucose 6-phosphate. The presence

needed to form blood glucose is converted to liver glyco­

(g)

Glucose 6-phosphate not irrunediately

of glucokinase allows hepatocytes to continue phospho­

gen, or has one of several other fates. Following glycoly­

rylating glucose when the glucose concentration rises

sis and the pyruvate dehydrogenase reaction,

well above levels that would overwhelm other hexoki­

acetyl-GoA so formed can be oxidized for energy produc­

@

the

nases. The high K111 of glucokinase also ensures that the

tion by the citric acid cycle, with ensuing electron trans­

phosphorylation of glucose in hepatocytes is minimal

fer

when the glucose concentration is low, preventing the

(Normally, however, fatty acids are the preferred fuel for

and

oxidative

phosphorylation

yielding

ATP.

@ Acetyl-GoA can

liver from consuming glucose as fuel via glycolysis. This

energy production in hepatocytes.)

spares glucose for other tissues. Fructose, galactose,

also serve as the precursor of fatty acids, which are in­

and mannose, all absorbed from the small intestine , are

corporated into TAGs and phospholipids, and of choles­

also converted to glucose 6-phosphate by enzymatic

terol. Much of the lipid synthesized in the liver is

pathways examined in Chapter 1 4 . Glucose 6-phosphate

transported to other tissues by blood lipoproteins.

is at the crossroads of carbohydrate metabolism in the

ternatively, glucose 6-phosphate can enter the pentose

liver. It may take any of several major metabolic routes

phosphate

(Fig. 23-13 ) , depending on the current metabolic

(NADPH) , needed for the biosynthesis of fatty acids and

pathway,

@ Al­

yielding both reducing power

cholesterol, and D-ribose 5-phosphate, a precursor for nucleotide biosynthesis. NADPH is also an essential co­ Liver glycogen

® Glucose 6phosphate

factor in the detoxification and elimination of many

Hepatocyte

---•••

Blood

drugs and other xenobiotics metabolized in the liver.

_.,.,.

_

glucose

Amino Acids Amino acids that enter the liver follow s v ral important m tabolic rout s (Fig. 23-1 4 ). CD Tl t ey a re pre ·urs r Jor protein synthesis, a process ·

discussed in Chapter 27. The liver constantly renews its

glycolysiB

NADPH Triacylglyoerol , phospholipids

®

l phosphat J t. t � · let �

t ��'.:; Chol"""''

Pyruvate

ucleotide

Ribose 5-

Acetyl- oA

@

ADP + P;

02

ATP

H20

oxidative phosphorylation

own proteins, which have a relatively high turnover rate (average half-life of hours to days) , and is also the site of biosynthesis of most plasma proteins .

(2) Alternatively,

amino acids pass in the bloodstream to other organs , to be used in the synthesis of tissue proteins .

@

Other

amino acids are precursors in the biosynthesis of nu­ cleotides, hormones, and other nitrogenous compounds in the liver and other tissues.

@ Amino acids not needed as biosynthetic precur­

sors are transaminated or deaminated and degraded to yield pyruvate and citric acid cycle intermediates, with various fates;

@ the arrunonia released is converted to

the excretory product urea.

®

Pyruvate can be con­

verted to glucose and glycogen via gluconeogenesis, or

@ it can be converted to acetyl-GoA, which has several possible fates: (j) oxidation via the citric acid cycle and @ oxidative phosphorylation to produce ATP, or CID con­

@ Citric acid cycle inter­

FIGURE 23-1 3 Metabolic pathways for glucose 6-phosphate in the

version to lipids for storage.

l iver.

mediates can be siphoned off into glucose synthesis by

Here and in Figures 23-1 4 and 2 3-1 5, anabolic pathways are generally shown leading upward, catabolic pathways leading down­ ward, and distribution to other organs horizontal ly. The numbered processes in each figure are described in the text.

gluconeogenesis. The liver also metabolizes amino acids that arrive in­ termittently from other tissues. The blood is adequately

2 3 . 2 Tissu e-Specific Meta b o l i s m : The Division of Labor

[915]

Hepatocyte Nucl otides, hormones, porphyrins

t

®

Glycogen in m uscle

@ � NH3

""'--f+-- GlucOse

t..,

t ro�cl ..1-u

@

_ _ _ _ _ _

gluconeogenesis

Pyruvate

Lipids

• '--

� Urea e

@

Alanine

Fatty acids

®

L Acet;l-CoA

Glycogen

G)

ADP

P· ATP

�?--� ® · ( �

C02

02

H20

oxidative phoS'phoryl11ti

o:;,

FIGURE 23-14 Metabolism of amino acids in the l iver.

supplied with glucose just after the digestion and ab­ sorption of dietary carbohydrate or, between meals, by

Liver lipids

®l

the conversion of liver glycogen to blood glucose. During the interval between meals, especially if prolonged, some muscle protein is degraded to amino acids. These amino acids donate their amino groups (by transamination) to

@

®

i s transported t o the liver and deaminated.

Hepatocytes convert the resulting pyruvate to blood glu­ cose (via gluconeogenesis for excretion

@ . One benefit of this glucose-alanine cy­

blood glucose between meals. The amino acid deficit in­ curred in muscles is made up after the next meal by in­ coming dietary amino acids.

Lipids

The fatty acid components of lipids entering he­

(Fig. 23-15 ) .

CD Some are converted to liver lipids. ® Under most cir­ cumstances, fatty acids are the primary oxidative fuel in the

liver. Free fatty acids may be activated and oxidized to yield acetyl-GoA and NADH.

® The

®

P n.xidll:tion

Steroid hormones

t

NADH

Cholesterol

Ketone • @--I!H.,. bodies ;;.. ®'- Acety l -CoA---;;;; in blood

®I � tr= l@ ·-

ADP

patocytes also have several different fates

Free fatty acids in blood

Bile salts

@) , and the ammonia to urea

cle (see Fig. 1 8-9) is the smoothing out of fluctuations in

Plasma lipoproteins

®

Fatty acids

pyruvate, the product of glycolysis, to yield alanine , which

Hepatocyte

C02

-t

Pi

ATP

02 H20 oxidative phosphorylation

acetyl-GoA is further oxi­

dized via the citric acid cycle, and ® oxidations in the cycle

drive the synthesis of ATP by oxidative phosphorylation.

FIGURE 23-1 5 Metabolism of fatty acids in the liver..

, 916 1

H o r m o n a l R e g u l ation a n d I nteg ration of M a m m a l i a n Meta b o l i s m

@ Excess acetyl-GoA, not required by the liver, is con­ verted to acetoacetate and ,B-hydroxybutyrate; these ke­ tone bodies circulate in the blood to other tissues, to be used as fuel for the citric acid cycle. Ketone bodies may be regarded as a transport form of acetyl groups. They can supply a significant fraction of the energy in some ex­ trahepatic tissues-up to one-third in the heart, and as much as 60% to 70% in the brain during prolonged fast­ ing. @ Some of the acetyl-GoA derived from fatty acids (and from glucose) is used for the biosynthesis of choles­ terol, which is required for membrane synthesis. Choles­ terol is also the precursor of all steroid hormones and of the bile salts, which are essential for the digestion and absorption of lipids. The other two metabolic fates of lipids involve spe­ cialized mechanisms for the transport of insoluble lipids in blood. (j) Fatty acids are converted to the phospho­ lipids and TAGs of plasma lipoproteins, which carry lipids to adipose tissue for storage as TAGs. ® Some free fatty acids are bound to serum albumin and carried to the heart and skeletal muscles, which take up and oxidize free fatty acids as a major fuel. Serum albumin is the most abundant plasma protein; one molecule can carry up to 10 molecules of free fatty acid. The liver thus serves as the body's distribution center, exporting nutrients in the correct proportions to other organs, smoothing out fluctuations in metabolism caused by intermittent food intake, and processing excess amino groups into urea and other products to be disposed of by the kidneys. Certain nutrients are stored in the liver, in­ cluding Fe ions and vitamin A. The liver also detoxifies foreign organic compounds, such as drugs, food additives, preservatives, and other possibly harmful agents with no food value. Detoxification often involves the cytochrome P-450-dependent hydroxylation of relatively insoluble organic compounds, making them sufficiently soluble for further breakdown and excretion (see Box 2 1-1 ) . (a)

Adipose Tissues Store and Supply Fatty Acids

There are two distinct types of adipose tissue, white and brown, with quite distinct roles, and we focus first on the more abundant of the two . White adipose tissue (WAT) ( Fig. 2:3 -16a) is amorphous and widely distrib­ uted in the body: under the skin, around the deep blood vessels , and in the abdominal cavity. The adipocytes of WAT are large (diameter 30 to 70 fLm) , spherical cells, completely filled with a single large lipid (TAG) droplet that constitutes about 65% of the cell mass and squeezes the mitochondria and nucleus into a thin layer against the plasma membrane (Fig. 23-1 6b) . In humans, WAT typically makes up about 1 5% of the mass of a healthy young adult. The adipocytes are metabolically very active, responding quickly to hormonal stimuli in a meta­ bolic interplay with the liver, skeletal muscles, and heart. Like other cell types, adipocytes have an active gly­ colytic metabolism, oxidize pyruvate and fatty acids via the citric acid cycle, and carry out oxidative phosphoryla­ tion. During periods of high carbohydrate intake , adipose tissue can convert glucose (via pyruvate and acetyl-GoA) to fatty acids, convert the fatty acids to TAGs, and store the TAGs as large fat globules-although, in humans, much of the fatty acid synthesis occurs in hepatocytes . Adipocytes store TAGs arriving from the liver (carried in the blood as VLDLs; see Fig. 2 1-40a) and from the intes­ tinal tract (carried in chylomicrons), particularly after meals rich in fat. When the demand for fuel rises, lipases in adipocytes hydrolyze stored TAGs to release free fatty acids, which can travel in the bloodstream to skeletal muscle and the heart. The release of fatty acids from adipocytes is greatly accelerated by epinephrine, which stimulates the cAMP-dependent phosphorylation of per­ ilipin and thus gives the hormone-sensitive lipase access to TAGs in the lipid droplet (see Fig. 1 7-3) . Hormone­ sensitive lipase is also stimulated by phosphorylation,

(b)

White adipocyte

(c) Brown adipocyte

Nucleus

FIGURE 2 3 - 1 6 Adipocytes of white and brown adipose tissue. (a)

Colorized scanning electron micrograph of human adipocytes i n white ad i pose tissue (WAT). I n fat tissues, cap i l laries and col l agen fibers form a supporting network around spherical adipocytes. Almost the entire vol ume of each of these metabolica l ly active cel ls is taken up by a fat droplet. (b) A typical adipocyte from WAT and (c) an adipocyte

from brown adipose tissue (BAT). In BAT cells, mitochondria are much more prominent, the nucleus is near the center of the cell, and mu lti­ ple fat droplets are present. White adipocytes are larger and conta i n a si ngle huge l ipid droplet, wh ich squeezes the mitochondria and nu­ cleus against the plasma membrane.

2 3 . 2 Tiss u e-Specific Meta b o l i s m : The Division of Labor

[91 7]

but this is not the main cause of increased lipolysis . Insulin counterbalances this effect o f epinephrine, decreasing the activity of the lipase . The breakdown and synthesis of TAGs in adipose tissue constitute a substrate cycle; up to 70% of the fatty acids released by hormone-sensitive lipase are reesterified in adipocytes, re-forming TAGs. Recall from Chapter 1 5 that such substrate cycles allow fine regula­ tion of the rate and direction of flow of intermediates through a bidirectional pathway. In adipose tissue, glyc­ erol liberated by hormone-sensitive lipase cannot be reused in the synthesis of TAGs, because adipocytes lack glycerol kinase. Instead, the glycerol phosphate required for TAG synthesis is made from pyruvate by glyceroneogenesis, involving the cytosolic PEP car­ boxykinase (see Fig. 2 1-22) . In addition to its central function as a fuel depot, adipose tissue plays an important role as an endocrine organ, producing and releasing hormones that signal the state of energy reserves and coordinate metabolism of fats and carbohydrates throughout the body. We return to this function later in the chapter as we discuss the hormonal regulation of body mass. Brown Adipose Tissue Is Thermogenic In small vertebrates and hibernating animals, a signifi­ cant proportion of the adipose tissue is brown adipose tissue (BAT), distinguished from WAT by its smaller (diameter 20 to 40 JLm) , differently shaped (polygonal, not round) adipocytes (Fig. 23- 1 6c) . Like white adipocytes, brown adipocytes store triacylglycerols, but in several smaller lipid droplets per cell rather than as a single central droplet. BAT cells have more mitochondria and a richer supply of capillaries than WAT cells, and it is the cytochromes of mitochondria and the hemoglobin in capillaries that give BAT its characteristic brown color. A unique feature of brown adipocytes is their strong expression of the gene UNCI , which encodes ther­ mogenin, the mitochondrial uncoupling protein (see Fig. 1 9-34) . Thermogenin activity is responsible for the principal function of BAT: thermogenesis. In brown adipocytes, fatty acids stored in lipid droplets are released, enter mitochondria, and un­ dergo complete conversion to C02 via {3 oxidation and the citric acid cycle. The reduced FADH 2 and NADH so generated pass their electrons through the respira­ tory chain to molecular oxygen. In WAT, protons pumped out of the mitochondria during electron transfer reenter the matrix through ATP synthase, with the energy of electron transfer conserved in ATP syn­ thesis. In BAT, thermogenin provides an alternative route for protons to reenter the matrix that bypasses ATP synthase; the energy of the proton gradient is thus dissipated as heat, which can maintain the body (especially the nervous system and viscera) at its op­ timal temperature when the ambient temperature is relatively low.

FIGURE 23-1 7 Distribution of brown adipose tissue in a newborn infant.

At birth, human infants have brown fat distributed as shown here, to protect the major blood vessels and the i nternal organs. Th is brown fat recedes over time, so that an adult has no major reserves of brown adipose.

In the human fetus, differentiation of fibroblast "preadipocytes" into BAT begins at the twentieth week of gestation, and at the time of birth BAT represents 1 % of total body weight. The brown fat deposits are located where the heat generated by thermogenesis can ensure that vital tissues-blood vessels to the head, major ab­ dominal blood vessels, and the viscera, including the pancreas, adrenal glands, and kidneys-are not chilled as the newborn enters a world of lower ambient temper­ ature (Fig. 23-1 7 ). At birth, WAT development begins and BAT begins to disappear. By adulthood humans have no discrete deposits of BAT, although brown adipocytes remain scattered throughout the WAT, making up about 1 % of all adipocytes. Adults also have preadipocytes that can be induced to differentiate into BAT during adapta­ tion to chronic cold exposure. Humans with pheochro­ mocytoma (tumors of the adrenal gland) overproduce epinephrine and norepinephrine, and one effect is dif­ ferentiation of preadipocytes into discrete regions of BAT, localized roughly as in newborns. In the induced adaptation to chronic cold, and in the normal differen­ tiation of WAT and BAT, the nuclear transcription factor PPARy (described later in the chapter) plays a central role.

[?1a]

H o r m o n a l Regulation a n d I ntegration of M a m m a l i a n Meta bolism

bodies. The glucose is phosphorylated, then degraded

Muscles Use AlP for Mechanical Work Metabolism in the cells of skeletal muscle-myocytes­ is specialized to generate ATP as the irrunediate source of energy for contraction. Moreover, skeletal muscle is adapted to do its mechanical work in an intermittent fash­ ion, on demand. Sometimes skeletal muscles must work at their maximum capacity for a short time, as in a 100 m sprint; at other times more prolonged work is required, as in running a marathon or in extended physical labor. There are two general classes of muscle tissue, which differ in physiological role and fuel utilization.

Slow-twitch muscle, also called red muscle, provides relatively low tension but is highly resistant to fatigue. It produces ATP by the relatively slow but steady process of oxidative phosphorylation. Red muscle is very rich in mitochondria and is served by very dense networks of blood vessels, which bring the oxygen essential to ATP production.

Fast-twitch muscle, or white muscle, has

fewer mitochondria than red muscle and is less well sup­ plied with blood vessels, but it can develop greater ten­ sion, and do so faster. White muscle is quicker to fatigue because when active, it uses ATP faster than it can re­ place it. There is a genetic component to the proportion of red and white muscle in any individual; with training, the endurance of fast-twitch muscle can be improved. Skeletal muscle can use free fatty acids, ketone bod­ ies, or glucose as fuel, depending on the degree of mus­ cular activity

( Fig. 23- 1 8 ). In resting muscle, the

primary fuels are free fatty acids from adipose tissue and ketone bodies from the liver. These are oxidized and degraded to yield acetyl-GoA, which enters the citric acid cycle for oxidation to C02. The ensuing transfer of electrons to 02 provides the energy for ATP synthesis by

by glycolysis to pyruvate, which is converted to acetyl­ GoA and oxidized via the citric acid cycle and oxidative phosphorylation. In maximally active fast-twitch muscles, the de­ mand for ATP is so great that the blood flow cannot pro­ vide 02 and fuels fast enough to supply sufficient ATP by aerobic respiration alone.

three ATP, because phosphorolysis of glycogen pro­ duces glucose 6-phosphate (via glucose 1 -phosphate) , sparing the ATP normally consumed in the hexokinase reaction. Lactic acid fermentation thus responds more quickly than oxidative phosphorylation to an increased need for ATP, supplementing basal ATP production by aerobic oxidation of other fuels via the citric acid cycle and respiratory chain. The use of blood glucose and muscle glycogen as fuels for muscular activity is greatly enhanced by the secretion of epinephrine, which stimu­ lates both the release of glucose from liver glycogen and the breakdown of glycogen in muscle tissue. The relatively small amount of glycogen (about 1% of the total weight of skeletal muscle) limits the amount of glycolytic energy available during all-out exertion. Moreover, the accumulation of lactate and consequent decrease in pH in maximally active muscles reduces their efficiency. Skeletal muscle , however, contains another source of ATP, phosphocreatine ( 1 0 to 30 mM) , which can rapidly regenerate ATP from ADP by the cre­ atine kinase reaction: o-

1

-o-P=O

uses blood glucose in addition to fatty acids and ketone

N-H

I I

+

C=NH2 + ADP

1

CHa-N

I

Lactate

during recovery

NH2 ATP +

I

+

C-NH2

I

CHa-N

I

CH2

coo-

coo-

Phosphocreatine

Fatty acids,

during activity

CH2

I

Muscle glycogen

conditions,

mentation (p. 530) . Each glucose unit degraded yields

oxidative phosphorylation. Moderately active muscle

Bursts of heavy activity

Under these

stored muscle glycogen is broken down to lactate by fer­

I

creatine

During periods of active contraction and glycolysis, this

ketone bodies , blood lucose

reaction proceeds predominantly in the direction of

g

ATP synthesis; during recovery from exertion, the same enzyme resynthesizes phosphocreatine from creatine C re atine

and ATP. Given the relatively high levels of ATP and phosphocreatine in muscle, these compounds can be detected in intact muscle, in real time, by NMR spec­ troscopy

(Fig. 23-19).

After a period of intense muscular activity, the in­ dividual continues breathing heavily for some time, Muscle contraction

using much of the extra 02 for oxidative phosphoryla­ tion in the liver. The ATP produced is used for gluco­

FIGURE 23-18 Energy sources for muscle contraction. Different fuels

neogenesis (in the liver) from lactate that has been

are used for ATP synthesis during bursts of heavy activity and during l ight activity or rest. Phosphocreatine can rapidly supply ATP.

thus formed returns to the muscles to replenish their

carried in the blood from the muscles. The glucose

2 3 . 2 Tissue-S pecific Metabo l i s m : The D i v i s i o n of Labor

[9 1 9]

Muscle: ATP produced by glycolysis for rapid contraction. · -.

0

-5

-10

-15

-2 0

Lactate

Chemical shift (parts per million) (identity of the compound) FIGURE 2 3 - 1 9

.,..,t-{

_ _ _ Glycogen

ATP

Phosphocreatine buffers ATP concentration during

exercise. A "stack plot" of magnetic resonance spectra (of 3 1 P) showing

inorgan ic phosphate (P;), phosphocreatine (PCr), and ATP (each of its three phosphates giving a signal). The series of plots represents the pas­ sage of time, from a period of rest to one of exercise, and then of re­ covery. Note that the ATP signal hardly changes during exercise, kept high by continued respiration and by the reservoi r of phosphocreatine, which d i m i nishes during exercise. During recovery, when ATP produc­ tion by catabolism is greater than ATP uti lization by the (now resting) muscle, the phosphocreatine reservoir is refi lled.

Lactate

glycogen, completing the Cori cycle (Fig. 23-20 ; see also Box 1 5-4) . Actively contracting skeletal muscle generates heat as a byproduct of imperfect coupling of the chemical en­ ergy of ATP with the mechanical work of contraction. This heat production can be put to good use when ambient temperature is low: skeletal muscle carries out shivering thermogenesis, rapidly repeated muscle contraction that produces heat but little motion, helping to maintain the body at its preferred temperature of 37 °C . Heart muscle differs from skeletal muscle in that .,. it is continuously active in a regular rhythm of contraction and relaxation, and it has a completely aerobic metabolism at all times. Mitochondria are much more abundant in heart muscle than in skeletal muscle, making up almost half the volume of the cells (Fig. 28-2 1 ) . The heart uses mainly free fatty acids, but also some glucose and ketone bodies taken up from the blood, as sources of energy; these fuels are oxidized via the citric acid cycle and oxidative phosphorylation to generate ATP. Like skeletal muscle, heart muscle does not store lipids or glycogen in large amounts. It does have small amounts of reserve energy in the form of phosphocreatine, enough for a few seconds of contrac­ tion. Because the heart is normally aerobic and obtains its energy from oxidative phosphorylation, the failure of

..

Electron micrograph of heart muscle. In the profuse m itochondria of heart tissue, pyruvate (from glucose), fatty acids, and ketone bodies are oxid ized to drive ATP synthesis. Th is steady aerobic metabolism allows the human heart to pump blood at a rate of nearly 6 L/m in, or about 350 L/hr-or 200 X 1 06 L over 70 years. FIGURE 23-21

Blood glucose

Blood

(

ATP

I

., Glucose

Liver: ATP used i:tr synthesis of glucose (gluconeogenesis) during recovery.

FIGURE 23-20 Metabolic cooperation between skeletal muscle and the liver: the Cori cycle. Extremely active muscles use glycogen as

energy source, generati ng lactate via glycolysis. During recovery, some of this lactate is transported to the l iver and converted to glucose via gl uconeogenesis. This gl ucose is released to the blood and returned to the muscles to replenish their glycogen stores. The overal l pathway (glucose � lactate � gl ucose) constitutes the Cori cycle.

[92o]

Horm ona l Regulation a n d I n te g ration of M a m m a l i a n Meta b o l i s m

02 to reach a portion of the heart muscle when the blood vessels are blocked by lipid deposits (atherosclerosis) or blood clots (coronary thrombosis) can cause that region of the heart muscle to die. This is what happens in myocardial infarction, more commonly known as a heart attack. •

(a)

The Brain Uses Energy for Transmission of Electrical I mpulses The metabolism of the brain is remarkable in several respects. The neurons of the adult mammalian brain normally use only glucose as fuel (Fig. 23-2 2 ). (Astro­ cytes, the other major cell type in the brain, can oxidize fatty acids.) The brain has a very active respiratory me­ tabolism (Fig. 23-23 ) ; it uses 02 at a fairly constant rate, accounting for almost 20% of the total 02 con­ sumed by the body at rest. Because the brain contains very little glycogen, it is constantly dependent on in­ coming glucose in the blood. Should blood glucose fall significantly below a critical level for even a short time, severe and sometimes irreversible changes in brain function may result. Although the neurons of the brain cannot directly use free fatty acids or lipids from the blood as fuels , they can, when necessary, use 13-hydro:xybutyrate (a ketone body) , formed from fatty acids in the liver. The capacity of the brain to oxidize 13-hydro:xybutyrate via acetyl-GoA becomes important during prolonged fasting or starva­ tion, after liver glycogen has been depleted, because it allows the brain to use body fat as an energy source. This spares muscle proteins-until they become the brain's ultimate source of glucose (via gluconeogenesis in the liver) during severe starvation. Neurons oxidize glucose by glycolysis and the citric acid cycle, and the flow of electrons from these oxidations through the respiratory chain provides almost all the ATP Starvation

Ket()ne bodies

Normal diet Olucose

(b)

mg/100 g /min FIGURE 23-23 Glucose metabolism in the brain. The technique of positron emission tomography (PET) scanning shows metabolic activ­ ity in specific regions of the brain. PET scans al low visual ization of isotopically labeled glucose in precisely local ized regions of the brain of a l iving person, i n real time. A positron-emitting glucose analog (2-[ 1 6 F]-fluoro-2-deoxy-o-glucose) is i njected into the bloodstream; a few seconds later, a PET scan shows how much of the glucose has been taken up by each region of the brain-a measure of metabolic ac­ tivity. Shown here are PET scans of front-to-back cross sections of the brain at three levels, from the top (at the left) downward (to the right). The scans compare glucose metabolism when the experimental subject (a) is rested and (b) has been deprived of sleep for 48 hours.

used by these cells. Energy is required to create and maintain an electrical potential across the neuronal plasma membrane. The membrane contains an electro­ genic ATP-driven antiporter, the Na+K+ ATPase, which simultaneously pumps 2 K+ ions into and 3 Na + ions out of the neuron (see Fig. 1 1-37) . The resulting transmem­ brane potential changes transiently as an electrical signal (action potential) sweeps from one end of a neuron to the other (see Fig. 12-25) . Action potentials are the chief mechanism of information transfer in the nervous system, so depletion of ATP in neurons would have disastrous ef­ fects on all activities coordinated by neuronal signaling. Blood Carries Oxygen, Metabolites, a nd Hormones

Electrogenic transport by Na+K+ ATPase FIGURE 23-22 The fuels that supply ATP in the brain. The energy source used by the brain varies with nutritional state. The ketone body used during starvation is J3-hydroxybutyrate. Electrogenic transport by the Na + K+ ATPase maintains the transmembrane potential essential to i nformation transfer among neurons.

Blood mediates the metabolic interactions among all tis­ sues. It transports nutrients from the small intestine to the liver, and from the liver and adipose tissue to other organs; it also transports waste products from the extra­ hepatic tissues to the liver for processing and to the kid­ neys for excretion. Oxygen moves in the bloodstream from the lungs to the tissues, and C02 generated by tis­ sue respiration returns via the bloodstream to the lungs for exhalation. Blood also carries hormonal signals from one tissue to another. In its role as signal carrier, the cir­ culatory system resembles the nervous system; both regulate and integrate the activities of different organs.

2 3 . 2 Tissue-S pecific Meta b o l i s m : The Division of Labor

Cell

Blood plasma

Inorganic components ( 10%) NaCl, bicarbonate, phosphate, CaC12, MgC12, KCl, Na2S04

Organic metabolites and waste products (20%) glucose, amino acids, lactate, pyruvate, ketone bodies, citrate, urea, uric acid

Plasma proteins (70%) Major plasma proteins: serum albumin, very-low-density lipoproteins (VLDL), low-density lipoproteins (LDL),

high-density lipoproteins (HDL), immunoglobulins (hundreds of kinds), fibrinogen, prothrombin, many specialized transport proteins such as transferrin

FIGURE 23-24 The composition of blood. Whole blood can be sepa­ rated into blood plasma and cel ls by centrifugation. About 1 0% of blood plasma is sol utes, of which about 1 0% consists of inorganic salts, 20% small organic molecules, and 70% plasma proteins. The major d issolved components are l isted. Blood contains many other substances, often in trace amounts. These incl ude other metabol ites, enzymes, hormones, vitam ins, trace elements, and b i le pigments. Measurements of the concentrations of components i n blood plasma are i mportant in the diagnosis and treatment of many diseases.

The average adult hwnan has 5 to 6 L of blood. Almost half of this volume is occupied by three types of blood cells (Fig. 23-24) : erythrocytes (red cells) , filled with hemo­ globin and specialized for carrying 02 and C02 ; much smaller nwnbers of leukocytes (white cells) of several types (including lymphocytes, also found in lymphatic tissue) , which are central to the immune system that de­ fends against infections; and platelets, which help to me­ diate blood clotting. The liquid portion is the blood plasma, which is 90% water and 1 0% solutes. Dissolved or suspended in the plasma is a large variety of proteins, lipoproteins, nutrients, metabolites, waste products, inor­ ganic ions, and hormones. More than 70% of the plasma solids are plasma proteins, primarily immunoglobulins (circulating antibodies) , serwn albumin, apolipoproteins involved in the transport of lipids, transferrin (for iron transport) , and blood-clotting proteins such as fibrinogen and prothrombin. The ions and low molecular weight solutes in blood plasma are not fixed components but are in constant flux between blood and various tissues. Dietary uptake of the

L921J

inorganic ions that are the predominant electrolytes of blood and cytosol (Na + , K + , and Ca2+ ) is, in general, counterbalanced by their excretion in the urine. For many blood components, something near a dynamic steady state is achieved: the concentration of the component changes little, although a continuous flux occurs between the digestive tract, blood, and urine. The plasma levels of Na + , K + , and Ca2+ remain close to 140, 5, and 2.5 mM, re­ spectively, with little change in response to dietary intake. Any significant departure from these values can result in serious illness or death. The kidneys play an especially im­ portant role in maintaining ion balance by selectively fil­ tering waste products and excess ions out of the blood while preventing the loss of essential nutrients and ions. The human erythrocyte loses its nucleus and mito­ chondria during differentiation. It therefore relies on glycolysis alone for its supply of ATP. The lactate pro­ duced by glycolysis returns to the liver, where gluconeo­ genesis converts it to glucose, to be stored as glycogen or recirculated to the peripheral tissues. The erythro­ cyte has constant access to glucose in the bloodstream. The concentration of glucose in plasma is subject to tight regulation. We have noted the constant requirement of the brain for glucose and the role of the liver in maintaining blood glucose in the normal range, 60 to 90 mg/100 mL of whole blood ( -4.5 mM) . (Because ery­ throcytes make up a significant fraction of blood volwne, their removal by centrifugation leaves a supernatant fluid, the plasma, containing the "blood glucose" in a smaller volume. To convert blood glucose to plasma glucose con­ centration, multiply the blood glucose level by 1 . 1 4 . ) When blood glucose i n a hwnan drops t o 4 0 mg/100 mL (the hypoglycemic condition) , the person experiences discomfort and mental confusion (Fig. 23-25 ) ; further FIGURE 23-25 Physiological effects of low blood glucose in humans. Blood gl ucose levels

Blood gluco e

of 40 mg/1 00 ml and below constitute severe hypoglycem ia.

(mg/100 mLl

100 90

-

-

o

-

70

-

60 50

-

}

Normal range Subtle neurological signs; hunger Release of glucagon, epinephrine, cortisol Sweating, trembling

Lethargy Convulsions, coma

Permanent brain damage (if prolonged) Death

[?22]

Hormonal Regulation and I ntegration of Mammalian Metabolism

reductions lead to coma, convulsions, and, in extreme hypoglycemia, death. Maintaining the normal concentra­ tion of glucose in blood is therefore a very high priority of the organism, and a variety of regulatory mechanisms have evolved to achieve that end. Among the most impor­ tant regulators of blood glucose are the hormones insulin, glucagon, and epinephrine, as discussed in Section 23.3. •

S U MMARY 2 3 . 2

Tissue-S pecific Meta bolism:





mal metabolic states-well-fed, fasted, and starving­ and look at the metabolic consequences of diabetes mellitus, a disorder that results from derangements in the signaling pathways that control glucose metabolism.

Amino acids are used to synthesize liver and plasma proteins, or their carbon skeletons are converted

I nsulin Counters H ig h Blood Glucose

The liver converts fatty acids to triacylglycerols, phospholipids, or cholesterol and its esters, for transport as plasma lipoproteins to adipose tissue for storage. Fatty acids can also be oxidized to yield ATP or to form ketone bodies, which are circulated to other tissues. White adipose tissue stores large reserves of triacylglycerols, and releases them into the blood in response to epinephrine or glucagon. Brown adipose tissue is specialized for thermogenesis, the result of fatty acid oxidation in uncoupled mitochondria.



Skeletal muscle is specialized to produce and use ATP for mechanical work. During strenuous muscular activity, glycogen is the ultimate fuel, supplying ATP through lactic acid fermentation. During recovery, the lactate is reconverted (through gluconeogenesis) to glycogen and glucose in the liver. Phosphocreatine is an immediate source of ATP during active contraction.

• •

23.3 Hormonal Regulation of Fuel Metabolism

undergo oxidation by glycolysis, the citric acid cycle, and respiratory chain to yield ATP, or enter the pentose phosphate pathway to yield pentoses and NADPH.

Glucose 6-phosphate is the key intermediate in carbohydrate metabolism. It may be polymerized into glycogen, dephosphorylated to blood glucose,

to glucose and glycogen by gluconeogenesis; the ammonia formed by deamination is converted to urea. •

The blood transfers nutrients, waste products , and hormonal signals among tissues and organs .

or converted to fatty acids via acetyl-CoA. It may

In mammals there is a division of metabolic labor among specialized tissues and organs. The liver is the central distributing and processing organ for nutrients. Sugars and amino acids produced in digestion cross the intestinal epithelium and enter the blood, which carries them to the liver. Some triacylglycerols derived from ingested lipids also make their way to the liver, where the constituent fatty acids are used in a variety of processes.





The minute-by-minute adjustments that keep the blood glucose level near 4.5 mM involve the combined actions of insulin, glucagon, epinephrine, and cortisol on meta­ bolic processes in many body tissues, but especially in liver, muscle, and adipose tissue. Insulin signals these tissues that blood glucose is higher than necessary; as a result, cells take up excess glucose from the blood and convert it to glycogen and triacylglycerols for storage. Glucagon signals that blood glucose is too low, and tis­ sues respond by producing glucose through glycogen breakdown and (in the liver) gluconeogenesis and by oxidizing fats to reduce the use of glucose. Epinephrine is released into the blood to prepare the muscles, lungs, and heart for a burst of activity. Cortisol mediates the body's response to longer-term stresses. We discuss these hormonal regulations in the context of three nor­

The Division of la bor •

uses most of its ATP for the active transport of Na +

and K + to maintain the electrical potential across the neuronal membrane.

Heart muscle obtains nearly all its ATP from oxidative phosphorylation. The neurons of the brain use only glucose and f3-hydroxybutyrate as fuels, the latter being important during fasting or starvation. The brain

Acting through plasma membrane receptors (see Figs 1 2-15, 1 2-16), insulin stimulates glucose uptake by muscle and adipose tissue (Table 23-3) , where the glucose is converted to glucose 6-phosphate. In the liver, insulin also activates glycogen synthase and inacti­ vates glycogen phosphorylase, so that much of the glu­ cose 6-phosphate is channeled into glycogen. Insulin also stimulates the storage of excess fuel as fat in adipose tissue (Fig. 23-26). In the liver, insulin activates both the oxidation of glucose 6-phosphate to pyruvate via glycolysis and the oxidation of pyruvate to acetyl-CoA. If not oxidized further for energy produc­ tion, this acetyl-CoA is used for fatty acid synthesis, and the fatty acids are exported from the liver as the TAGs of plasma lipoproteins (VLDLs) to adipose tissue . Insulin stimulates the synthesis of TAGs in adipocytes, from fatty acids released from the VLDL triacylglycerols. These fatty acids are ultimately derived from the excess glucose taken up from blood by the liver. In summary, the effect of insulin is to favor the conversion of excess blood glucose to two storage forms: glycogen (in the liver and muscle) and triacylglycerols (in adipose tis­ sue) (Table 23-3) . Besides acting directly on muscle and liver to change their metabolism of carbohydrates and fats, insulin can also act in the brain to signal these tissues indirectly, as described later.

23.3 Hormonal Regulation of Fuel Metabolism

[923]

, , \ I � /�

,, I t ; / - Insulin - to brain, adipose, muscle

Pancreas

)

Insulin -

Blood vessel

Amino acids

Am] �

Liver

Py ruvate

ino acids N H3 -> Urea

a-Keto acids Protein synthesis

Fats

1

AceLy lCoA

1

ATP

_}

/

L --+ J

Q.,�

TAG

Intestine

Adipose tissue

TAG

FIGURE 23-26 The well-fed state: the lipogenic liver. Immediately after a calorie-rich meal, gl ucose, fatty acids, and amino acids enter the liver. Insu l i n released in response to the high blood glucose concentration stimu lates glucose uptake by the tissues. Some glucose is exported to the brain for its energy needs, and some to adipose and muscle tissue. I n the liver, excess gl·ucose is oxidized to acetyi-CoA, which is used to

TAB L E 23-3

synthesize fatty acids for export as triacylglycerols in VLDls to adipose and muscle tissue. The NADPH necessary for lipid synthesis is obtained by oxidation of glucose in the pentose phosphate pathway. Excess amino acids are converted to pyruvate and acetyi-CoA, which are also used for l ipid synthesis. Dietary fats move via the lymphatic system, as chylomicrons, from the i ntestine to muscle and adipose tissues.

Effects of Insulin on Blood Glucose: Uptake of Glucose by Cells and Storage as Triacylglycerols and G lycogen

___.

_ _ _ _ _ _ _

Metabolic effect

Target enzyme

i Glucose uptake (muscle, adipose)

i Glucose transporter (GLUT4)

i Glycogen synthesis (liver, muscle)

i Glycogen synthase

i Glucose uptake (liver)

i Glucokinase (increased expression)

� Glycogen breakdown (liver, muscle)

� Glycogen phosphorylase

i Glycolysis, acetyl-GoA production

i PFK-1 (by i PFK-2) i Pyruvate dehydrogenase complex

(liver, muscle)

i Fatty acid synthesis (liver)

i Triacylglycerol synthesis (adipose tissue)

Pancreatic f3 Cells Secrete I nsulin in Response to Chang es in Blood Glucose When glucose enters the bloodstream from the intestine after a carbohydrate-rich meal, the resulting increase in blood glucose causes increased secretion of insulin (and

i Acetyl-GoA carboxylase i Lipoprotein lipase

decreased secretion of glucagon) by the pancreas. In­ sulin release is largely regulated by the level of glucose in the blood supplying the pancreas. The peptide hor­ mones insulin, glucagon, and somatostatin are produced by clusters of specialized pancreatic cells, the islets of Langerhans (Fig. 23-2 7 ). Each cell type of the islets

[924]

H o r m o n a l Regulation a n d I ntegrati o n of M a m m a l i a n Meta b o l i s m

Pancreas

a

ce l l (glucagon)

/

f3 cell (insulin)

I

FIGURE 23-27 The endocrine system of the pancreas. The pancreas contains both exocrine cells (see Fig. 1 8-3b), which secrete digestive enzymes in the form of zymogens, and clusters of endocrine cells, the islets of Langerhans. The islets contain a, {3, and 13 cel ls (also known as A, B, and D cells, respectively), each cell type secreting a specific pep­ tide hormone.

produces a single hormone: a cells produce glucagon; f3 cells, insulin; and 8 cells, somatostatin. As shown in Figure 2:3-2 8, when blood glucose rises, CD GLUT2 transporters carry glucose into the f3 cells, where it is immediately converted to glucose 6-phosphate by hexokinase IV (glucokinase) and enters

glycolysis . With the higher rate of glucose catabolism, ® [ATP] increases, causing the closing of ATP-gated K+ channels in the plasma membrane. ® Reduced efflux of K + depolarizes the membrane. (Recall from Section 1 2 . 6 that exit of K+ through an open K + chan­ nel hyperpolarizes the membrane; closing the K+ chan­ nel therefore effectively depolarizes the membrane.) Membrane depolarization opens voltage-gated Ca2 + channels , and @ the resulting increase i n cytosolic [Ca2 + ] triggers @ the release of insulin by exocytosis . Parasympathetic and sympathetic nervous system sig­ nals also affect (stimulate and inhibit, respectively) in­ sulin release. A simple feedback loop limits hormone release: insulin lowers blood glucose by stimulating glu­ cose uptake by the tissues; the reduced blood glucose is detected by the f3 cell as a diminished flux through the hexokinase reaction; this slows or stops the release of insulin. This feedback regulation holds blood glucose concentration nearly constant despite large fluctua­ tions in dietary intake. The activity of ATP-gated K+ channels is central to the regulation of insulin secretion by f3 cells. The channels are octamers of four identical Kir6.2 subunits and four identical SUR1 subunits, and are constructed along the same lines as the K + channels of bacteria and those of other eukaryotic cells (see Figs 1 1-48, 1 1-49, and 1 1-50) . The four Kir6.2 subunits form a cone around the K + channel and function as the selectivity filter and ATP-gating mechanism (Fig. 2:3-29). When [ATP] rises (indicating increased blood glucose) , the K + channels close, depolarizing the plasma membrane and triggering insulin release as shown in Figure 23-28.



CD GluCe

Separated chromosomes

IV

25.1 DNA Replication

when it meets the first (arrested) fork. The final few hundred base pairs of DNA between these large protein complexes are then replicated (by an as yet unknown mechanism) , completing two topologically interlinked (catenated) circular chromosomes (Fig. 25-19). DNA circles linked in this way are known as catenanes. Sep­ aration of the catenated circles in E. coli requires topoi­ somerase IV (a type II topoisomerase) . The separated chromosomes then segregate into daughter cells at cell division. The terminal phase of replication of other circu­ lar chromosomes, including many of the DNA viruses that infect eukaryotic cells, is similar.

[991]

ORC Origin DNA

Repl ication in Euka ryotic Cells Is Both Similar and More Complex

The DNA molecules in eukaryotic cells are considerably larger than those in bacteria and are organized into com­ plex nucleoprotein structures (chromatin; p. 962) . The essential features of DNA replication are the same in eukaryotes and bacteria, and many of the protein complexes are functionally and structurally conserved. However, eukaryotic replication is regulated and coordi­ nated with the cell cycle, introducing some additional complexities. Origins of replication have a well-characterized structure in some lower eukaryotes, but they are much less defined in higher eukaryotes. In vertebrates, a vari­ ety of A=T-rich sequences may be used for replication initiation, and the sites may vary from one cell division to the next. Yeast (Saccharomyces cerevisiae) has de­ fined replication origins called autonomously replicating sequences (ARS) , or replicators. Yeast replicators span 150 bp and contain several essential, conserved sequences. About 400 replicators are distributed among the 1 6 chromosomes of the haploid yeast genome. Regulation ensures that all cellular DNA is replicated once per cell cycle. Much of this regulation involves pro­ teins called cyclins and the cyclin-dependent kinases (CDKs) with which they form complexes (p. 469) . The cy­ clins are rapidly destroyed by ubiquitin-dependent prote­ olysis at the end of the M phase (mitosis) , and the absence of cyclins allows the establishment of pre-replicative complexes (pre-RCs) on replication initiation sites. In rapidly growing cells, the pre-RC forms at the end of M phase. In slow-growing cells, it does not form until the end of G 1 . Formation of the pre-RC renders the cell competent for replication, an event sometimes called licensing. As in bacteria, the key event in the initiation of replication in all eukaryotes is the loading of the replica­ tive helicase, a heterohexameric complex of minichro­ mosome maintenance (MCM) proteins (MCM2 to MCM7) . The ring-shaped MCM2-7 helicase, functioning much like the bacterial DnaB helicase, is loaded onto the DNA by another six-protein complex called ORC (origin recognition complex) (Fig. 25-20) . ORC has five AAA + ATPase domains among its subunits and is functionally analogous to the bacterial DnaA. Two other proteins, CDC6 (cell division cycle) and CDT1 �

FIGURE 25-20 Assembly of a pre-replicative complex at a eukaryotic replication origin. The initiation site (origin) is bound by ORC, CDC6,

and CDT1 . These proteins, many of them AAA+ ATPases, promote load­ i ng of the replicative hel icase, MCM2-7, in a reaction that is analogous to the loading of the bacterial DnaB helicase by DnaC protein. Loading of the MCM helicase complex onto the DNA forms the pre-replicative complex, or pre-RC, and is the key step in the initiation of repl ication.

(CDC 1 0-dependent transcript 1 ) , are also required to load the MCM2-7 complex, and the yeast CDC6 is an­ other AAA + ATPase. Commitment to replication requires the synthesis and activity of S-phase cyclin-CDK complexes (such as the cyclin E-CDK2 complex; see Fig. 12-45) and CDC7DBF4. Both types of complexes help to activate replica­ tion by binding to and phosphorylating several proteins in the pre-RC. Other cyclins and CDKs function to in­ hibit the formation of more pre-RC complexes once replication has been initiated. For example, CDK2 binds to cyclin A as cyclin E levels decline during S phase, in­ hibiting CDK2 and preventing the licensing of additional pre-RC complexes.

[y92_j '

. ,

DNA Metabolism

The rate of movement of the replication fork in eu­ karyotes (-50 nucleotides/s) is only one-twentieth that observed in E. coli. At this rate, replication of an aver­ age human chromosome proceeding from a single origin would take more than 500 hours. Replication of human chromosomes in fact proceeds bidirectionally from many origins, spaced 30 to 300 kbp apart. Eukaryotic chromosomes are almost always much larger than bac­ terial chromosomes, so multiple origins are probably a universal feature of eukaryotic cells. Like bacteria, eukaryotes have several types of DNA polymerases. Some have been linked to particular func­ tions, such as the replication of mitochondrial DNA. The replication of nuclear chromosomes involves DNA poly­ merase a, in association with DNA polymerase 8. DNA polymerase a is typically a multisubunit enzyme with similar structure and properties in all eukaryotic cells. One subunit has a primase activity, and the largest sub­ unit CMr - 1 80,000) contains the polymerization activity. However, this polymerase has no proofreading 3 '�5 ' exonuclease activity, making it unsuitable for high­ fidelity DNA replication. DNA polymerase a is believed to function only in the synthesis of short primers (either RNA or DNA) for Okazaki fragments on the lagging strand. These primers are then extended by the multi­ subunit DNA polymerase 5. This enzyme is associated with and stimulated by proliferating cell nuclear antigen (PCNA; Mr 29,000) , a protein found in large amounts in the nuclei of proliferating cells. The three-dimensional structure of PCNA is remarkably similar to that of the {3 subunit of E. coli DNA polymerase III (Fig. 25-l Ob) , al­ though primary sequence homology is not evident. PCNA has a function analogous to that of the {3 subunit, forming a circular clamp that greatly enhances the pro­ cessivity of the polymerase. DNA polymerase 8 has a 3 ' �5' proofreading exonuclease activity and seems to carry out both leading and lagging strand synthesis in a complex comparable to the dimeric bacterial DNA poly­ merase III. Yet another polymerase, DNA polymerase e , re­ places DNA polymerase 8 in some situations, such as in DNA repair. DNA polymerase e may also function at the replication fork, perhaps playing a role analogous to that of the bacterial DNA polymerase I , removing the primers of Okazaki fragments on the lagging strand. Two other protein complexes also function in eu­ karyotic DNA replication. RPA (replication protein A) is a eukaryotic single-stranded DNA-binding protein, equivalent in function to the E. coli SSB protein. RFC (replication factor C) is a clamp loader for PCNA and fa­ cilitates the assembly of active replication complexes. The subunits of the RFC complex have significant se­ quence similarity to the subunits of the bacterial clamp­ loading ( 1') complex. The termination of replication on linear eukaryotic chromosomes involves the synthesis of special struc­ tures called telomeres at the ends of each chromo­ some, as discussed in the next chapter.

Viral DNA Polymerases Provide Targets for Antiviral Therapy

Many DNA viruses encode their own DNA poly­ merases, and some of these have become targets for pharmaceuticals. For example, the DNA polymerase of the herpes simplex virus is inhibited by acyclovir, a compound developed by Gertrude Elion (p. 894) . Acyclovir consists of guanine attached to an incomplete ribose ring.

Acyclovir

It is phosphorylated by a virally encoded thymidine ki­ nase; acyclovir binds to this viral enzyme with an affinity 200-fold greater than its binding to the cellular thymi­ dine kinase. This ensures that phosphorylation occurs mainly in virus-infected cells. Cellular kinases convert the resulting acyclo-GMP to acyclo-GTP, which is both an inhibitor and a substrate of DNA polymerases; acy­ clo-GTP competitively inhibits the herpes DNA poly­ merase more strongly than cellular DNA polymerases. Because it lacks a 3' hydroxyl, acyclo-GTP also acts as a chain terminator when incorporated into DNA. Thus viral replication is inhibited at several steps. •

S U M M A RY 2 5 . 1 •









DNA Replication

Replication of DNA occurs with very high fidelity and at a designated time in the cell cycle. Replication is semiconservative, each strand acting as template for a new daughter strand. It is carried out in three identifiable phases: initiation, elongation, and termination. The process starts at a single origin in bacteria and usually proceeds bidirectionally. DNA is synthesized in the 5'�3 ' direction by DNA polymerases. At the replication fork, the leading strand is synthesized continuously in the same direction as replication fork movement; the lagging strand is synthesized discontinuously as Okazaki fragments , which are subsequently ligated. The fidelity of DNA replication is maintained by ( 1 ) base selection by the polymerase, (2) a 3 '�5 ' proofreading exonuclease activity that is part of most DNA polymerases, and (3) specific repair systems for mismatches left behind after replication. Most cells have several DNA polymerases. In E. coli, DNA polymerase III is the primary replication enzyme. DNA polymerase I is responsible for special functions during replication, recombination, and repair. The separate initiation, elongation, and termination phases of DNA replication involve an array of enzymes and protein factors, many belonging to the AAA + ATPase family.

25.2 DNA Repair •

[993]

The replication proteins in bacteria are organized into replication factories, in which template DNA is spooled through two replisomes tethered to the bacterial plasma membrane.

25.2 DNA Repair

Most cells have only one or two sets of genomic DNA. Damaged proteins and RNA molecules can be quickly re­ placed by using information encoded in the DNA, but DNA molecules themselves are irreplaceable. Maintaining the integrity of the information in DNA is a cellular imperative, supported by an elaborate set of DNA repair systems. DNA can become damaged by a variety of processes, some spontaneous, others catalyzed by envirorunental agents (Chapter 8) . Replication itself can very occasionally dam­ age the information content in DNA when errors intro­ duce mismatched base pairs (such as G paired with T) . The chemistry of DNA damage is diverse and com­ plex. The cellular response to this damage includes a wide range of enzymatic systems that catalyze some of the most interesting chemical transformations in DNA metabolism. We first examine the effects of alterations in DNA sequence and then consider specific repair systems. M utations Are Linked to Cancer

The best way to illustrate the importance of DNA repair is to consider the effects of unrepaired DNA damage (a lesion) . The most serious outcome is a change in the base sequence of the DNA, which, if replicated and transmitted to future generations of cells, becomes perma­ nent. A permanent change in the nucleotide sequence of DNA is called a mutation. Mutations can involve the re­ placement of one base pair with another (substitution mu­ tation) or the addition or deletion of one or more base pairs (insertion or deletion mutations) . If the mutation affects nonessential DNA or if it has a negligible effect on the func­ tion of a gene, it is known as a silent mutation. Rarely, a mutation confers some biological advantage. Most nonsi­ lent mutations, however, are neutral or deleterious. In mammals there is a strong correlation between the accumulation of mutations and cancer. A simple test developed by Bruce Ames measures the potential of a given chemical compound to promote certain easily detected mutations in a specialized bacterial strain (Fig. 25-21 ) . Few of the chemicals that we encounter in daily life score as mutagens in this test. However, of the com­ pounds known to be carcinogenic from extensive animal trials, more than 90% are also found to be mutagenic in the Ames test. Because of this strong correlation be­ tween mutagenesis and carcinogenesis, the Ames test for bacterial mutagens is widely used as a rapid and inex­ pensive screen for potential human carcinogens. The genome of a typical mammalian cell accumu­ lates many thousands of lesions during a 24-hour period. However, as a result of DNA repair, fewer than 1 in 1 ,000 become a mutation. DNA is a relatively stable molecule ,

{ c) FIGURE 25-21 Ames test for carcinogens, based on their mutagenicity.

A strain of Salmonella typhimurium having a mutation that inactivates an enzyme of the histidine biosynthetic pathway is plated on a histidine-free medium. Few cells grow. (a) The few small colonies of 5. typhimurium that do grow on a histidine-free medium carry sponta­ neous back-mutations that permit the histidine biosynthetic pathway to operate. Three identical nutrient plates (b), (c), and (d) have been inoculated with an equal number of cells. Each plate then receives a disk of filter paper containing progressively lower concentrations of a mutagen. The mutagen greatly i ncreases the rate of back-mutation and hence the number of colonies. The clear areas around the filter paper indicate where the concentration of mutagen is so h igh that it is lethal to the cel ls. As the mutagen diffuses away from the filter paper, it is d i l uted to sublethal concentrations that promote back-mutation. Mutagens can be compared on the basis of their effect on mutation rate. Because many compounds undergo a variety of chemical trans­ formations after entering cells, compounds are sometimes tested for mutagenicity after first incubating them with a l iver extract. Some substances have been found to be mutagenic only after this treatment.

but in the absence of repair systems, the cumulative effect of many infrequent but damaging reactions would make life impossible. • All Cells Have M ultiple DNA Repair Systems

The number and diversity of repair systems reflect both the importance of DNA repair to cell survival and the diverse sources of DNA damage (Table 25-5) . Some common types of lesions, such as pyrimidine dimers (see Fig. 8-31), can be repaired by several distinct systems. Many DNA repair processes also seem to be extraordinarily inefficient ener­ getically-an exception to the pattern observed in the vast majority of metabolic pathways, where every ATP is gener­ ally accounted for and used optimally. When the integrity of the genetic information is at stake, the amount of chemical energy invested in a repair process seems almost irrelevant. DNA repair is possible largely because the DNA mol­ ecule consists of two complementary strands. DNA dam­ age in one strand can be removed and accurately replaced by using the undamaged complementary strand

[994]

DNA Metabolism

TABLE 25-5

CH3 I

Types of DNA Repair Systems In £ CDII Type of damage

E�es/proteins

3'

Mismatch repair

DNA glycosylases AP endonucleases

DNA polymerase I DNA ligase

G A T c

Direct repair

I

replication Mismatches CH3 I

5'

G A T C

3'

1

}

Abnormal bases (uracil, hypoxanthine, xanthine) ; alkylated bases; in some other organisms, pyrimidine dimers

3' 5'

5' ... 3'

C T A G .1.

·.Gila

For a short period following replication, the template strand is methylated and the new strand is not.

DNA lesions that cause large structural changes (e.g., pyrimidine dimers)

DNA photolyases

Pyrimidine dimers

06-Methylguanine-DNA

06 -Methylguanine

AlkB protein

1-Methylguanine, 3-methylcytosine

methyltransferase

5'

c T A G

Nucleotide-excision repair

ABC excinuclease DNA polymerase I DNA ligase

3'

CH3

Dam methylase MutH, MutL, MutS proteins DNA helicase II SSB DNA polymerase III Exonuclease I Exonuclease VII RecJ nuclease Exonuclease X DNA ligase Base-excision repair

5'

CH3 I

5' 3'



c T A

I I l-i-.L..L1

3' 5'

Hemimethylated DNA

as a template. We consider here the principal types of re­ pair systems, beginning with those that repair the rare nucleotide mismatches that are left behind by replication. Mismatch Repair Correction of the rare mismatches left after replication in E. coli improves the overall fidelity of replication by an additional factor of 1 02 to 103 . The mismatches are nearly always corrected to reflect the in­ formation in the old (template) strand, so the repair sys­ tem must somehow discriminate between the template and the newly synthesized strand. The cell accomplishes this by tagging the template DNA with methyl groups to distinguish it from newly synthesized strands. The mis­ match repair system of E. coli includes at least 1 2 protein components (Table 25-5) that function either in strand discrimination or in the repair process itself. The strand discrimination mechanism has not been worked out for most bacteria or eukaryotes, but is well understood for E. coli and some closely related bacter­ ial species. In these bacteria, strand discrimination is based on the action of Dam methylase, which, as you will recall, methylates DNA at the � position of all adenines within (5')GATC sequences. Immediately after passage of the replication fork, there is a short period (a few sec­ onds or minutes) during which the template strand is methylated but the newly synthesized strand is not (Fig. 25-22). The transient unmethylated state of

G A T c

C T A G I

9as 01111

Ill

J V)BH

9:EJa I

5' 3'

G A T C C T A G I

After a few minutes the new strand is methylated and the two strand can no longer be distinguished.

3' 5'

CH 3 CH3 I

5' 3'

G A T C C T A G I

3' 5'

CH3

FIGURE 25-22 Methylation and mismatch repair. Methylation of DNA strands can serve to d istinguish parent (template) strands from newly synthesized strands in E. coli DNA, a function that is critical to mismatch repair (see Fig. 2 5-23). The methylation occurs at the N6 of adeni nes in (S')GATC sequences. This sequence is a pal i ndrome (see Fig. 8-1 8), present in opposite orientations on the two strands.

25.2 DNA Repair

GATC sequences in the newly synthesized strand per­ mits the new strand to be distinguished from the tem­ plate strand. Replication mismatches in the vicinity of a hemimethylated GATC sequence are then repaired ac­ cording to the information in the methylated parent (template) strand. Tests in vitro show that if both strands are methylated at a GATC sequence, few mis­ matches are repaired; if neither strand is methylated, repair occurs but does not favor either strand. The cell's methyl-directed mismatch repair system efficiently re­ pairs mismatches up to 1 ,000 bp from a hemimethylated GATC sequence. How is the mismatch correction process directed by relatively distant GATC sequences? A mechanism is illustrated in Figure 25-23 . MutL protein forms a complex with MutS protein, and the complex binds to all mismatched base pairs (except C-C) . MutH protein binds to MutL and to GATC sequences encountered by the MutL-MutS complex. DNA on both sides of the mis­ match is threaded through the MutL-MutS complex, creating a DNA loop ; simultaneous movement of both legs of the loop through the complex is equivalent to the complex moving in both directions at once along the DNA. MutH has a site-specific endonuclease activ­ ity that is inactive until the complex encounters a hemimethylated GATC sequence. At this site, MutH catalyzes cleavage of the unmethylated strand on the 5 ' side of the G in GATC, which marks the strand for re­ pair. Further steps in the pathway depend on where the mismatch is located relative to this cleavage site ( Fig. 25-24). When the mismatch is on the 5' side of the cleav­ age site (Fig. 25-24 , right side) , the unmethylated strand is unwound and degraded in the 3 '�5' direc­ tion from the cleavage site through the mismatch, and this segment is replaced with new DNA. This process requires the combined action of DNA helicase II, SSB, exonuclease I or exonuclease X (both of which de­ grade strands of DNA in the 3 '�5' direction) , DNA polymerase III, and DNA ligase . The pathway for re­ pair of mismatches on the 3 ' side of the cleavage site is similar (Fig. 25-24, left) , except that the exonucle­ ase is either exonuclease VII (which degrades single­ stranded DNA in the 5 ' �3 ' or 3 '�5' direction) or RecJ nuclease (which degrades single-stranded DNA in the 5 '�3 ' direction) . Mismatch repair is a particularly expensive process for E. coli in terms of energy expended. The mismatch may be 1 ,000 bp or more from the GATC sequence. The degradation and replacement of a strand segment of this length require an enormous investment in activated de­ oxynucleotide precursors to repair a single mismatched base. This again underscores the importance to the cell of genomic integrity. All eukaryotic cells have several proteins struc­ turally and functionally analogous to the bacterial MutS and MutL (but not MutH) proteins. Alterations in hu­ man genes encoding proteins of this type produce some of the most common inherited cancer-susceptibility

G

Mismatched base pair

CH3 I



5' 3 ' --------�

'

'

'

'

T C

C T A G '

"

[995]

'11' ;

/

;

;

/ -

l=l-

3' 5'

CFI.a

I

CHs

l

CRa

1

:VIutH cleave tb • unm •thylaeed B'lrand

CH3 I

· -··"--- ·---

.. ....r--·-·--�

·-----

F IGURE 25-23 A model for the early steps of methyl-directed mis­

match repair. The proteins i nvolved in this process in f. coli have

been purified (see Table 2 5-5 ) . Recogn ition of the sequence ( 5 ' ) GATC and of the m ismatch are special ized functions of the MutH and MutS proteins, respectively. The Mutl protein forms a complex with MutS at the mismatch. DNA is threaded through this complex such that the complex moves simu ltaneously in both d i rections along the DNA until it encounters a MutH protein bou nd at a hemi methy­ lated GATC sequence. MutH cleaves the unmethylated strand on the 5 ' side of the G in this sequence. A complex consisting of DNA he­ l icase II and one of several exonucleases then degrades the un­ methylated DNA strand from that point toward the m ismatch (see Fig. 2 5-2 4) .

[?96



DNA Meta bolism

5' 3'

3' 5' TP.

ADP+ Pi *'

CH3 I

v-ATP ADP+Pi

CH3 I

M• .

or

CH1 I



l

!I

CH3 I

TP

\ !I

ADP+Pi CH3 I

l"

r 'r r \I L•l ' l nH

CH3 I

\I I t ! ll

(

CH3 I

FIGURE 25-24 Completing methyl-directed mismatch repair. The combined action of DNA hel icase II, 558, and one of four different exonucleases removes a segment of the new strand between the MutH cleavage site and a point just beyond the mismatch, The exonuclease

syndromes (see Box 25- 1 , p, 1003) , further demonstrat­ ing the value to the organism of DNA repair systems. The main MutS homologs in most eukaryotes, from yeast to humans, are MSH2 (MutS homolog 2) , MSH3, and MSH6. Heterodimers of MSH2 and MSH6 generally bind to single base-pair mismatches, and bind less well to slightly longer mispaired loops. In many organisms the longer mismatches (2 to 6 bp) may be bound in­ stead by a heterodimer of MSH2 and MSH3, or are bound by both types of heterodirners in tandem. Ho­ mologs of MutL, predominantly a heterodimer of MLH1 (MutL homolog 1 ) and PMS 1 (post-meiotic segrega­ tion) , bind to and stabilize the MSH complexes. Many details of the subsequent events in eukaryotic mis­ match repair remain to be worked out. In particular, we do not know the mechanism by which newly synthe­ sized DNA strands are identified, although research has revealed that this strand identification does not involve GATC sequences. Base-Excision Repair Every cell has a class of en­ zymes called DNA glycosylases that recognize particu­ larly common DNA lesions (such as the products of cytosine and adenine deamination; see Fig. 8-30a) and remove the affected base by cleaving the N-glycosyl bond. This cleavage creates an apurinic or apyrimidinic

CH3 I

CH3 I

l

Ha

r I>N '"" "iS!l

Ill

''"

I

CHs -- ---·

-

--

that is used depends on the location of the cleavage site relative to the mismatch, as shown by the alternative pathways here. The resulting gap is filled i n (dashed l ine) by DNA polymerase Ill, and the nick is sealed by DNA l igase (not shown).

site in the DNA, commonly referred to as an AP site or abasic site. Each DNA glycosylase is generally specific for one type of lesion. Uracil DNA glycosylases, for example, found in most cells, specifically remove from DNA the uracil that results from spontaneous deamination of cytosine. Mutant cells that lack this enzyme have a high rate of G-C to A=T mutations. This glycosylase does not re­ move uracil residues from RNA or thymine residues from DNA. The capacity to distinguish thymine from uracil, the product of cytosine deamination-neces­ sary for the selective repair of the latter-may be one reason why DNA evolved to contain thymine instead of uracil (p . 289) . Most bacteria have just one type of uracil DNA glyco­ sylase, whereas humans have at least four types, with dif­ ferent specificities-an indicator of the importance of uracil removal from DNA. The most abundant human uracil glycosylase, UNG, is associated with the human replisome, where it eliminates the occasional U residue inserted in place of a T during replication. The deamina­ tion of C residues is 1 00-fold faster in single-stranded DNA than in double-stranded DNA, and humans have the enzyme hSMUG 1 , which removes any U residues that oc­ cur in single-stranded DNA during replication or tran­ scription. Two other human DNA glycosylases, TDG and

25.2 DNA Repair

MBD4, remove either U or T residues paired with G, gen­ erated by deamination of cytosine or 5-methylcytosine, respectively. Other DNA glycosylases recognize and remove a va­ riety of damaged bases, including formamidopyrimidine and 8-hydroxyguanine (both arising from purine oxida­ tion) , hypoxanthine (arising from adenine deamina­ tion) , and alkylated bases such as 3-methyladenine and 7-methylguanine. Glycosylases that recognize other le­ sions, including pyrimidine dimers, have also been iden­ tified in some classes of organisms. Remember that AP sites also arise from the slow, spontaneous hydrolysis of the N-glycosyl bonds in DNA (see Fig. 8-30b) . Once an AP site has been formed by a DNA glyco­ sylase, another type of enzyme must repair it. The re­ pair is not made by simply inserting a new base and re-forming the N-glycosyl bond. Instead, the deoxyri­ bose 5 ' -phosphate left behind is removed and replaced with a new nucleotide . This process begins with one of the AP endonucleases, enzymes that cut the DNA strand containing the AP site. The position of the inci­ sion relative to the AP site (5 ' or 3 ' to the site) varies with the type of AP endonuclease. A segment of DNA including the AP site is then removed, DNA polymerase I replaces the DNA, and DNA ligase seals the remaining nick ( Fig. 25-2 5 ) . In eukaryotes, nucleotide replace­ ment is carried out by specialized polymerases , as described below.

DNA g l�·c

-_ ---"""'_

N

H2C=O H�

H H t ,O C CN 0 _..c_; NHz

+

Formaldehyde

Adenine

CN r0 NHz

_,,

_ _

I

NH2

I

Cytosine

25.2 DNA Repair

The Interaction of Replication Forks with DNA Damage

G 00�

to create a specialized DNA polymerase, DNA poly­ merase V, that can replicate past many of the DNA le­

Can Lead to Error-Prone Translesion DNA Synthesis

sions that would normally block replication. Proper base

The repair pathways considered to this point generally

pairing is often impossible at the site of such a lesion, so

work only for lesions in double-stranded DNA, the undam­

this translesion replication is error-prone.

aged strand providing the correct genetic information to

Given the emphasis on the importance of genomic in­

restore the damaged strand to its original state. However,

tegrity throughout this chapter, the existence of a system

in certain types of lesions, such as double-strand breaks,

that increases the rate of mutation may seem incongru­

double-strand cross-links, or lesions in a single-stranded

ous. However, we can think of this system as a despera­

DNA, the complementary strand is itself damaged or is ab­

tion strategy. The umuC and umuD genes are fully

sent. Double-strand breaks and lesions in single-stranded

induced only late in the SOS response, and they are not

DNA most often arise when a replication fork encounters

activated for translesion synthesis initiated by UmuD

an unrepaired DNA lesion

cleavage unless the levels of DNA damage are particularly

(Fig. 25-30). Such lesions and

all replication forks are blocked. The mutations

DNA cross-links can also result from ionizing radiation and

high and

oxidative reactions.

resulting from DNA polymerase V-mediated replication

At a stalled bacterial replication fork, there are two

kill some cells and create deleterious mutations in others,

avenues for repair. In the absence of a second strand, the

but this is the biological price a species pays to overcome

information required for accurate repair must come from

an otherwise insurmountable barrier to replication, as it

a separate, homologous chromosome. The repair system

permits at least a few mutant daughter cells to survive.

thus involves homologous genetic recombination. This

In addition to DNA polymerase V, translesion repli­

recombinational DNA repair is considered in detail in

cation requires the RecA protein. RecA filaments bound

Section

25.3. Under some conditions, a second repair error-prone translesion DNA synthesis

to single-stranded DNA at one chromosomal location

pathway,

can activate DNA polymerase V complexes bound at dis­

(often abbreviated TLS), becomes available. When this

tant sites on the chromosome. This has been described

pathway is active, DNA repair becomes significantly less

as acting "in trans," a phenomenon aided by looping of

accurate and a high mutation rate can result. In bacteria,

the chromosome that brings distant sites adjacent to

error-prone translesion DNA synthesis is part of a cellu­

each other. Yet another DNA polymerase, DNA poly­

lar stress response to extensive DNA damage known, ap­

merase IV, is also induced during the SOS response.

propriately enough, as the

Some SOS

Replication by DNA polymerase IV, a product of the

proteins, such as the UvrA and UvrB proteins already de­

dinE gene, is also highly error-prone. The bacterial DNA

scribed (Table 25-6) , are normally present in the cell but

polymerases IV and V are part of a family of TLS poly­

are induced to higher levels as part of the SOS response.

merases found in all organisms. These enzymes lack a

SOS response.

Additional SOS proteins participate in the pathway for

proofreading exonuclease activity, and the fidelity of

error-prone repair; these include the UmuC and UmuD

base selection during replication can be reduced by a

proteins ("Umu" from unmutable; lack of the umu gene

factor of

function eliminates error-prone repair) . The UmuD pro­

error in

102 , lowering overall replication fidelity to � 1 ,000 nucleotides.

one

tein is cleaved in an 80S-regulated process to a shorter

Mammals have many low-fidelity DNA polymerases

form called UmuD ' , which forms a complex with UmuC

of the TLS polymerase family. However, the presence of

Unrepaired lesion

1

Unrepaired break

I

Single-stranded

DNA

/

Recombinational

DNA repair or

error-prone repair

Double-strand break

/

Recombinational DNA repair

FIGURE 25-30 DNA damage and its effect on DNA

replication. If the repI ication fork encounters an un­

repaired lesion or strand break, replication generally halts and the fork may collapse. A lesion is left be­ hind in an unreplicated, single-stranded segment of the DNA (left); a strand break becomes a double­ strand break (right). I n each case the damage to one strand cannot be repai red by mechanisms described earlier in this chapter, because the complementary strand required to direct accurate repair is damaged or absent. There are two possible avenues for repair: recombinational DNA repair (described in Fig. 25-39) or, when lesions are unusua lly numerous, error-prone repair. The latter mechanism involves a novel DNA polymerase (DNA polymerase V, en­ coded by the umuC and umuD genes) that can repli­ cate, albeit inaccurately, over many types of lesions . The repair mechan ism is "error-prone" because mu­ tations often result.

� 00�

DNA Metabolism

TABLE 25-6

Genes Induced as Part of the SOS Response In E. coli

Gene name

-------

Protein encoded and/or role in DNA repair

Genes of known function

polE (dinA) uvrA

}

l umuD j uvrE

umuC

sulA

Encodes polymerization subunit of DNA polymerase II, required for replication restart in recombinational DNA repair Encode ABC excinuclease subunits UvrA and UvrB Encode DNA polymerase V Encodes protein that inhibits cell division, possibly to allow time for DNA repair

recA

Encodes RecA protein, required for error-prone repair and recombinational repair

dinE

Encodes DNA polymerase IV

ssb

Encodes single-stranded DNA-binding protein (SSB)

hirnA

Encodes subunit of integration host factor (IHF), involved in site-specific recombination, replication, transposition, regulation of gene expression

Genes involved in DNA metabolism, but role in DNA repair unknown

uvrD

Encodes DNA helicase II (DNA-unwinding protein)

recN

Required for recombinational repair

Genes of unknown function

dinD dinF Note:

Some of these genes and their functions are further discussed in Chapter 28.

these enzymes does not necessarily translate into an un­ acceptable mutational burden, because most of these en­ zymes also have specialized functions in DNA repair. DNA polymerase 11 (eta) , for example, found in all eu­ karyotes, promotes translesion synthesis primarily across cyclobutane T-T dimers. Few mutations result in this case, because the enzyme preferentially inserts two A residues across from the linked T residues. Sev­ eral other low-fidelity polymerases, including DNA poly­ merases {3, t (iota) , and A , have specialized roles in eukaryotic base-excision repair. Each of these enzymes has a 5'-deoxyribose phosphate lyase activity in addi­ tion to its polymerase activity. After base removal by a glycosylase and backbone cleavage by an AP endonucle­ ase, these polymerases remove the abasic site (a 5 ' -de­ oxyribose phosphate) and fill in the very short gap . The frequency of mutation due to DNA polymerase 11 activ­ ity is minimized by the very short lengths (often one nu­ cleotide) of DNA synthesized. What emerges from research into cellular DNA repair sys­ tems is a picture of a DNA metabolism that maintains ge­ nomic integrity with multiple and often redundant systems. In the human genome, more than 130 genes encode pro­ teins dedicated to the repair of DNA. In many cases, the loss of function of one of these proteins results in genomic insta­ bility and an increased occurrence of oncogenesis (Box 25-1). These repair systems are often integrated with the DNA replication systems and are complemented by recom­ bination systems, which we tum to next.

S U M M A RY 2 5 .2 •









DNA Repair

Cells have many systems for DNA repair. Mismatch repair in E. coli is directed by transient nonmethylation of (5') GATC sequences on the newly synthesized strand. Base-excision repair systems recognize and repair damage caused by environmental agents (such as radiation and alkylating agents) and spontaneous reactions of nucleotides. Some repair systems recognize and excise only damaged or incorrect bases, leaving an AP (abasic) site in the DNA. This is repaired by excision and replacement of the DNA segment containing the AP site. Nucleotide-excision repair systems recognize and remove a variety of bulky lesions and pyrimidine dimers. They excise a segment of the DNA strand including the lesion, leaving a gap that is filled in by DNA polymerase and ligase activities . Some DNA damage is repaired by direct reversal of the reaction causing the damage : pyrimidine dimers are directly converted to monomeric pyrimidines by a photolyase, and the methyl group of 06methylguanine is removed by a methyltransferase. In bacteria, error-prone translesion DNA synthesis, involving TLS DNA polymerases, occurs in response to very heavy DNA damage. In eukaryotes, similar polymerases have specialized roles in DNA repair that minimize the introduction of mutations.

25.2 DNA

BOX 25-1

� 00�

D N A R e p a i r a n d Ca n ce r ..;...__�---------"-__;._l

Human cancers develop when genes that regulate nor­ mal cell division (oncogenes and tumor suppressor genes; Chapter 1 2) fail to function, are activated at the wrong time, or are altered. As a consequence , cells may grow out of control and form a tumor. The genes con­ trolling cell division can be damaged by spontaneous mutation or overridden by the invasion of a tumor virus (Chapter 26) . Not surprisingly, alterations in DNA repair genes that result in an increased rate of mutation can greatly increase an individual's susceptibility to cancer. Defects in the genes encoding the proteins involved in nucleotide-excision repair, mismatch repair, recombina­ tional repair, and error-prone translesion DNA synthesis have all been linked to human cancers. Clearly, DNA repair can be a matter of life and death. Nucleotide-excision repair requires a larger num­ ber of proteins in humans than in bacteria, although the overall pathways are very similar. Genetic defects that inactivate nucleotide-excision repair have been associated with s everal genetic disease s , the best­ studied of which is xeroderma pigmentosum (XP) . Because nucleotide-excision repair is the sole repair pathway for pyrimidine dimers in humans, people with XP are extremely sensitive to light and readily develop sunlight-induced skin cancers. Most people with XP also have neurological abnormalitie s , pre­ sumably because of their inability to repair certain le­ sions caused by the high rate of oxidative metabolism in neurons. Defects in the genes encoding any of at least seven different protein components of the nu­ cleotide-excision repair system can result in XP, giv­ ing rise to seven different genetic groups denoted XPA to XPG. Several of these proteins (notably those defective in XPB, XPD, and XPG) also play roles in transcription-coupled base-excision repair of oxida­ tive lesions , described in Chapter 26. Most microorganisms have redundant pathways for the repair of cyclobutane pyrimidine dimers-making use of DNA photolyases and sometimes base-excision repair as alternatives to nucleotide-excision repair-but humans and other placental mammals do not. This lack of a back-up for nucleotide-excision repair for removing pyrimidine dimers has led to speculation that early mammalian evolution involved small, furry, nocturnal animals with little need to repair UV damage. However, mammals do have a pathway for the translesion bypass of cyclobutane pyrimidine dimers, which involves DNA

25.3 DNA Recombination

Repair

The rearrangement of genetic information within and among DNA molecules encompasses a variety of processes, collectively placed under the heading of genetic recombination. The practical applications of DNA rearrangements in altering the genomes of

polymerase Tl · This enzyme preferentially inserts two A residues opposite a T-T pyrimidine dimer, minimizing mutations. People with a genetic condition in which DNA polymerase T/ function is missing exhibit an XP-like illness known as XP-variant or XP-V. Clinical manifesta­ tions of XP-V are similar to those of the classic XP dis­ eases, although mutation levels are higher in XP-V when cells are exposed to UV light. Apparently, the nu­ cleotide-excision repair system works in concert with DNA polymerase T/ in normal human cells, repairing and/or bypassing pyrimidine dimers as needed to keep cell growth and DNA replication going. Exposure to UV light introduces a heavy load of pyrimidine dimers, and some must be bypassed by translesion synthesis to keep replication on track. When one system is missing, it is partly compensated for by the other. A loss of DNA poly­ merase T/ activity leads to stalled replication forks and bypass of UV lesions by different, more mutagenic, translesion synthesis (TLS) polymerases. As when other DNA repair systems are absent, the resulting increase in mutations often leads to cancer. One of the most common inherited cancer-suscepti­ bility syndromes is hereditary nonpolyposis colon can­ cer (HNPCC) . This syndrome has been traced to defects in mismatch repair. Human and other eukaryotic cells have several proteins analogous to the bacterial MutL and MutS proteins (see Fig. 25-23) . Defects in at least five different mismatch repair genes can give rise to HNPCC. The most prevalent are defects in the hMLHl (human MutL homolog 1 ) and hMSH2 (human MutS homolog 2) genes. In individuals with HNPCC, cancer generally develops at an early age, with colon cancers being most common. Most human breast cancer occurs in women with no known predisposition. However, about 10% of cases are associated with inherited defects in two genes, BRCA l and BRCA2. Human BRCA1 and BRCA2 are large proteins ( 1 ,834 and 3,4 1 8 amino acid residues, respec­ tively) that interact with a wide range of other proteins involved in transcription, chromosome maintenance , DNA repair, and control o f the cell cycle. BRCA2 has been implicated in the recombinational DNA repair of double-strand breaks. However, the precise molecular function of BRCAl and BRCA2 in these various cellular processes is not yet clear. Women with defects in either the BRCA l or BRCA2 gene have a greater than 80% chance of developing breast cancer.

increasing numbers of organisms are now being explored (Chapter 9). Genetic recombination events fall into at least three general classes. Homologous genetic recombination (also called general recombination) involves genetic exchanges between any two DNA molecules (or seg­ ments of the same molecule) that share an extended

:-1 oo4 '



DNA Meta b o l i s m

region of nearly identical sequence. The actual sequence of bases is irrelevant, as long as it is similar in the two DNAs. In site-specific recombination the exchanges occur only at a particular DNA sequence. DNA trans­ position is distinct from both other classes in that it usually involves a short segment of DNA with the remarkable ca­ pacity to move from one location in a chromosome to another. These "jumping genes" were first observed in maize in the 1 940s by Barbara McClintock. There is in addition a wide range of unusual genetic rearrange­ ments for which no mechanism or purpose has yet been pro­ Barbara McCli ntock, posed. Here we focus on the 1 902-1 992 three general classes. The functions of genetic recombination systems are as varied as their mechanisms . They include roles in specialized DNA repair systems, specialized activities in DNA replication, regulation of expression of certain genes, facilitation of proper chromosome segregation during eukaryotic cell division, maintenance of genetic diversity, and implementation of programmed genetic rearrangements during embryonic development. In most cases, genetic recombination is closely integrated with other processes in DNA metabolism, and this be­ comes a theme of our discussion.

(recipient) . Recombination during conjugation, although rare in wild bacterial populations, contributes to genetic diversity. In eukaryotes, homologous genetic recombination can have several roles in replication and cell division, including the repair of stalled replication forks. Recom­ bination occurs with the highest frequency during meiosis, the process by which diploid germ-line cells with two sets of chromosomes divide to produce haploid gametes (sperm cells or ova) in animals (haploid spores in plants) -each gamete having only one member of each chromosome pair (l 3 ' direction on single-stranded D NA. D isassembly proceeds, also in the 5 '---> 3 ' d i rection, from the end opposite to that where extension occurs. (d) Fi lament assembly is assisted by the ReeF, RecO, and RecR proteins (RecFOR). The RecX protein inhibits RecA filament extension. The Din I protein stabi l i zes RecA filaments, preventing disassembly.

(b)

(c)

Circular single­ stranded DNA

5' �

nucleation

Circular duplex DNA with single-strand gap

3'

0 RecA protein

+ 5'

Homologous linear duplex DNA

3'

RecA protein

extension

5'

Branched intermediates

3'

0

disassembly

5'

ADP

t

Pt RecA protein binds to single-stranded or gapped DNA. The complementary strand of the linear DNA pairs with a circular single strand. The other linear strand is displaced (left) or pairs with its complement in the circular duplex to yield a Holliday intermediate (right).

3'

(d)

SSB

ffi rn

0 RecFOR t !�

0

+

l

0

ADP + Pi

RecA protein

ATP ADP + Pi

+ Continued branch migration yields a circular duplex with a nick and either a displaced linear strand (left) or a partially single-stranded linear duplex (right).

FIGURE that can align two DNA molecules. Strands are then exchanged between the two DNAs to create hybrid DNA. The exchange occurs at a rate of 6 bp/s and pro­ gresses in the 5' �3 ' direction relative to the single­ stranded DNA within the RecA filament. This reaction can involve either three or four strands (Fig. 25-37) ; in the latter case, a Holliday intermediate forms during the process.

ATP

RecA protein

25-37 RecA-promoted

DNA strand exchange in vitro.

Strand exchange involves the separation of one strand of a duplex DNA from its complement and transfer of the strand to an alternative comple­ mentary strand to form a new duplex (heteroduplex) DNA. The transfer forms a branched intermediate. Formation of the final product depends on branch migration, which is faci l itated by RecA. The reaction can in­ volve three strands (left) or a reciprocal exchange between two homolo­ gous duplexes-four strands in all (right). When four strands are i nvolved, a Holliday intermediate results. RecA promotes the branch-migration phases of these reactions, using energy derived from ATP hydrolysis.

25.3 DNA Recombination

As the duplex DNA is incorporated within the RecA filament and aligned with the bound single-stranded DNA over regions of hundreds of base pairs, one strand of the duplex switches pairing partners (Fi�. 2 5-:ls , step @ ) . Because DNA is a helical structure, continued strand exchange requires an ordered rotation of the two aligned DNAs . This brings about a spooling action (steps ® and @) that shifts the branch point along the helix. ATP hydrolysis is coupled to the late stages of

c1")



Three-stranded pairing intermediate

Homologous duplex DNA

Homologous duplex DNA

®

ATP

@

5'

L

i 1 009

DNA strand exchange, in which the hybrid DNA created in the initial pairing reaction is extended. The coupling mechanism is not yet understood. Once a Holliday intermediate has formed, a host of enzymes-topoisomerases, the RuvAB branch migration protein, a resolvase, other nucleases, DNA polymerase I or III, and DNA ligase-are required to complete recombina­ tion. The RuvC protein CMr 20,000) of E. coli cleaves Hol­ liday intermediates to generate full-length, unbranched chromosome products.

RecA protein

5'((:_�� 3 ' �

'

3'

FIGURE 25-38 Model for RecA-mediated DNA strand exchange. A three-strand reaction is shown. The bal l s representing RecA protein are undersized relative to the thickness of DNA to clarify the fate of the DNA strands. CD RecA forms a filament on the single-stranded D NA. (I) A homologous duplex incorporates into this complex. ® As spooling shifts the three-stranded region from left to right, one of the strands in the duplex is transferred to the single strand originally bound in the filament. The other strand of the duplex is displaced, and a new duplex forms within the fi lament. As rotation continues (@) and @), the displaced strand separates entirely. In this model, hydrolysis of ATP by RecA rotates the two DNA molecules relative to each other and thus d i rects the strand exchange from left to right as shown.

All Aspects of DNA Metabolis m Come Together to Repair Stal led Replication Forks

Like all cells, bacteria sustain high levels of DNA dam­ age even under normal growth conditions. Most DNA lesions are repaired rapidly by base-excision repair, nucleotide-excision repair, and the other pathways described earlier. Nevertheless, almost every bacter­ ial replication fork encounters an unrepaired DNA le­ sion or break at some point in its journey from the replication origin to the terminus (Fig. 25-30) . For many types of lesions , DNA polymerase III cannot proceed and the encounter tends to leave the lesion in a single-strand gap. An encounter with a DNA strand break creates a double-strand break. Both sit­ uations require recombinational DNA repair ( Fig. 2 5-8 9 ) . Under normal growth conditions, stalled replication forks are reactivated by an elaborate re­ pair pathway encompassing recombinational DNA re­ pair, the restart of replication, and the repair of any lesions left behind. All aspects of DNA metabolism come together in this process. After a replication fork has been halted, it can be restored by at least two major paths, both of which re­ quire the RecA protein. The repair pathway for lesion­ containing DNA gaps also requires the ReeF, RecO, and RecR proteins. Repair of double-strand breaks re­ quires the RecBCD enzyme (Fig. 25-39) . Additional recombination steps are followed by origin-inde­ pendent restart of replication, in which the repli­ cation fork reassembles with the aid of a complex of seven proteins (PriA, B, and C, and DnaB, C, G, and T) . This complex, originally discovered as a compo­ nent required for the replication of c/>X 1 74 DNA in vitro, is now termed the replication restart primo­ some . Restart of the replication fork also requires DNA polymerase II, in a role not yet defined; this poly­ merase II activity gives way to DNA polymerase III for the extensive replication generally required to com­ plete the chromosome. In at least some cases , replica­ tion restart can occur downstream of a blocking DNA lesion before the lesion is repaired. The repair of stalled replication forks entails coordi­ nated transitions between replication and recombina­ tion. The recombination steps function to fill the DNA gap or rejoin the broken DNA branch to recreate the

� � 01

DNA Metabolism

FIGURE 25-39 Models for recombinational DNA

3'

repair of stalled replication forks. The replication

fork collapses on encountering a DNA lesion (left) or strand break (right). Recombination enzymes promote the DNA strand transfers needed to re· pair the branched DNA structure at the repl ication fork. A lesion in a single-strand gap is repaired in a reaction requiring the ReeF, RecO, and RecR proteins. Double·strand breaks are repaired in a pathway requiring the RecBCD enzyme. Both pathways require RecA. Recombination interme· diates are processed by additional enzymes (e.g., RuvA, RuvB, and RuvC, which process Holliday intermediates). Lesions in double-stranded DNA are repaired by nucleotide-excision repair or other pathways. The replication fork re-forms with the aid of enzymes catalyzing origin·independent replication restart, and chromosomal replication is completed. The overal l process requires an elaborate coordination of all aspects of bacterial DNA metabolism.

/DNA

nick

1

======;•

strand

II Rt h )

invasion

RecA

RecBCD

----

Pol I

replication

----

revc,.,e

brancl!

migrotioo

resolution of Hollidny intermedlnt�

Origin-independent replication restart

branched DNA structure at the replication fork. Lesions left behind in what is now duplex DNA are repaired by pathways such as base-excision or nucleotide-excision repair. Thus a wide range of enzymes encompassing every aspect of DNA metabolism ultimately take part in the repair of a stalled replication fork. This type of repair process is a primary function of the homologous recom­ bination system of every cell, and defects in recombina­ tional DNA repair play an important role in human disease (Box 25-1 ) . Site-Specific Recombination Results in Precise DNA Rearrangements

Homologous genetic recombination, the type we have discussed so far, can involve any two homologous

sequences. The s econd general type of recombina­ tion, site-specific recombination, is a very different type of process: recombination is limited to specific sequences . Recombination reactions of this type oc­ cur in virtually every cell, filling spe cialized roles that vary greatly from one species to another. Exam­ ples include regulation of the expression of certain genes and promotion of programmed DNA re­ arrangements in embryonic development or in the replication cycles of some viral and plasmid DNAs. E ach site-specific recombination system consists of an enzyme called a recombinase and a short (20 to 200 bp) , unique DNA sequence where the recombi­ nase acts (the recombination site) . One or more aux­ iliary proteins may regulate the timing or outcome of the reaction.

25.3 DNA Recombination

3'

Recombi nase

I

'

5'

3'

-'l'yr

Tyr -

5' 3'

CD 3'

3'

5' /

5'

01

5'

Tyr

Tyr I

5'

3'

� �J

Jf

.s·

HO

Tyr ··-··

5'

5'

3'

3'

- , 1.r'e!) I

3'

( OH

'

3'

3'

5'

5'

3'

/

Tyr I

Tyr

HO

OH

5'

(

Tyr

I.J (

!

/

3'

5' 3'

5'

3'

5'

5'

3' 5'

3'

3'

5' ;-Tyr J

I Tyr

(

Tyr 3'

5'

3'

(a}

There are two general classes of site-specific recom­ bination systems, which rely on either Tyr or Ser residues in the active site. In vitro studies of many site­ specific recombination systems in the tyrosine class have elucidated some general principles, including the fundamental reaction pathway (Fig. 2 5-40a) . Several of these enzymes have been crystallized, revealing structural details of the reaction. A separate recombi­ nase recognizes and binds to each of two recombination sites on two different DNA molecules or within the same DNA. One DNA strand in each site is cleaved at a spe­ cific point within the site, and the recombinase becomes covalently linked to the DNA at the cleavage site through a phosphotyrosine bond (step (D). The tran­ sient protein-DNA linkage preserves the phosphodiester bond that is lost in cleaving the DNA, so high-energy co­ factors such as ATP are unnecessary in subsequent steps. The cleaved DNA strands are rejoined to new partners to form a Holliday intermediate, with new phosphodiester bonds created at the expense of the protein-DNA linkage (step ®). To complete the reaction, the process must be repeated at a second point within each of the two

(b)

FIGURE 25-40 A site-specific recombination reaction. (a} The reac­

tion shown here is for a common class of site-specific recombinases cal led integrase-class recombinases (named after bacteriophage A inte­ grase, the first recombi nase characterized). These enzymes use Tyr residues as nucleophi les at the active site. The reaction is carried out within a tetramer of identical subunits. Recombinase subunits bind to a specific sequence, the recombination site. CD One strand in each D NA is cleaved at particular points in the sequence. The nucleophile is the -OH group of an active-site Tyr residue, and the product is a co­ valent phosphotyrosine l i n k between protein and D NA. CD The cleaved strands join to new partners, producing a Hol l iday i ntermedi­ ate. Steps ® and @) complete the reaction by a process simi lar to the first two steps. The original sequence of the recombi nation site is regenerated after recombining the DNA flanking the site. These steps occur within a complex of mu ltiple recombinase subunits that some­ times includes other proteins not shown here. (b) Surface contour model of a four-subunit integrase-c lass recombi nase cal led the Cre recombi nase, bound to a Holl iday intermediate (shown with l ight blue and dark blue hel ix strands). The protein has been rendered transpar­ ent so that the bound DNA is visible (derived from PDB ID 3CRX). Another group of recombinases, cal led the resolvase/invertase fami ly, use a Ser residue as nucleophile at the active site.

recombination sites (steps ® and @)). In the systems that employ an active-site Ser residue , both strands of each recombination site are cut concurrently and re­ joined to new partners without the Holliday intermedi­ ate. In both types of system, the exchange is always reciprocal and precise, regenerating the recombination sites when the reaction is complete. We can view a recombinase as a site-specific endonuclease and ligase in one package . The sequences of the recombination sites recognized by site-specific recombinases are partially asynunetric (nonpalindromic), and the two recombining sites align in the same orientation during the recombinase reaction. The outcome depends on the location and orientation of

[

1 01

��

DNA Metabolism

Deletion and insertion

Inversion

ll Sites of exchange

insertion

---:.;:;.; .

(a)

deletion

+

(b)

FIGURE 15-41 Effects of site-specific recombination. The outcome of site-specific recombination depends on the location and orientation of the recombination sites (red and green) in a double-stranded DNA molecule. Orientation here (shown by arrowheads) refers to the order of nucleotides in the recombi nation site, not the 5 '�3 ' d i rection.

the recombination sites (Fig. 25-41 ). If the two sites are on the same DNA molecule, the reaction either inverts or deletes the intervening DNA, determined by whether the recombination sites have the opposite or the same orien­ tation, respectively. If the sites are on different DNAs, the recombination is intermolecular; if one or both DNAs are circular, the result is an insertion. Some recombinase sys­ tems are highly specific for one of these reaction types and act only on sites with particular orientations. The first site-specific recombination system studied in vitro was that encoded by bacteriophage A. When A phage DNA enters an E. coli cell, a complex series of reg­ ulatory events commits the DNA to one of two fates. The A DNA replicates and produces more bacteriophages (destroying the host cell) , or it integrates into the host

(a) Recombination sites with opposite orientation in the same DNA

molecule. The result is an inversion. (b) Recombination sites with the same orientation, either on one DNA molecule, producing a deletion, or on two DNA molecu les, producing an insertion.

chromosome and (as prophage) replicates passively along with the chromosome for many cell generations. In­ tegration is accomplished by a phage-encoded, tyrosine­ class recombinase (A integrase) that acts at recombination sites on the phage and bacterial DNAs-at attachment sites attP and attB, respectively (Fig. 25-42 ). The role of site-specific recombination in regulating gene expression is considered in Chapter 28. Complete Chromosome Replication Can Require Site-Specific Reco m bination

Recombinational DNA repair of a circular bacterial chromosome , while essential, sometimes generates deleterious byproducts. The resolution of a Holliday

Bacterial attachment site (attB)

I

ll

a ttL

Phage attachment site (attP)

Integration:

A integrase (INT) IHF

Point of crossover

A

Phage

DNA

Excision:

A integrase (INT) IHF

FIS + XIS

E. coli chromosome

FIGURE 15-41 Integration and excision of bacteriophage A DNA at

the chromosomal target site. The attachment site on the A phage DNA (attP) shares only 1 5 bp of complete homology with the bacterial site (attB) in the region of the crossover. The reaction generates two new

attachment sites (attR and a ttL) flanking the integrated phage DNA.

The recombinase is the A i ntegrase (or INT protein). Integration and excision use different attachment sites and different auxil iary proteins. Excision uses the proteins XIS, encoded by the bacteriophage, and FIS, encoded by the bacterium. Both reactions require the protein IHF (integration host factor), encoded by the bacterium.

25.3

DNA Recombination

� � 01

"jump," from one place on a chromosome (the donor site) to another on the same or a different chromosome (the target site) . DNA sequence homology is not usually

transposition; the

required for this movement, called

new location is determined more or less randomly. In­ sertion of a transposon in an essential gene could kill the cell, so transposition is tightly regulated and usually very infrequent. Transposons are perhaps the simplest of molecular parasites, adapted to replicate passively within the chromosomes of host cells. In some cases they carry genes that are useful to the host cell, and thus exist in a kind of symbiosis with the host.

Inser­ tion sequences (simple transposons) contain Bacteria have two classes of transposons. termination

of replkauon

�O::: = : D = i m e r i c g e n = o m e = � f\ � � � ��=====djj} :::::: resolution to monomers by XerCD system

only the sequences required for transposition and the genes for the proteins (transposases) that promote the process.

Complex transposons contain one or more

genes in addition to those needed for transposition. These extra genes might, for example, confer resistance to antibiotics and thus enhance the survival chances of the host cell. The spread of antibiotic-resistance ele­ ments among disease-causing bacterial populations that is rendering some antibiotics ineffectual (p. 949) is mediated in part by transposition. •

Bacterial transposons vary in structure, but most have

short repeated sequences at each end that serve as binding sites for the transposase. When transposition occurs, a short sequence at the target site (5 to

10 bp) is duplicated

to form an additional short repeated sequence that flanks

(Fig. 25-44) . These

FIGURE 25-43 DNA deletion to undo a deleterious effect of recombi­

each end of the inserted transposon

national DNA repair. The resolution of a Holl iday intermediate during

duplicated segments result from the cutting mechanism

recombinational DNA repair (if cut at the points indicated by red arrows) can generate a contiguous dimeric chromosome. A specialized site-spe­ cific recombinase in E. coli, XerCD, converts the dimer to monomers, al­ lowing chromosome segregation and cell division to proceed.

used to insert a transposon into the DNA at a new location.

intermediate at a replication fork by a nuclease such as RuvC , followed by completion of replication, can give rise to one of two products: the usual two monomeric chromosomes or a contiguous dimeric chromosome

Transposase makes staggered cuts in the target site.

Terminal rep ats

I

Transposon

t��

Target DNA

(Fig. 2 5-43 ) . In the latter case, the covalently linked chromosomes cannot be segregated to daughter cells at cell division and the dividing cells become "stuck." A specialized site-specific recombination system in E. coli, the XerCD system, converts the dimeric chromosomes

The transposon is inserted at the site of the cuts.

to monomeric chromosomes so that cell division can proceed. The reaction is a site-specific deletion reaction (Fig. 25-4lb) . This is another example of the close coor­ dination between DNA recombination processes and other aspects of DNA metabolism.

Replication fills in the gaps, duplicating the sequences flanking the transposon.

Transposable Genetic Elements Move from One location to Another

FIGURE 25-44 Duplication of the DNA sequence at a target site when

We now consider the third general type of recombina­

a transposon is inserted. The sequences that are dupl icated following

tion system: recombination that allows the movement of

transposon insertion are shown in red. These sequences are generally only a few base pairs long, so their size relative to that of a typical transposon is greatly exaggerated in th is drawing.

transposable elements, or

transposons. These seg­

ments of DNA, found in virtually all cells, move , or

�0 1 �

DNA Metabolism

There are two general pathways for transposition in bacteria. In direct (or simple) transposition (Fig. 25-45, left) , cuts on each side of the transposon excise it, and the transposon moves to a new location. This leaves a double-strand break in the donor DNA that must be re­ paired. At the target site, a staggered cut is made (as in Fig. 25-44) , the transposon is inserted into the break, and DNA replication fills in the gaps to duplicate the

Direct transposition

i

Replicative transposition

CD

1

Cleavage

t

I m munoglobulin Genes Assemble by Recombination 3' 5'

Target

DNA

target site sequence. In replicative transposition (Fig. 25-45, right) , the entire transposon is replicated , leav­ ing a copy behind at the donor location. A cointe­ grate is an intermediate in this process, consisting of the donor region covalently linked to DNA at the tar­ get site. Two complete copies of the transposon are present in the cointegrate, both having the same rela­ tive orientation in the DNA. In some well-character­ ized transposons, the cointegrate intermediate is converted to products by site-specific recombination, in which specialized recombinases promote the re­ quired deletion reaction. Eukaryotes also have transposons, structurally sim­ ilar to bacterial transposons, and some use similar trans­ position mechanisms. In other cases, however, the mechanism of transposition seems to involve an RNA intermediate. Evolution of these transposons is inter­ twined with the evolution of certain classes of RNA viruses. Both are described in the next chapter.

@

Free ends of transposons attack target DNA

....../.

� - :; / ---=-=-::

...::::====�

Gaps filled Cleft) or entire transposon replicated (right)

Some DNA rearrangements are a programmed part of development in eukaryotic organisms . An important example is the generation of complete immunoglobulin genes from separate gene segments in vertebrate genomes. A human (like other mammals) is capable of producing millions of different immunoglobulins (anti­ bodies) with distinct binding specificities, even though the human genome contains only �29,000 genes. Re­ combination allows an organism to produce an extraor­ dinary diversity of antibodies from a limited DNA-coding capacity. Studies of the recombination mechanism re­ veal a close relationship to DNA transposition and sug­ gest that this system for generating antibody diversity may have evolved from an ancient cellular invasion of transposons. We can use the human genes that encode proteins of the immunoglobulin G (IgG) class to illustrate how anti­ body diversity is generated. Immunoglobulins consist

FIGURE 25-45 Two general pathways for transposition: direct (sim­

CD The DNA is first cleaved on each side of the transposon, at the sites i n dicated by arrows. (I) The l iberated 3 ' ­ hydroxyl groups a t the ends o f the transposon act as nucleophiles in a di rect attack on phosphodiester bonds in the target D NA. The target phosphodiester bonds are staggered (not d i rectly across from each other) in the two D NA strands. @ The transposon is now linked to the target DNA. I n direct transposition (left), replication fi l ls in gaps at each end to complete the process. I n replicative transposition (right), the entire transposon is replicated to create a cointegrate i ntermedi­ ate. @) The cointegrate is often resolved later, with the aid of a separate site-specific recombi nation system. The cleaved host DNA left behind after direct transposition is either repai red by DNA end-join i ng or de­ graded (not shown). The latter outcome can be lethal to an organism. ple) and replicative.

@

Site-specific recombination (within transposon)

l

25.3 DNA Recombination

of two heavy and two light polypeptide chains (see Fig. 5-2 1 ) . Each chain has two regions, a variable region, with a sequence that differs greatly from one immunoglobulin to another, and a region that is virtually constant within a class of immunoglobulins. There are also two distinct families of light chains, kappa and lambda, which differ somewhat in the sequences of their constant regions. For all three types of polypeptide chain (heavy chain, and kappa and lambda light chains) , diversity in the variable regions is generated by a similar mechanism. The genes for these polypeptides are divided into segments, and the genome contains clusters with multiple versions of each segment. The joining of one version of each gene segment creates a complete gene. Figure 2 5-46 depicts the organization of the DNA encoding the kappa light chains of human IgG and shows how a mature kappa light chain is generated. In undifferentiated cells, the coding information for this polypeptide chain is separated into three segments. The V (variable) segment encodes the first 95 amino acid residues of the variable region, the J (joining) segment encodes the remaining 1 2 residues of the variable region, and the C segment encodes the constant region.

V segments ( 1 to -300)

J segments

=

=

}

C segment C

01

The genome contains -300 different V segments, 4 dif­ ferent J segments, and 1 C segment. As a stem cell in the bone marrow differentiates to form a mature B lymphocyte, one V segment and one J segment are brought together by a specialized recombi­ nation system (Fig. 25-46) . During this programmed DNA deletion, the intervening DNA is discarded. There are about 300 X 4 1 ,2 00 possible V-J combinations. The recombination process is not as precise as the site­ specific recombination described earlier, so additional variation occurs in the sequence at the V-J junction. This increases the overall variation by a factor of at least 2.5, so the cells can generate about 2 . 5 X 1 ,2 00 3 ,000 different V-J combinations. The final joining of the V-J combination to the C region is accomplished by an RNA­ splicing reaction after transcription, a process described in Chapter 26. The recombination mechanism for joining the V and J segments is illustrated in Figure 25-4 7. Just beyond each V segment and just before each J segment lie recom­ bination signal sequences (RSS) . These are bound by proteins called RAG 1 and RAG2 (products of the recom­ bination activating gene) . The RAG proteins catalyze the



- - {Yi]-L��HJ�-� ��r@:4)Jl�fu�-

G �

- -

g�:

-linc

recombination resulting in deletion of DNA between

V and J segments

Mature light­ chain gene �

- - {_\'LH v2 ��s�t.J�±f{��-c

i- -· -

���� hocytc

transcription

Primary transcript

Processed mRNA lrnnslation

FIGURE 25-46 Recombination of the V and I

gene segments of the human lgG kappa light Light-chain polypeptide Variable region protein folding and assembly

Constant region

chain. This process is designed to generate anti­ body diversity. At the top is shown the arrange­ ment of lgG-coding sequences in a stem cel l of the bone marrow. Recombi nation deletes the DNA between a particular V segment and a J segment. After transcription, the transcript is processed by RNA spl ici ng, as described i n Chapter 26; translation produces the l ight-chain polypeptide. The l ight chain can combine with any of 5,000 possible heavy chains to produce an antibody molecule.

1016

DNA Metabolism

sequence structure found in most transposons. In the test tube,

RAG 1 and RAG2 can associate with this deleted DNA and insert it, transposonlike, into other DNA mole­

V segment

cules (probably a rare reaction in B lymphocytes) . Al­

J segment

though we cannot know for certain, the properties of the dcavuge

I \1 I

immunoglobulin gene rearrangement system suggest an

I{ \ . :2

intriguing origin in which the distinction between host and parasite has become blurred by evolution.

�----------M-��---------�

D N A Reco m b i n a t i o n

S U M M A RY 2 5 . 3 •

intramolecular

transesterification

DNA sequences are rearranged in recombination reactions, usually in processes tightly coordinated with



� �--

DNA replication or repair.

Homologous genetic recombination can take place between any two

DNA molecules that share

sequence homology. In meiosis (in eukaryotes) , this type of recombination helps to ensure accurate

double-strand

chromosomal segregation and create genetic

break repair

diversity. In both bacteria and eukaryotes it

via end-joining

serves in the repair of stalled replication forks.

A Holliday intermediate forms during homologous recombination. v

FIGURE 25-47



J

Mechanism of immunoglobulin gene rearrangement

The RAG l and RAG2 proteins bind to the recombination signal se­ quences (RSS) and cleave one DNA strand between the RSS and the V (or J) segments to be joined. The liberated 3 ' hydroxyl then acts as a nucleophile, attacking a phosphodiester bond in the other strand to cre­ ate a double-strand break. The resulting hairpin bends on theV and J seg­ ments are cleaved, and the ends are covalently l inked by a complex of proteins specialized for end-joining repair of double-strand breaks. The steps in the generation of the double-strand break catalyzed by RAG l and RAG2 are chemically related to steps in transposition reactions.

Site-specific recombination occurs only at specific target sequences, and this process can also involve a Holliday intermediate. Recombinases cleave the

DNA at specific points and ligate the strands to new partners. This type of recombination is found in virtually all cells, and its many functions include

DNA integration and regulation of gene expression. •

In virtually all cells, transposons use recombination to move within or between chromosomes. In vertebrates, a programmed recombination reaction related to transposition joins immunoglobulin gene segments to form immunoglobulin genes during

formation of a double-strand break between the signal

B-lymphocyte differentiation.

sequences and the V (or J) segments to be joined. The V and

J

segments are then joined with the aid of a second

complex of proteins. The genes for the heavy chains and the lambda light

Key Terms

chains form by similar processes. Heavy chains have more

Terms in bold are defined in the glossary_

gene segments than light chains, with more than 5,000

template

sequences during B-lymphocyte differentiation. Each

leading strand

Okazaki fragments 979 979

981 DNA polymerase III 982 replisome 984 helicases 984 topoisomerases 984 primases 984 DNA ligases 984

mature B lymphocyte produces only one type of antibody,

DNA unwinding element (DUE) 985 AAA + ATPases 985 primosome 987 catenanes 991 pre-replicative complex

possible combinations. Because any heavy chain can

977 semiconservative

combine with any light chain to generate an immunoglob­ 7 ulin, each human has at least 3 , 000 x 5,000 1 .5 x 1 0

replication fork

=

possible IgGs. And additional diversity is generated by high mutation rates (of unknown mechanism) in the

V

977

replication origin

proofreading

978

978

double-strand breaks by RAG 1 and RAG2 does mirror

979 979 exonuclease 979 endonuclease 979 DNA polymerase I 979 primer 980

several reaction steps in transposition (Fig. 25-4 7) . In

primer terminus

addition, the deleted

processivity

but the range of antibodies produced by the B lympho­ cytes of an individual organism is clearly enormous. Did the immune system evolve in part from ancient transposons? The mechanism for generation of the

DNA, with its terminal RSS, has a

lagging strand nucleases

980

980

(pre-RC) 991 licensing 991

Further Reading

minichromosome

homologous genetic

maintenance (MCM) proteins

recombination

991

site-specific

ORC (origin recognition complex)

recombination

991

DNA polymerase

DNA transposition

a

992 992 992

DNA polymerase B DNA polymerase

e

repair meiosis

993 base-excision repair 996 DNA glycosylases 996 AP site 996 DNA photolyases

1005 double-strand break repair model 1 006

1 00 1 1001

O'Donnell, M. (2006) Replisome architecture and dynamics in

Escherichia coli. J Biol. Chem. 281, 10,653-10,656. An excellent summary of what goes on at a replication fork. Stillman, B. (2005) Origin recognition and the chromosome cycle.

FEES Lett. 579, 877-884. Good summary of the initiation of eukaryotic DNA replication.

DNA Repair Begley, T.J. & Samson, L.D. (2003) AlkB mystery solved: oxidative demethylation of N 1 -methyladenine and N3-methylcytosine adducts by a direct reversal mechanism.

Trends Biochem. Sci. 28, 2-5.

Erzberger, J.P. & Berger, J.M. (2006) Evolutionary relationships

Holliday

and structural mechanisms of

1 006 transposons 1 0 1 3 transposition 1 0 1 3 insertion sequence 1 0 1 3 cointegrate 1 0 1 4

Biomol. Struct. 35, 93-114.

intermediate

error-prone translesion DNA synthesis

1 004 1 004

branch migration

997 998

AP endonucleases

1 004 1 004

01

recombinational DNA

mutation

S O S response

1 003

G �

AAA + proteins . Annu Rev Biophys.

Friedberg, E.C., Fischhaber, P.L., & Kisker, C. (2001) Error-prone DNA polymerases: novel structures and the benefits of infidelity.

Cell

107, 9-12 Goodman, M.F. (2002) Error-prone repair DNA polymerases in prokaryotes and eukaryotes. Annu.

Rev Biochem. 71, 1 7-50.

Review of a class of DNA polymerases that continues to grow.

Kunkel, T.A. & Erie, D.A. (2005) DNA mismatch repair. Annu. Rev. Biochem 74, 68 1-710.

Further Reading

Lindahl, T. & Wood, R.D. (1999) Quality control by DNA repair. Science 286, 1897-1905.

Genend Friedberg, E.C., Walker, G.C., Siede, W., Wood, R.D., Schultz, R.A., & Ellenberger, T. (2006) DNA Repair and Mutagenesis, 2nd edn, American Society for Microbiology, Washington, DC. A thorough treatment of DNA metabolism and a good place to

Marnett, L.J. & Plastaras, J.P. (2001) Endogenous DNA damage and mutation. Trends

Genet. 17, 214-221.

Sancar, A. (1996) DNA excision repair. Annu Rev Biochem 65, 43-8 1 .

start exploring this field.

Sutton, M.D., Smith, B.T., Godoy, V.G., & Walker, G.C. (2000)

Kornberg, A. & Baker, T.A. (1991) DNA Replication, 2nd edn,

The SOS response: recent insights into umuDC-dependent mutagen­

W. H Freeman and Company, New York. Excellent primary source for all aspects of DNA metabolism.

Rev Genet. 34, 4 79-497.

excision repair, and its relation to aging and disease. DNA

DNA Replication

Repair 6,

544-559.

Benkovic, S.J., Valentine, A.M., & Salinas, F. (2001) R eplisome­ mediated DNA replication

esis and DNA damage toleranc e . Annu.

Wilson, D.M. III & Bohr, V.A. (2007) The mechanics of base

Annu Rev. Biochem. 70, 18 1-208.

This review describes the similar strategies and enzymes of DNA replication in different classes of organisms.

Wood, R.D., Mitchell, M., Sgouros, J., & Lindahl, T. (2001) Human DNA repair genes.

Science 291, 1284-1289 .

What an early look at the human genome revealed about DNA repair.

Bloom, L.B. (2006) Dynamics of loading the Escherichia coli DNA polymerase processivity clamp

Grit Rev. Biochem Mol Biol. 41,

1 79-208.

Frick, D.N. & Richardson, C.C. (2001) DNA primases. Annu. Rev.

Biochem 70, 39-80.

DNA Recombination Cox, M.M. (2001) Historical overview: searching for replication help in all of the rec places. Proc.

Natl. Acad. Sci USA 98, 8173-8180.

A review of how recombination was shown to be a replication­

Heller, R.C. & Marians, K.J. (2006) Replisome assembly and the

fork repair process.

direct restart of stalled replication forks.

Cox, M.M. (2007) R egulation of bacterial RecA protein function.

Nat Rev. Mol Celt Biol. 7,

932-943. Mechanisms for the restart of replication forks before the repair of DNA damage.

Hiibscher, U., Maga, G., & Spadari, S. (2002) Eukaryotic DNA polymerases . Annu.

Rev Biochem 71, 133- 1 63.

Good summary of the properties and roles of the more than one dozen known eukaryotic DNA polymerases.

Rev. Mol. Cell

253-254.

Gellert, M. (2002) V(D)J recombination: RAG proteins, repair factors, and regulation . Annu

Rev. Biochem 71, 101-132.

nisms of site-specific recombination. Annu.

Rev. Biochem. 75,

567-605.

Hallet, B. & Sherratt, D.J. (1997) Transposition and site-specific

Biol. 7, 751- 76 1 . Kamada, K., Horiuchi, T., Ohsnmi, K., Shimamoto, N., & Morikawa, K. (1996) Structure of a replication-tenninator protein complexed with DNA. Nature

383, 598-603.

The report revealing the structure of the Tus-Ter complex

Kool, E.T. (2002) Active site tightness and substrate fit in DNA replication . Annu

Craig, N.L. (1995) Unity in transposition reactions. Science 270,

Grindley, N.D.F., Whiteson, K.L., & Rice, P.A. (2006) Mecha­

lndiani, C. & O'Donnell, M. (2006) The replication clamp-loading machine at work in the three domains of life. Nat

Grit. Rev Biochem. Mol. Biol. 42, 41-63.

Rev Biochem 71, 191-219.

Excellent sununary of the molecular basis of replication fidelity by a DNA polymerase-base-pair geometry as well as hydrogen bonding.

recombination: adapting DNA cut-and-paste mechanisms to a variety of genetic rearrangements.

FEMS Microbial. Rev. 21, 157-1 78 .

Haniford, D.B. (2006) Transpososome dynamics and regulation in Tn10 transposition.

Grit Rev. Biochem Mol Biol. 41, 407-424.

A detailed look at one well-studied bacterial transposon.

Lusetti, S.L. & Cox, M.M. (2002) The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu

Rev. Biochem. 71, 7 1-100.

� 01 �

DNA Metabolism

Paques, F. & Haber, J.E. (1 999) Multiple pathways of recombina­

tion induced by double-strand breaks in Saccharomyces cerevisiae

Microbial. Mol Biol Rev. 63, 349-404.

Singleton, M.R., Dillingham, M.S., Gaudier, M., Kowal­ czykowski, S.C., & Wigley, D.B. (2004) C1ystal structure of

RecBCD enzyme reveals a machine for processing DNA breaks.

Nature 432, 187-193. Van Duyne, G.D. (200 1 ) A structural view of Cre-loxP site-specific

recombination. Annu Rev Biophys Biomol Struct. 30, 87-104 A nice structural analysis of a site-specific recombination system

(a) If any one of the four nucleotide precursors were omit­ ted from the incubation mixture, would radioactivity be found in the precipitate? Explain. (b) Would 3 2P be incorporated into the DNA if only dTTP were labeled? Explain.

(c) Would radioactivity be found in the precipitate if 3 2P

labeled the {3 or y phosphate rather than the the deoxyribonucleotides? Explain.

a

phosphate of

6. The Chemistry of DNA Replication All DNA poly­

merases synthesize new DNA strands in the 5'�3' direction. In some respects, replication of the antiparallel strands of du­

Problems

plex DNA would be simpler if there were also a second type of polymerase , one that synthesized DNA in the 3' �5 ' direction.

1 . Conclusions from the Meselson-Stahl Experiment

The Meselson-Stahl experiment (see Fig. 25-2) proved that

The two types of polymerase could, in principle, coordinate DNA synthesis without the complicated mechanics required

DNA undergoes semiconservative replication in E. coli. In the

for lagging strand replication. However, no such 3 '�5'­

strands are cleaved into pieces of random size, then joined

mechanisms for 3 '�5' DNA synthesis. Pyrophosphate should

"dispersive" model of DNA replication, the parent DNA with pieces of newly replicated DNA to yield daughter du­ plexes. Explain how the results of Meselson and Stahl's exper­ iment ruled out such a model. of E. coli growing in a medium containing 1 5NH Cl is switched 4 to a medium containing 1 4NH4Cl for three generations (an eightfold increase in population) . What is the molar ratio of hy­

brid DNA (5N- 1 4N) to light DNA (4N-14N) at this point?

3. Replication of the E. coli Chromosome The E coli

chromosome contains 4,639,221 bp.

(a) How many turns of the double helix must be unwound during replication of the E. coli chromosome?

(b) From the data in this chapter, how long would it take

to replicate the E. coli chromosome at 37 oc if two replication

forks proceeded from the origin? Assume replication occurs at a rate of 1 ,000 bp/s. Under some conditions E. coli cells can di­

vide every 20 min. How might this be possible?

(c) In the replication of the E. coli chromosome, about

how many Okazaki fragments would be formed? What factors guarantee that the numerous Okazaki fragments are assem­ bled in the correct order in the new DNA? Composition of DNAs

be one product of both proposed reactions. Could one or both mechanisms be supported in a cell? Why or why not? (Hint: You may suggest the use of DNA precursors not actually pres­

2. Heavy Isotope Analysis of DNA Replication A culture

4. Base

synthesizing enzyme has been found. Suggest two possible

Made

ent in extant cells.) 7. Leading and Lagging Strands Prepare a table that lists

the names and compares the functions of the precursors, en­

zymes, and other proteins needed to make the leading strand versus the lagging strand during DNA replication in E. coli. 8. Function of DNA Ligase Some E. coli mutants contain

defective DNA ligase. When these mutants are exposed to 3 H­

labeled thymine and the DNA produced is sedimented on an alkaline sucrose density gradient, two radioactive bands ap­ pear. One corresponds to a high molecular weight fraction, the other to a low molecular weight fraction. Explain. 9. Fidelity of Replication of DNA What factors promote

the fidelity of replication during synthesis of the leading strand of DNA? Would you expect the lagging strand to be made with the same fidelity? Give reasons for your answers. 10. Importance of DNA Topoisomerases in DNA Repli­ cation DNA unwinding, such as that occurring in replication,

from Single­

affects the superhelical density of DNA. In the absence of

Stranded Templates Predict the base composition of the to­

topoisomerases, the DNA would become overwound ahead of

tal DNA synthesized by DNA polymerase on templates

a replication fork as the DNA is unwound behind it. A bacter­

provided by an equimolar mixture of the two complementary strands of bacteriophage ¢X1 74 DNA (a circular DNA mole­

ial replication fork will stall when the superhelical density (a)

of the DNA ahead of the fork reaches + 0 . 1 4 (see Chapter 24) .

cule) . The base composition of one strand is A, 24. 7% ; G,

Bidirectional replication is initiated at the origin of a 6,000

24. 1 % ; C, 18.5%; and T, 32.7% . What assumption is necessaJy to answer this problem?

bp plasmid in vitro, in the absence of topoisomerases. The

5. DNA Replication Kornberg and his colleagues incubated

soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the a-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate.

plasmid initially has a a of -0.06. How many base pairs will be

unwound and replicated by each replication fork before the forks stall? Assume that each fork travels at the same rate and

that each includes all components necessary for elongation ex­ cept topoisomerase. 1 1 . The Ames Test In a nutrient medium that lacks histi­

cline,

a

thin layer of agar containing - 1 09 Salmonella ty­

phimurium histidine auxotrophs (mutant cells that require

histidine to survive) produces - 1 3 colonies over a two-day

Problems

� 01 �

incubation period at 37 oc (see Fig. 25-2 1 ) . How do these

Data Ana lysis Problem

repeated in the presence of 0.4 p,g of 2-aminoanthracene. The

1 6 . Mutagenesis in Escherichia coli Many mutagenic

colonies arise in the absence of histidine? The experiment is number of colonies produced over two days exceeds 10,000.

compounds act by alkylating the bases in DNA. The alkylating

What does this indicate about 2-aminoanthracene? What can

agent R7000 (7-methoxy-2-nitronaptho[2, 1 -b ]furan) is an

you surmise about its carcinogenicity?

extremely potent mutagen.

CH3

1 2 . DNA Repair Mechanisms Vertebrate and plant cells

n _ 1 1JJ-No,

often methylate cytosine in DNA to form 5-methylcytosine (see Fig. 8-5a) . In these same cells, a specialized repair sys­ tem recognizes G-T mismatches and repairs them to o-c

base pairs. How might this repair system be advantageous to

the cell? (Explain in terms of the presence of 5-methylcytosine

R7000

in the DNA.) .. .

13. DNA Repair in People with Xeroderma Pig­ mentosum The condition known as xeroderma pig-

mentosum (XP) arises from mutations in at least seven different human genes (see Box 25-1 ) . The deficiencies are generally in genes encoding enzymes involved in some part of the pathway for human nucleotide-excision repair. The vari­ ous types of XP are denoted A through G (XPA, XPB, etc.) , with a few additional variants lumped under the label XP-V. Cultures of fibroblasts from healthy individuals and from patients with XPG are irradiated with ultraviolet light. The DNA is isolated and denatured, and the resulting single-stranded DNA is characterized by analytical ultracentrifugation. (a) Samples from the normal fibroblasts show a significant reduction in the average molecular weight of the single­ stranded DNA after irradiation, but samples from the XPG fi­ broblasts show no such reduction. Why might this be? (b) If you assume that a nucleotide-excision repair system is operative in fibroblasts, which step might be defective in the cells from the patients with XPG? Explain. 14. Holliday Intermediates How does the formation of

Holliday intermediates in homologous genetic recombination differ from their formation in site-specific recombination? 15. A Connection between Replication and Site-Specific Recombination Most wild strains of Saccharomyces cere­ v·isiae have multiple copies of the circular plasmid 2p, (named for its contour length of about 2 p,m) , which has �6,300 bp of DNA. For its replication the plasmid uses the host replication system, under the same strict control as the host cell chromo­ somes, replicating only once per cell cycle. Replication of the

plasmid is bidirectional, with both replication forks initiating at a single, well-defined origin. However, one replication cycle of a 2p, plasmid can result in more than two copies of the plas­

In vivo, R7000 is activated by the enzyme nitroreductase, and this more reactive form covalently attaches to DNA-primarily, but not exclusively, to G-C base pairs. In a 1 996 study, Quillardet, Touati, and Hofnung explored the mechanisms by which R7000 causes mutations in E. coli.

They compared the genotoxic activity of R7000 in two strains of E. coli: the wild-type (uvr+) and mutants lacking uvrA ac­

tivity (uvr- ; see Table 25-6) . They first measured rates of mu­ tagenesis. Rifampicin is an inhibitor of RNA polymerase (see Chapter 26) . In its presence, cells will not grow unless certain mutations occur in the gene encoding RNA polymerase; the appearance of rifampicin-resistant colonies thus provides a useful measure of mutagenesis rates. The effects of different concentrations of R7000 were de­ termined, with the results shown in the graph below. "'0

.g

1l 1,000 �----, 0, rn

8

§

100

] §

""

.� 00

10

� � ·c ·a s

.ci iU (l::.ndi !G A ··Ci tc u Gl la· A ; (j:J ii�J::tJ:!:�H:Q':im�·:: :O� !�::; :�::r:::Uj - - - 3 ' .

Reading frame 2

- - -]) Ju C uJJc G Gj[EJ;:=-::_g] Ju G G//A G A//u U C//A C A/ /G

Reading frame 3

- - - U U[[C U C[[G G A[ [C C u[JG G A[ [G A u[ [U C A[ [C A G[ [![ - - -

U ---

FIGURE 27-5 Reading frames in the genetic code. I n a triplet, nonoverlapping code, a l l m R NAs have three potentia l reading frames, shaded here in different colors. The triplets, and hence the amino acids specified, are different in each reading frame.

nucleotide triplets are read in a successive, nonoverlap­ ping fashion. A specific first codon in the sequence es­ tablishes the reading frame, in which a new codon begins every three nucleotide residues. There is no punctuation between codons for successive amino acid residues. The amino acid sequence of a protein is de­ fined by a linear sequence of contiguous triplets. In prin­ ciple, any given single-stranded DNA or mRNA sequence has three possible reading frames. Each read­ ing frame gives a different sequence of codons ( Fig. 2 7-5 ), but only one is likely to encode a given protein. A key question remained: what were the three-letter code words for each amino acid? In 196 1 Marshall Niren­ berg and Heinrich Matthaei reported the first break­ through. They incubated syn­ thetic polyuridylate, poly(U) , with an E. coli extract, GTP, ATP, and a mixture of the 20 amino acids in 20 different tubes, each tube containing a different radioactively labeled amino acid. Because poly(U) mRNA is made up of many suc­ Marshall N i renberg cessive UUU triplets, it should promote the synthesis of a polypeptide containing only the amino acid encoded by the triplet UUU. A radioactive polypeptide was indeed formed in only one of the 20 tubes, the one containing radioactive phenylalanine . Nirenberg and Matthaei therefore concluded that the triplet codon UUU encodes

phenylalanine . The same approach soon revealed that polycytidylate, poly(C) , encodes a polypeptide contain­ ing only proline (polyproline) , and polyadenylate, poly(A) , encodes polylysine. Polyguanylate did not gen­ erate any polypeptide in this experiment because it spontaneously forms tetraplexes (see Fig. 8-20) that cannot be bound by ribosomes. The synthetic polynucleotides used in such experi­ ments were prepared with polynucleotide phosphory­ lase (p. 1 049) , which catalyzes the formation of RNA polymers starting from ADP, UDP, CDP, and GDP. This enzyme, discovered by Severo Ochoa, requires no template and makes polymers with a base composition that directly reflects the relative concentrations of the nucleoside 5 ' -diphosphate precursors in the medium. If polynucleotide phosphorylase is presented with UDP only, it makes only poly(U) . If it is presented with a mixture of five parts ADP and one part CDP, it makes a polymer in which about five-sixths of the residues are adenylate and one-sixth are cytidylate. This ran­ dom polymer is likely to have many triplets of the se­ quence AAA, smaller numbers of AAC, ACA, and CAA triplets, relatively few ACC, CCA, and CAC triplets , and very few CCC triplets (Table 27- 1 ) . Using a vari­ ety of artificial mRNAs made by polynucleotide phos­ phorylase from different starting mixtures of ADP, GDP, UDP, and CDP, the Nirenberg and Ochoa groups soon identified the base compositions of the triplets coding for almost all the amino acids. Although these experiments revealed the base composition of the coding triplets, they usually could not reveal the se­ quence of the bases.

� 06�

Protein Metabolism

TABLE 2 7- 1

Incorporation of Amino Adds into Polypeptides in Response to Random Polymers of RNA Observed frequency of incorporation (Lys = 100)

Amino acid

Tentative assignment for nucleotide composition of corresponding codon*

Expected frequency of incorporation based on assignment (Lys = 100)

Asparagine

24

A2 C

20

Glutamine

24

A2C

20

6

AC 2

4

100

AAA

1 00

Histidine Lysine Proline Threonine

7

AC 2 , CCC

26

A2 C, AC 2

4.8 24

Note: Presented here is a summary of data from one of the early experiments designed to elucidate the genetic code. A synthetic RNA 5:1 ratio directed polypeptide synthesis, and both the identity and the quantity of incorporated

containing only A and C residues in a

amino acids were determined. Based on the relative abundance of A and C residues in the synthetic RNA, and assigning the codon AAA (the most likely codon) a frequency of 100, there should be three different codons of composition A2C, each at a relative frequency of 20; three of composition AC2, each at a relative frequency of 4.0; and CCC at a relative frequency of 0.8. The CCC assignment was based on information derived from prior studies with poly( C). Where two tentative codon assignments a re made, both are proposed to code for the same amino acid. *These designations of nucleotide composition contain no information on nucleotide sequence (except, of course, AAA and CCC).

KEY CONVENT I O N : Much of the following discussion deals

chemically synthesized small oligonucleotides. With this

with tRNAs . The amino acid specified by a tRNA is indi­

technique researchers determined which aminoacyl­

cated by a superscript, such as tRNAA1a, and the amino­

tRNA bound to

acylated tRNA by a hyphenated name: alanyl-tRNAAJa or

some codons, either no aminoacyl-tRNA or more than

Ala-tRNAAJa. •

one would bind. Another method was needed to com­

In

1 964

54

of the

64 possible

plete and confirm the entire genetic code.

Nirenberg and Philip Leder achieved an­

other experimental breakthrough. Isolated

E. coli ribo­

At about this time , a com­ plementary approach was pro­

somes would bind a specific aminoacyl-tRNA in the

vided by

presence of the corresponding synthetic polynucleotide

who developed chemical meth­

H.

Gobind Khorana,

messenger. For example, ribosomes incubated with

ods to synthesize polyribonu­

poly(U) and phenylalanyl-tRNAPhe (Phe-tRNAPhe) bind

cleotides with defined, repeating

both RNAs, but if the ribosomes are incubated with

sequences of two to four bases.

poly(U) and some other aminoacyl-tRNA, the aminoacyl­

The polypeptides produced by

tRNA is not bound, because it does not recognize the

these mRNAs had one or a few

UUU triplets in poly(U)

amino acids in repeating pat­

(Table

2 7-2) .

Even trinu­

cleotides could promote specific binding of appropriate

terns.

tRNAs , so these experiments could be carried out with

combined with information from

These

patterns,

when

the random polymers used by

TABLE 2 7- 2

triplet codons. For

Trinudeotides That Induce Specific Binding of Aminoacyl-tRNAs to Ribosomes

Relative increase in 14C-labeled aminoacyl-tRNA bound to ribosome*

Trinucleotide Phe-tRNAPhe Lys..tRNALys Pro-tRNAPro uuu

4.6

0

0

AAA

0

7.7

0

CCC

0

0

3.1

Source: Modified from N i renberg, M. synthesis. Science 145, 1399.

& Leder, P. ( 1964) RNA code words and protein

14 *Each number represents the factor by which the amount of bound C increased when the indicated trinucleotide was present, relative to a control with no trinucleotide

H . Gobi nd Khorana

Nirenberg and colleagues, permitted unambiguous codon assignments. The copolymer (AC)n, for example, has alter­ nating ACA and CAC codons: ACACACACACACACA. The polypeptide synthesized on this messenger contained equal amounts of threonine and histidine. Given codon has one A and two Cs (Table

27-1) ,

that a histidine

CAC must code

for histidine and ACA for threonine. Consolidation of the results from many experi­ ments permitted the assignment of 61 of the

64 possible

codons. The other three were identified as termination codons, in part because they disrupted amino acid coding patterns when they occurred in a synthetic RNA polymer

(Fig. 2 7-6). Meanings for all the triplet Fig. 2 7-7) were established by

codons (tabulated in

1 966

and have been verified in many different ways.

27.1 The Genetic Code

Reading frame 1

- - -j:�i'ij':t;,tA:li�::r:�.: ·'lli:J jA,::·�:::�j jU

5'

A

Aj j�:::�i::j:[lj l�i:;];�:!::;:fij'j A A - -

Reading frame 2

- - - G jlJ A A ljG U AjjA G UjjA A G j jp

Reading frame 3

n -

G

u

IA A GIIu A A II G

u

A II A G

u

A

[2 06�

3'

A j jG U A l A - - -

I I A A G I Iu A A 1 - - -

FIGURE 2 7-6 Effect of a termination codon in a repeating tetranucleotide. Termi nation codons (pi nk) are encountered every fourth codon in three different reading frames (shown in different colors) . Dipeptides or tripeptides are synthesized, depending on where the ribosome in itially binds. The cracking of the genetic code is regarded as one of the most important scientific discoveries of the twenti­ eth century. Codons are the key to the translation of genetic in­ formation, directing the synthesis of specific proteins. The reading frame is set when translation of an mRNA molecule begins, and it is maintained as the synthetic machinery reads sequentially from one triplet to the next. If the initial reading frame is off by one or two bases, or if translation somehow skips a nucleotide in the mRNA, all the subsequent codons will be out of reg­ ister; the result is usually a "missense" protein with a garbled amino acid sequence. Several codons serve special functions (Fig. 27-7) . The initiation codon AUG is the most common signal for the beginning of a polypeptide in all cells, in addition to coding for Met residues in internal positions of

!

First letter of codon (5' end)

u

c

A

G

Second letter of codon

A

c

u

G

uuu uuc

Phe Phe

ucu ucc

Ser Ser

UAU UAC

Tyr Tyr

UGU UGC

Cys Cys

UUA UUG

Leu Leu

UCA UCG

Ser Ser

UAA UAG

Stop Stop

UGA UGG

Stop Trp

cuu cue

Leu Leu

ccu

CCC

Pro Pro

CAU CAC

His His

CGU CGC

Arg Arg

CUA CUG

Leu Leu

CCA CCG

Pro Pro

CAA CAG

Gin CGA Gin CGG

Arg Arg

AUU AUC

Ile Ile

ACU ACC

Thr Thr

AAU AAC

Asn Asn

AGU AGC

Ser Ser

AUA AUG

Ile Met

ACA ACG

Thr Thr

AAA AAG

Lys Lys

AGA AGG

Arg Arg

GUU GUC

Val Val

GCU GCC

Ala Ala

GAU GAC

Asp

Asp GGU GGC

Gly

GUA GUG

Val Val

GCA GCG

Ala Ala

GAA GAG

Glu GGA Glu GGG

Gly Gly

Gly

F I G U R E 2 7 - 7 "Dictionary" of amino acid code words in mRNAs. The codons are written in the 5 ' --1 3 ' d i rection. The third base of each codon (in bold type) plays a lesser role in specifying an amino acid than the first two. The three termination codons are shaded i n pink, the i n itiation codon AUG in green. All the amino acids except methionine and tryptophan have more than one codon. In most cases, codons that specify the same amino acid differ only at the third base.

polypeptides. The termination codons (UAA, UAG, and UGA) , also called stop codons or nonsense codons, normally signal the end of polypeptide synthesis and do not code for any known amino acids. Some deviations from these rules are discussed in Box 27-1 . As described in Section 27.2, initiation of protein synthesis in the cell is an elaborate process that relies on initiation co dons and other signals in the mRNA In retro­ spect, the experiments of Nirenberg, Khorana, and oth­ ers to identify codon function should not have worked in the absence of initiation codons. Serendipitously, exper­ imental conditions caused the normal initiation require­ ments for protein synthesis to be relaxed. Diligence combined with chance to produce a breakthrough-a common occurrence in the history of biochemistry. In a random sequence of nucleotides, 1 in every 20 codons in each reading frame is, on average , a termina­ tion codon. In general, a reading frame without a termi­ nation codon among 50 or more codons is referred to as an open reading frame (ORF ) . Long open reading frames usually correspond to genes that encode pro­ teins. In the analysis of sequence databases, sophisti­ cated programs are used to search for open reading frames in order to find genes among the often huge background of nongenic DNA An uninterrupted gene coding for a typical protein with a molecular weight of 60,000 would require an open reading frame with 500 or more codons. A striking feature of the genetic code is that an amino acid may be specified by more than one codon, so the code is described as degenerate. This does not sug­ gest that the code is flawed: although an amino acid may have two or more codons, each codon specifies only one amino acid. The degeneracy of the code is not uniform. Whereas methionine and tryptophan have single codons, for example, three amino acids (Arg, Leu, Ser) have six codons, five amino acids have four, isoleucine has three, and nine amino acids have two (Table 27-3) . The genetic code is nearly universaL With the in­ triguing exception of a few minor variations in mitochon­ dria, some bacteria, and some single-celled eukaryotes (Box 2 7-1) , amino acid codons are identical in all species examined so far. Human beings, E. coli, tobacco plants, amphibians, and viruses share the same genetic code. Thus it would appear that all life forms have a common evolutionary ancestor, whose genetic code has been pre­ served throughout biological evolution. Even the varia­ tions reinforce this theme.

� 07�

Protein Metabolism

B O X 2 7-1 In biochemistry, as in other disciplines, exceptions to

encodes only 10 to 20 proteins. Mitochondria have their own

general rules can be problematic for instructors and

tRNAs, so their code variations do not affect the much larger

frustrating for students. At the same time, though, they

cellular genome. The most common changes in mitochon­

teach us that life is complex and inspire us to search for

dria (and the only code changes that have been observed in

more surprises. Understanding the exceptions can even

cellular genomes) involve termination codons. These

reinforce the original rule in surprising ways.

changes affect termination in the products of only a subset

One would expect little room for variation in the ge­ netic code. Even a single amino acid substitution can have

of genes, and sometimes the effects are minor because the genes have multiple (redundant) termination codons. Vertebrate mtDNAs have genes that encode

profoundly deleterious effects on the structure of a pro­ tein. Nevertheless, variations in the code do occur in some

teins ,

13 pro­ 2 rRNAs, and 22 tRNAs (see Fig. 1 9-38) . The

organisms, and they are both interesting and instructive.

small number of codon reassignments, along with an un­

The types of variation and their rarity provide powerful ev­

usual set of wobble rules (p.

idence for a common evolutionary origin of all living things.

sufficient to decode the protein genes, as opposed to the

1 072) , makes the 22 tRNAs

To alter the code, changes must occur in the

32 tRNAs required for the normal code. In mitochon­

gene(s) encoding one or more tRNAs, with the obvious

dria, these changes can be viewed as a kind of genomic

target for alteration being the anticodon. Such a change

streamlining, as a smaller genome confers a replication

would lead to the systematic insertion of an amino acid

advantage on the organelle. Four codon families (in

at a codon that, according to the normal code (see

which the amino acid is determined entirely by the first

Fig.

27-7) , does not specify that amino acid. The genetic code, in effect, is defined by two elements: (1) the anti­

two nucleotides) are decoded by a single tRNA with a U

codons on tRNAs (which determine where an amino acid

codon. Either the U pairs somehow with any of the four

is placed in a growing polypeptide) and

possible bases in the third position of the codon or a

(2) the specificity

residue in the first (or wobble) position in the anti­

of the enzymes-the aminoacyl-tRNA synthetases-that

"two out of three" mechanism is used-that is, no base

charge the tRNAs , which determines the identity of the

pairing is needed at the third position. Other tRNAs rec­

amino acid attached to a given tRNA.

ognize codons with either A or G in the third position,

Most sudden changes in the code would have cata­ strophic effects on cellular proteins, so code alterations

and yet others recognize U or C, so that virtually all the tRNAs recognize either two or four codons.

are more likely to persist where relatively few proteins

In the normal code, only two amino acids are specified

would be affected-such as in small genomes encoding

by single codons: methionine and tryptophan (see Table

only a few proteins. The biological consequences of a

27 -3). If all mitochondrial tRNAs recognize two codons, we

code change could also be limited by restricting changes

would expect additional Met and Trp codons in mitochon­

to the three termination codons, which do not generally

dria. And we find that the single most common code varia­

occur within genes (see Box

27-4 for exceptions to this

rule) . This pattern is in fact observed.

tion is the normal termination codon UGA specifying tryptophan. The tRNATrp recognizes and inserts a Trp

Of the very few variations in the genetic code that we

residue at either UGA or the normal Trp codon, UGG. The

know of, most occur in mitochondrial DNA (mtDNA) , which

second most common variation is conversion of AUA from

TABLE 2 7 -3 Amino acid

Number of codons

Met

1

Trp

1

Amino acid Tyr

Number of codons 2

Ile

3

Wobble Allows Some tRNAs to Recognize More than One Codon

When several different codons specify one amino acid, the difference between them usually lies at the third base position (at the

3 ' end) . For example , alanine is

XY� XYg. The first two letters of each codon are the pri­

coded by the triplets GCU, GCC, GCA, and GCG. The

Asn

2

Ala

4

codons for most amino acids can be symbolized by

Asp

2

Gly

4

or

Cys

2

Pro

4

Gln

2

Thr

4

Glu

2

Val

4

His

2

Arg

6

Lys

2

Leu

6

direction) pairs with the third base of the anticodon

Phe

2

Ser

6

(Fig. 2 7-Sa). If the anticodon triplet of a tRNA recog­

mary determinants of specificity, a feature that has some interesting consequences.

Transfer RNAs base-pair with mRNA codons at a three-base sequence on the tRNA called the

anticodon. 5' �3 '

The first base of the codon in mRNA (read in the

nized only one codon triplet through Watson-Crick base

27.1

The Genetic Code

� 07�

Known Variant Codon Assignments in Mitochondria Codons*

Normal code assignment Animals Vertebrates Drosophila

UGA

AVA

AGA AGG

CUN

CGG

Stop

lle

Arg

Leu

Arg

Trp

Met Met

Stop Ser

+ +

+ +

Met Met +

+ + +

Thr Thr +

+ ? +

Trp

+

+

+

+

+

+

+

+

+

+

+

+

?

+

+

+

Trp

Yeasts Saccharomyces cerevisiae Torulopsis glabrata Schizosaccharomyces pombe

Trp Trp Trp

Filamentous fungi

Trp

Trypanosomes Higher plants Chlamydomonas reinhardtii

Trp ?

*N indicates any nucleotide; + , codon has the same meaning as in the normal code; ?, codon not observed in this mitochondrial genome.

an lie codon to a Met codon; the normal Met codon is AUG, and a single tRNA recognizes both codons. The known cod­ ing variations in mitochondria are summarized in Table 1 . Turning t o the much rarer changes in the codes for cellular (as distinct from mitochondrial) genomes, we find that the only known variation in a bacterium is again the use of UGA to encode Trp residues, occurring in the sim­ plest free-living cell, Mycoplasma capricolum. Among eukaryotes, the only known extramitochondrial coding changes occur in a few species of ciliated protists, in which both termination codons UAA and UAG can specify gluta­ mine. There are also rare but interesting cases where stop codons have been adapted to encode amino acids that are not among the standard 20, as detailed in Box 27-3. 3'

Changes in the code need not be absolute; a codon might not always encode the same amino acid. For example, in many bacteria-including E. coli--GUG (Val) is some­ times used as an initiation codon that specifies Met. This oc­ curs only for those genes in which the GUG is properly located relative to particular mRNA sequences that affect the initiation of translation (as discussed in Section 27.2) . These variations tell us that the code is not quite as uni­ versal as once believed, but that its flexibility is severely constrained. The variations are obviously derivatives of the normal code, and no example of a completely different code has been found. The limited scope of code variants strengthens the principle that all life on this planet evolved on the basis of a single (slightly flexible) genetic code.

pairing at all three positions, cells would have a different tRNA for each amino acid codon. This is not the case, however, because the anticodons in some tRNAs include the nucleotide inosinate (designated I) , which contains the uncommon base hypoxanthine (see Fig. 8-5b ) .

5' tRNA

3

2

1

3

-

mRNA 5' -----

11 2

(a)

31 ----Codon

3'

2

3

1

c-G-ir

Codon (5') e-G-A 1

2

G-C- 1

Anticodon (3') G-C-1

(b)

1

2

3

3

2

1

G-C- 1 (5') c-G-c (3') 1

2

3

FIGURE 17-8 Pairing relationship of codon and anticodon. (a) Align­ ment of the two RNAs is antiparallel. The tRNA is shown in the tradi­ tional cloverleaf configuration. (b) Three different codon pairing relationships are possible when the tRNA anticodon contains inosinate.

�07�

Protein Metabolism

Inosinate can form hydrogen bonds with three different nucleotides (U, C, and A; Fig. 27-8b), although these pairings are much weaker than the hydrogen bonds of Watson-Crick base pairs (G = C and A= U). In yeast, one tRNAArg has the anticodon (5')ICG, which recognizes three arginine codons: (5')CGA, (5')CGU, and (5')CGC. The first two bases are identical (CG) and form strong Watson-Crick base pairs with the corresponding bases of the anticodon, but the third base (A, U, or C) forms rather weak hydrogen bonds with the I residue at the first position of the anticodon. Examination of these and other codon-anticodon pairings led Crick to conclude that the third base of most codons pairs rather loosely with the corresponding base of its anticodon; to use his picturesque word, the third base of such codons (and the first base of their cor­ responding anticodons) "wobbles." Crick proposed a set of four relationships called the wobble hypothesis: 1.

The first two bases of an mRNA codon always form strong Watson-Crick base pairs with the correspon­ ding bases of the tRNA anticodon and confer most of the coding specificity.

2. The first base of the anticodon (reading in the 5'�3' direction; this pairs with the third base of the codon) determines the number of codons rec­ ognized by the tRNA. When the first base of the an­ ticodon is C or A, base pairing is specific and only one codon is recognized by that tRNA. When the first base is U or G, binding is less specific and two different codons may be read. When inosine (I) is the first (wobble) nucleotide of an anticodon, three different codons can be recognized-the maximum number for any tRNA. These relationships are sum­ marized in Table 27-4. 3. When an amino acid is specified by several different codons, the codons that differ in either of the first two bases require different tRNAs. 4. A minimum of 32 tRNAs are required to translate all 61 codons (31 to encode the amino acids and 1 for initiation). The wobble (or third) base of the codon contributes to specificity, but, because it pairs only loosely with its corresponding base in the anticodon, it permits rapid dissociation of the tRNA from its codon during protein synthesis. If all three bases of a codon engaged in strong Watson-Crick pairing with the three bases of the anti­ codon, tRNAs would dissociate too slowly and this would severely limit the rate of protein synthesis. Codon-anticodon interactions balance the requirements for accuracy and speed. The genetic code tells us how protein sequence in­ formation is stored in nucleic acids and provides some clues about how that information is translated into pro­ tein. We now turn to the molecular mechanisms of the translation process.

TA B LE 27-4

How the Wobble Base of the Anticodon Determines the Number of Codons a tRNA can Recognize

--------------�

1 . One codon recognized: Anticodon

(3')

X- Y- Q (5')

(3')

X- Y- A (5')

Codon

(5')

X'- Y'-G (3')

(5')

X'-Y'-U (3')

2. Two codons recognized: Anticodon

(3')

X- Y- U (5')

(3')

X- Y- G (5')

Codon

(5')

X'- Y'-� (3')

(5')

X'- Y'-3 (3')

3. Three codons recognized: Anticodon

(3')

X -Y-! (5')

Codon

(5')

X'-Y'-� (3') C.

Note: X andY denote bases complementary to and capable of strong Watson-Crick base pairing with X' andY'. respectively. Wobble bases-in the 3' position of codons

and 5' position of anticodons-are shaded in pink.

Translational Frameshifting and RNA Editing Affect How the Code Is Read

Once the reading frame has been set during protein syn­ thesis, codons are translated without overlap or punctu­ ation until the ribosomal complex encounters a termination codon. The other two possible reading frames usually contain no useful genetic information, but a few genes are structured so that ribosomes "hic­ cup" at a certain point in the translation of their mRNAs, changing the reading frame from that point on. This ap­ pears to be a mechanism either to allow two or more re­ lated but distinct proteins to be produced from a single transcript or to regulate the synthesis of a protein. One of the best-documented examples of transla­ tional frameshifting occurs during translation of the mRNA for the overlapping gag and pol genes of the Rous sarcoma virus (see Fig. 26-35). The reading frame for pol is offset to the left by one base pair (- 1 reading frame) relative to the reading frame for gag (Fig. 27-9) . The product of the pol gene (reverse transcrip­ tase) is translated as a larger polyprotein, on the same mRNA that is used for the gag protein alone (see Fig. 26-34). The polyprotein, or gag-pol protein, is then trimmed to the mature reverse transcriptase by prote­ olytic digestion. Production of the polyprotein requires a translational frameshift in the overlap region to allow the ribosome to bypass the UAG termination codon at the end of the gag gene (shaded pink in Fig. 27-9). Frameshifts occur during about 5% of translations of this mRNA, and the gag-pol polyprotein (and ulti­ mately reverse transcriptase) is synthesized at about one-twentieth the frequency of the gag protein, a level that suffices for efficient reproduction of the virus. In

27. 1 The Genetic Code

gag

Go?�

reading frame

�-�-�-�-�-�-�-� � · ftJ �U� M'fii! 'I tJJ l lf!Uf Ji (fiJ I: ,(l;BJI s - --li'UR�!J:

--- c u

AGG G

c u c c

put t·eacling frame

G

c u u

GA

c

AAA

A' Q:j G G A G G G C c A --- 3' u lA u AIIG G GilA G GiiG c ciA--Ile - Gly - Arg - Ala

u u

FIGURE 27-9 Translational frameshifting in a retroviral transcript. The gag-pol overlap region in Rous sarcoma virus RNA is shown.

some retroviruses, another translational frameshift allows translation of an even larger polyprotein that includes the product of the env gene fused to the gag and pol gene products (see Fig. 26-34). A similar mechanism produces both the T and y subunits of E. coli DNA polymerase III from a single dnaX gene transcript (see Table 25-2). Some mRNAs are edited before translation. RNA editing can involve the addition, deletion, or alteration of nucleotides in the RNA in a manner that affects the meaning of the transcript when it is translated. Addition or deletion of nucleotides has been most commonly ob­ served in RNAs originating from the mitochondrial and chloroplast genomes of eukaryotes. The reactions re­ quire a special class of RNA molecules encoded by these same organelles, with sequences complementary to the edited mRNAs. These guide RNAs (gRNAs; Fig. 27- 1 0) act as templates for the editing process.

DNA coding strand Edited mRNA

The initial transcripts of the genes that encode cy­ tochrome oxidase subunit II in some protist mitochon­ dria provide an example of editing by insertion. These transcripts do not correspond precisely to the sequence needed at the carboxyl terminus of the protein product. A posttranscriptional editing process inserts four U residues that shift the translational reading frame of the transcript. Figure 27-10 shows the added U residues in the small part of the transcript that is affected by editing. Note that the base pairing between the initial transcript and the guide RNA involves a number of G U base pairs (blue dots), which are common in RNA molecules. RNA editing by alteration of nucleotides most com­ monly involves the enzymatic deamination of adenosine or cytidine residues, forming inosine or uridine, respec­ tively ( Fig. 27-1 1 ), although other base changes have been described. Inosine is interpreted as a G residue =

FIGURE 27-10 RNA editing of the transcript

5·--- IA:'.ll\'' �lfl:rt'it':::.iVIl� :' O:]tA:{; 7z��:� JA :'qJE§;::JI'; ''�G! I�?�: ,;;.WI ---



Lys - Val Glu Asn Leu Val ---i:A::A 'Ai'li'Gi'Q'·'�]iG A uliu G Ull A U Aile c uiiG G ui--­ Lys - Val - Asp - Cys - lie - Pro - Gly �







3'

5'

(b)

0 (�NH N -lN) \

0 OH \

\

Adenosine

I nsertion of four

U

residues (pink) produces a

revised read ing frame. (b) A special class of guide RNAs, complementary to the edited process. Note the presence of two

mRNA 5' ---A A A GU A G A u u G u AU A c c u G G Guide RNA sU u AUA u c u A A u A U A u G G A U A

I

from Trypanosoma brucei mitochondria. (a)

product, act as templates for the editing

(a)

0 OH

of the cytochrome oxidase subunit II gene

Ino·ine

(a)

FIGURE 27-1 1 Deamination reactions that result in RNA editing. (a)

The conversion of adenosine nucleotides to i nosi ne nucleotides is

U-

- 3'

base

Watson-Crick pai ring .

J

(AoNH

A� lNAO oc 2 o HH HH 0 OH

\

G=U

pai rs, signified by a blue dot to indicate non­



� \ I

' Cytidine

N \oc , o HH HH 0 OH I

(b)

\

Uridine

catalyzed by ADAR enzymes. (b) Cytidine to uridine conversions are catalyzed by the APOBEC family of enzymes.

� 07�

Protein Metabolism

Residue number 2,156 2,146 2,150 2,154 2,152 2,148 Human liver 5' - - -{O�.'\!t.l1'Zf:H\!!�Ji;i�f1;'€l:1 it!ii��j�ffH�;!:Oii;!�jt·Jf'1'�!iijjjt,A: tf t'£li�Ji:;:Q"'AtllC A All'\1t411J®llltl �����i!fi!J �Cti��:�J llm1tqi,ll -- - 3' (apoB-100) - Gin - Leu - Gin - Thr - Tyr - Met - Ile - Gin - Phe - Asp - Gin - Tyr Human intestine -- -i.m:[L\:,:Ail f�:i·P£:,GJ l'0i'·i:W:ii!:�It'l f�12·:�i!!llijjl ttt.r:: �iil.UI [tA;;:Q::S.I i�!i�;Jf:'A] ltJiA' AIf:llllitWi !:��1:·11Eil !IWjl�ili il'i.�fill --(apoB-48) - Gin - Leu - Gin - Thr - Tyr - Met - Ile Stop FIGURE 27- 1 2 RNA editing of the transcript of the gene for the apoB-1 00 component of LDL. Deami na­

tion, which occurs only in the intestine, converts a specific cytidine to u ridi ne, changing

a

Gin codon to

a stop codon and producing a truncated protei n.

during translation. The adenosine deamination reac­ tions are carried out by adenosine deaminases that act on RNA (ADARs). The cytidine deaminations are car­ ried out by the apoB mRNA editing catalytic peptide (APOBEC) family of enzymes, which includes the re­ lated activation-induced deaminase (AID) enzymes. Both groups of deaminase enzymes have a homologous zinc-coordinating catalytic domain. A well-studied example of RNA editing by deamina­ tion occurs in the gene for the apolipoprotein B compo­ nent of low-density lipoprotein in vertebrates. One form of apolipoprotein B, apoB-100 (Mr 513,000), is synthe­ sized in the liver; a second form, apoB-48 CMr 250,000), is synthesized in the intestine. Both are encoded by an mRNA produced from the gene for apoB-100. An APOBEC cytidine deaminase found only in the intestine binds to the mRNA at the codon for amino acid residue 2,153 (CAA = Gln) and converts the C to aU, to create the termination codon UAA. The apoB-48 produced in the intestine from this modified mRNA is simply an ab­ breviated form (corresponding to the amino-terminal half) of apoB-100 (Fig. 2 7- 1 2 ). This reaction permits tissue-specific synthesis of two different proteins from one gene. The ADAR-promoted A to I editing is particularly common in transcripts derived from the genes of pri­ mates, and perhaps 90% or more of the editing occurs in the short interspersed elements (SINEs) called Alu ele­ ments (see Fig. 24-8). There are over a million of the 300 bp Alu elements in human DNA, making up about 10% of the genome. These are concentrated near protein-encoding genes, often appearing in introns and untranslated regions at the 3' and 5' ends of transcripts. When it is first synthesized (prior to processing), the average human mRNA includes 10 to 20 Alu elements. The ADAR enzymes bind to and promote A to I editing only in duplex regions of RNA. The abundant Alu ele­ ments offer many opportunities for intramolecular base pairing within the transcripts, providing the duplex tar­ gets required by the ADARs. Some of the editing affects the coding sequences of genes. Defects in ADAR func­ tion have been associated with a variety of human neu­ rological conditions, including amyotrophic lateral sclerosis (ALS), epilepsy, and major depression.

The genomes of all vertebrates are replete with SINEs, but there are many different types of SINES present in most of these organisms. The Alu elements predominate only in the primates. Careful screening of genes and transcripts indicates that A to I editing is 30 to 40 times more prevalent in humans than in mice, largely due to the presence of many Alu elements. Large-scale A to I editing and an increased level of alter­ native splicing (see Fig. 26-22) are two features that set primate genomes apart from those of other mammals. It is not yet clear whether these reactions are incidental, or whether they played key roles in the evolution of primates and, ultimately, humans.

S U M M A R Y 27.1 •















The G e n e tic Co d e

The particular amino acid sequence of a protein is constructed through the translation of information encoded in mRNA. This process is carried out by ribosomes. Amino acids are specified by mRNA codons consisting of nucleotide triplets. Translation requires adaptor molecules, the tRNAs, that recognize codons and insert amino acids into their appropriate sequential positions in the polypeptide. The base sequences of the codons were deduced from experiments using synthetic mRNAs of known composition and sequence. The codon AUG signals initiation of translation. The tripletsUAA,UAG, andUGA are signals for termination. The genetic code is degenerate: it has multiple codons for almost every amino acid. The standard genetic code is universal in all species, with some minor deviations in mitochondria and a few single-celled organisms. The third position in each codon is much less specific than the first and second and is said to wobble. Translational frameshifting and RNA editing affect how the genetic code is read during translation.

27.2 Protein Synthesis

27.2 Protein Synthesis

Protein Biosynthesis Takes Place in

As we have seen for DNA and RNA (Chapters 25 and 26),

Five Stages

� 07�

the synthesis of polymeric biomolecules can be consid­

Stage 1: Activation of Amino Acids

ered in terms of initiation, elongation, and termination

thesis of a polypeptide with a defined sequence, two

stages. These fundamental processes are typically brack­

fundamental chemical requirements must be met: (1)

For the syn­

eted by two additional stages: activation of precmsors be­

the carboxyl group of each amino acid must be acti­

fore synthesis and postsynthetic processing of the

vated to facilitate formation of a peptide bond, and (2)

completed polymer. Protein synthesis follows the same

a link must be established between each new amino

pattern. The activation of amino acids before their incor­

acid and the information in the mRNA that encodes it.

poration into polypeptides and the posttranslational pro­

Both these requirements are met by attaching the

cessing of the completed polypeptide play particularly

amino acid to a tRNA in the first stage of protein syn­

important roles in ensliTing both the fidelity of synthesis

thesis. Attaching the right amino acid to the right tRNA

and the proper function of the protein product. The cellu­

is critical. This reaction takes place in the cytosol, not

lar components involved in the five stages of protein syn­

on the ribosome. Each of the 20 amino acids is cova­

coli and other bacteria are listed in Table 27-5;

the requirements in eukaryotic cells are quite similar, al­

lently attached to a specific tRNA at the expense of ATP energy, using Mg2+ -dependent activating enzymes

though the components are in some cases more numer­

known as aminoacyl-tRNA synthetases. When attached

thesis in E.

ous. An initial overview of the stages of protein synthesis

provides a useful outline for the discussion that follows.

TA BLE 27-5

to their amino acid (aminoacylated) the tRNAs are said to be "charged."

Components Required for the Ave Major Stages of Protein

s�m£mU

__ �--------------------

Stage

Essential components

l. Activation of amino acids

20 amino acids 20 aminoacyl-tRNA synthetases 32 or more tRNAs ATP Mg2+

2. Initiation

mRNA N-Formylmethionyl-tRNAJMet Initiation codon in mRNA (AUG) 30S ribosomal subunit 50S ribosomal subunit Initiation factors (IF-1 , IF-2, IF-3) GTP Mg2+

3. Elongation

Functional 70S ribosome (initiation complex) Aminoacyl-tRNAs specified by codons



Elongation factors (EF-Tu, EF-Ts, EF-G) GTP Mg2+ 4. Termination and ribosome

recycling

Termination codon in mRNA Release factors (RF-1, RF-2, RF-3, RRF) EF-G IF-3

5 . Folding and posttranslational processing

Specific enzymes, cofactors, and other components for removal of initiating residues and signal sequences, additional proteolytic processing, modification of terminal residues, and attachment of acetyl, phosphoryl, methyl, carboxyl, carbohydrate, or prosthetic groups

� 07�

Protein Metabolism

TABLE 27-6 Subunit

308 508

RNA and Protein Components of the E. alii Ribosome Number of different proteins

21

33

Total number

Protein

Number and

of proteins

designations

type of rRNA.s

81-821

21

36

L1-L36*

1 (168 rRNA)

2 (58 and 238 rRNAs)

•The Ll to L36 protein designations do not correspond to 36 different proteins. The protein originally designated L7 is in fact a modified form of L12, and

L8 is a complex of three

other proteins. Also, L26 proved to be the same protein as S20 (and not part

of the 50S subunit). This gives 33 different proteins in the large subunit. There are four copies of the L7/L12 protein, with the three extra copies bringing the total protein count to 36.

Stage 2: Initiation The mRNA bearing the code for the polypeptide to be synthesized binds to the smaller of two ribosomal subunits and to the initiating aminoacyl­ tRNA. The large ribosomal subunit then binds to form an initiation complex. The initiating aminoacyl-tRNA base­ pairs with the mRNA codon AUG that signals the begin­ ning of the polypeptide. This process, which requires GTP, is promoted by cytosolic proteins called initiation factors. Stage 3: Elongation The nascent polypeptide is lengthened by covalent attachment of successive amino acid units, each carried to the ribosome and correctly positioned by its tRNA, which base-pairs to its corre­ sponding codon in the mRNA. Elongation requires cy­ tosolic proteins known as elongation factors. The binding of each incoming aminoacyl-tRNA and the movement of the ribosome along the mRNA are facili­ tated by the hydrolysis of GTP as each residue is added to the growing polypeptide. Stage 4: Termination and Ribosome Recycling Completion of the polypeptide chain is signaled by a ter­ mination codon in the mRNA. The new polypeptide is released from the ribosome, aided by proteins called re­ lease factors, and the ribosome is recycled for another round of synthesis. Stage 5: Folding and Posttranslational Processing In order to achieve its biologically active form, the new polypeptide must fold into its proper three-dimensional conformation. Before or after folding, the new polypep­ tide may undergo enzymatic processing, including re­ moval of one or more amino acids (usually from the amino terminus); addition of acetyl, phosphoryl, methyl, carboxyl, or other groups to certain amino acid residues; proteolytic cleavage; and/or attachment of oligosaccha­ rides or prosthetic groups. Before looking at these five stages in detail, we must ex­ amine two key components in protein biosynthesis: the ribosome and tRNAs.

The Ribosome Is a Complex Supramolecular Machine

Each E. coli cell contains 1 5,000 or more ribosomes, ac­ counting for almost a quarter of the dry weight of the cell. Bacterial ribosomes contain about 65% rRNA and 35% protein; they have a diameter of about 18 nm and are composed of two unequal subunits with sedimenta­ tion coefficients of 308 and 50S and a combined sedi­ mentation coefficient of 70S. Both subunits contain dozens of ribosomal proteins and at least one large rRNA (Table 27-6) . Following Zamecnik's dis­ covery that ribosomes are the complexes responsible for protein synthesis, and following elucidation of the genetic code, the study of ribosomes acceler­ ated. In the late 1 960s Masayasu Nomura and colleagues demon­ strated that both ribosomal sub­ units can be broken down into their RNA and protein compo­ nents, then reconstituted in Masayasu Nomura vitro. Under appropriate experimental conditions, the RNA and protein sponta­ neously reassemble to form 308 or 50S subunits nearly identical in structure and activity to native subunits. This breakthrough fueled decades of research into the function and structure of ribosomal RNAs and proteins. At the same time, increasingly sophisticated structural methods revealed more and more details about ribo­ some structure. The dawn of a new millennium brought with it the elucidation of the first high-resolution structures of bac­ terial ribosomal subunits, providing a wealth of sur­ prises ( Fig. 27-13 ). First, the traditional focus on the protein components of ribosomes was shifted. The ribo­ somal subunits are huge RNA molecules. In the 50S sub­ unit, the 58 and 238 rRNAs form the structural core. The proteins are secondary elements in the complex, decorating the surface. Second and most important, there is no protein within 18 A of the active site for

27.2 Protein Synthesis

l!.

07�J

p

50S

(a)

30S

(c)

(d)

50S

FIGURE 27- 1 3 The bacterial ribosome. Our understanding of ri bo­

shown) winds through grooves or chan nels on the 305 subunit

some structure has been greatly enhanced by m u ltiple h igh-resolution

surface. (b) The assembled active bacterial ri bosome, viewed down

i m ages of the bacterial ribosome and its subun its, contributed by

into the groove separati ng the subun its (derived from PDB ID 20W8,

several research groups. A sampl i ng is presented here. (a) The 505 and

1 V5A, and 1 GIX). A l l components are colored as in (a). (c) A pair of

305 bacterial subunits, split apart to visualize the su rfaces that i nter­

ribosome images i n the same orientation as in (b), but with all com­

act in the active ri bosome. The structure on the left is the 505 subunit

ponents shown as su rface renderings to emphasize the mass of the

(derived from PDB I D 20W8, 1 V5A, and 1 GIX), with tRNAs (dis­ played as green backbone structures) bound to sites E, P, and A, de­

entire structure. In the structure on the right, the tRNAs have been omitted to give a better sense of the cleft where protein synthesis

scri bed later in the text; the tRNA anticodons are in red. Proteins

occurs. (d) The 505 bacterial ri bosome subunit (PDB ID 1 Q7Y). The

appear as blue wormlike structures representing the peptide back­

subunit is again viewed from the side that attaches to the 305 subun it,

bone; the rRNA as a gray rendering of the surface featu res. The struc­

but tilted down slightly compared with its orientation in (a). The active

ture on the right is the 305 subu n i t (derived from PDB ID 20W8).

site for peptide bond formation (the peptidyl transferase activity), deep

Prote i n backbones are brown worm l ike structures and the rRNA is a

with i n a su rface groove and far away from any protein, is marked by a

lighter tan surface rendering. The part of the mRNA that i nteracts with

bound i n h i bitor, puromycin (red).

the tRNA anticodons is shown in red . The rest of the m RNA (not

peptide bond formation. The high-resolution structure thus confirms what many had suspected for more than a decade: the ribosome is a ribozyme. In addition to the in­ sight they provide into the mechanism of protein syn­ thesis (as elaborated below), the detailed structures of

the ribosome and its subunits have stimulated a new look at the evolution of life (Box 27-2). The bacterial ribosome is complex, with a combined molecular weight of -2.7 million. The two irregularly shaped ribosomal subunits fit together to form a cleft

� 07�

Protein Metabolism

BOX 27-2

From a n RNA Worl d to a Pro te i n World

to stabi l ize them.

for catalysis of reactions involving a growing range of metabolites and macromolecules could have led to larger and more complex RNA catalysts. The many neg­ atively charged phosphoryl groups in the RNA backbone limit the stability of very large RNA molecules. In an RNA world, divalent cations or other positively charged groups could be incorporated into the structures to aug­ ment stability. Certain peptides could stabilize large RNA mole­ cules. For example, many ribosomal proteins in modern eukaryotic cells have long extensions, lacking second­ ary structure, that snake into the rRNAs and help stabi­ lize them (Fig. 1). Ribozyme-catalyzed synthesis of peptides could thus initially have evolved as part of a general solution to the structural maintenance of large RNA molecules. The synthesis of peptides may have helped stabilize large ribozymes, but this advance also marked the beginning of the end for the RNA world. Once peptide synthesis was possible, the greater cat­ alytic potential of proteins would have set in motion an irreversible transition to a protein-dominated metabolic system. Most enzymatic processes, then, were eventually surrendered to the proteins-but not all. In every organ­ ism, the critical task of synthesizing the proteins re­ mains, even now, a ribozyrne-catalyzed process. There appears to be only one good arrangement (or just a very few) of nucleotide residues in a ribozyrne active site that can catalyze peptide synthesis. The rRNA residues that seem to be involved in the peptidyl transferase activity of ribosomes are highly conserved in the large-subunit rRNAs of all species. Using in vitro evolution (SELEX; see Box 26-3), investigators have isolated artificial ri­ bozyrnes that promote peptide synthesis. Intriguingly, most of them include the ribonucleotide octet (5')AUAACAGG(3'), a highly conserved sequence found at the peptidyl transferase active site in the ribo­ somes of all cells. There may be just one optimal solution to the overall chemical problem of ribozyme-catalyzed synthesis of proteins of defined sequence. Evolution found this solution once, and no life form has notably improved on it.

through which the mRNA passes as the ribosome moves along it during translation (Fig. 27-13b). The 57 pro­ teins in bacterial ribosomes vary enormously in size and structure. Molecular weights range from about 6,000 to 75,000. Most of the proteins have globular domains arranged on the ribosome surface. Some also have snakelike extensions that protrude into the rRNA core of the ribosome, stabilizing its structure. The functions of some of these proteins have not yet been elucidated

in detail, although a structural role seems evident for many of them. The sequences of the rRNAs of many organisms are now known. E ach of the three single-stranded rRNAs of E. coli has a specific three-dimensional con­ formation featuring extensive intrachain base pairing. The predicted secondary structure of the rRNAs ( Fig. 2 7-1 4) has largely been confirmed in the high­ resolution models, but fails to convey the extensive

Extant ribozyrnes generally promote one of two types of reactions: hydrolytic cleavage of phosphodiester bonds or phosphoryl transfers (Chapter 26). In both cases, the substrates of the reactions are also RNA mol­ ecules. The ribosomal RNAs provide an important ex­ pansion of the catalytic range of known ribozymes. Coupled to the laboratory exploration of potential RNA catalytic function (see Box 26-3), the idea of an RNA world as a precursor to current life forms becomes in­ creasingly attractive. A viable RNA world would require an RNA capable of self-replication, a primitive metabolism to generate the needed ribonucleotide precursors, and a cell bound­ ary to aid in concentrating the precursors and seques­ tering them from the environment. The requirements

'

FIGURE 1 The 50S subu n it of a bacterial ribosome (PDB 10 1 NKW).

The protein backbones are shown as blue worm l i ke structures; the rRNA components are transparent. The u n structured extensions of many of the ribosomal proteins snake into the rRNA structures, helping

27.2 Protein Synthesis

Bacterial ribosome

Eukaryotic ribosome

70S Mr2.7 x 106

80S Mr4.2 x 106

60S

50S

Mr 1.8

x

106

58 rRNA (120 nucleotides) 238 rRNA (3,200 nucleotides) 36 proteins

Mr2.8

16S rRNA

5' �

3'

�07�

1'

X

106

58 rRNA (120 nucleotides) 288 rRNA (4,700 nucleotides) 5.88 rRNA 160 nucleotides) - 49 proteins

40S

5S rRNA

FIGURE 27-14 Bacterial rRNAs. Diagrams of the secondary structure of E. coli 1 65 and 55 rRNAs. The first (5' end) and fi nal (3' end) ribonu­ cleotide residues of the 1 65 rRNA are n u mbered.

network of tertiary interactions apparent in the com­ plete structure. The ribosomes of eukaryotic cells (other than mito­ chondrial and chloroplast ribosomes) are larger and more complex than bacterial ribosomes (Fig. 27-15 ), with a diameter of about 23 nm and a sedimentation coefficient of about 80S. They also have two subunits, which vary in size among species but on average are 60S and 40S. Altogether, eukaryotic ribosomes contain more than 80 different proteins. The ribosomes of mitochon­ dria and chloroplasts are somewhat smaller and simpler than bacterial ribosomes. Nevertheless, ribosomal struc­ ture and function are strikingly similar in all organisms and organelles. Transfer RNAs Have Characteristic Structural Features

To understand how tRNAs can serve as adaptors in translating the language of nucleic acids into the lan­ guage of proteins, we must first examine their struc­ ture in more detail. Transfer RNAs are relatively small and consist of a single strand of RNA folded into a precise three-dimensional structure (see Fig. 8-25a).

Mr 0.9

x

106

168 rRNA (1,540 nucleotides) 21 proteins

Mr 1.4

x

106

188 rRNA (1,900 nucleotides) - 33 proteins

FIGURE 27-15 Summary of the composition and mass of ribosomes in bacteria and eukaryotes. R i bosomal s u b u n i ts are identified by the i r 5 (Svedberg un it) val u es, sedimentation coefficients that refer to thei r

rate of sedimentation in a centrifuge. The 5 values are not necessarily additive when subunits are combined, because rates of sedimentation are affected by shape as well as mass.

The tRNAs in bacteria and in the cytosol of eukary­ otes have between 73 and 93 nucleotide residues, cor­ responding to molecular weights of 24 ,000 to 3 1 ,000. Mitochondria and chloroplasts contain distinctive , somewhat smaller tRNAs. Cells have at least one kind of tRNA for each amino acid; at least 32 tRNAs are re­ quired to recognize all the amino acid codons (some recognize more than one codon), but some cells use more than 32. Yeast alanine tRNA (tRNAA1a) , the first nucleic acid to be completely sequenced (Fig. 27-16), con­ tains 76 nucleotide residues, 10 of which have modified bases. Comparisons of tRNAs from various species have revealed many conunon structural features

� 08�

Protein Metabolism

3' A C

5' pO­ G G c G u

Robert W. Holley, 1 92 2-1 993 D

G

g

1 Gm G

D

u u

s·l

I

uCCGG A G A G G G

c c

o

5'

3' A S ite for amino acid C attachment c A c c u G c 0 C U U A .A: GO c C

C

,D G

:r

pG

Amino acid

C arm

Pu •



Tl{tCarm

D arm Pu •

• •



G*

A Contain two or three D re idue at different positions G

c

Wobble position

Extra arm

Variable in size, not present in all tRNAs •



Py



Pu

Anticodon

arm

5.� 3, •

Anticodon

13'

FIGURE 27- 1 7 General cloverleaf secondary structure of tRNAs. The

Anticodon triplet

large dots on the backbone represent nucleotide residues; the b l ue

FIGURE 27-16 N ucleotide sequence of yeast tRNAA1•. This structure

common to a l l tRNAs are shaded in pink. Transfer RNAs vary in length

l i nes represent base pairs. Characteristic and/or i nvariant residues

was deduced in 1 965 by Robert W. Hol ley and h i s col l eagues; it is

from 73 to 93 nuc leotides. Extra nucleotides occur in the extra arm or

shown in the cloverleaf conformation in which i ntrastrand base pairing

i n the D arm. At the end of the anticodon arm is the anti codon loop,

is max i m a l . The fol lowing symbols are used for the modified nu­

which always contains seven unpaired nucleotides. The D arm contains

cleotides (shaded p i n k): 1/J, pseudou ridine; I, inosine; T, r ibothymidi ne; 1 D, 5 , 6-dihydrou ridi ne; m11, 1 -methy l i nosine; m G, 1 -methylguanosine; 2 2 m G, N -di methylguanos i n e (see Fig. 2 6-2 3) . B l u e li nes between

two or three D (5,6-di hydrouridine) residues, depending on the tRNA. In

para l lel sections i nd icate Watson-Crick base pai rs. In RNAs, guanosine

Py, pyrimidine nucleotide; G*, guanylate or 2 ' -0-methylguanylate.

some tRNAs, the D arm has only three hydrogen-bonded base pairs. I n addition to the symbols explai ned i n Figure 27- 1 6: Pu, purine nucleotide;

is often base-paired with uridine, although the G=U pair is not as stable as the Watson-Crick G=C pair (Chapter 8). The anticodon can recogn ize three codons for alanine (GCA, GCU, and GCC). Other features of tRNA structure are shown in Figu res 2 7- 1 7 and 27-1 8 .

( Fig. 27-17 ) . Eight or more of the nucleotide residues have modified bases and sugars, many of which are methylated derivatives of the principal bases. Most

FIGURE 27-18 Three-dimensional struc­

ture of yeast tRNAPhe deduced from x-ray diffraction analysis. The shape

tRNAs have a guanylate (pG) residue at the 5' end, and all have the trinucleotide sequence CCA(3 ') at the 3 ' end. When drawn in two dimensions, the hydrogen­ bonding pattern of all tRNAs forms a cloverleaf struc­ ture with four arms; the longer tRNAs have a short fifth arm, or extra arm (Fig. 27- 1 7) . In three dimensions , a tRNA has the form of a twisted L ( Fig. 27- 1 8 ) .

Darm (residues 10-25)

resembles a twisted L. (a) Schematic dia­ gram with the various arms identified in Figure 27-17 shaded in different colors. (b) A space-fi l l i ng model, with the same color coding (PDB ID 4TRA) . The CCA sequence at the 3' end (orange) is the at­ tachment point for the amino acid.

Anticodon arm

[

(a)

(b)

27.2 Protein Synthesis

Two of the arms of a tRNA are critical for its adap­ tor function. The

amino acid arm can carry a specific

amino acid esterified by its carboxyl group to the 2'- or

G 08�

This reaction occurs in two steps in the enzyme's ac­ tive site. In step

G)

(Fig. 27-19) an enzyme-bound in­

termediate, aminoacyl adenylate (aminoacyl-AMP), is

3'-hydroxyl group of the A residue at the 3' end of the

formed. In the second step the aminoacyl group is trans­

tRNA. The anticodon arm contains the anticodon. The

ferred from enzyme-bound aminoacyl-AMP to its corre­

other major arms are the D arm, which contains the un­

sponding specific tRNA. The course of this second step

usual nucleotide dihydrouridine (D), and the

TI/JC

depends on the class to which the enzyme belongs, as

arm, which contains ribothymidine (T), not usually

shown by pathways �and @in Figure 27-19. The re­

present in RNAs, and pseudouridine

sulting ester linkage between the amino acid and the

(t/1), which has an

unusual carbon-carbon bond between the base and ri­

tRNA

bose (see Fig. 26-23). The D and Tt/JC arms contribute

energy of hydrolysis

important interactions for the overall folding of tRNA

rophosphate formed in the activation reaction undergoes

molecules, and the Tt/JC arm interacts with the large­

hydrolysis to phosphate by inorganic pyrophosphatase.

subunit rRNA.

Thus

( Fig. 27-20) has a highly negative standard free

(AG'0

=

-29 kJ/mol). The py­

two high-energy phosphate bonds are ultimately

expended for each amino acid molecule activated, ren­ Having looked at the structures of ribosomes and tRNAs,

dering the overall reaction for amino acid activation es­

we now consider in detail the five stages of protein

sentially irreversible:

synthesis.

Amino acid

Stage 1 : Aminoacyl-tRNA Synthetases Attach the Correct

+ tRNA + ATP �

aminoacyl-tRNA llG'0

Amino Acids to Their tRNAs During the first stage of protein synthesis, taking place in the cytosol, aminoacyl-tRNA synthetases esterify the 20 amino acids to their corresponding tRNAs. Each enzyme is specific for one amino acid and one or more corresponding

tRNAs.

Most

organisms

have

one

aminoacyl-tRNA synthetase for each amino acid. For amino acids with two or more corresponding tRNAs, the same enzyme usually aminoacylates all of them. The structures of all the aminoacyl-tRNA syn­ thetases of E.

coli have been determined. Researchers

have divided them into two classes (Table 27-7) based on substantial differences in primary and tertiary struc­ ture and in reaction mechanism

=

+AMP + 2Pi -29 kJ/mol

Proofreading by Aminoacyl-tRNA Synthetases The aminoacylation of tRNA accomplishes two ends: (1) it activates an amino acid for peptide bond forma­ tion and (2) it ensures appropriate placement of the amino acid in a growing polypeptide. The identity of the amino acid attached to a tRNA is not checked on the ribosome, so attachment of the correct amino acid to the tRNA is essential to the fidelity of protein synthesis.

As you will recall from Chapter

6, enzyme speci­

ficity is limited by the binding energy available from enzyme-substrate interactions. Discrimination between

(Fig. 27-19 ); these

two similar amino acid substrates has been studied in

idence for a common ancestor, and the biological, chem­

guishes between valine and isoleucine, amino acids that

two classes are the same in all organisms. There is no ev­

ical, or evolutionary reasons for two enzyme classes for essentially identical processes remain obscure.

detail in the case of Ile-tRNA synthetase, which distin­ differ by only a single methylene group (-CH2-):

The reaction catalyzed by an aminoacyl-tRNA syn­

Amino acid

+

Leu

ys

M t

Glu II Note:

'frp Tyr Val

Ala n

Asp Gly Bis

Lys Ph

Pr

S r

Thr

Here, Arg represents arginyl-tRNA synthetase, and so forth. The classification applies

to all organisms for which tRNA synthetases have been analyzed and is based on protein structural distinctions and on the mechanistic distinction outlined in Figure 27-19.

+

I

HN-C-H 3

9I

H-C - CH3

H- - CH3

CH3

CH2 I CH3 Isoleucine

I

The Two Oasses of Amlnoacyl-tRNA Synthetases Class II

Arg Gln

I

aminoacyl-tRNA + AMP + PPi

Class I

I

H3N-C-H

+ tRNA + ATP �

TABLE 27-7

coo­

coo­

thetase is

Valine

Ile-tRNA synthetase favors activation of isoleucine (to form Ile-AMP) over valine by a factor of 200-as we would expect, given the amount by which a methylene group (in Ile) could enhance substrate binding. Yet va­ line is erroneously incorporated into proteins in positions normally occupied by an Ile residue at a frequency of only about 1 in 3,000. How is this greater than 10-fold increase in accuracy brought about? Ile-tRNA synthetase, like some other aminoacyl-tRNA synthetases, has a proofread­ ing function.

�08�

Protein Metabolism

H R- �-0 11 NH3 0

� 0 II / - IIP' -PII' � -P o-

0

I

0

Amino acid

I

0

-

vI

ATP

.

-

MECHANISM FIGURE 27-19 Aminoacylation of tRNA by aminoacyl-tRNA synthetases. Step

-

0

second step the a m i noacyl group is trans­ is somewhat different for the two cl asses of aminoacyl-tRNA synthetases (see Table 2 7-7). OH

For class I enzymes,

OH

of the 3' -term i n a l A residue, then action . For class I I enzymes, cyl group

3'-hydroxyl group of the term inal adenylate.

I

:�,:i�:�::·'/ ntl/

OH

OH

5' -Aminoacyl adenylate (aminoacyl-AMP)

I

�. . -

3' end of tRNA

i

H

H

CH2

I

,

- OH

H R-

7

, OH .



0

-0

.NH3 0

rII

-o

s

-

H R-C

�eno in

e

I

+�

o-

?

C-0-P -0

II

0

I

� Adenosine [

0

Aminoacyl-AMP

Aminoacyl-AMP

0

+

@ the ami noa­

i s transferred d i rectly to the

0

0

I

H

(§} to the

3 '-hydroxyl group by a transesterification re­

I

IIIII II'

[Adenin

@ the a m i noacyl group

is transferred i n itia l l y to the 2'-hydroxyl group

C-0-P-0-

II

is formation of an ami noacyl adenylate,

which remains bound to the active site. I n the ferred to the tRNA. The mechanism of this step

a-Carboxyl of amino acid attacks a-phosphate of ATP, forming 5' amino­ acyl adenylate

H R -C ._1 NH3

G)

-0-

I

-o-P=O

I

t�A

Aminoacyl group is transferred to 2' -OH of the 3' -terminal A residue of tRNA, releasing AMP.

.

Aminoacyl group is transferred directly to the 3'-0H of the 3'-terminal A residue of tRNA, generating the aminoacyl-tRNA product.

H 0- -C-R



_,- li

r OH

CH2

I

0 +N1-I3

CH2

I

0

I

I

transesterification

-0-P=O

I

0

+

0

I

-o-P=O

Transesterification moves aminoacyl group to 3' -OH of the same tRNA residue, generating the aminoacyl­ tRNA product.

I

0

+

Aminoacyt-tRNA

27.2 Protein Synthesis

3 ' end oftRNA

0

Anrinoacyl group

I

-0-P=O I

0

5'

D

arm

The overall error rate of protein synthesis ( 1 mis­ take per 104 amino acids incorporated) is not nearly as low as that of DNA replication. Because flaws in a pro­ tein are eliminated when the protein is degraded and are not passed on to future generations, they have less bio­ logical significance. The degree of fidelity in protein syn­ thesis is sufficient to ensure that most proteins contain no mistakes and that the large amount of energy re­ quired to synthesize a protein is rarely wasted. One de­ fective protein molecule is usually unimportant when many correct copies of the same protein are present. �

CH2 I

pG

� 08�

Amino acid arm T1fC arm arm

FIGURE 27-20 General structure of aminoacyl-tRNAs. The ami noacyl group is esterified to the 3' position of the term inal A residue. The es­ ter l i nkage that both activates the amino acid and joins it to the tRNA is shaded pink.

Recall a general principle from the discussion of proofreading by DNA polymerases (p. 982): if available binding interactions do not provide sufficient discrimi­ nation between two substrates, the necessary specificity can be achieved by substrate-specific binding in two successive steps. The effect of forcing the system through two successive filters is multiplicative. In the case of Ile-tRNA synthetase, the first filter is the initial binding of the amino acid to the enzyme and its activa­ tion to aminoacyl-AMP. The second is the binding of any incorrect aminoacyl-AMP products to a separate active site on the enzyme; a substrate that binds in this second active site is hydrolyzed. The R group of valine is slightly smaller than that of isoleucine, so Val-AMP fits the hy­ drolytic (proofreading) site of the Ile-tRNA synthetase but Ile-AMP does not. Thus Val-AMP is hydrolyzed to va­ line and AMP in the proofreading active site, and tRNA bound to the synthetase does not become aminoacyl­ ated to the wrong amino acid. In addition to proofreading after formation of the aminoacyl-AMP intermediate, most aminoacyl-tRNA synthetases can also hydrolyze the ester linkage be­ tween amino acids and tRNAs in the aminoacyl-tRNAs. This hydrolysis is greatly accelerated for incorrectly charged tRNAs, providing yet a third filter to enhance the fidelity of the overall process. The few aminoacyl­ tRNA synthetases that activate amino acids with no close structural relatives (Cys-tRNA synthetase, for ex­ ample) demonstrate little or no proofreading activity; in these cases, the active site for aminoacylation can suffi­ ciently discriminate between the proper substrate and any incorrect amino acid.

Interaction between an Aminoacyl-tRNA Syn­ thetase and a tRNA: A "Second Genetic Code" An individual aminoacyl-tRNA synthetase must be spe­ cific not only for a single amino acid but for certain tRNAs as welL Discriminating among dozens of tRNAs is just as important for the overall fidelity of protein biosynthesis as is distinguishing among amino acids. The interaction between aminoacyl-tRNA synthetases and tRNAs has been referred to as the "second genetic code," reflecting its critical role in maintaining the accuracy of protein synthesis. The "coding" rules appear to be more complex than those in the "first" code. Figure 2 7-2 1 summarizes what we know about the nucleotides involved in recognition by some aminoacyl­ tRNA synthetases. Some nucleotides are conserved in 3' •

5'

Amin o acid arm

D ann

Anticodon ru:m Anticodon FIGURE 27-21 Nucleotide positions in tRNAs that are recognized by aminoacyl-tRNA synthetases. Some positions (blue dots) are the same in all tRNAs and therefore cannot be used to discri m i nate one from an­ other. Other positions are known recogn ition poi nts for one (orange) or more (green) ami noacyl-tRNA synthetases. Structural features other than sequence are important for recognition by some of the synthetases.

Protein Metabolism

FIGURE 27-22 Aminoacyl-tRNA synthetases. Both synthetases are complexed with their cognate tRNAs (green stick structures). Bound ATP (red) pi npoi nts the active site near the end of the ami noa­ cyl arm. (a) G l n-tRNA synthetase from E. coli, a typical monomeric class I synthetase (POB 1 0

(a}

1 QRT) . (b) Asp-tRNA synthetase from yeast, a typical di meric class I I synthetase (POB 1 0 1 ASZ).

all tRNAs and therefore cannot be used for discrimina­

by the Ala-tRNA synthetase, as long as the RNA contains

tion. By observing changes in nucleotides that alter sub­

the critical

strate specificity, researchers have identified nucleotide

alanine system may be an evolutionary relic of a period

positions that are involved in discrimination by the

when RNA oligonucleotides, ancestors to tRNA, were

aminoacyl-tRNA synthetases. These nucleotide positions

aminoacylated in a primitive system for protein synthesis.

G

=

U (Fig. 27-23b) . This relatively simple

seem to be concentrated in the amino acid arm and the

The interaction of aminoacyl-tRNA synthetases and

anticodon arm, including the nucleotides of the anti­

their cognate tRNAs is critical to accurate reading of the

codon itself, but are also located in other parts of the

genetic code. Any expansion of the code to include ·new

tRNA molecule . Determination of the crystal structures

amino acids would necessarily require a new aminoacyl­

of aminoacyl-tRNA synthetases complexed with their

tRNA synthetase:tRNA pair. A limited expansion of the

cognate tRNAs and ATP has added a great deal to our

genetic code has been observed in nature; a more exten­

understanding of these interactions

sive expansion has been accomplished in the laboratory

( Fig. 27-22 ) .

Ten or more specific nucleotides may be involved in

(Box 2 7-3) .

recognition of a tRNA by its specific aminoacyl-tRNA 3'

synthetase. But in a few cases the recognition mecha­



nism is quite simple. Across a range of organisms from bacteria to humans, the primary determinant of tRNA recognition by the Ala-tRNA synthetases is a single G U base pair in the amino acid arm of tRNAAJa (Fig. 27-2:1a) . =



5'

76



A short synthetic RNA with as few as 7 bp arranged in a simple hairpin minihelix is efficiently aminoacylated

3'

FIGURE 27-23 Structural elements of tRNAAi a that are required for recognition by Ala-tRNA synthetase. (a) The tRNAAi a structural elements recogn ized by the Ala-tRNA synthetase are un­ usual l y simple. A single G=U base pair (pink) is the only element needed for specific bind i ng and ami noacylation. (b) A short synthetic RNA m i n i­ hel ix, with the critical G=U base pair but lacking most of the rema i n i ng tRNA structure. Th i s is a m i noacylated spec ifica lly with alanine a l most as efficiently as the compl ete tRNAAi a_

(a)

(b)

27.2 Protein Synthesis

� 08�

Nat u ra l a n d U n n atura l Expa n s i o n of---t h e G e n et i c Code ----�

�------�-

As we have seen, the 20 amino acids commonly found in proteins offer only limited chemical functionality. Living systems generally overcome these limitations by using enzymatic cofactors or by modifying particular amino acids after they have been incorporated into proteins. In principle, expansion of the genetic code to introduce new amino acids into proteins offers another route to new functionality, but it is a very difficult route to ex­ ploit. Such a change might just as easily result in the in­ activation of thousands of cellular proteins . Expanding the genetic code to include a new amino acid requires several cellular changes. A new aminoacyl­ tRNA synthetase must generally be present, along with a cognate tRNA. Both of these components must be highly specific, interacting only with each other and the new amino acid. Significant concentrations of the new amino acid must be present in the cell, which may entail the evolution of new metabolic pathways. As outlined in Box 27-1, the anticodon on the tRNA would most likely pair with a codon that normally specifies termination. Making all of this work in a living cell seems unlikely, but it has happened both in nature and in the laboratory. There are actually 22 rather than 20 amino acids specified by the known genetic code. The two extra ones are selenocysteine and pyrrolysine, each found in only a very few proteins but both offering a glimpse into the in­ tricacies of code evolution. coo­

I H3N-CH I CH2 I SeH Selenocysteine +

Pyrrolysine

A few proteins in all cells (such as formate dehydro­ genase in bacteria and glutathione peroxidase in mam­ mals) require selenocysteine for their activity. In E. coli selenocysteine is introduced into the enzyme formate dehydrogenase during translation, in response to an in­ frame UGA codon. A special type of Ser-tRNA, present at lower levels than other Ser-tRNAs, recognizes UGA and no other codons. This tRNA is charged with serine by the normal serine aminoacyl-tRNA synthetase, and the ser­ ine is enzymatically converted to selenocysteine by a separate enzyme before its use at the ribosome. The charged tRNA does not recognize just any UGA codon;

some contextual signal in the mRNA, still to be identified, ensures that this tRNA recognizes only the few UGA codons, within certain genes, that specify selenocysteine. In effect, UGA doubles as a codon for both termination and (very occasionally) selenocysteine. This particular code expansion has a dedicated tRNA as described above, but it lacks a dedicated cognate aminoacyl-tRNA synthetase. The process works for selenocysteine, but one might consider it an intermediate step in the evolu­ tion of a complete new codon definition. Pyrrolysine is found in a group of anaerobic archaea called methanogens (see Box 22- 1 ) . These organisms produce methane as a required part of their metabolism, and the Methanosarcinaceae group can use methyl­ amines as substrates for methanogenesis. Producing methane from monomethylamine requires the enzyme monomethylamine methyltransferase. The gene encod­ ing this enzyme has an in-frame UAG termination codon. The structure of the methyltransferase was elucidated in 2002, revealing the presence of the novel amino acid pyrrolysine at the position specified by the UAG codon. Subsequent experiments demonstrated that-unlike se­ lenocysteine-pyrrolysine was attached directly to a dedicated tRNA by a cognate pyrrolysyl-tRNA syn­ thetase. These cells produce pyrrolysine via a metabolic pathway that remains to be elucidated. The overall sys­ tem has all the hallmarks of an established codon assign­ ment, although it only works for UAG codons in this particular gene. As in the case of selenocysteine, there are probably contextual signals that direct this tRNA to the correct UAG codon. Can scientists match this evolutionary feat? Modifi­ cation of proteins with various functional groups can provide important insights into the activity and/or struc­ ture of the proteins. However, protein modification is of­ ten quite laborious. For example, an investigator who wishes to attach a new group to a particular Cys residue will have to somehow block the other Cys residues that may be present on the same protein. If one could instead adapt the genetic code to enable a cell to insert a modi­ fied amino acid at a particular location in a protein, the process could be rendered much more convenient. Peter Schultz and coworkers have done just that. To develop a new codon assignment, one again needs a new aminoacyl-tRNA synthetase and a novel cognate tRNA, both adapted to work only with a par­ ticular new amino acid. E fforts to create such an "un­ natural" code expansion initially focused on E. coli. The codon UAG was chosen as the best target for en­ coding a new amino acid. UAG is the least used of the three termination codons, and strains with tRNAs se­ lected to recognize UAG (see Box 27-4) do not ex­ hibit growth defects. To create the new tRNA and (continued on next page)

� 08�

Protein Metabolism

B OX 27-3

Nat u ra l a n d U n n a t u r a l E x pa n s i o n of t h e G e n et i c Cod e

--------�-

(continued from 3'

l

Expression

MjtRNATyr gene Randomize MjtRNATy• sequence at 1 1 po ition transform cells to create library.

Add plasmid encoding engineered barnase gene. Barnase gene

Library

( ((



----�----�"

J

1

l

® Cells containing MjtRNATyr variants aminoacylated by endogenous tRNA synthetases die. Survivors have MjtRNATyr variant that are not aminoacylated.

Negative s lection

Remove barnase plasmid.

MjTyrRS gene

#

..

Add plasmid encoding MjTyrRS and engineered 13-lactamase gene.

13-lactamase gene

Grow in medium containing ampicillin .

(

!

Po itive election

1

®

Cells live only if they contain MjtRNATyr variants aminoacylated by MjTyrRS. FIGURE 1 Selecting MjtRNATyr variants that function only with the tyro­

by endogenous (E. coli) a m i noacyl-tRNA synthetases, i nserting an

syl tRNA synthetase MJTyrRS. The sequence of the gene encod ing Mj­ tRNATY•, on a plasmid, is randomized at 1 1 positions that do not interact

/3-lactamase, a n d also engineered with TAG sequences t o produce UAG

with MJTyrRS (red dots). The mutageni zed plasmids are introduced i nto £. coli cells to create a l i brary of m i l l ions of MjtRNATyr variants, rep­ resented by the six cells shown here. The toxic barnase gene, engi­

amino acid i n stead of stopping translation. Another gene, encod i n g stop codons, is provided on yet another plasmid that also expresses the gene encodi ng MJTyrRS. This serves as a means of positive selection for T the remaining MjtRNA yr variants. Those variants that are ami noacy­

neered to include the sequence TAG so that its transcript incl udes UAG

lated by MJTyrRS al low expression of the /3-lactamase gene, which al­

codons, is provided on a separate plasmid, providing a negative selec­

lows cells to grow on ampic i l l i n . Mu ltiple rounds of negative and positive selection yield the best MjtRNATyr variants that are aminoacyl­

tion. If this gene is expressed, the cel l s die. It can only be expressed if the MjtRNATyr variant expressed by that particular cel l is ami noacyl ated

ated u n iquely by MJTyrRS and used efficiently in translation.

27.2 Protein Synthesis

� 08�

tRNA synthetase , the genes for a tyrosyl-tRNA and its

its transcript contained several UAG codons and intro­

cognate tyrosyl-tRNA synthetase were taken from the

ducing this gene into the cells along with the gene en­

archaean

coding MjTyrRS. Those MjtRNATyr variants that could

Methanococcus jannaschii (MjtRNATyr

and MjTyrRS) . MjTyrRS does not bind to the anti­

be aminoacylated by MjTyrRS allowed growth on ampi­

codon loop of MjtRNATyr, allowing the anticodon loop

cillin only when MjTyrRS was also expressed in the cell.

to be modified to CUA (complementary to UAG) with­

Several rounds of this negative and positive selection scheme identified a new MjtRNATyr variant that was not

out affecting the interaction. Because the archaeal and bacterial systems are orthologous, the modified

affected by endogenous enzymes, was aminoacylated

archaeal components could be transferred to

by MjTyrRS, and functioned well in translation.

E. coli

Second, the MjTyrRS had to be modified to recog­

cells without disrupting the intrinsic translation sys­ tem of the cells.

nize the new amino acid. The gene encoding MjTyrRS

ified to generate an ideal product tRNA-one that was

variants . Variants that would aminoacylate the new

First, the gene encoding MjtRNATyr had to be mod­

was now mutagenized to create a large library of MjtRNATyr variant with endogenous amino acids were

not recognized by any aminoacyl-tRNA synthetases en­

E. coli, but was aminoacylated by Mj­

eliminated using the barnase gene selection. A second

TyrRS. Finding such a variant could be accomplished

positive selection (similar to the ampicillin selection

dogenous to

via a series of negative and positive selection cycles de­

above) was carried out so that cells would survive only if

signed to efficiently sift through variants of the tRNA

the MjtRNATyr variant was aminoacylated only in the

gene (Fig.

1). Parts of the MjtRNATyr sequence were

presence of the unnatural amino acid. Several rounds of

randomized, allowing creation of a library of cells that

negative and positive selection generated a cognate

each expressed a different version of the tRNA. A gene

tRNA synthetase-tRNA pair that recognized only the un­

encoding barnase (a ribonuclease toxic to

E. coli) was

natural amino acid. These components were then re­

engineered so that its mRNA transcript contained sev­

named to reflect the unnatural amino acid used in the

eral UAG codons, and this gene was also introduced

selection.

pressed in a particular cell in the library was aminoacyl­

constructed, each capable of incorporating one particular

into the cells on a plasmid. If the MjtRNATyr variant ex­

Using this approach, many E.

coli strains have been

ated by an endogenous tRNA synthetase it would

unnatural amino acid into a protein in response to a

express the barnase gene and that cell would die (a

UAG codon. The same approach has been used to artifi­

negative selection) . Surviving cells would contain tRNA

cially expand the genetic code of yeast and even mam­

variants that were not aminoacylated by endogenous

malian cells. Over 30 different amino acids (Fig. 2) can

tRNA synthetases, but could potentially be aminoacyl­

be

ated by MjTyrRS. A positive selection (Fig.

introduced site-specifically and efficiently into

cloned proteins in this way. The result is an increasingly

1) was then

set up by engineering the /3-lactamase gene (which

useful and flexible toolkit with which to advance the

confers resistance to the antibiotic ampicillin) so that

study of protein structure and function.

coo +

I

H3N-CH

I

coo+

I

H3N- CH

I

I

H3N- CH

I

Q Q Q C=O

N

CH3

N+

I

II

II

N-

(a)

(b)

C-N F" / \ // c N /1 F F

(c)

coo -

coo -

coo+

+

I

+

I

H3N- CH

H3N- CH

I

I

Do

Q

(d)

(e)

CH2

I

0

0

OH

Br

coo-

I + H3N-CH I

CH2

I

CH2

I

CH2

I

I

CH2 SH

(f)

FIGURE 2 A sa mpling of un natural amino acids that have been added

with a nearby group when activated by l ight), (d) a highly fluorescent

to the genetic code. These un natural amino acids add u n i quely reac-

amino acid, (e) an amino acid with a heavy atom (Br) for use in crys-

tive chemical groups such as (a) a ketone, (b) an azide, (c) a pho-

tal l ography, and (f ) a long-chain cysteine analog that can form ex-

tocross l i nker (a functional group designed to form a covalent bond

tended disu lfide bonds.

� 08�

Protein Metabolism

Stage 2 : A Specific Amino Acid I nitiates Protein Synthesis

Protein synthesis begins at the amino-terminal end and proceeds by the stepwise addition of amino acids to the carboxyl-terminal end of the growing polypeptide, as determined by Howard Dintzis in 1961 (Fig. 2 7-24). The AUG initiation codon thus specifies an amino­ terminal methionine residue. Although methionine has only one codon, (5')AUG, all organisms have two tRNAs for methionine. One is used exclusively when (5')AUG is the initiation codon for protein synthesis. The other is used to code for a Met residue in an internal position in a polypeptide. The distinction between an initiating (5')AUG and an internal one is straightforward. In bacteria, the two types of tRNA specific for methionine are designated tRNAMet and tRNAfMet. The amino acid incorporated in response to the (5')AUG initiation codon is N-formylmethionine (fMet) . It arrives at the ribosome as N-formylmethionyl­ tRNA!Met (fMet-tRNA!Met) , which is formed in two succes­ sive reactions. First, methionine is attached to tRNAfMet by the Met-tRNA synthetase (which in E. coli amino­ acylates both tRNAfMet and tRNAMet) : Methionine

+ tRNAfMet + ATP

-----+

+ AMP + PP;

Next, a transformylase transfers a formyl group from N10-formyltetrahydrofolate to the amino group of the Met residue: Met-tRNAfMet

-----+

tetrahydrofolate + tMet-tRNAfMet

The transformylase is more selective than the Met­ tRNA synthetase; it is specific for Met residues attached to tRNAfMet, presumably recognizing some unique struc­ tural feature of that tRNA. By contrast, Met-tRNAMet inserts methionine in interior positions in polypeptides. H

l

Amino terminus

Carboxyl terminus

4 min 7 min

16 min 60 min 146

1 Residue number

FIGURE 27-24 Proof that polypeptides grow by addition of amino add residues to the carboxyl end: the Dintzis experiment. Reticulo­ cytes (im mature erythrocytes) actively synthesizing hemoglobin were i ncubated with radioactive leucine (sel ected because it occurs fre­ quently i n both the a- and {3-globin chains). Samples of completed a chains were isolated from the reticu l ocytes at various times afterward, and the d i stribution of radioactivity was determ i ned. The dark red zones show the portions of completed a-globin cha ins conta i n i ng ra­ dioactive Leu residues. At 4 m i n, only a few residues at the carboxyl

end of a-globin were labeled, because the only complete globin

chains with incorporated label after 4 min were those that had nearly

completed synthesis at the time the label was added. With longer incu­

Met-tRNAfMet

N10-Formyltetrahydrofolate +

Direction of chain growth

coo­

I

H-C-N-C-H II I 0 CH2 I CH2 I

s I

CH3 N-Formylmethionine

Addition of the N-formyl group to the amino group of methionine by the transformylase prevents fMet from entering interior positions in a polypeptide while also al­ lowing fMet-tRNAfMet to be bound at a specific ribosomal initiation site that accepts neither Met-tRNAMet nor any other aminoacyl-tRNA. In eukaryotic cells, all polypeptides synthesized by cytosolic ribosomes begin with a Met residue (rather than fMet) , but, again, the cell uses a specialized initiat­ ing tRNA that is distinct from the tRNAMet used at (5 ')AUG codons at interior positions in the mRNA.

bation ti mes, successively longer segments of the polypeptide con­ tained labeled residues, a lways in a block at the carboxyl end of the chain. The u n labeled end of the polypeptide (the a m i no termi nus) was thus defined as the i n itiating end, which means that polypeptides grow by successive addition of amino acids to the carboxyl end.

Polypeptides synthesized by mitochondrial and chloroplast ribosomes, however, begin with N-formylmethionine. This strongly supports the view that mitochondria and chloroplasts originated from bacterial ancestors that were symbiotically incorporated into precursor eukary­ otic cells at an early stage of evolution (see Fig. 1-36) . How can the single (5')AUG codon determine whether a starting N-formylmethionine (or methionine, in eukaryotes) or an interior Met residue is ultimately inserted? The details of the initiation process provide the answer. The initiation of polypeptide synthesis in bacteria requires (1) the 308 ri­ bosomal subunit, (2) the mRNA coding for the polypep­ tide to be made, (3) the initiating fMet-tRNAfMet, (4) a set of three proteins called initiation factors (IF-1, IF-2, and IF-3) , (5) GTP, (6) the 50S ribosomal subunit, and (7) Mg2 + . Formation of the initiation complex takes place in three steps (Fig. 2 7-25) . In step CD the 30S ribosomal subunit binds two initi­ ation factors, IF-1 and IF-3. Factor IF-3 prevents the 30S and 50S subunits from combining prematurely. The mRNA then binds to the 30S subunit. The initiating (5')AUG is guided to its correct position by the Shine­ Dalgarno sequence (named for Australian researchers John Shine and Lynn Dalgarno, who identified it) in the The Three Steps of Initiation

27.2 Protein Synthesis

8 ----

308 subunit

\(

8

3'

'

( 3 ' ) UAC (5' J Anticodon

3'

®

3'

FIGURE 27-25 Formation o f the initiation complex i n bacteria. The com­ plex forms i n three steps (described in the text) at the expense of the hy­ drolysis of GTP to GOP and P;. I F-1 , I F-2, and IF-3 are initiation factors. P designates the peptidyl site, A the ami noacyl site, and E the exit site. Here the anticodon of the tRNA is oriented 3 ' to 5 ', left to right, as in Figure 27-8 but opposite to the orientation in Figures 27-21 and 27-2 3 .

�08�

mRNA. This consensus sequence is an initiation signal of four to nine purine residues, 8 to 13 bp to the 5' side of the initiation codon (Fig. 2 7-26a) . The sequence base-pairs with a complementary pyrimidine-rich se­ quence near the 3' end of the 16S rRNA of the 30S riboso­ mal subunit (Fig. 27-26b) . This mRNA-rRNA interaction positions the initiating (5')AUG sequence of the mRNA in the precise position on the 30S subunit where it is re­ quired for initiation of translation. The particular (5')AUG where fMet-tRNAfMet is to be bound is distinguished from other methionine codons by its proximity to the Shine­ Dalgarno sequence in the mRNA. Bacterial ribosomes have three sites that bind tRNAs, the aminoacyl (A) site , the peptidyl (P) site , and the exit (E) site. The A and P sites bind to aminoacyl­ tRNAs, whereas the E site binds only to uncharged tRNAs that have completed their task on the ribosome. Both the 30S and the 50S subunits contribute to the charac­ teristics of the A and P sites, whereas the E site is largely confined to the 50S subunit. The initiating (5')AUG is positioned at the P site, the only site to which fMet-tRNAfMet can bind (Fig. 27-25). The fMet­ tRNAfMet is the only aminoacyl-tRNA that binds first to the P site; during the subsequent elongation stage, all other incoming aminoacyl-tRNAs (including the Met­ tRNAMet that binds to interior AUG codons) bind first to the A site and only subsequently to the P and E sites. The E site is the site from which the "uncharged" tRNAs leave during elongation. Factor IF-1 binds at the A site and prevents tRNA binding at this site during initiation. In step ® of the initiation process (Fig. 27-25), the complex consisting of the 30S ribosomal subunit, IF-3, and mRNA is joined by both GTP-bound IF-2 and the ini­ tiating fMet-tRNAfMet . The anticodon of this tRNA now pairs correctly with the mRNA's initiation codon. In step ® this large complex combines with the 50S ribosomal subunit; simultaneously, the GTP bound to IF-2 is hydrolyzed to GOP and Pi, which are released from the complex. All three initiation factors depart from the ribosome at this point. Completion of the steps in Figure 27-25 produces a functional 70S ribosome called the initiation complex, containing the mRNA and the initiating fMet-tRNAfMet. The correct binding of the fMet-tRNAfMet to the P site in the complete 70S initiation complex is assured by at least three points of recognition and attachment: the codon-anticodon interaction involving the initiation AUG fixed in the P site; interaction between the Shine­ Dalgarno sequence in the mRNA and the 16S rRNA; and binding interactions between the ribosomal P site and the fMet-tRNAfMet . The initiation complex is now ready for elongation. Translation is gener­ ally similar in eukaryotic and bacterial cells; most of the significant differences are in the mechanism of initia­ tion. Eukaryotic mRNAs are bound to the ribosome as a Initiation in Eukaryotic Cells

� 09�

Protein Metabolism

coli trpA (5') A G c A c G .Pt G coli araB u u u G G A u 0: E. coli lacl c A A u u c A G ¢>Xl 74 phage A protein A A u c u u G G A phage cro A u G u A c u A E.

E.

G G G A G AG u G G tJ G A 0: 0: c

A A u c u G A u G G A A C G C U A C (3') G A A A c G A u G G c G A U U G C A

u

G A A u G u G

A A A c C A G U A

u u u u u u A u G

G u u c G U U c u G A A C A A C G C

G

A G 0: A G G u

u G u A u G

\

Shine-Dalgarno sequence; pairs with 168 rRNA

Initiation codon; pairs with fMet-tRNAIMet

(a)

3'

Bacterial mRNA with consensus Shine-Dalgarno sequence

3' end of 16S rRNA

OH

I

I I I

G A

A u c u u c c 11 c c A

(5') G A u u c c u A G G A G G u u U G A c c U

A O Q IJII· IIJ-IJ IIIIII III.

(b) FIGURE 27-26 Messenger R N A sequences that serve a s signals for initi­

tions of the mRNA transcripts of five bacterial genes are shown. Note the

ation of protein synthesis in bacteria. (a) Alignment of the i n itiating

unusual example of the E. coli Lacl protein, which i n itiates with a GUG

AUG (shaded in green) at its correct location on the 305 ribosomal sub­

(Val) codon (see Box 2 7-1 ) . (b) The 5hine-Dalgarno sequence of the

unit depends i n part on upstream 5hine-Dalgarno sequences (pink). Por-

mRNA pairs with a sequence near the 3' end of the 1 65 rRNA.

complex with a number of specific binding proteins. Several of these tie together the 5' and 3 ' ends of the message. At the 3 ' end, the mRNA is bound by the poly(A) binding protein (PAB) . Eukaryotic cells have at least nine initiation factors. A complex called eiF4F, which includes the proteins eiF4E , eiF4G, and eiF4A, binds to the 5' cap (see Fig. 26-13) through eiF4E . The protein eiF4G binds to both eiF4E and PAB, effectively tying them together (Fig. 2 7-27 ). The protein eiF4A has an RNA helicase activity. It is the eiF4F complex that associates with another factor, eiF3, and with the 40S ribosomal subunit. The efficiency of translation is affected by many properties of the mRNA and proteins in this complex, including the length of the 3' poly(A)

tract (in most cases, longer is better) . The end-to-end arrangement of the eukaryotic mRNA facilitates transla­ tional regulation of gene expression, considered in Chapter 28. The initiating (5')AUG is detected within the mRNA not by its proximity to a Shine-Dalgarno-like se­ quence but by a scanning process: a scan of the mRNA from the 5' end until the first AUG is encountered, sig­ naling the beginning of the reading frame. The eiF4F complex is probably involved in this process, perhaps using the RNA helicase activity of eiF4A to eliminate secondary structure in the 5' untranslated portion of the mRNA. Scanning is also facilitated by another pro­ tein, eiF4B.

40S rihosomal.subunit

FIGURE 27-27 Protein complexes in the for­ mation of a eukaryotic initiation complex. The 3' and 5 ' ends of eukaryotic mRNAs are l i n ked by a complex of proteins that incl udes several i n itiation factors and the poly(A) binding protein (PAB). The factors eiF4E and e i F4G are part of a larger complex called ei F4F. This complex b i nds to the 405 ri boso­ mal subunit.

Gene

3' untranslated region

(3 ' )

27.2 Protein Synthesis

� 09�

TAB L E 27-8 Factor

Function

Bacterial

IF-1

Prevents premature binding of tRNAs to A site

IF-2

Facilitates binding of fMet-tRNAfMet to 308 ribosomal subunit

IF-3

Binds to 308 subunit; prevents premature association of 508 subunit; enhances specificity of P site for fMet-tRNAfMet

Eukaryotic

eiF2

Facilitates binding of initiating Met-tRNAMet to 40S ribosomal subunit

eiF2B, eiF3

First factors to bind 408 subunit; facilitate subsequent steps

eiF4A

RNA helicase activity removes secondary structure in the mRNA to permit binding to 408 subunit; part of the eiF4F complex

eiF4B

Binds to mRNA; facilitates scanning of mRNA to locate the first AUG

eiF4E

Binds to the 5' cap of mRNA; part of the eiF4F complex

eiF4G

Binds to eiF4E and to poly(A) binding protein (PAB) ; part of the eiF4F complex

eiF5

Promotes dissociation of several other initiation factors from 40S subunit as a prelude to association of 60S subunit to form 80S initiation complex

eiF6

Facilitates dissociation of inactive 80S ribosome into 408 and 60S subunits

The roles of the various bacterial and eukaryotic ini­ tiation factors in the overall process are sunuuarized in Table 2 7-8. The mechanism by which these proteins act is an important area of investigation. Stage 3: Peptide Bonds Are Formed in the Elongation Stage

The third stage of protein synthesis is elongation. Again, our initial focus is on bacterial cells. Elongation requires (1) the initiation complex described above, (2) aminoacyl-tRNAs, (3) a set of three soluble cytosolic proteins called elongation factors (EF-Tu, EF-Ts, and EF-G in bacteria) , and (4) GTP. Cells use three steps to add each amino acid residue, and the steps are repeated as many times as there are residues to be added. Elongation Step 1 : Binding of an Incoming Aminoacyl-tRNA In the first step of the elongation cycle (Fig. 2 7-28), the appropriate incoming aminoacyl­ tRNA binds to a complex of GTP-bound EF-Tu. The resulting aminoacyl-tRNA-EF-Tu-GTP complex binds to the A site of the 708 initiation complex. The GTP is hydrolyzed and an EF-Tu-GDP complex is released from the 708 ribosome. The EF-Tu-GTP complex is regenerated in a process involving EF-Ts and GTP. Elongation Step 2: Peptide Bond Formation A peptide bond is now formed between the two amino acids bound by their tRNAs to the A and P sites on the ribosome. This occurs by the transfer of the initiating N-formylmethionyl group from its tRNA to the amino

group of the second amino acid, now in the A site ( Fig. 2 7-2 9 ) . The a-amino group of the amino acid in the A site acts as a nucleophile, displacing the tRNA in the P site to form the peptide bond. This reaction produces a dipeptidyl-tRNA in the A site, and the now "uncharged" (deacylated) tRNAtMet remains bound to the P site. The tRNAs then shift to a hybrid binding state, with elements of each spanning two different sites on the ribosome, as shown in Figure 27-29. The enzymatic activity that catalyzes peptide bond formation has historically been referred to as peptidyl transferase and was widely assumed to be intrinsic to one or more of the proteins in the large ri­ bosomal subunit. We now know that this reaction is catalyzed by the 238 rRNA (Fig. 27-13d) , adding to the known catalytic repertoire of ribozymes. This dis­ covery has interesting implications for the evolution of life (see Box 27-2) . Elongation Step 3: 'Ii"anslocation In the final step of the elongation cycle, translocation, the ribosome moves one codon toward the 3' end of the mRNA (Fig. 27-30a). This movement shifts the anticodon of the dipeptidyl-tRNA, which is still attached to the second codon of the mRNA, from the A site to the P site, and shifts the deacylated tRNA from the P site to the E site, from where the tRNA is released into the cytosol. The third codon of the mRNA now lies in the A site and the second codon in the P site. Movement of the ribosome along the mRNA requires EF-G (also known as translocase) and the energy provided by hydrolysis of another molecule of GTP. A change in the three-dimensional conformation of

� 09�

Protein Metabolism

E site

Initiation complex

P site

A site

tl'llet !Metr-t.RNA Aminoacyl­ tRNA2

t

lncomin aminoacyl tRNA

peptide bond formation

binding of incom1ng

E site

aminoacyl­ tRNA

P ite

A site

Deacylated tM tRNA e t GDP

1 FIGURE 27-29 Second elongation step in bacteria: formation of the first peptide bond. The peptidyl transferase catalyzing this reaction is the 2 3 5 rRNA ribozyme. The N-formylmethionyl group is transferred to the amino group of the second ami noacyl-tRNA in the A site, forming FIGURE 27-28 First elongation step in bacteria: binding of the second aminoacyl-tRNA. The second ami noacyl-tRNA (AA2) enters the A site

a d i peptidyl-tRNA. At this stage, both tRNAs bound to the ribosome shift position i n the 505 subunit to take up a hybrid b i n d i ng state. The uncharged tRNA sh ifts so that its 3' and 5' ends are in the E site. Simi­

of the ri bosome bound to E F-Tu (shown here as Tu), which also con­

larly, the 3 ' and 5' ends of the peptidyl tRNA sh ift to the P site. The an­

tains GTP. B i nding of the second ami noacyl-tRNA to the A site is ac­

ticodons remain in the A and P sites.

companied by hydrolysis of the GTP to GOP and P; and release of the E F-Tu-G OP complex from the ribosome. The bound GOP is released when the E F-Tu-G O P complex b i nds to EF-Ts, and E F-Ts is subse­ quently released when another molecule of GTP bi nds to E F-Tu . Th is recycles E F-Tu and makes it ava i l able to repeat the cycle.

the entire ribosome results in its movement along the mRNA. Because the structure of EF-G mimics the structure of the EF-Tu-tRNA complex (Fig. 27-30b) , EF-G can bind the A site and presumably displace the peptidyl-tRNA.

After translocation, the ribosome, with its attached dipeptidyl-tRNA and mRNA, is ready for the next elon­ gation cycle and attachment of a third amino acid residue. This process occurs in the same way as addition of the second residue (as shown in Figs 27-28, 27-29, and 27-30) . For each amino acid residue correctly added to the growing polypeptide, two GTPs are hy­ drolyzed to GDP and Pi as the ribosome moves from codon to codon along the mRNA toward the 3 ' end.

2 7 . 2 Protein Synthesis

E site

P site

� 09�

A site

Deacylated tRNAf!lfet

(b) FIGURE 27-30 Third elongation step in bacteria: translocation. (a) The GTP

ri bosome moves one codon toward the 3' end of the mRNA, using en­ ergy provided by hydrolysis of GTP bound to EF-G (translocase). The

+ GDP + Pi

d i peptidyl-tRNA is now entirely in the P site, leaving the A site open for the i ncoming (third) ami noacyl-tRNA. The uncharged tRNA dissoci­ ates from the E site, and the elongation cycle begins again. (b) The struc­

E site

P site

A site

ture of EF-G m i m ics the structure of EF-Tu complexed with tRNA. Shown here are (left) E F-Tu complexed with tRNA (green) (PDB ID 1 B23) and (right) EF-G complexed with GDP (red) (PDB I D 1 DAR). The

Incoming aminoacyl-tRNA3

carboxyl-terminal part of EF-G (dark gray) m i m ics the structure of the anticodon loop of tRNA in both shape and charge distribution.

(eEF la, eEFl,By, and eEF2) have functions analogous to those of the bacterial elongation factors (EF- Tu, EF­ Ts, and EF-G, respectively) . Eukaryotic ribosomes do not have an E site; uncharged tRNAs are expelled di­ rectly from the P site.

Direction of ribosome movement (a)

The polypeptide remains attached to the tRNA of the most recent amino acid to be inserted. This associa­ tion maintains the functional connection between the information in the mRNA and its decoded polypeptide output. At the same time, the ester linkage between this tRNA and the carboxyl terminus of the growing polypep­ tide activates the terminal carboxyl group for nucle­ ophilic attack by the incoming amino acid to form a new peptide bond (Fig. 27-29) . As the existing ester linkage between the polypeptide and tRNA is broken during peptide bond formation, the linkage between the polypep­ tide and the information in the mRNA persists, because each newly added amino acid is still attached to its tRNA. The elongation cycle in eukaryotes is quite similar to that in bacteria. Three eukaryotic elongation factors

Proofreading on the Ribosome The GTPase activity of EF-Tu during the first step of elongation in bacterial cells (Fig. 27-28) makes an important contribution to the rate and fidelity of the overall biosynthetic process. Both the EF-Tu-GTP and EF-Tu-GDP complexes exist for a few milliseconds before they dissociate. These two intervals provide opportunities for the codon-anticodon interactions to be proofread. Incorrect aminoacyl-tRNAs normally dis­ sociate from the A site during one of these periods. If the GTP analog guanosine 5' -0-(3-thiotriphosphate) (GTPyS) is used in place of GTP, hydrolysis is slowed, improving the fidelity (by increasing the proofreading intervals) but re­ ducing the rate of protein synthesis. Guanosine 5' -0-(3-thiotriphosphate) (GTPyS)

s II

0 II

0 II

o-

o-

o-

-o- P-O-P-O-P-O-C H2

I

I

I

OH

OH

� 09�

Protein Metabolism

I nd u ced Va riati o n i n t h e G e n et i c Cod e : No n s e n s e S u p p ress i o n When a mutation produces a termination codon in the interior of a gene, translation is prematurely halted and the incomplete polypeptide is usually inactive. These are called nonsense mutations. The gene can be re­ stored to normal function if a second mutation either ( 1 ) converts the misplaced termination codon to a codon specifying an amino acid or (2) suppresses the ef­ fects of the termination codon. Such restorative muta­ tions are called nonsense suppressors; they generally involve mutations in tRNA genes to produce altered (suppressor) tRNAs that can recognize the termination codon and insert an amino acid at that position. Most known suppressor tRNAs have single base substitutions in their anticodons. Suppressor tRNAs constitute an experimentally in­ duced variation in the genetic code to allow the reading of what are usually termination codons, much like the naturally occurring code variations described in Box 27-1 . Nonsense suppression does not completely disrupt normal information transfer in a cell, because the cell usually has several copies of each tRNA gene; some of these duplicate genes are weakly expressed and account for only a minor part of the cellular pool of a particular tRNA. Suppressor mutations usually involve a "minor" tRNA, leaving the major tRNA to read its codon normally. For example, E. coli has three identical genes for tRNATYr , each producing a tRNA with the anticodon

(5') GUA. One of these genes is expressed at relatively high levels and thus its product represents the major r tRNATY species; the other two genes are transcribed in only small amounts. A change in the anticodon of the tRNA product of one of these duplicate tRNATYr genes, from (5 ' ) GUA to (5')CUA, produces a minor tRNA1Yr species that will insert tyrosine at UAG stop codons . This insertion of tyrosine at UAG is carried out ineffi­ ciently, but it can produce enough full-length protein from a gene with a nonsense mutation to allow the cell to survive. The major tRNA1Yr continues to translate the genetic code normally for the majority of proteins. The mutation that leads to creation of a suppressor tRNA does not always occur in the anticodon. The sup­ pression of UGA nonsense codons generally involves the tRNATrp that normally recognizes UGG. The alteration that allows it to read UGA (and insert Trp residues at these positions) is a G to A change at position 24 (in an arm of the tRNA somewhat removed from the anti­ codon) ; this tRNA can now recognize both UGG and UGA. A similar change is found in tRNAs involved in the most common naturally occurring variation in the ge­ netic code (UGA Trp; see Box 27-1) . Suppression should lead to many abnormally long proteins, but this does not always occur. We understand only a few details of the molecular events in translation termination and nonsense suppression.

The process of protein synthesis (including the characteristics of codon-anticodon pairing already de­ scribed) has clearly been optimized through evolution to balance the requirements for speed and fidelity. Im­ proved fidelity might diminish speed, whereas in­ creases in speed would probably compromise fidelity. And, recall that the proofreading mechanism on the ri­ bosome establishes only that the proper codon-anti­ codon pairing has taken place, not that the correct amino acid is attached to the tRNA. If a tRNA is suc­ cessfully aminoacylated with the wrong amino acid (as can be done experimentally) , this incorrect amino acid is efficiently incorporated into a protein in re­ sponse to whatever codon is normally recognized by the tRNA.

coded amino acid. Mutations in a tRNA anticodon that allow an amino acid to be inserted at a termination codon are generally deleterious to the cell (Box 27-4) . In bacteria, once a termination codon occupies the ribosomal A site, three termination factors, or re­ lease factors-the proteins RF- 1 , RF-2 , and RF-3contribute to (1) hydrolysis of the terminal peptidyl­ tRNA bond; (2) release of the free polypeptide and the last tRNA, now uncharged, from the P site; and (3) dis­ sociation of the 70S ribosome into its 30S and 50S sub­ units, ready to start a new cycle of polypeptide synthesis (Fig. 2 7-3 1 ) . RF-1 recognizes the termination codons UAG and UAA, and RF-2 recognizes UGA and UAA. Ei­ ther RF -1 or RF-2 (depending on which codon is pres­ ent) binds at a termination codon and induces peptidyl transferase to transfer the growing polypeptide to a wa­ ter molecule rather than to another amino acid. The re­ lease factors have domains thought to mimic the structure of tRNA, as shown for the elongation factor EF-G in Figure 27-30b. The specific function of RF-3 has not been firmly established, although it is thought to release the ribosomal subunit. In eukaryotes, a single release factor, eRF, recognizes all three termination codons .

Stage 4: Termi nation of Polypeptide Synthesis Requires a Special Signal

Elongation continues until the ribosome adds the last amino acid coded by the mRNA. Termination, the fourth stage of polypeptide synthesis, is signaled by the pres­ ence of one of three termination codons in the mRNA (UAA, UAG, UGA) , immediately following the final

=

27.2 Protein Synthesis

� 09�

FIGURE 27-31 Termination of protein synthesis in bacteria. Ter m i ­ nation occurs i n response t o a term i nation codon i n t h e A site. F i rst, a release factor, RF (RF-1 or RF-2, depend i n g on which term i nation codon i s present), b i nds to the A site. Th is leads to hydrolysis of the ester l i n kage between the nascent polypeptide and the tRNA in the P site and release of the completed polypeptide. F i n a l l y, the m R NA, deacylated tRNA, and release factor leave the r i bosome, wh ich dis­ soc i ates i nto its 3 05 and 50S subun its, a i ded by r i bosome recyc l i ng factor ( R RF), I F-3, and energy provided by E F-G-med iated GTP

1

hydrolysis. The 3 05 s u b u n i t complex with I F-3 i s ready to beg i n another cycle o f translation (see F i g. 2 7-2 5 ) .

polypeptidyl-tRNA link hydrolyzed

Energy Cost of Fidelity in Protein Synthesis Syn­ thesis of a protein true to the information specified in its mRNA requires energy. Formation of each aminoacyl­ tRNA uses two high-energy phosphate groups. An additional ATP is consumed each time an incorrectly activated amino acid is hydrolyzed by the deacylation activity of an aminoacyl-tRNA synthetase, as part of its proofreading activity. A GTP is cleaved to GDP and P; during the first elongation step, and another during the translocation step. Thus, on average, the energy derived from the hydrolysis of more than four NTPs to NDPs is required for the formation of each peptide bond of a polypeptide. This represents an exceedingly large thermody­ namic "push" in the direction of synthesis: at least 4 X 30.5 kJ/mol 1 22 kJ/mol of phosphodiester bond en­ ergy to generate a peptide bond, which has a standard free energy of hydrolysis of only about - 2 1 kJ/mol. The net free-energy change during peptide bond synthesis is thus - 10 1 kJ/mol. Proteins are information-containing polymers. The biochemical goal is not simply the forma­ tion of a peptide bond but the formation of a peptide bond between two specified amino acids. Each of the high-energy phosphate compounds expended in this process plays a critical role in maintaining proper align­ ment between each new codon in the mRNA and its as­ sociated amino acid at the growing end of the polypeptide. This energy permits very high fidelity in the biological translation of the genetic message of mRNA into the amino acid sequence of proteins. =

� GDP �J P; +

RRF

di�o�a� components

� (§)

Ribosome recycling leads to dissociation of the translation components. The release factors dissociate from the posttermination complex (with an uncharged tRNA in the P site) , and are replaced by EF-G and a protein called ribosome recycling factor (RRF; Mr 20,300) . Hydrolysis of GTP by EF-G leads to dissocia­ tion of the 50S subunit from the 30S tRNA-mRNA com­ plex. EF-G and RRF are replaced by IF 3 , which promotes the dissociation of the tRNA. The mRNA is then released. The complex of IF-3 and the 30S subunit is then ready to initiate another round of protein syn­ thesis (Fig. 27-25) . -

Rapid Translation of a Single Message by Poly­ somes Large clusters of 10 to 1 00 ribosomes that are very active in protein synthesis can be isolated from both eukaryotic and bacterial cells. Electron micro­ graphs show a fiber between adjacent ribosomes in the cluster, which is called a polysome (Fig. 2 7-32 ). The connecting strand is a single molecule of mRNA that is being translated simultaneously by many closely spaced ribosomes, allowing the highly efficient use of the mRNA. In bacteria, transcription and translation are tightly coupled. Messenger RNAs are synthesized and trans­ lated in the same 5'�3' direction. Ribosomes begin

� 09�

Protein Metabolism

(b) Direction of translation

Ribosomes

FIGURE 27-32 Polysome. (a) Four ri bosomes translating a eu karyotic

polysome from the s i l k gland of a s i l kworm larva. The m RNA is being

mRNA molecule simultaneous ly, moving from the 5 ' end to the 3' end

translated by many ribosomes simultaneously. The nascent polypep­

and synthesizing a polypeptide from the amino term inus to the car­

tides become longer as the ribosomes move toward the 3 ' end of the

boxyl term i n us. (b) Electron m icrograph and explanatory diagram of a

m R NA. The final product of th is process is s i l k fibroin.

RNA

FIGURE 27-33 Coupling of transcription and translation in bacteria. The m RNA is translated by ri bosomes while it is sti l l being transcribed from DNA by RNA polymerase. Th is is possible because the mRNA in

3' ..{' 5 ' .,.

bacteria does not have to be transported from a nucleus to the cyto­ plasm before encountering ri bosomes. In th is schematic diagram the ri bosomes are depi cted as smal ler than the RNA polymerase. In reality 6 X 1 0 ) are an order of magnitude larger than

the ri bosomes (M, 2 . 7

the RNA polymerase (M, 3. 9 X 1 05 ) .

translating the 5 ' end of the mRNA before transcription is complete (Fig. 27-33). The situation is quite differ­ ent in eukaryotic cells, where newly transcribed mRNAs must leave the nucleus before they can be translated. Bacterial mRNAs generally exist for just a few min­ utes (p. 1 049) before they are degraded by nucleases. In order to maintain high rates of protein synthesis, the mRNA for a given protein or set of proteins must be made continuously and translated with maximum efficiency. The short lifetime of mRNAs in bacteria allows a rapid ces­ sation of synthesis when the protein is no longer needed. Stage 5: N ewly Synthesized Polypeptide Chains Undergo Folding and Processing

In the final stage of protein synthesis, the nascent polypeptide chain is folded and processed into its biologically active form. During or after its synthesis, the polypeptide progressively assumes its native conforma­ tion, with the formation of appropriate hydrogen bonds and van der Waals, ionic, and hydrophobic interactions. In this way the linear, or one-dimensional, genetic message in the mRNA is converted into the three­ dimensional structure of the protein. Some newly made

Direction of translation

proteins, bacterial, archaeal, and eukaryotic, do not at­ tain their final biologically active conformation until they have been altered by one or more processing reac­ tions called posttranslational modifications. Amino-Terminal and Carboxyl-Terminal Modifica­ tions The first residue inserted in all polypeptides is N-formylmethionine (in bacteria) or methionine (in eukazy­ otes) . However, the formyl group, the amino-terminal Met residue, and often additional amino-terminal (and, in some cases, carboxyl-terminal) residues may be removed enzy­ matically in formation of the final functional protein. In as many as 50% of eukazyotic proteins, the amino group of the amino-terminal residue is N-acetylated after translation. Carboxyl-terminal residues are also sometimes modified. Loss of Signal Sequences As we shall see in Sec­ tion 27.3, the 15 to 30 residues at the amino-terminal end

2 7 . 2 Protein Synthesis

coo­

I

+

H3N-C-H

H3N-C-H

II



CH2-0-P-O-

I

o-

y

Phosphoserine coo-

I

+

H3N-C-H

I

0

I

0

II

O=P-o -

I

o-

1

H-C -0-P-o-

1

CH3

(a)

I

+

0

I

coo­

o-

Phosphotyrosine

Phosphothreonine

+

coo­

I

H3N-C-H

I

CH2

I

CH

- ooc

/ "

coo -

r-Carboxyglutamate

(b)

Methyllysine

Dimethyllysine coo­ +

I

H3N-C-H

I

CH2

I

CH2

I

C=O

I

0

I

CH3

some proteins are enzymatically phosphorylated by ATP ( Fig. 2 7-34a) ; the phosphate groups add negative charges to these polypeptides . The functional signifi­ cance of this modification varies from one protein to the next. For example , the milk protein casein has many phosphoserine groups that bind Ca2 + . Calcium, phos­ phate, and amino acids are all valuable to suckling young, so casein efficiently provides three essential nu­ trients. And as we have seen in numerous instances, phosphorylation-dephosphorylation cycles regulate the activity of many enzymes and regulatory proteins. Extra carboxyl groups may be added to Glu residues of some proteins. For example, the blood-clotting protein prothrombin contains a number of y-carboxyglutamate residues (Fig. 27-34b) in its amino-terminal region, intro­ duced by an enzyme that requires vitamin K. These car­ boxyl groups bind Ca2 + , which is required to initiate the clotting mechanism. Monomethyl- and dimethyllysine residues (Fig. 27-34c) occur in some muscle proteins and in cy­ tochrome c. The calmodulin of most species contains one trimethyllysine residue at a specific position. In other proteins , the carboxyl groups of some Glu residues un­ dergo methylation, removing their negative charge. Attachment of Carbohydrate Side Chains The carbohydrate side chains of glycoproteins are attached covalently during or after synthesis of the polypeptide. In some glycoproteins, the carbohydrate side chain is attached enzymatically to Asn residues (N-linked oligosaccharides) , in others to Ser or Thr residues CO­ linked oligosaccharides) (see Fig. 7-29) . Many proteins that function extracellularly, as well as the lubricating proteoglycans that coat mucous membranes, contain oligosaccharide side chains (see Fig. 7-27) . Addition of lsoprenyl Groups A number of eukary­ otic proteins are modified by the addition of groups derived from isoprene (isoprenyl groups) . A thioether bond is formed between the isoprenyl group and a Cys residue of the protein (see Fig. 1 1-1 4) . The isoprenyl groups are derived from pyrophosphorylated intermedi­ ates of the cholesterol biosynthetic pathway (see Fig. 2 1-35) , such as farnesyl pyrophosphate (Fig. 2 7-35) . 0

0

(c)

Trimethyllysine

Methylglutamate

FIGURE 27-34 Some modified amino acid residues. (a) Phosphory­ lated amino acids. (b) A carboxyl ated amino acid. (c) Some methy­ lated amino acids.

II

II

:")

-o- P-0- P-0-C H2

6-

y @-sH Ras protein

of some proteins play a role in directing the protein to its ultimate destination in the cell. Such signal sequences are eventually removed by specific peptidases. Modification of Individual Amino Acids The hy­ droxyl groups of certain Ser, Thr, and Tyr residues of

� 09J

G

Farnesyl pyrophosphate

PP;

- S -CH2

Farnesylated Ras protein

FIGURE 27-35 Farnesylation of a Cys residue. The thioether l i n kage is shown i n red. The Ras protein is the product of the ras oncogene.

�09�

Protein Metabolism

Proteins modified in this way include the Ras proteins , products of the ras oncogenes and proto-oncogenes, and G proteins (both discussed in Chapter 1 2) , and lamins, proteins found in the nuclear matrix. The iso­ prenyl group helps to anchor the protein in a membrane. The transforming (carcinogenic) activity of the ras oncogene is lost when isoprenylation of the Ras protein is blocked, a finding that has stimulated interest in iden­ tifying inhibitors of this posttranslational modification pathway for use in cancer chemotherapy. Addition of Prosthetic Groups Many proteins require for their activity covalently bound prosthetic groups. Two examples are the biotin molecule of acetyl­ GoA carboxylase and the heme group of hemoglobin or cytochrome c. Proteolytic Processing Many proteins are initially synthesized as large, inactive precursor polypeptides that are proteolytically trimmed to form their smaller, active forms. Examples include proinsulin, some viral proteins, and proteases such as chymotrypsinogen and trypsinogen (see Fig. 6-38) . Formation of Disulfide Cross-Links After folding into their native conformations, some proteins form in­ trachain or interchain disulfide bridges between Cys residues. In eukaryotes, disulfide bonds are common in proteins to be exported from cells. The cross-links formed in this way help to protect the native conforma­ tion of the protein molecule from denaturation in the ex­ tracellular environment, which can differ greatly from intracellular conditions and is generally oxidizing.

producing peptidyl-puromycin (Fig. 2 7-36 ) . How­ ever, because puromycin resembles only the 3' end of the tRNA, it does not engage in translocation and dis­ sociates from the ribosome shortly after it is linked to the carboxyl terminus of the peptide . This prema­ turely terminates polypeptide synthesis. Tetracyclines inhibit protein synthesis in bacteria by blocking the A site on the ribosome, preventing the binding of aminoacyl-tRNAs. Chloramphenicol inhibits protein synthesis by bacterial (and mitochondrial and chloroplast) ribosomes by blocking peptidyl transfer; it does not affect cytosolic protein synthesis in eukaryotes. Conversely, cycloheximide blocks the peptidyl trans­ ferase of 808 eukaryotic ribosomes but not that of 708 bacterial (and mitochondrial and chloroplast) ribosomes. Streptomycin, a basic trisaccharide, causes misreading of the genetic code (in bacteria) at relatively low concen­ trations and inhibits initiation at higher concentrations. CH3 CH3

'

/

OH

OH

0

OH

Tetracycline

-o- I I I I I

NH-C-CHC}z

0 2N

CH-CH OH

0

CH2

OH

Chloramphenicol

Protein Synthesis Is Inhibited by Many Antibiotics and Toxins

Protein synthesis is a central function in cellular physiol­ ogy and is the primary target of many naturally occurring antibiotics and toxins. Except as noted, these antibiotics inhibit protein synthesis in bacteria. The differences be­ tween bacterial and eukaryotic protein synthesis, though in some cases subtle, are sufficient that most of the compounds discussed below are relatively harmless to eukaryotic cells. Natural selection has favored the evolu­ tion of compounds that exploit minor differences in order to affect bacterial systems selectively, such that these biochemical weapons are synthesized by some microorganisms and are extremely toxic to others. Be­ cause nearly every step in protein synthesis can be specifically inhibited by one antibiotic or another, antibi­ otics have become valuable tools in the study of protein biosynthesis. Puromycin, made by the mold Streptomyces al­ boniger, is one of the best-understood inhibitory an­ tibiotics. Its structure is very similar to the 3 ' end of an aminoacyl-tRNA, enabling it to bind to the riboso­ mal A site and participate in peptide bond formation,

H

OH

H

Streptomycin

Several other inhibitors of protein synthesis are no­ table because of their toxicity to humans and other mammals. Diphtheria toxin (Mr 58,330) catalyzes the ADP-ribosylation of a diphthamide (a modified

27.2 Protein Synthesis

P site peptidyl-tRNA

A site puromycin

histidine) residue of eukaryotic elongation factor eEF2, thereby inactivating it. Ricin CMr 29,895) , an extremely toxic protein of the castor bean, inactivates the 60S sub­ unit of eukaryotic ribosomes by depurinating a specific adenosine in 23S rRNA.

S U M M A R Y 27. 2 •





�'"'"'!

tr 1 1 1 rt·r r

t

(a)



P rote i n S y n t h e s i s

Protein synthesis occurs on the ribosomes, which consist of protein and rRNA. Bacteria have 70S ribosomes, with a large (50S) and a small (30S) subunit. Eukaryotic ribosomes are significantly larger (80S) and contain more proteins. Transfer RNAs have 73 to 93 nucleotide residues, some of which have modified bases. Each tRNA has an amino acid arm with the terminal sequence CCA(3 ') to which an amino acid is esterified, an anticodon arm, a Tlj!C arm, and a D arm; some tRNAs have a fifth arm. The anticodon is responsible for the specificity of interaction between the aminoacyl­ tRNA and the complementary mRNA codon. The growth of polypeptides on ribosomes begins with the amino-terminal amino acid and proceeds by successive additions of new residues to the carboxyl-terminal end. Protein synthesis occurs in five stages. 1. Amino acids are activated by specific aminoacyl­ tRNA synthetases in the cytosol. These enzymes catalyze the formation of aminoacyl-tRNAs, with simultaneous cleavage of ATP to AMP and PPi. The fidelity of protein synthesis depends on the accuracy of this reaction, and some of these enzymes carry out proofreading steps at separate active sites. 2. In bacteria, the initiating aminoacyl-tRNA in all proteins is N-formylmethionyl-tRNAtMet . Initiation of protein synthesis involves formation of a complex between the 30S ribosomal subunit, mRNA, tM GTP, fMet-tRNA et, three initiation factors, and the 50S subunit; GTP is hydrolyzed to GDP and Pi. 3. In the elongation steps, GTP and elongation factors are required for binding the incoming aminoacyl-tRNA to the A site on the ribosome. In the first peptidyl transfer reaction, the fMet residue is transferred to the amino group of the incoming aminoacyl-tRNA. Movement of the ribosome along the mRNA then translocates the dipeptidyl-tRNA from the A site to the P site, a process requiring hydrolysis of GTP. Deacylated tRNAs dissociate from the ribosomal E site.

(b) FIGURE 27-36

G 09�

Disruption of peptide bond formation by puromycin.

(a) The antibiotic puromycin resembles the ami noacyl end of a charged tRNA, and it can bind to the ri bosomal A site and partici pate in peptide bond formation (see Fig. 2 7-1 3d). The product of this reaction, i nstead

of being translocated to the P site, dissociates from the ri bosome, caus­ ing premature cha i n term ination. (b) Peptidyl puromycin.

4. After many such elongation cycles, synthesis of the polypeptide is terminated with the aid of release factors. At least four high-energy phosphate equivalents (from ATP and GTP) are required to generate each peptide bond, an energy investment required to guarantee fidelity of translation.

i j 1 oo

Protein Metabo lism

5. Polypeptides fold into their active , three­ dimensional forms. Many proteins are further processed by posttranslational modification reactions. •

Many well-studied antibiotics and toxins inhibit some aspect of protein synthesis.

27.3 Protein Ta rgeti ng a n d Deg radation The eukaryotic cell is made up of many structures, com­ partments, and organelles, each with specific functions that require distinct sets of proteins and enzymes. These proteins (with the exception of those produced in mitochondria and plastids) are synthesized on ribosomes in the cytosol, so how are they directed to their final cellular destinations? We are now beginning to understand this complex and fascinating process. Proteins destined for secretion, integration in the plasma membrane, or inclusion in lysosomes generally share the first few steps of a pathway that begins in the endoplasmic reticulum. Pro­ teins destined for mitochondria, chloroplasts, or the nucleus use three separate mechanisms. And proteins destined for the cytosol simply remain where they are synthesized. The most important element in many of these tar­ geting pathways is a short sequence of amino acids called a signal sequence, whose function was first pos­ tulated by Gunter Blobel and colleagues in 1 970. The signal sequence directs a protein to its appropriate location in the cell and, for many proteins, is removed during transport or after the protein has reached its final destination. In proteins slated for transport into mito­ chondria, chloroplasts, or the ER, the signal sequence is at G u nter B lobel the amino terminus of a newly

Human influenza virus A Human preproinsulin Bovine growth

�� Bee promellitin

Posttranslational Modification of Many Eu karyotic Proteins Begins in the Endoplasmic Reticu l u m

Perhaps the best-characterized targeting system begins in the ER. Most lysosomal, membrane, or secreted proteins have an amino-terminal signal sequence ( Fig. 2 7-:3 7 ) that marks them for translocation into the lumen of the ER; hundreds of such signal sequences have been determined. The carboxyl terminus of the signal sequence is defined by a cleavage site, where protease action removes the sequence after the protein is im­ ported into the ER. Signal sequences vary in length from 1 3 to 36 amino acid residues, but all have the following features: (1) about 1 0 to 1 5 hydrophobic amino acid residues; (2) one or more positively charged residues, usually near the amino terminus, preceding the hy­ drophobic sequence; and (3) a short sequence at the carboxyl terminus (near the cleavage site) that is rela­ tively polar, typically having amino acid residues with short side chains (especially Ala) at the positions closest to the cleavage site. As originally demonstrated by George Palade, pro­ teins with these signal sequences are synthesized on ribosomes attached to the ER. The signal sequence itself helps to direct the ribosome to the ER, as illustrated by steps CD through ® in Figure 2 7-38 . CD The targeting cleavage site

� � � � � �� � � �� � � � � � �� •

� � � � � � � � � � � � � � � �� � � � � � � � � � � •

� � � � � � � � � � � � � � � � � � � � � � � � � � ,j. � � �

Drosophila glue protein

synthesized polypeptide. In many cases, the targeting capacity of particular signal sequences has been con­ firmed by fusing the signal sequence from one protein to a second protein and showing that the signal directs the second protein to the location where the first pro­ tein is normally found. The selective degradation of proteins no longer needed by the cell also relies largely on a set of molecular signals embedded in each pro­ tein's structure . In this concluding section we examine protein tar­ geting and degradation, emphasizing the underlying sig­ nals and molecular regulation that are so crucial to cellular metabolism. Except where noted, the focus is now on eukaryotic cells.

� � � � � � � � � � � � � � � & � � & � � � fu � •

� � � � � � � � � � � � � & � � � � � � � � � � � •

FIGURE 27-37 Amino-terminal signal sequences of some eukaryotic

the polar and short-side-chain residues im mediately preced i ng (to the

proteins that direct their translocation into the ER. The hydrophobic

left of, as shown here) the cleavage sites (indicated by red arrows).

core (yellow) is preceded by one or more basic residues (blue) . Note

2 7 . 3 Protein Targeting and Degradation

� 0� 1

Signal sequence

I

Ribosome cycle

SRP cycl

Cytosol

Ribosome

Endoplasmic reticulum

receptor

S�al peptidase

ER lumen

FIGURE 27-38 Directing eukaryotic proteins with the appropriate sig­

sequence, i n h i b iting elongation by sterically blocking the entry of

nals to the endoplasmic reticulum. This process involves the SRP cycle

a m i noacyl-tRNAs and i n h i b iting peptidyl transferase. Another protein

and translocation and cleavage of the nascent polypeptide. The steps

subunit b i nds and hydrolyzes GTP. The SRP receptor is a heterodimer

are described in the text. SRP is a rod-shaped complex conta i n i ng a

of a (M, 69,000) and f3 (M, 30, 000) subunits, both of which bind and

300 nucleotide RNA (7SL-RNA) and six different proteins (combined

hydrolyze multiple GTP molecules during th i s process.

M, 3 2 5,000) . One protein subu n it of SRP bi nds d i rectly to the signal

pathway begins with initiation of protein synthesis on free ri­ bosomes. ® The signal se­ quence appears early in the synthetic process, because it is at the amino terminus, which as we have seen is synthesized first. ® As it emerges from the ribosome, the signal se­ quence-and the ribosome it­ self-are bound by the large George Pa lade signal recognition particle (SRP) ; SRP then binds GTP and halts elongation of the polypeptide when it is about 70 amino acids long and the signal sequence has com­ pletely emerged from the ribosome. @ The GTP-bound SRP now directs the ribosome (still bound to the mRNA) and the incomplete polypeptide to GTP-bound SRP receptors in the cytosolic face of the ER; the nas­ cent polypeptide is delivered to a peptide transloca­ tion complex in the ER, which may interact directly with the ribosome. @ SRP dissociates from the ribo­ some, accompanied by hydrolysis of GTP in both SRP and the SRP receptor. @ Elongation of the polypeptide

now resumes, with the ATP-driven translocation com­ plex feeding the growing polypeptide into the ER lu­ men until the complete protein has been synthesized. (j) The signal sequence is removed by a signal peptidase within the ER lumen; @ the ribosome dissociates and is recycled. G lycosylation Plays a Key Role i n Protein Ta rgeting

In the ER lumen, newly synthesized proteins are fur­ ther modified in several ways . Following the removal of signal sequences, polypeptides are folded, disulfide bonds formed, and many proteins glycosylated to form glycoproteins. In many glycoproteins the linkage to their oligosaccharides is through Asn residues. These N-linked oligosaccharides are diverse (Chapter 7) , but the pathways by which they form have a com­ mon first step . A 14 residue core oligosaccharide is built up in a stepwise fashion, then transferred from a dolichol phosphate donor molecule to certain Asn residues in the protein ( Fig. 2 7-39 ). The transferase is on the lumenal face of the ER and thus cannot cat­ alyze glycosylation of cytosolic proteins. After transfer,

[i 0 �

Protein Meta bolism

1

• N-Acetylglucosamine (GlcNAc)

CH3

CH3

e Mannose (Man)

CH3

e Glucose (Glc)

tunicamycin

5

GDP

5

GDP-Man

\__ �

I I I I

UMP + UDP.j.

2

\__®�

®

CH3 n Dolichol phosphate

UDP-GlcNAc

(n

=

9-22)

Endoplasmic reticulum 4 Dolichol-®-Man

:

4 Dolichol-® 3 3

Dolichol-®-Glc Dolichol-®

Cytosol

mRNA

3' FIGURE 27-39

Synthesis of the core oligosaccharide of glycoproteins.

The core ol igosaccharide is b u i lt up by the successive addition of monosaccharide units. (!), Q) The first steps occur on the cytosolic face

Tunicamycin

@ Translocation moves the incomplete oligosaccharide across the membrane (mechanism not shown), and @ completion of the core

of the ER.

ol igosaccharide occurs with i n the l u men of the ER. The precursors that

N-Acetylglucosamine

contribute additional mannose and gl ucose residues to the growing ol igosaccharide i n the l u men are dol ichol phosphate derivatives. I n the first step in the construction of the N- l i nked oligosaccharide moiety of a glycoprotei n,

(0, ®

the core oligosaccharide is transferred from

dol ichol phosphate to an Asn res i d ue of the protei n with i n the ER l u men . The core ol igosaccharide is then further modified i n t h e E R a n d the Golgi complex in pathways that differ for different proteins . The five sugar residues shown su rrounded by a beige screen (after step

0l

Uracil

are reta i ned in the fi nal structure of a l l N- l i n ked ol igosaccharides .

@ The released dol ichol

pyrophosphate is again translocated so that

the pyrophosphate is on the cytosol i c face of the ER, then

® a phos-

phate is hydrolytica l l y removed to regenerate dol ichol phosphate.

Fatty acyl side chain

the core oligosaccharide is trimmed and elaborated in different ways on different proteins, but all N-linked oligosaccharides retain a pentasaccharide core derived from the original 14 residue oligosaccharide. Several antibiotics act by interfering with one or more steps in this process and have aided in elucidating the steps of protein glycosylation. The best-characterized is tuni­ camycin, which mimics the structure of UDP-N­ acetylglucosamine and blocks the first step of the process (Fig. 27-39, step (D) . A few proteins are 0glycosylated in the ER, but most 0-glycosylation oc­ curs in the Golgi complex or in the cytosol (for proteins that do not enter the ER) .

OH

OH

Tunicamine

Suitably modified proteins can now be moved to a variety of intracellular destinations. Proteins travel from the ER to the Golgi complex in transport vesicles ( Fig. 27-40) . In the Golgi complex, oligosaccharides are 0-linked to some proteins, and N-linked oligosaccharides are further modified. By mechanisms not yet fully un­ derstood, the Golgi complex also sorts proteins and sends them to their final destinations. The processes

2 7 . 3 Protei n Targeting and Degradation

FIGURE 27-40 Pathway taken by proteins destined for lysosomes, the .

plasma membrane, or secretion. Proteins are moved from the ER to the

· -

- ..

.

.. . '":' . .... . • ,

cis side of the Golgi complex in transport vesicles. Sorting occurs pri­ marily in the trans side of the Golgi complex.

that segregate proteins targeted for secretion from those targeted for the plasma membrane or lysosomes must distinguish among these proteins on the basis of structural features other than signal sequences, which were removed in the ER lumen. This sorting process is best understood in the case of hydrolases destined for transport to lysosomes. On arrival of a hydrolase (a glycoprotein) in the Golgi com­ plex, an as yet undetermined feature (sometimes called a signal patch) of the three-dimensional structure of the hydrolase is recognized by a phosphotransferase , which phosphorylates certain mannose residues in the oligosaccharide (Fig. 27-4 1 ) . The presence of one or more mannose 6-phosphate residues in its N-linked oligosaccharide is the structural signal that targets the protein to lysosomes. A receptor protein in the mem­ brane of the Golgi complex recognizes the mannose 6phosphate signal and binds the hydrolase so marked. Vesicles containing these receptor-hydrolase complexes

NH

I

0

ll

0

o

o-

...

Lysol1 .•

+

II o- p- o- P-o-1 UridineI I I

!:...Secretory granu1 Trana)>Ort vesicles

H

H

UDP N-Acetylglucosamine (UDP-GlcNAc)

0

II

0-P1 0

H

H

GlcNAc

l'

0

II

O-P-D- CH2

I

o-

FIGURE 27-41 Phosphorylation of mannose residues

on

lysosome-targeted

H H

0-jOligosaccharide� N

enzymes.

N-Acetylgl ucosamine phosphotransferase rec­ ogni zes some as yet u n identified structural feature of hydrolases destined for lysosomes.

"\

/� _L__

Hydrolase

residue

I

•r 1

•f�leX ' ��

O-iOiigos acch arid� N

CH3

pho 1 hodar



H

M anno

C=O

.."'"''\ I/Trans sid.e

H

H

Mannose 6-phosphate residue

� 1 0�

� 0� 1

Protein Metabolism

bud from the trans side of the Golgi complex and make their way to sorting vesicles. Here, the receptor-hydrolase complex dissociates in a process facilitated by the lower pH in the vesicle and by phosphatase-catalyzed removal of phosphate groups from the mannose 6-phosphate residues. The receptor is then recycled to the Golgi complex, and vesicles containing the hydrolases bud from the sorting vesicles and move to the lysosomes. In cells treated with tunicamycin (Fig. 27-39, step (j)) , hydrolases that should be targeted for lysosomes are instead secreted, confirming that the N-linked oligosac­ charide plays a key role in targeting these enzymes to lysosomes. The pathways that target proteins to mitochondria and chloroplasts also rely on amino-terminal signal se­ quences. Although mitochondria and chloroplasts con­ tain DNA, most of their proteins are encoded by nuclear DNA and must be targeted to the appropriate organelle. Unlike other targeting pathways, however, the mito­ chondrial and chloroplast pathways begin only after a precursor protein has been completely synthesized and released from the ribosome. Precursor proteins des­ tined for mitochondria or chloroplasts are bound by cy­ tosolic chaperone proteins and delivered to receptors on the exterior surface of the target organelle. Special­ ized translocation mechanisms then transport the pro­ tein to its final destination in the organelle, after which the signal sequence is removed. Signal Sequences for N uclear Transport Are Not Cleaved

Molecular communication between the nucleus and the cytosol requires the movement of macromolecules through nuclear pores. RNA molecules synthesized in the nucleus are exported to the cytosol. Ribosomal pro­ teins synthesized on cytosolic ribosomes are imported into the nucleus and assembled into 60S and 40S riboso­ mal subunits in the nucleolus; completed subunits are then exported back to the cytosol. A variety of nuclear proteins (RNA and DNA polymerases, histones, topoiso­ merases, proteins that regulate gene expression, and so forth) are synthesized in the cytosol and imported into the nucleus. This traffic is modulated by a complex sys­ tem of molecular signals and transport proteins that is gradually being elucidated. In most multicellular eukaryotes, the nuclear enve­ lope breaks down at each cell division, and once division is completed and the nuclear envelope reestablished, the dispersed nuclear proteins must be reimported. To allow this repeated nuclear importation, the signal sequence that targets a protein to the nucleus-the nuclear localization sequence, NLS-is not removed after the protein arrives at its destination. An NLS, un­ like other signal sequences, may be located almost any­ where along the primary sequence of the protein. NLSs can vary considerably, but many consist of four to eight amino acid residues and include several consecutive basic (Arg or Lys) residues.

Nuclear importation is mediated by a number of proteins that cycle between the cytosol and the nucleus (Fig. 2 7-42 ), including importin a and {3 and a small GTPase known as Ran (Ras-related nuclear protein) . A heterodimer of importin a and {3 functions as a soluble receptor for proteins targeted to the nucleus, with the a subunit binding NLS-bearing proteins in the cytosol. The complex of the NLS-bearing protein and the im­ portin docks at a nuclear pore and is translocated through the pore by an energy-dependent mechanism. In the nucleus, the importin {3 is bound by Ran GTPase, releasing importin {3 from the imported protein. Im­ portin a is bound by Ran and by CAS (cellular apoptosis susceptibility protein) and separated from the NLS­ bearing protein. Importin a and {3, in their complexes with Ran and CAS, are then exported from the nucleus. Ran hydrolyzes GTP in the cytosol to release the im­ portins, which are then free to begin another importa­ tion cycle. Ran itself is also cycled back into the nucleus by the binding of Ran-GDP to nuclear transport factor 2 (NTF2) . Inside the nucleus, the GDP bound to Ran is re­ placed with GTP through the action of Ran guanosine nucleotide exchange factor (RanGEF; see Box 12-2) . Bacteria Also Use Signal Sequences for Protein Targeting

Bacteria can target proteins to their inner or outer membranes, to the periplasmic space between these membranes, or to the extracellular medium. They use signal sequences at the amino terminus of the proteins (Fig. 2 7-43) , much like those on eukaryotic proteins targeted to the ER, mitochondria, and chloroplasts. Most proteins exported from E. coli make use of the pathway shown in Figure 2 7-44. Following translation, a protein to be exported may fold only slowly, the amino-terminal signal sequence impeding the folding. The soluble chaperone protein SecB binds to the pro­ tein's signal sequence or other features of its incom­ pletely folded structure . The bound protein is then delivered to SecA, a protein associated with the inner surface of the plasma membrane. SecA acts as both a re­ ceptor and a translocating ATPase. Released from SecB and bound to SecA, the protein is delivered to a translo­ cation complex in the membrane, made up of SecY, E , and G , and is translocated stepwise through the mem­ brane at the SecYEG complex in lengths of about 20 amino acid residues. Each step is facilitated by the hy­ drolysis of ATP, catalyzed by SecA. An exported protein is thus pushed through the membrane by a SecA protein located on the cytoplasmic surface, rather than being pulled through the membrane by a protein on the periplasmic surface. This difference may simply reflect the need for the translocating ATPase to be where the ATP is. The transmembrane electrochem­ ical potential can also provide energy for translocation of the protein, by an as yet unknown mechanism. Although most exported bacterial proteins use this pathway, some follow an alternative pathway that uses

I

(a)

I

1 ..:! 1 0�

2 7 . 3 Protein Targeting and Degradation

(b)

Cytosol

Nuclear p.rotein

�NLS

p

20 h

Destabilizing

Ile, Gin



Tyr, Glu



30 min IO min

Pro



Leu, Phe, Asp, Lys



Arg



Modified from Bachmair, A., Finley, D.,

of a protein is a function of its amino-terminal

7 min

3 min

2 min

& Varshavsky, A. ( 1986) In vivo half-life residue. Science 234, 179-186.

* Half-lives were measured in yeast for the ,a-galactosidase protein modified so that in each experiment it had a different amino-terminal residue. Half-lives may vary for differ­

conditions: renal diseases, asthma, neurodegenerative dis­ orders such as Alzheimer's and Parkinson's diseases (asso­ ciated with the formation of characteristic proteinaceous structures in neurons) , cystic fibrosis (caused in some with resultant loss of function; see Box 1 1-3) , Liddle's syndrome (in which a sodium channel in the kidney is not degraded, leading to excessive Na + absorption and early­ onset hypertension)-and many other disorders. Drugs designed to inhibit proteasome function are being devel­ oped as potential treatments for some of these conditions. In a changing metabolic environment, protein degradation is as important to a cell's survival as is protein synthesis, and much remains to be learned about these interesting pathways.



S U M M A RY 27. 3

ent proteins and in different organisms, but this general pattern appears to hold for all organisms. •

Although we do not yet understand all the signals

mechanism involves a peptide signal sequence, synthesized protein.

residue that remains after removal of the amino-terminal •

on

half-life

(Table

2 7-9) .

which binds the signal sequence as soon as it

These

appears on the ribosome and transfers the entire

amino-terminal signals have been conserved over bil­

ribosome and incomplete polypeptide to the ER.

lions of years of evolution, and are the same in bacterial

Polypeptides with these signal sequences are

protein degradation systems and in the human ubiquiti­

moved into the ER lumen as they are synthesized;

nation pathway. More complex signals, such as the de­

once in the lumen they may be modified and moved

struction box discussed in Chapter 12 (see Fig. 12-46) ,

to the Golgi complex, then sorted and sent to

are also being identified.

lysosomes, the plasma membrane, or transport

Ubiquitin-dependent proteolysis is as important for

vesicles.

the regulation of cellular processes as for the elimina­ tion of defective proteins. Many proteins required at

In eukaryotic cells, one class of signal sequences is recognized by the signal recognition particle (SRP) ,

olytic processing of the amino-terminal end, has a pro­ influence

After synthesis, many proteins are directed to

generally found at the amino terminus of a newly

found. For many proteins , the identity of the first Met residue, and any other posttranslational prote­

Prote i n Ta rgeti n g a n d D e g ra d a t i o n

particular locations in the cell. One targeting

that trigger ubiquitination, one simple signal has been

found

1

cases by a too-rapid degradation of a chloride ion channel,

Stabilizing

Source:

� 0�



Proteins targeted to mitochondria and chloroplasts

only one stage of the eukaryotic cell cycle are rapidly

in eukaryotic cells, and those destined for export in

degraded by the ubiquitin-dependent pathway after

bacteria, also make use of an amino-terminal signal

completing their function. Ubiquitin-dependent de­

sequence .

struction of cyclin is critical to cell-cycle regulation (see Fig. 12-46) . The E 2 and E3 components of the ubiquiti­



signal sequence that, unlike other signal sequences,

nation pathway (Fig. 27-47) are in fact two large fami­

is not cleaved once the protein is successfully

lies of proteins . Different E2 and E 3 enzymes exhibit

targeted.

different specificities for target proteins and thus regu­ late different cellular processes. Some E2

and E 3



Not surprisingly, defects in the ubiquitination path­ way have been implicated in a wide range of dis­ ease states.

An inability to degrade certain proteins that

Some eukaryotic cells import proteins by receptor-mediated endocytosis.

enzymes are highly localized i n certain cellular compart­ ments, reflecting a specialized function.

Proteins targeted to the nucleus have an internal



All cells eventually degrade proteins , using specialized proteolytic systems. Defective proteins and those slated for rapid turnover are generally degraded by an ATP-dependent system. In eukaryotic

activate cell division (the products of oncogenes) can lead

cells, the proteins are first tagged by linkage

to tumor formation, whereas a too-rapid degradation of

to ubiquitin, a highly conserved protein.

proteins that act as tumor suppressors can have the same

Ubiquitin-dependent proteolysis is carried out by

effect. The ineffective or overly rapid degradation of cellu­

proteasomes, also highly conserved, and is critical

lar proteins also appears to play a role in a range of other

to the regulation of many cellular processes.

� � 11

Protein Metab o l ism

Schimmel, P. & Beebe, K. (2004) Molecular biology-genetic code

Key Terms

seizes pyrrolysine . Nature 431, 257-258.

Stadtman, T.C. ( 1 996) Selenocysteine . Annu. Rev Biochem. 65, 83-100.

Terms in bold are defined in the glossary.

aminoacyl-tRNA

1066

aminoacyl-tRNA

codon

1094 1 094 release factors 1094 polysome 1095 suppressor

1066 1066

synthetases translation

nonsense

1066

1067 1069 termination codons 1069 reading frame

termination

posttranslational modification

initiation codon

open reading frame (ORF)

1 069 1070 1072

anticodon wobble

translational

1072 1 073

frameshifting RNA editing

initiation

1088

Shine-Dalgarno sequence 1088 aminoacyl (A) site 1089 peptidyl (P) site 1 089 exit (E) site 1089 initiation complex 1089 elongation 1091 elongation factors peptidyl transferase

translocation

1091 1091

1 091

1096

1 098 tetracyclines 1098 chloramphenicol 1098 cycloheximide 1098

puromycin

streptomycin 1098 diphtheria toxin 1098 ricin 1099 signal sequence 1 1 00 signal recognition particle (SRP) 1 10 1 peptide translocation complex 1 10 1 tunicamycin 1 102 nuclear localization sequence (NLS) 1 104 coated pits 1 106 clathrin 1 106 dynamin 1 106 ubiquitin 1 107 proteasome 1 1 08

Further Reading

Vetsigian, K., Woese, C., & Goldenfeld, N. (2006) Collective evolution and the genetic code . Proc_ Natl. Acad. Sci USA 103, 1 0,696-1 0,701 _ Xie, J.M. & Schultz, P.G. (2006) Innovation: a chemical toolkit for proteins-an expanded genetic code . Nat. Rev. Mol. Cell Biol. 7, 775-782. Yanofsky, C. (2007) Establishing the triplet nature of the genetic code Cell 128, 8 1 5-818. Yarus, M., Caporaso, J.G., & Knight, R. (2005) Origins of the genetic code: the escaped triplet theory. Annu. Rev Biochem. 7 4, 1 79-198.

Protein Synthesis Ban, N., Nissen, P., Hansen, J., Moore, P.B., & Steitz, T.A. (2000) The complete atomic structure of the large ribosomal subunit at 2.4 angstrom resolution. Science 289, 905-920 . The first high-resolution structure of a major ribosomal subunit.

Bjork, G.R., Ericson, J.U., Gustafsson, C.E.D., Hagervall, T.G., Jonsson, Y.H., & Wikstrom, P.M. ( 1 987) Transfer RNA modifica­ tion. Annu. Rev Biochem. 56, 263-288. Chapeville, F., Lipmann, F., von Ehrenstein, G., Weisblum, B., Ray, W.J., Jr. , & Benzer, S. ( 1 962) On the role of soluble ribonu­ cleic acid in coding for amino acids. Proc. Natl Acad Sci USA 48, 1086-1092. Classic experiments providing proof for Crick's adaptor hypothesis and showing that amino acids are not checked after they are linked to tRNAs.

Dintzis, H.M. ( 1 96 1 ) Assembly of the peptide chains of hemoglobin. Proc Natl. Acad Sci. USA 47, 247-2 6 1 . A classic experiment establishing that proteins are assembled beginning at the amino terminus .

Giege, R., Sissler, M., & Florentz, C. ( 1 998) Universal rules and idiosyncratic features in tRNA identity. Nucleic Acid Res. 26,

5017-5035.

Genetic Code Ambrogelly, A., Palioura, S., & Soli, D. (2007) Natural expansion of the genetic code. Nat Chem Biol. 3, 29-35. Blanc, V. & Davidson, N.O. (2003) C-to-U RNA editing: mechanisms leading to genetic diversity. J. Biol. Chem. 278, 1395-1398. Crick, F.H.C. ( 1 966) The genetic code: III. Sci Am. 215 (October) , 55-62. An insightful overview of the genetic code at a time when the

code words had just been worked out.

Hohn, M.J., Park, H.S., O'Donoghue, P. , Schnitzbauer, M., & Soli, D. (2006) Emergence of the universal genetic code imprinted in an RNA record. Proc. Natl. Acad. Sci USA 103, 18,095-18,100. Klobutcher, L.A. & Farabaugh, P.J. (2002) Shifty ciliates: frequent programmed translational frarneshifting in Euplotids.

Cell 1 1 1 , 763-766. Levanon, K., Eisenberg E., Rechavi G., & Levanon, E.Y. (2005) Letter from the editor: adenosine-to-inosine RNA editing in Alu repeats in the human genome. EMBO Rep _ 6, 831-835_

Gray, N.K. & Wickens, M. ( 1 998) Control of translation initiation in animals . Annu. Rev. Cell Dev Biol 14, 399-458 .

lbba, M. & Soli, D. (2000) Arninoacyl-tRNA synthesis . Annu. Rev Biochem. 69, 6 1 7-650. Kapp, L.D. & Lorsch, J.R. (2004) The molecular mechanics of eukaryotic translation Annu. Rev. Biochem_ 73, 657-704_ Korostelev, A., Trakhanov, S., Laurberg, M., & Noller, H.F. (2006) Crystal structure of a 70S ribosome-tRNA complex reveals functional interactions and rearrangements. Cell 126, 1 065-1077. Moore, P.B. & Steitz, T.A. (2003) The structural basis of large ribosomal subunit function. Annu Rev. Biochem. 72, 813-850. Peske, F., Rodnina, M.V., & Wrntermeyer, W. (2005) Sequence of steps in ribosome recycling as defined by kinetic analysis_ Mol Cell 18, 403-41 2. Poehlsgaard, J. & Douthwaite, S. (2005) The bacterial ribosome as a target for antibiotics. Nat Rev. Microbial 3, 870-881 . Rodnina, M.V. & Wintermeyer, W. (2001) Fidelity of aminoacyl­ tRNA selection on the ribosome: kinetic and structural mechanisms.

Maas, S., Rich, A., & Nishikura, K. (2003) A-to-! RNA editing: recent news and residual mysteries. J. Biol. Chem 278, 139 1-1394.

Annu_ Rev. Biochem_ 70, 4 1 5-435.

Neeman, Y., Dahary, D., & Nishikura, K. (2006) Editor meets silencer: crosstalk between RNA editing and RNA interference . Nat. Rev_ Mol_ Cell Biol. 7, 9 1 9-93 1 .

Microbial. Mol Biol. Rev. 64, 202-236 .

Nirenberg, M . (2004) Historical review: deciphering the genetic code-a personal account. Trends Biochem Sci. 29, 46-54_

DeMartino, G.N. & Gillette, T.G. (2007) Proteasomes: machines for all reasons. Cell 129, 659-662.

Woese, C.R., Olsen, G.J., Ibba, M., & Soli, D. (2000) Arninoacyl­ tRNA synthetases, the genetic code, and the evolutionary process .

Protein Targeting and Secretion

Problems

� � 11

Hartmann-Petersen, R., Seeger, M., & Gordon C. (2003) Transferring substrates to the 26S proteasome. Trends Biochem. Sci. 28, 26-3 1 .

(b) What amino acid sequence could be coded by the mRNA in (a) , starting from the 5' end? (c) If the complementary (nontemplate) strand of this

Higgins, M.K. & McMahon, H.T. (2002) Snap-shots of clathrin­

DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biolog­

mediated endocytosis. Trends Biochem. Sci. 27, 257-263.

Liu, C.W., Li, X.H., Thompson, D., Wooding, K., Chang, T., Tang, Z., Yu, H., Thomas, P.J., & DeMartino, G.N. (2006) ATP binding and ATP hydrolysis play distinct roles in the function of 268 proteasome. Mol. Cell 24, 39-50.

Luzio, J.P., Pryor, P.R., & Bright, N.A. (2007) Lysosomes: fusion and function. Nat. Rev Mol. Cell Biol. 8, 622-632 . Mayor, S. & Pagano, R.E. (2007) Pathways of clathrin-independent endocytosis. Nat. Rev. Mol. Cell Biol. 8, 603-6 12 . Neupert, W. ( 1 997) Protein import into mitochondria. Annu. Rev. Biochem. 66, 863-9 1 7. Pickart, C.M. & Cohen, R.E. (2004) Proteasomes and their kin: proteases in the machine age. Nat Rev. Mol. Cell Biol 5, 1 77-187. Royle, S.J. (2006) The cellular functions of clathrin. Cell Mol Life Sci 63, 1823-1 832. Schatz, G. & Dobberstein, B. ( 1 996) Common principles of pro­ tein translocation across membranes. Science 271, 1 5 1 9-1525.

Schekman, R. (2007) How sterols regulate protein sorting and traf­ fic Proc Natl Acad Sci USA 104, 6496-6497.

Smalle, J. & Vierstra, R.D. (2004) The ubiquitin 268 proteasome proteolytic pathway. Annu Rev. Plant Biol 55, 555-590.

Stewart, M. (2007) Molecular mechanism of the nuclear protein im­ port cycle. Nat Rev. Mol. Cell Biol 8, 1 95-208.

Problems

ical significance of your answer. 5. Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the sin­ gle codon for methionine specify both the initiating residue

and interior Met residues of polypeptides synthesized by E. coli? 6. Synthetic mRNAs The genetic code was elucidated with polyribonucleotides synthesized either enzymatically or chem­ ically in the laboratory. Given what we now know about the ge­ netic code, how would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and a small number of Leu and Ser residues? What other amino acid(s) would be coded for by this polyribonu­ cleotide, but in smaller amounts? 7. Energy Cost of Protein Biosynthesis Determine the minimum energy cost, in terms of ATP equivalents expended, required for the biosynthesis of the {3-globin chain of hemoglo­ bin (146 residues) , starting from a pool including all necessary amino acids, ATP, and GTP. Compare your answer with the di­ rect energy cost of the biosynthesis of a linear glycogen chain of 1 46 glucose residues in (a1�4) linkage, starting from a

sequences that can code for the simple tripeptide segment

pool including glucose, UTP, and ATP (Chapter 1 5) . From your data, what is the extra energy cost of making a protein, in which all the residues are ordered in a specific sequence, com­ pared with the cost of making a polysaccharide containing the same number of residues but lacking the informational content of the protein? In addition to the direct energy cost for the synthesis of a protein, there are indirect energy costs-those required for the cell to make the necessary enzymes for protein synthesis. Compare the magnitude of the indirect costs to a eukaryotic cell of the biosynthesis of linear (a1�4) glycogen chains and the biosynthesis of polypeptides, in terms of the enzymatic machinery involved.

Leu-Met-Tyr. Your answer will give you some idea about the number of possible mRNAs that can code for one polypeptide.

8. Predicting Anticodons from Codons Most amino

1 . Messenger RNA Translation Predict the amino acid se­ quences of peptides formed by ribosomes in response to the following mRNA sequences, assuming that the reading frame begins with the first three bases in each sequence. (a) GGUCAGUCGCUCCUGAUU (b) UUGGAUGCGCCAUAAUUUGCU (c) CAUGAUGCCUGUUGCUAC (d) AUGGACGAA 2 . How Many Different mRNA Sequences Can Specify

One Amino Acid Sequence? Write all the possible mRNA

3. Can the Base Sequence of an mRNA Be Predicted

from the Amino Acid Sequence of Its Polypeptide Prod­ uct? A given sequence of bases in an mRNA will code for one

and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome c, can we pre­ dict the base sequence of the unique mRNA that coded it? Give reasons for your answer. 4. Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence

(5') CTTAACACCCCTGACTTCGCGCCGTCG(3 ') (a) What is the base sequence of the mRNA that can be transcribed from this strand?

acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible an­ ticodons for the four codons of glycine: (5')GGU, GGC, GGA,

and GGG. (a) From your answer, which of the positions in the anti­ codons are primary determinants of their codon specificity in the case of glycine? (b) Which of these anticodon-codon pairings has/have a wobbly base pair? (c) In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding? 9. Effect of Single-Base Changes on Amino Acid Se­

quence Much important confirmatory evidence on the ge­ netic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the

� � 11

Protein Metabolism

following amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single-base mu­ tation? Why? (a) Phe�Leu (e) Ile�Leu (b) Lys�Ala (f) His� Glu (c) Ala�Thr (g) Pro� Ser (d) Phe� Lys 10. Basis of the Sickle-Cell Mutation Sickle-cell hemoglo­ bin has a Val residue at position 6 of the f3-globin chain, instead

of the Glu residue found in normal hemoglobin A. Can you pre­ dict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val? 1 1 . Proofreading by Aminoacyl-tRNA Synthetases The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain. 1 2 . Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other struc­ tural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. (a) What features of tRNAAia are recognized by Ala-tRNA

synthetase? (b) Describe the consequences of a c � G mutation in the third position of the anticodon of tRNAAla. (c) What other kinds of mutations might have similar effects? (d) Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.) 13. Maintaining the Fidelity of Protein Synthesis The chemical mechanisms used to avoid errors in protein synthesis are different from those used during DNA replication. DNA polymerases use a 3' �5· exonuclease proofreading activity to remove mispaired nucleotides incorrectly inserted into a

growing DNA strand. There is no analogous proofreading func­ tion on ribosomes and, in fact, the identity of an amino acid at­ tached to an incoming tRNA and added to the growing polypeptide is never checked. A proofreading step that hy­ drolyzed the previously formed peptide bond after an incor­ rect amino acid had been inserted into a growing polypeptide (analogous to the proofreading step of DNA polymerases) would be impractical. Why? (Hint: Consider how the link be­ tween the growing polypeptide and the mRNA is maintained during elongation; see Figs 27-29 and 27-30.) 14. Predicting the Cellular Location of a Protein The gene for a eukaryotic polypeptide 300 amino acid residues

long is altered so that a signal sequence recognized by SRP oc­ curs at the polypeptide's amino terminus and a nuclear local­ ization signal (NLS) occurs internally, beginning at residue 1 50. Where is the protein likely to be found in the cell?

1 5 . Requirements for Protein Translocation across a

Membrane The secreted bacterial protein OmpA has a pre­

cursor, ProOmpA, which has the amino-terminal signal se­ quence required for secretion. If purified ProOmpA is denatured with 8 M urea and the urea is then removed (such as by running the protein solution rapidly through a gel filtra­ tion column) the protein can be translocated across isolated bacterial inner membranes in vitro. However, translocation be­ comes impossible if ProOmpA is first allowed to incubate for a few hours in the absence of urea. Furthermore, the capacity for translocation is maintained for an extended period if ProOmpA is first incubated in the presence of another bacter­ ial protein called trigger factor. Describe the probable function of this factor. 16. Protein-Coding Capacity of a Vll'al DNA The 5,386 bp

genome of bacteriophage cf>Xl 74 includes genes for 10 pro­ teins, designated A to K, with sizes given in the table below. How much DNA would be required to encode these 10 pro­ teins? How can you reconcile the size of the cf>X174 genome with its protein-coding capacity? Number of

Number of amino

amino

Protein

acid residues

Protein

acid residues

A B c D E

455 120 86 152 91

F G H

427 1 75 328 38 56

J

K

Data Analysis Problem 17. Designing Proteins b y Using Randomly Generated

Genes Studies of the amino acid sequence and corresponding

three-dimensional structure of wild-type or mutant proteins have led to significant insights into the principles that govern protein folding. An important test of this understanding would be to design a protein based on these principles and see whether it folds as expected. Kamtekar and colleagues (1 993) used aspects of the ge­ netic code to generate random protein sequences with defined patterns of hydrophilic and hydrophobic residues. Their clever approach combined knowledge about protein structure, amino acid properties, and the genetic code to explore the factors that influence protein structure. They set out to generate a set of proteins with the simple four-helix bundle structure shown at the top of page 1 1 13 (right) , with a helices (shown as cylinders) connected by segments of random coil (pink) . Each a helix is amphipathic­ the R groups on one side of the helix are exclusively hydropho­ bic (yellow) and those on the other side are exclusively hydrophilic (blue). A protein consisting of four of these helices separated by short segments of random coil would be expected to fold so that the hydrophilic sides of the helices face the solvent.

Problems

� � 11

the degenerate codon NTN, where N can be A, G, C, or T. They

filled each N position by including an equimolar mixture of A, G, C, and T in the DNA synthesis reaction to generate a mix­ ture of DNA molecules with different nucleotides at that posi­ tion (see Fig. 8-35) . Similarly, to encode random polar amino acid sequences, they began with the degenerate codon NAN

An

amphipathic a helix

Four-helix bundle

(a) What forces or interactions hold the four a helices to­

and used an equimolar mixture of A, G, and C (but in this case, no T) to fill the N positions. (e) Which amino acids can be encoded by the NTN triplet? Are all amino acids in this set hydrophobic? Does the set include all the hydrophobic amino acids? (f) Which amino acids can be encoded by the NAN triplet? Are all of these polar? Does the set include all the po­ lar amino acids?

ment to be an amphipathic helix, with the left side hydrophilic and the right side hydrophobic. Give a sequence of 1 0 amino acids that could potentially fold into such a structure. There are many possible correct answers here. (d) Give one possible double-stranded DNA sequence that could encode the amino acid sequence you chose for (c) . (It is an internal portion of a protein, so you do not need to in­ clude start or stop codons.) Rather than designing proteins with specific sequences, Kamtekar and colleagues designed proteins with partially ran­ dom sequences, with hydrophilic and hydrophobic amino acid residues placed in a controlled pattern. They did this by taking

(g) In creating the NAN codons, why was it necessary to leave T out of the reaction mixture? Kamtekar and coworkers cloned this library of random DNA sequences into plasmids, selected 48 that produced the correct patterning of hydrophilic and hydrophobic amino acids, and expressed these in E. coli. The next challenge was to determine whether the proteins folded as expected. It would be very time-consuming to express each protein, crystallize it, and determine its complete three-dimensional structure. Instead, the investigators used the E. coli protein­ processing machinery to screen out sequences that led to highly defective proteins. In this initial screening, they kept only those clones that resulted in a band of protein with the expected molecular weight on SDS polyacrylamide gel electrophoresis (see Fig. 3-18) . (h) Why would a grossly misfolded protein fail to produce a band of the expected molecular weight on electrophoresis? Several proteins passed this initial test, and further explo­ ration showed that they had the expected four-helix structure. (i) Why didn't all of the random-sequence proteins that passed the initial screening test produce four-helix structures?

advantage of some interesting features of the genetic code to construct a library of synthetic DNA molecules with partially

Ueferenee

gether in this bundled structure? Figure 4-4a shows a segment of a helix consisting of 1 0 amino acid residues. With the gray central rod as a divider, four of the R groups (purple spheres) extend from the left side of the helix and six extend from the right. (b) Number the R groups in Figure 4-4a, from top (amino terminus; 1 ) to bottom (carboxyl terminus; 1 0) . Which R groups extend from the left side and which from the right? (c) Suppose you wanted to design this 10 amino acid seg­

random sequences arranged in a particular pattern. To design a DNA sequence that would encode random hy­ drophobic amino acid sequences, the researchers began with

Kamtekar, S., Schiffer, J.M., Xiong, H., Babik, J.M., & Hecht, M.H. ( 1 993) Protein design by binary patterning of polar and non­ polar amino acids. Science 262, 1680-1685.

The fundamental problem of chemical physiology and of embryology is to u n derstand why tissue cel l s do not a l l express, a l l the ti me, a l l

p o te ntia l iti es i n herent i n their ge nom e.

the

-Franc;ois jacob and jacques Monad, article in journal of Mo l ecular Biology, 7 96 7

Regulation of Gene Expression 28.1

Principles of Gene Regulation

28.2

Regulation of Gene Expression in Bacteria

28.3

Regulation of Gene Expression in Eukaryotes

1116

O

1 1 26 1 1 36

f the 4,000 or so genes in the typical bacterial genome , or the perhaps 29 ,000 genes in the human genome, only a fraction are expressed in a cell at any given time. Some gene products are present in very large amounts: the elongation factors required for pro­ tein synthesis, for example, are among the most abun­ dant proteins in bacteria, and ribulose 1 ,5-bisphosphate carboxylase/oxygenase (rubisco) of plants and photo­ synthetic bacteria is, as far as we know, the most abun­ dant enzyme in the biosphere. Other gene products occur in much smaller amounts; for instance, a cell may contain only a few molecules of the enzymes that repair rare DNA lesions. Requirements for some gene products change over time. The need for enzymes in certain metabolic pathways may wax and wane as food sources change or are depleted. During development of a multi­ cellular organism, some proteins that influence cellular differentiation are present for just a brief time in only a few cells . Specialization of cellular function can dramat­ ically affect the need for various gene products; an ex­ ample is the uniquely high concentration of a single protein-hemoglobin-in erythrocytes. Given the high cost of protein synthesis, regulation of gene expression is essential to making optimal use of available energy. The cellular concentration of a protein is deter­ mined by a delicate balance of at least seven processes, each having several potential points of regulation: 1.

Synthesis of the primary RNA transcript (transcription)

2.

Posttranscriptional modification o f mRNA

3.

Messenger RNA degradation

4.

Protein synthesis (translation)

5.

Posttranslational modification of proteins

6.

Protein targeting and transport

7.

Protein degradation

These processes are summarized in Figure 28-1 . We have examined several of these mechanisms in previous chapters. Posttranscriptional modification of mRNA, by processes such as alternative splicing patterns (see Fig. 26-22) or RNA editing (see Figs 27-10, 27-12) , can affect which proteins are produced from an mRNA transcript and in what amounts. A variety of nucleotide sequences in an mRNA can affect the rate of its degrada­ tion (p. 1 048) . Many factors affect the rate at which an mRNA is translated into a protein, as well as the posttranslational modification, targeting, and eventual degradation of that protein (Chapter 27) . Of the regulatory processes illustrated in Figure 28-1 , those operating at the level of transcription initiation are the best documented and these are a major focus of this chapter; other mechanisms are also considered. Researchers continue to discover complex and some­ times surprising regulatory mechanisms, leading to an increasing appreciation of the importance of posttran­ scriptional and translational regulation, especially in eukaryotes. For many genes, the regulatory processes are elaborate and redundant and can involve a considerable investment of chemical energy. Control of transcription initiation permits the syn­ chronized regulation of multiple genes encoding prod­ ucts with interdependent activities. For example, when their DNA is heavily damaged, bacterial cells require a coordinated increase in the levels of the many DNA re­ pair enzymes. And perhaps the most sophisticated form of coordination occurs in the complex regulatory cir­ cuits that guide the development of multicellular eu­ karyotes, which can involve many types of regulatory mechanisms.

� � 11

Reg u l ation of Gene Exp ression

DNA ----.i

Gene

Transc•iption

Primary transcript Posttranscr�ptional processing

[\ 1 __/mRNA

Nucleotides

degradation

Mature mRNA � Translation

Protein (inactive)

Posttransl�tional processing

Amino acids

!V

• • • G

Modified protein (active)

1 FIGURE 28-1

Protein targeting and transport

Seven processes that affect the steady-state concen­

tration of a protein. Each process has several potential poi nts of regu lation.

We begin by examining the interactions between proteins and DNA that are the key to transcriptional regulation. We next discuss the specific proteins that influence the expression of specific genes, first in bacte­ rial and then in eukaryotic cells. Information about post­ transcriptional and translational regulation is included in the discussion, where relevant, to provide a more complete overview of the rich complexity of regulatory mechanisms.

28.1 Principles of Gene Reg ulation Genes for products that are required at all times, such as those for the enzymes of central metabolic pathways, are expressed at a more or less constant level in virtually every cell of a species or organism. Such genes are often referred to as housekeeping genes. Unvarying expres­ sion of a gene is called constitutive gene expression.

For other gene products, cellular levels rise and fall in response to molecular signals; this is regulated gene expression. Gene products that increase in concentra­ tion under particular molecular circumstances are referred to as inducible; the process of increasing their expression is induction. The expression of many of the genes encoding DNA repair enzymes, for example, is induced by a system of regulatory proteins that re­ sponds to high levels of DNA damage. Conversely, gene products that decrease in concentration in response to a molecular signal are referred to as repressible, and the process is called repression. For example, in bacteria, ample supplies of tryptophan lead to repression of the genes for the enzymes that catalyze tryptophan biosynthesis. Transcription is mediated and regulated by protein­ DNA interactions, especially those involving the protein components of RNA polymerase (Chapter 26) . We first consider how the activity of RNA polymerase is regu­ lated, and proceed to a general description of the pro­ teins participating in this regulation. We then examine the molecular basis for the recognition of specific DNA sequences by DNA-binding proteins. RNA Polymerase Binds to DNA at Promoters

RNA polymerases bind to DNA and initiate transcription at promoters (see Fig. 26-5) , sites generally found near points at which RNA synthesis begins on the DNA tem­ plate. The regulation of transcription initiation often en­ tails changes in how RNA polymerase interacts with a promoter. The nucleotide sequences of promoters vary con­ siderably, affecting the binding affinity of RNA poly­ merases and thus the frequency of transcription initiation. Some Escherichia coli genes are transcribed once per second, others less than once per cell genera­ tion. Much of this variation is due to differences in pro­ moter sequence. In the absence of regulatory proteins, differences in promoter sequence may affect the fre­ quency of transcription initiation by a factor of 1 ,000 or more. Most E. coli promoters have a sequence close to a consensus (Fig. 28-2 ). Mutations that result in a shift away from the consensus sequence usually decrease promoter function; conversely, mutations toward con­ sensus usually enhance promoter function. Although housekeeping genes are expressed consti­ tutively, the cellular concentrations of the proteins they encode vary widely. For these genes, the RNA polymerase-promoter interaction strongly influences the rate of transcription initiation; differences in promoter sequence allow the cell to synthesize the appropriate level of each housekeeping gene product. The basal rate of transcription initiation at the pro­ moters of nonhousekeeping genes is also determined by the promoter sequence, but expression of these genes is further modulated by regulatory proteins.

2 8 . 1 Principles of Gene Regu lation

� j 11

RNA start site

DNA 5 ' --------k � �P el_e_ m_e_ n_ t __

FIGURE 28-2



-35 region

GACA ----�� TT_

� �

__

-10 region

LI

__ __



I



N�1� 7-- �-T_ AAT_L A_ T_

__ __ _

__

--



N �5� -9 ��-------------

__

mRNA

Consensus sequence for many f. coli promoters. Most base substitutions in the

-

\.f'VV"+

1 0 and

-35 regions have a negative effect on promoter function. Some promoters also incl ude the UP (upstream

promoter) element (see Fig. 2 6-5). By convention, DNA sequences are shown as they exist in the nontem­ plate strand, with the 5' term i n us on the left. Nucleotides are numbered from the transcription start site, with positive nu mbers to the right (in the di rection of transcription) and negative numbers to the left. N indicates any nucleotide.

Many of these proteins work by enhancing or interfer­ ing with the interaction between RNA polymerase and the promoter. The sequences of eukaryotic promoters are more variable than their bacterial counterparts (see Fig. 26-9). The three eukaryotic RNA polymerases usually require an array of general transcription factors in order to bind to a promoter. Yet, as with bacterial gene expres­ sion, the basal level of transcription is determined by the effect of promoter sequences on the function of RNA polymerase and its associated transcription factors. Transcri ption I n itiation Is Regulated by Proteins That Bind to or near Promoters

At least three types of proteins regulate transcription initiation by RNA polymerase: specificity factors alter the specificity of RNA polymerase for a given promoter or set of promoters; repressors impede access of RNA polymerase to the promoter; and activators enhance the RNA polymerase-promoter interaction. We introduced bacterial specificity factors in Chap­ ter 26 (see Fig. 26-5) , although we did not refer to them by that name. The u subunit of the E. coli RNA poly­ merase holoenzyme is a specificity factor that mediates promoter recognition and binding. Most E. coli promot­ ers are recognized by a single u subunit (M 70,000) , r u70. Under some conditions, some of the u70 subunits are replaced by one of six other specificity factors. One notable case arises when the bacteria are subjected to heat stress, leading to the replacement of u70 by u32 (Mr 32 000) . When bound to u32, RNA polymerase is di­ rected to a specialized set of promoters with a different ,

consensus sequence ( Fig. 2 8-3 ) . These promoters control the expression of a set of genes that encode pro­ teins, including some protein chaperones (p. 1 43) , that are part of a stress-induced system called the heat shock response. Thus, through changes in the binding affinity of the polymerase that direct it to different promoters, a set of genes involved in related processes is coordinately regulated. In eukaryotic cells, some of the general transcription factors, in particular the TATA-binding protein (TBP; see Fig. 26-9) , may be considered speci­ ficity factors. Repressors bind to specific sites on the DNA In bac­ terial cells, such binding sites, called operators, are generally near a promoter. RNA polymerase binding, or its movement along the DNA after binding, is blocked when the repressor is present. Regulation by means of a repressor protein that blocks transcription is referred to as negative regulation. Repressor binding to DNA is regulated by a molecular signal (or effector) , usually a small molecule or a protein, that binds to the repressor and causes a conformational change. The interaction be­ tween repressor and signal molecule either increases or decreases transcription. In some cases, the conforma­ tional change results in dissociation of a DNA-bound re­ pressor from the operator (Fig. 2 8-4a) . Transcription initiation can then proceed unhindered. In other cases, interaction between an inactive repressor and the signal molecule causes the repressor to bind to the operator (Fig. 28-4b) . In eukaryotic cells, the binding site for a repressor may be some distance from the promoter; binding has the same effect as in bacterial cells: inhibit­ ing the assembly or activity of a transcription complex at the promoter. RNA start site

DNA 5'

FIGURE 28-3

I TNTCNCCCTTGAA

N l3-15

l I CCCCATTTA I N7 I mRNA

.f"VV'-+

Consensus sequence for promoters that regulate expression of the f. coli heat shock genes.

This system responds to temperature i ncreases as well as some other environmental stresses, resulting in the induction of a set of proteins. B i nding of RNA polymerase to heat shock promoters is mediated by a spe­ cial ized

u

subunit of the polymerase,

32 u ,

which replaces

70

u

in the RNA polymerase i n itiation complex.

� � 11

Regu lation of Gene Expression

Negative regulation

Positive regulation

(bound repressor inhibits transcription)

(bound activator facilitates transcription)

(a) DNA

Promoter Molecular signal causes dissociation of regnlatory protein from DNA ignal

I

molecule



1

5' J'+ 3' mRNA

5' V'+ 3' mRNA

(b)

d)



Molecular signal causes binding of regulatory protein to DNA

1

5' V'+ 3' mR. 'A

5' ...f'-+ 3' mRNA

FIGURE 28-4

Common patterns of regulation of transcription initia­

signal and transcription proceeds; when the signal is added, the activa­

tion. Two types of negative regulation are i l l ustrated. (a) Repressor

tor di ssociates and transcription is inhibited. (d) Activator binds in the

(pink) binds to the operator in the absence of the molecular signal; the

presence of the signal; it dissociates only when the signal is removed.

external signal causes dissociation of the repressor to permit transcrip­

N ote that "positive" and "negative" regu lation refer to the type of

tion. (b) Repressor binds in the presence of the signal; the repressor

regulatory protein involved: the bound protein either fac i l i tates or i n­

dissociates and transcription ensues when the signal is removed. Posi­

h ibits transcription. In either case, addition of the molecular signal

tive regulation is mediated by gene activators. Again, two types are

may increase or decrease transcription, depending on its effect on the

shown. (c) Activator (green) binds in the absence of the molecular

regulatory protein.

Activators provide a molecular counterpoint to re­ pressors; they bind to DNA and enhance the activity of RNA polymerase at a promoter; this is positive regula­ tion. Activator-binding sites are often adjacent to pro­ moters that are bound weakly or not at all by RNA polymerase alone, such that little transcription occurs in the absence of the activator. Some eukaryotic activators bind to DNA sites, called enhancers, that are quite dis­ tant from the promoter, affecting the rate of transcrip­ tion at a promoter that may be located thousands of base pairs away. Some activators are usually bound to DNA, enhancing transcription until dissociation of the activator is triggered by the binding of a signal molecule (Fig. 28-4c) . In other cases the activator binds to DNA only after interaction with a signal molecule (Fig. 28-4d) . Signal molecules can therefore increase or decrease transcription, depending on how they affect

the activator. Positive regulation is particularly common in eukaryotes, as we shall see. Many Bacterial Genes Are Clustered and Regulated in Operons

Bacteria have a simple general mechanism for coordi­ nating the regulation of genes encoding products that participate in a set of related processes: these genes are clustered on the chromosome and are transcribed together. Many bacterial mRNAs are polycistronic­ multiple genes on a single transcript-and the single promoter that initiates transcription of the cluster is the site of regulation for expression of all the genes in the cluster. The gene cluster and promoter, plus additional sequences that function together in regulation, are called an operon ( Fig. 28-5 ) . Operons that include

2 8 . 1 Prin ciples of Gene Regulation

Activator binding site DNA

I

"'

11

Repressor binding site (operator)

I Promoter W$/M I I

Regulatory sequences

FIGURE 28-5

� �

A

B

c

Genes transcribed as a unit

Representative bacterial operon. Genes A, B, and C are

transcri bed on one polycistron i c m RNA. Typ ical regulatory sequences include binding sites for proteins that either activate or repress tran­ scription from the promoter.

two to six genes transcribed as a unit are common; some operons contain 20 or more genes. Many of the principles of bacterial gene expression were first defined by studies of lactose metabolism in E. coli, which can use lactose as its sole carbon source . In 1 960, FranEnol- 1 -o-carboxy fndole-3-glycerol � phosphate anthranilate phenylaminoC 02 PRPP PP1 1-deoxyribulose Glyceraldehyde phosphate 3-phosphate H.20

l-Serme

(Fig. 2 8-20) . When tryptophan is abundant it binds to

overlaps the promoter, so binding of the repressor

the Trp repressor, causing a conformational change that

blocks binding of RNA polymerase.

permits the repressor to bind to the

trp operator and in­ hibit expression of the trp operon. The trp operator site

Once again, this simple on/off circuit mediated by a repressor is not the entire regulatory story. Different cellular concentrations of tryptophan can vary the rate of synthesis of the biosynthetic enzymes over a 700-fold range. Once repression is lifted and transcrip­ tion begins, the rate of transcription is fine-tuned by a second regulatory process, called transcription atten­

uation, in which transcription is initiated normally but before the operon genes are tran­

is abruptly halted

scribed. The frequency with which transcription is at­ tenuated is regulated by the availability of tryptophan and relies on the very close coupling of transcription and translation in bacteria. The

Trp repressor. The repressor is a dimer, with both sub­

trp operon attenuation mechanism uses signals 1 62 nucleotide leader region at the 5' end of the mRNA, preceding the initiation codon of the first gene (Fig. 2 8-2 1a) . Within the leader lies a region known as the attenuator, made up of sequences 3 and 4. These sequences base-pair to

units (gray and l ight b l ue) bi nding the DNA at hel ix-tu rn-hel i x motifs

form a G=C-rich stem-and-loop structure closely followed

(PDB ID 1 TRO) . Bound molecules of tryptophan are in red.

by a series of U residues. The attenuator structure acts as

encoded in four sequences within a

FIGURE 28-20



Leader peptide Met- Lys - Ala - lle - Phe - Val --

mRNA """'GUUCACGUAAAAAGGGUAUCGACAAOGAAGCA A A .� . GAAA .:::l"

}�

'lJCGIJAC�

_ "OOdUACCACUUA-oGUGA GGGCAG AA UCCUUCAOOOGGUGGuUG,_;

2



(stop)-Ser

13 9

-

0

162

�Met-Gln -Thr-+

uuubUUGAACAAAAUUAGAGAAUAACiAUGCAAACAl TrpE polypeptide

�UACCCAGCCCGCCUAAUGAGCGGGCUU 3

- Thr- Arg- T'P - Trp

4

Site of transcription attenuation

End of leader region (trpL)

(a)

Completed leader peptide

MRAIF v�

RNA �.-/ polymerase

4

UUUU 3 '

A U A U G C A C -G G- C c -o C-G C-G o-c A- u U UUUUU C AGAUACC

I

1 10

3:4 Pair (attenuator)

When tryptophan levels are high, the ribosome quickly translates sequence 1 (open reading frame encoding leader peptide) and blocks sequence 2 before sequence 3 is transcribed. Continued transcription leads to attenuation at the terminator-like attenuator structure formed by sequences 3 and 4.

A

A G A C - G - 100 G- C U>-- A A A u 90 - c c c A A C -G U ·A U

U

A-U

U- A - 1 1 0 G--c c u 80 -G C A A C-G o�- c o� c G- C C-G A C A C u

4

When tryptophan levels are low, the ribosome pauses at the Trp codons in sequence 1. Formation of the paired structure between sequences 2 and 3 prevents attenuation, because sequence 3 is no longer available to form the attenuator structure with sequence 4. The 2:3 structure, unlike the 3:4 attenuator, does not prevent transcription.

2:3

(b) F IGURE 28-21

Transcriptional attenuation in the trp operon. Tran­

Pair

(c) complementary, as are sequences 3 and 4. The attenuator structure

scription is in itiated at the begi nning of the 1 62 nucleotide mRNA

forms by the pairing of sequences 3 and 4 (top). Its structure and func­

leader encoded by a DNA region cal led trpL (see Fig. 28-1 9) . A regu­

tion are similar to those of a transcription terminator (see Fig. 2 6-8).

latory mechanism determi nes whether transcription is attenuated at

Pairing of sequences 2 and 3 (bottom ) prevents the attenuator structure

the end of the leader or continues i nto the structural genes. (a) The trp

from forming. Note that the l eader peptide has no other cel l u lar func­

mRNA leader (trpL). The attenuation mechanism in the trp operon i n­

tion. Translation of its open reading frame has a purely regulatory role

volves sequences 1 to 4 (h ighl ighted). (b) Sequence 1 encodes a small

that determines which complementary sequences (2 and 3 or 3 and 4)

peptide, the leader peptide, containing two Trp res idues (W); it is trans­

are paired. (c) Base-pai ring schemes for the compl ementary regions of

l ated immed iately after transcription begins. Sequences 2 and 3 are

the trp m R NA l eader.

� 1 3�

Regulation of Gene Expression

a transcription terminator (Fig. 28-2 1b) . Sequence 2 is an alternative complement for sequence 3 (Fig. 28-2 1 c) . If sequences 2 and 3 base-pair, the attenuator structure cannot form and transcription continues into the trp biosynthetic genes; the loop formed by the pairing of se­ quences 2 and 3 does not obstruct transcription. Regulatory sequence 1 is crucial for a tryptophan­ sensitive mechanism that determines whether sequence 3 pairs with sequence 2 (allowing transcription to con­ tinue) or with sequence 4 (attenuating transcription) . Formation of the attenuator stern-and-loop structure depends on events that occur during translation of reg­ ulatory sequence 1 , which encodes a leader peptide (so called because it is encoded by the leader region of the rnRNA) of 1 4 amino acids, two of which are Trp residues. The leader peptide has no other known cellu­ lar function; its synthesis is simply an operon regulatory device. This peptide is translated immediately after it is transcribed, by a ribosome that follows closely behind RNA polymerase as transcription proceeds. When tryptophan concentrations are high, concen­ trations of charged tryptophan tRNA (Trp-tRNATrp) are also high. This allows translation to proceed rapidly past the two Trp codons of sequence 1 and into sequence 2 , before sequence 3 i s synthesized by RNA polymerase. In this situation, sequence 2 is covered by the ribosome and unavailable for pairing to sequence 3 when sequence 3 is synthesized; the attenuator structure (sequences 3 and 4) forms and transcription halts (Fig. 28-2 lb, top) . When tryptophan concentrations are low, however, the ribo­ some stalls at the two Trp codons in sequence 1 , because

E. coli

charged tRNATrp is less available. Sequence 2 remains free while sequence 3 is synthesized, allowing these two sequences to base-pair and permitting transcription to proceed (Fig. 28-2 1b, bottom). In this way, the propor­ tion of transcripts that are attenuated declines as trypto­ phan concentration declines. Many other amino acid biosynthetic operons use a sim­ ilar attenuation strategy to fine-tune biosynthetic enzymes to meet the prevailing cellular requirements. The 15 amino acid leader peptide produced by the phe operon contains seven Phe residues. The leu operon leader peptide has four contiguous Leu residues. The leader peptide for the his operon contains seven contiguous His residues. In fact, in the his operon and a number of others, attenuation is suffi­ ciently sensitive to be the only regulatory mechanism. Induction of the 505 Response Requires Destruction of Repressor Proteins

Extensive DNA damage in the bacterial chromosome triggers the induction of many distantly located genes. This response, called the SOS response (p. 1001) , pro­ vides another good example of coordinated gene regula­ tion. Many of the induced genes are involved in DNA repair (see Table 25-6) . The key regulatory proteins are the RecA protein and the LexA repressor. The LexA repressor CMr 22,700) inhibits transcrip­ tion of all the SOS genes (Fig. 2 8-22), and induction of the SOS response requires removal of LexA. This is not a simple dissociation from DNA in response to binding of a small molecule, as in the regulation of the lac operon

chromosome

poiB

dinB

uurB

() 11) Damage to

DNA produces ingle- trand gap \

FIGURE 28-22

SOS response in f. coli. See Table 2 5-6

lexA

for the functions of many of these proteins. The LexA protein is the repressor i n this system, which has an op· erator site (red) near each gene. Because the recA gene is not entirely repressed by the LexA repressor, the nor­ mal cel l contains about 1 ,000 RecA monomers.

G)

When DNA is extensively damaged (such as by UV l ight), DNA repl ication is halted and the n u mber of sin­ gle-strand gaps i n the DNA i ncreases.

0

RecA protein

b i nds to this damaged, single-stranded DNA, activating the protein's coprotease activity.

®

While bound to

DNA, the RecA protein fac i l itates c leavage and inacti­ vation of the LexA repressor. When the repressor is in­ activated, the 505 genes, i n c l ud i ng recA, are i nduced; RecA levels increase 50-

to

1 00-fold.

recA

+ - - Replication - - ->

polE

1

dinE

uvrB

28.2 Regu lation of Gene Expression in Bacteria

described above. Instead, the Lex.A repressor is inacti­ vated when it catalyzes its own cleavage at a specific Ala-Gly peptide bond, producing two roughly equal pro­ tein fragments. At physiological pH, this autocleavage re­ action requires the RecA protein. RecA is not a protease in the classical sense, but its interaction with Lex.A facil­ itates the repressor's self-cleavage reaction. This func­ tion of RecA is sometimes called a coprotease activity. The RecA protein provides the functional link be­ tween the biological signal (DNA damage) and induc­ tion of the SOS genes. Heavy DNA damage leads to numerous single-strand gaps in the DNA, and only RecA that is bound to single-stranded DNA can facilitate cleavage of the Lex.A repressor (Fig. 28-22, bottom) . Binding of RecA at the gaps eventually activates its co­ protease activity, leading to cleavage of the Lex.A re­ pressor and SOS induction. During induction of the SOS response in a severely damaged cell, RecA also cleaves and thus inactivates the repressors that otherwise allow propagation of certain viruses in a dormant lysogenic state within the bacterial host. This provides a remarkable illustration of evolu­ tionary adaptation. These repressors, like Lex.A, also un­ dergo self-cleavage at a specific Ala-Gly peptide bond, so induction of the SOS response permits replication of the virus and lysis of the cell, releasing new viral parti­ cles. Thus the bacteriophage can make a hasty exit from a compromised bacterial host cell.

f3 operon 5 ' [

r;o

L10 \L71Ll2J

/3

[3'

(3'

ft

7

str

a

operon 5 ' 1

operon 5 ' [

812

f I

Synthesis of Ribosomal Proteins Is Coordinated with rRNA Synthesis

In bacteria, an increased cellular demand for protein synthesis is met by increasing the number of ribosomes rather than altering the activity of individual ribosomes. In general, the number of ribosomes increases as the cellular growth rate increases. At high growth rates, ri­ bosomes make up approximately 45% of the cell's dry weight. The proportion of cellular resources devoted to making ribosomes is so large , and the function of ribo­ somes so important, that cells must coordinate the syn­ thesis of the ribosomal components: the ribosomal proteins (r-proteins) and RNAs (rRNAs) . This regula­ tion is distinct from the mechanisms described so far, because it occurs largely at the level of translation. The 52 genes that encode the r-proteins occur in at least 20 operons, each with 1 to 1 1 genes. Some of these operons also contain the genes for the subunits of DNA prirnase (see Fig. 25-1 3) , RNA polymerase (see Fig. 26-4) , and protein synthesis elongation factors (see Fig. 27-28)-revealing the close coupling of replication, transcription, and protein synthesis during cell growth. The r-protein operons are regulated primarily through a translational feedback mechanism. One r-protein encoded by each operon also functions as a translational repressor, which binds to the mRNA transcribed from that operon and blocks translation of all the genes the messenger encodes (Fig. 2 8-23). In general, the r-protein that plays the role of repressor also binds directly to an rRNA. Each translational re­ pressor r-protein binds with higher affinity to the appro­ priate rRNA than to its mRNA, so the rnRNA is bound and translation repressed only when the level of the r­ protein exceeds that of the rRNA. This ensures that translation of the mRNAs encoding r-proteins is re­ pressed only when synthesis of these r-proteins exceeds that needed to make functional ribosomes. In this way, the rate of r-protein synthesis is kept in balance with rRNA availability. FIGURE 28-23

84

Translational feedback in some ribosomal protein

operons. The r-proteins that act as translational repressors are shaded pink. Each translational repressor blocks the translation of a l l genes i n that operon b y b i nd i ng t o the i ndicated site o n the m R NA . Genes that

813

811

84

a

I L17LJ3'

encode subunits of RNA polymerase are shaded yel l ow; genes that en­ code el ongation factors are blue. The r-proteins of the large (505) ri bo­ somal subunit are desi gnated L 1 to L34; those of the smal l (305)

-

810 operon 5 ' 1

13'

87 I EF-G I EF-Tul

� 1 3�

subun it, 5 1 to 52 1 .

-- L4

-

810

L3

I

S8

t

'

� 1 3�

'

Reg ulation of Gene Exp ression

The mRNA binding site for the translational repres­

sis is halted. Amino acid starvation leads to the binding

sor is near the translational start site of one of the genes

of uncharged tRNAs to the ribosomal A site; this triggers

in the operon, usually the first gene (Fig. 28-23) . In

a sequence of events that begins with the binding of an

other operons this would affect only that one gene, be­

enzyme called

cause in bacterial polycistronic mRNAs most genes have

ribosome. When bound to the ribosome, stringent factor

stringent factor (RelA protein) to the

independent translation signals . In the r-protein oper­

catalyzes formation of the unusual nucleotide guanosine

ons, however, the translation of one gene depends on

tetraphosphate (ppGpp; see Fig. 8-39) ; it adds py­

the translation of all the others. The mechanism of this

rophosphate to the 3' position of GTP, in the reaction

translational coupling is not yet understood in detail.

GTP + ATP

However, in some cases the translation of multiple genes

---)-

pppGpp + AMP

seems to be blocked by folding of the mRNA into an

then a phosphohydrolase cleaves off one phosphate to

elaborate three-dimensional structure that is stabilized

form ppGpp. The abrupt rise in ppGpp level in response

both by internal base-pairing "(as in Fig. 8-23) and by

to amino acid starvation results in a great reduction in

binding of the translational repressor protein. When the

rRNA synthesis, mediated at least in part by the binding

translational repressor is absent, ribosome binding and

of ppGpp to RNA polymerase.

translation of one or more of the genes disrupts the

The nucleotide ppGpp, along with cAMP, belongs

folded structure of the mRNA and allows all the genes to

to a class of modified nucleotides that act as cellular

be translated.

second messengers (p. 298) . In

Because the synthesis of r-proteins is coordinated

E. coli, these two nu­

cleotides serve as starvation signals; they cause large

with the available rRNA, the regulation of ribosome pro­

changes in cellular metabolism by increasing or decreas­

duction reflects the regulation of rRNA synthesis. In

ing the transcription of hundreds of genes. In eukaryotic

responds to cellular growth rate and to changes in the

multiple regulatory functions. The coordination of cellu­

availability of crucial nutrients , particularly amino acids.

lar metabolism with cell growth is highly complex, and

E. coli, rRNA synthesis from the seven rRNA operons

The regulation coordinated with amino acid concentra­ tions is known as the stringent response

( Fig. 28-24) .

cells, similar nucleotide second messengers also have

further regulatory mechanisms undoubtedly remain to be discovered.

When amino acid concentrations are low, rRNA synthe-

The Fu nction of Some m RNAs Is Regulated by +

Small RNAs in Cis or in Trans A s described throughout this chapter, proteins play an important and well-documented role in regulating gene expression. But RNA also has a crucial role-one that is becoming better recognized as more examples of regula­ tory RNAs are discovered. Once an mRNA is synthesized, its functions can be controlled by RNA-binding proteins, as seen for the r-protein operons just described, or by an

5'

3'

RNA. A separate RNA molecule may bind to the mRNA "in trans" and affect its activity. Alternatively, a portion of

�---.-----+-- Stringent

factor (RelA protein)

GTP + ATP

(p)ppGpp + AMP I I I I

RNA polymerase

the mRNA itself may regulate its own function. When part of a molecule afiects the function of another part of the same molecule, it is said to act "in cis." A well-characterized example of RNA regulation in trans is seen in the regulation of the mRNA of the gene rpoS (RNA polymerase sigma factor) , which encodes one of the seven E. coli sigma factors (see Table

if',

26-1).

The cell uses this specificity factor in certain stress situa­ tions, such as when it enters the stationary phase (a state

of no growth, necessitated by lack of nutrients) and if' is

FIGURE 28-24 Stringent response in f. coli. Th is response to amino acid starvation is triggered by binding of an uncharged tRNA in the ri­ bosomal A site. A protein cal l ed stringent factor binds to the ribosome

needed to transcribe large numbers of stress response genes. The

if' mRNA is present at low levels under most

conditions but is not translated, because a large hairpin

and catalyzes the synthesis of pppGpp, which is converted by a phos­

structure upstream of the coding region inhibits ribosome

phohydrolase to ppGpp. The signal ppGpp reduces transcription of

binding

some genes and increases that of others, in part by binding to the f3

one or both of two small special-function RNAs, DsrA

subunit of RNA polymerase and altering the enzyme's promoter speci ­ ficity. Synthesis of rRNA is reduced when ppGpp levels i nc rease.

(Fig. 28-25 ) . Under certain stress conditions,

(downstream region A) and RprA (Rpos regulator RNA A) , are induced. Both can pair with one strand of the hair-

28.2 Regulation of Gene Expression in Bacteria

(a)

and numerous examples of RNA-mediated regulation in

rpoS

mRNA

5'

®

G 1 3�

eukaryotes.

Ribosomebinding site

iii

3'

Regulation in cis involves a class of RNA structures 3'

known as

riboswitches. As described in Box 26-3 , ap­

tamers are RNA molecules , generated in vitro, that are capable of specific binding to a particular ligand. As one

D"A 5'

might expect, such ligand-binding RNA domains are also present in nature-in riboswitches-in a significant number of bacterial mRNAs (and even in some eukary­ otic mRNAs) . These natural aptamers are structured domains found in untranslated regions at the

5' ends of

certain bacterial mRNAs. Binding of an mRNA's ri­ boswitch to its appropriate ligand results in a conforma­ tional

change

in the

mRNA,

and transcription is

inhibited by stabilization of a premature transcription

(b)

termination structure, or translation is inhibited (in cis) rpoS

mRNA

by occlusion of the ribosome-binding site Ribosome­ binding site

(Fig. 28-26) .

In most cases, the riboswitch acts in a kind of feedback loop. Most genes regulated in this way are involved in the synthesis or transport of the ligand that is bound by the riboswitch; thus, when the ligand is present in high

Ribosome­ bind ing site

5'

FIGURE 28-25 Regulation of bacterial mRNA function in trans by sRNAs. Several sRNAs (small RNAs)- DsrA, RprA, and OxyS-are

Stabilization of a

(a}

i nvolved i n regulation of the rpoS gene. All req u i re the protein Hfq, an

poly(U)

RNA chaperone that fac i l itates RNA-RNA pa i ring. Hfq has a toroid

terminator

structu re, with a pore in the center. (a) DsrA promotes translation by

transcription termina­ tor structure aborts transcription.

pairing with one strand of a stem-loop structure that otherwise blocks the ribosome-binding site. RprA acts in a s i m i lar way. (b) OxyS blocks tra nslation by pairing with the ri bosome-binding site.

pin in the

us

Blockage of the

( b)

ribosome-binding site blocks translation.

"\."-------- 3'

mRNA, disrupting the hairpin and thus al­

lowing translation of rpoS. Another small RNA, OxyS (oxidative stress gene S) , is induced under conditions of oxidative stress and inhibits the translation of rpoS, prob­ ably by pairing with and blocking the ribosome-binding site on the mRNA. OxyS is expressed as part of a system

(c)

Regulation of intron splicing in fungal and

that responds to a different type of stress (oxidative dam­

plant introns.

age) than does rpoS, and its task is to prevent expression of unneeded repair pathways. DsrA, RprA, and OxyS are

all relatively small bacterial RNA molecules (less than 300 nucleotides) , designated sRNAs (s for small; there are of course other "small" RNAs with other designations in eu­ karyotes) . All require for their function a protein called

3' 5 '-- GUACGG



5' splice site

FIGURE 28-26 Regulation o f bacterial mRNA function i n cis by riboswitches. The known modes of action are i l l ustrated by several

Hfq, an RNA chaperone that facilitates RNA-RNA pairing.

different riboswitches based on a widespread natural aptamer that

The known bacterial genes regulated in this way are few

bi nds th iamine pyrophosphate. TPP b i n d i ng to the aptamer leads to a

in number, just a few dozen in a typical bacterial species.

conformational change that produces the varied results i l lustrated i n

However, these examples provide good model systems

parts (a), (b), and (c) i n the different systems i n which the aptamer is

for understanding patterns present in the more complex

uti l i zed.

� 1 3�J

Regulation of G e n e Expression

concentrations, the riboswitch inhibits expression of the genes needed to replenish this ligand. Each riboswitch binds only one ligand. Distinct ri­ boswitches have been detected that respond to more than a dozen different ligands, including thiamine py­ rophosphate (TPP, vitamin B ) cobalamin (vitamin B 1 2)

1 ,

,

flavin mononucleotide, lysine , S-adenosylmethionine (adoMet) , purines , N-acetylglucosamine 6-phosphate, and glycine. It is likely that many more remain to be dis­ covered. The riboswitch that responds to TPP seems to be the most widespread; it is found in many bacteria, fungi, and some plants. The bacterial TPP riboswitch in­ hibits translation in some species and induces prema­ ture transcription termination in others (Fig. 28-26) .

FIGURE 28-27 Salmonella typhimurium, with flagel l a evident.

The eukaryotic TPP riboswitch is found in the introns of certain genes and modulates the alternative splicing of those genes (see Fig. 26-22) . It is not yet clear how common riboswitches are. However, estimates suggest that more than 4% of the genes of Bacillus

subtilis are

regulated by riboswitches . A s riboswitches become better understood, re­ searchers are finding medical applications. For example, most of the riboswitches described to date in­



cluding the one that responds to adoMet, have b en found only in bacteria. A drug that bound to and acti­ vated the adoMet riboswitch would shut down the genes encoding the enzymes that synthesize and transport adoMet, effectively starving the bacterial cells of this es­ sential cofactor. Drugs of this type are being sought for use as a new class of antibiotics . •

The pace of discovery of functional RNAs shows no

signs of abatement and continues to enrich the hypoth­ esis that RNA played a special role in the evolution of life (Chapter 26) . The sRNAs and riboswitches ' like ri­ bozymes and ribosomes, may be vestiges of an RNA world obscured by time but persisting as a rich array of biological devices still functioning in the extant bio­ sphere. The laboratory selection of aptamers and ri­ bozymes with novel ligand-binding and

enzymatic

functions (see Box 26-3) tells us that the RNA-based activities necessary for a viable RNA world are possible. Discovery of many of the same RNA functions in living organisms tells us that key components for RNA-based metabolism do exist. For example, the natural aptamers of riboswitches may be derived from RNAs that billions

�ote the

of years ago, bound to cofactors needed to pro

enzymatic processes required for metabolism in the RNA world.

Some Genes Are Regu lated by Genetic Recom bination

nent targets of mammalian immune systems. But

Sal­ monella cells have a mechanism that evades the im­ mune response : they switch between two distinct flagellin proteins (FljB and FliC) roughly once every 1 ,000

generations ,

using

a process

called

phase

variation. The switch is accomplished by periodic inversion of a segment of DNA containing the promoter for a flagellin gene. The inversion is a site-specific recombination re­ action (see Fig. 25-4 1 ) mediated by the Hin recombi­ nase at specific 14 bp sequences (hix sequences) at either end of the DNA segment. When the DNA segment is in one orientation, the gene for FljB flagellin and the gene

encoding

a

repressor

(FljA)

are

expressed

(Fig. 2 8-28a) ; the repressor shuts down expression of the gene for FliC flagellin. When the DNA segment is

inverted (Fig. 28-28b) , the jljA and jljB genes are no longer transcribed, and the .fiiC gene is induced as the repressor becomes depleted. The Hin recombinase , encoded b y the

hin gene i n the DNA segment that

undergoes inversion, is expressed when the DNA segment is in either orientation, so the cell can always switch from one state to the other. This type of regulatory mechanism has the advan­ tage of being absolute: gene expression is impossible when the gene is physically separated from its pro­ moter (note the position of the jljB promoter in Fig.

28-28b) . An absolute on/off switch may be important in

this system (even though it affects only one of the two flagellin genes) , because a flagellum with just one copy of the wrong flagellin might be vulnerable to host anti­ bodies against that protein. The

Salmonella system is

by no means unique. Similar regulatory systems occur in some other bacteria and in some bacteriophages , and recombination systems with similar functions have

We turn now to another mode of bacterial gene regula­

been found in eukaryotes (Table 28-1 ) . Gene regula­

tion, at the level of DNA rearrangement-recombination.

tion by DNA rearrangements that move genes and/or

Salmonella typhimurium, which inhabits the mam­

promoters is particularly common in pathogens that

malian intestine, moves by rotating the flagella on its cell

benefit by changing their host range or by changing

(Fig. 2 8-27 ) . The many copies of the protein flagellin CMr 53,000) that make up the flagella are promi-

immune systems.

surface

their surface proteins, thereby staying ahead of host

28.2 Regu lation of Gene Exp ression in Bacteria

I

G 13�

Inverted repeat (hix)

D A

IH

hin

/ Promoter for FljB and repressor K----1 fljB I

Promoter

/ for FliC 1

fliC

"'\/'+ hin mRNA

f1jB and f1jA mRNA

!

Hin recombi.nase (a)

!

FljB flagellin

!

FljA protein .,, (repressor)

Transposed segment

I F-FI

.rv

lun

I�

f1jB

fljA

El

..r\./\..

FIGURE 28-28

1

fliC mRNA

Fli

Hin recombinase

Regulation of flagellin genes in Salmonella: phase

variation. The products of genes fliC and fljB are different flagel l i ns.

I

J\./"'+

hin mRNA

(b)

fii

1

flageUin

the fljA gene) that represses transcription of the fliC gene. (b) I n the op­

posite orientation only the fliC gene is expressed; the fljA and fljB

The hin gene encodes the recombi nase that catalyzes inversion of the

genes cannot be transcribed. The i nterconversion between these two

DNA segment conta i n i ng the fljB promoter and the hin gene. The re­

states, known as phase variation, also requi res two other nonspecific

combination s ites ( inverted repeats) are cal led hix (yellow). (a) In one

DNA-binding proteins (not shown), HU and FIS.

orientation, fljB is expressed along with a repressor protein (product of

TABLE 28- 1 System

Recombinase/ recombination site

Type of recombination

Phase variation (Salmonella)

Hinlhix

Site-specific

Host range (bacteriophage J.L)

Alternative expression of two fiagellin genes allows evasion of host immune response.

Ginlgix

Site-specific

Alternative expression of two sets of tail fiber genes affects host range.

Mating-type switch (yeast)

HO endonuclease, RAD52 protein, other proteins/MAT

Nonreciprocal gene conversion*

Alternative expression of two mating types of yeast, a and a, creates cells of different mating types that can mate and undergo meiosis.

Antigenic variation (trypanosomes) t

Varies

Nonreciprocal gene conversion*

Successive expression of different genes encoding the variable surface glycoproteins (VSGs) allows evasion of host immune response.

Function

*In nonreciprocal gene conversion (a class of recombination events not discussed in Chapter 25), genetic information is moved from one part of the genome (where it is silent) to another (where it is expressed). The reaction is similar to replicative transposition (see Fig. 25-45). 1

Trypanosomes cause African sleeping sickness and other diseases (see Box 22-3). The outer surface of a trypanosome is made up of multiple

copies of a single VSG, the major surface antigen. A cell can change surface antigens to more than 100 different forms, precluding an effective defense by the host immune system.

� 1 3�

Regulation of Gene Expression

S U M M A RY 2 8.2 •











Regulation of Gene E x p r e s s i o n i n Ba cteria

In addition to repression by the Lac repressor, the E. coli lac operon undergoes positive regulation by the cAMP receptor protein (CRP) . When [glucose] is low, [cAMP] is high and CRP-cAMP binds to a specific site on the DNA, stimulating transcription of the lac operon and production of lactose-metabolizing enzymes. The presence of glucose depresses [cAMP] , decreasing expression of lac and other genes involved in metabolism of secondary sugars. A group of coordinately regulated operons is referred to as a regulon. Operons that produce the enzymes of amino acid synthesis have a regulatory circuit called attenuation, which uses a transcription termination site (the attenuator) in the mRNA. Formation of the attenuator is modulated by a mechanism that couples transcription and translation while responding to small changes in amino acid concentration. In the SOS system, multiple unlinked genes repressed by a single repressor are induced simultaneously when DNA damage triggers RecA protein-facilitated autocatalytic proteolysis of the repressor. In the synthesis of ribosomal proteins, one protein in each r-protein operon acts as a translational repressor. The mRNA is bound by the repressor, and translation is blocked only when the r-protein is present in excess of available rRNA. Posttranscriptional regulation of some mRNAs is mediated by sRNAs that act in trans or by riboswitches, part of the mRNA structure itself, that act in cis. Some genes are regulated by genetic recombination processes that move promoters relative to the genes being regulated. Regulation can also take place at the level of translation.

28.3 Regulation of Gene Expression in

Eukaryotes Initiation of transcription is a crucial regulation point for gene expression in all organisms. Although eukaryotes and bacteria use some of the same regulatory mecha­ nisms, the regulation of transcription in the two systems is fundamentally different. We can define a transcriptional ground state as the in­ herent activity of promoters and transcriptional machinery in vivo in the absence of regulatory sequences. In bacteria, RNA polymerase generally has access to every promoter and can bind and initiate transcription at some level of efficiency in the absence of activators or repressors; the

transcriptional ground state is therefore nonrestrictive. In eukaryotes, however, strong promoters are generally inac­ tive in vivo in the absence of regulatory proteins; that is, the transcriptional ground state is restrictive. This funda­ mental difference gives rise to at least four important fea­ tures that distinguish the regulation of gene expression in eukaryotes from that in bacteria. First, access to eukaryotic promoters is restricted by the structure of chromatin, and activation of tran­ scription is associated with many changes in chromatin structure in the transcribed region. Second, although eukaryotic cells have both positive and negative regula­ tory mechanisms, positive mechanisms predominate in all systems characterized so far. Thus, given that the transcriptional ground state is restrictive, virtually every eukaryotic gene requires activation in order to be tran­ scribed. Third, eukaryotic cells have larger, more com­ plex multimeric regulatory proteins than do bacteria. Finally, transcription in the eukaryotic nucleus is sepa­ rated from translation in the cytoplasm in both space and time. The complexity of regulatory circuits in eukaryotic cells is extraordinary, as the following discussion shows. We conclude the section with an illustrated description of one of the most elaborate circuits: the regulatory cas­ cade that controls development in fruit flies. Transcriptionally Active Chromatin Is Structurally Distinct from Inactive Chromatin The effects of chromosome structure on gene regulation in eukaryotes have no clear parallel in bacteria. In the eukaryotic cell cycle, interphase chromosomes appear, at first viewing, to be dispersed and amorphous (see Figs 12-43, 24-25) . Nevertheless, several forms of chro­ matin can be found along these chromosomes. About 10% of the chromatin in a typical eukaryotic cell is in a more condensed form than the rest of the chromatin. This form, heterochromatin, is transcriptionally inac­ tive. Heterochromatin is generally associated with par­ ticular chromosome structures-the centromeres, for example. The remaining, less condensed chromatin is called euchromatin. Transcription of a eukaryotic gene is strongly re­ pressed when its DNA is condensed within heterochro­ matin. Some, but not all, of the euchromatin is tran­ scriptionally active. Transcriptionally active chromosomal regions are characterized not only by a more open chro­ matin structure but also by the presence of nucleosomes with particular compositions and modifications. Tran­ scriptionally active chromatin tends to be deficient in histone H l , which binds to the linker DNA between nucleosome particles, and enriched in the histone variants H3.3 and H2AZ (see Box 24-2) . Histones within transcriptionally active chromatin and heterochromatin differ in their patterns of covalent modification. The core histones of nucleosome particles (H2A, H2B, H3, H4; see Fig. 24-27) are modified by

28.3 Regulation of Gene Exp ression in Eu karyotes

�1 3�

methylation of Lys or Arg residues, phosphorylation of

tissues where the genes are expressed than in those

Ser or Thr residues, acetylation (see below) , ubiquitina­

where the genes are not expressed. The overall pattern

tion (see Fig. 27-47) , or sumoylation. Each of the core

suggests that active chromatin is prepared for transcrip­

histones has two distinct structural domains. A central

tion by the removal of potential structural barriers.

domain is involved in histone-histone interaction and the wrapping of DNA around the nucleosome. A second, lysine-rich amino-terminal domain is generally posi­ tioned near the exterior of the assembled nucleosome

Chromatin Is Remodeled by Acetylation and N ucleosomal Displacement/Repositioning

particle; the covalent modifications occur at specific

The transcription-associated structural changes in chro­

residues concentrated in this amino-terminal domain.

matin are generated by a process called

The patterns of modification have led some researchers

chromatin re­ modeling. The remodeling involves enzymes that

to propose the existence of a histone code, in which

promote the changes described above . Some enzymes

modification patterns are recognized by enzymes that

covalently modify the histones of the nucleosome. Oth­

alter the structure of chromatin. Modifications associ­

ers use the chemical energy of ATP to reposition nucle­

ated with transcriptional activation-primarily methyla­

osomes on the DNA (Table 28-2) . Still others alter the

tion and acetylation-would be recognized by enzymes

histone composition of the nucleosomes.

that make the chromatin more accessible to the tran­

The acetylation and methylation of histones figure

scription machinery. Indeed, some of the modifications

prominently in the processes that activate chromatin for

are essential for interactions with proteins that play key

transcription. As noted above, the amino-terminal do­

roles in transcription.

mains of the core histones are generally rich in Lys and

5-Methylation of cytosine residues of CpG se­ DNA in transcriptionally active chromatin tends to be

H3 is methyl­ 4 ated (by specific histone methylases) at Lys in nucleo­ 36 somes near the 5' end of the coding region and at Lys

undermethylated. Furthermore, CpG sites in particular

throughout the coding region. These methylations facili­

genes are more often undermethylated in the cells of

tate the binding of histone

quences is common in eukaryotic DNA (p. 292) , but

TABLE 28-2

Arg residues. During transcription, histone

acetyltransferases (HATs),

Some Enzyme Complexes Catalyzing Chromatin s Oligomeric structure

Enzyme complex*

(number of polypeptides)

Source

Activities

Yeast

GCN5 has type A HAT activity

Histone modification

GCN5-ADA2-ADA3

3

SAGAIPCAF

>20

Eukaryotes

Includes GCN5-ADA2-ADA3; acetylates residues in H3 and H2B

NuA4

At least 12

Eukaryotes

Esai component has HAT activity; acetylates H4, H2A, and H2AZ

SWIJSNF

�6; total Mr 2 X 1 06

Eukaryotes

Nucleosome remodeling; transcriptional activation

ISWI family

Varies

Eukaryotes

Nucleosome remodeling; transcriptional repression; transcriptional activation in some cases (NURF)

SWR1 family

�12

Eukaryotes

H2AZ deposition

1

Eukaryotes

Deposition of H3.3 during transcription

Histone movement/replacement enzymes that require ATP

Histone chaperones that do not require ATP

HIRA

*The abbreviations for eukaryotic genes and proteins are often more confusing or obscure than those used for bacteria. The complex of GCN5 (general control nonderepressible) and ADA (alteration/deficiency activation) proteins was discovered during investigation of the regulation of nitrogen metabolism genes in yeast These proteins can be part of the larger SAGA complex (SPF, ADA2,3, GCN5, acetyltransferase) in yeasts. The equivalent of SAGA in humans is PCAF (p300/CBP-associated factor). NuA4 is nucleosome acetyltransferase of H4; ESA1 is essential SAS2-related acetyltransferase. SWI (switching) was discovered as a protein required for expression of certain genes involved in mating-type switching in yeast, and SNF (sucrose nonfermenting) as a factor for expression of the yeast gene for sucrase. Subsequent studies revealed multiple SWI and SNF pro­ teins that acted in a complex. The SWI/SNF complex has a role in the expression of a wide range of genes and has been found in many eukaryotes, including humans. ISWI is imitation SWJ; NURF, nuclear remodeling factor; SWR1, Swi2/Snf2-related ATPase 1; and HIRA, histone regulator A.

� 1 3�

Regu lation of Gene Expression

enzymes that acetylate particular Lys residues. Cytosolic

of multiple activator proteins. One important reason for

(type B) HATs acetylate newly synthesized histones be­

the apparent predominance of positive regulation seems

fore the histones are imported into the nucleus. The sub­

obvious: the storage of DNA within chromatin effec­

sequent assembly of the histones into chromatin after

tively renders most promoters inaccessible, so genes are

replication is facilitated by histone chaperones: CAFI for

silent in the absence of other regulation. The structure

H3 and H4, and NAPl for H2A and H2B (see Box 24-2) .

of chromatin affects access to some promoters more

Where chromatin is being activated for transcrip­

than others, but repressors that bind to DNA so as to

tion, the nucleosomal histones are further acetylated by

preclude access of RNA polymerase (negative regula­

nuclear (type A) HATs. The acetylation of multiple Lys

tion) would often be simply redundant. Other factors

residues in the amino-terminal domains of histones H3

must be at play in the use of positive regulation, and

and H4 can reduce the affinity of the entire nucleosome

speculation generally centers around two: the large size

for DNA. Acetylation of particular Lys residues is criti­

of eukaryotic genomes and the greater efficiency of pos­

cal for the interaction of nucleosomes with other pro­

itive regulation.

teins. When transcription of a gene is no longer

First, nonspecific DNA binding of regulatory pro­

required, the extent of acetylation of nucleosomes in

teins becomes a more important problem in the much

that vicinity is reduced by the activity of histone deacetylases (HDACs) , as part of a general gene-si­

larger genomes of higher eukaryotes. And the chance

lencing process that restores the chromatin to a tran­

domly at an inappropriate site also increases with

that a single specific binding sequence will occur ran­

scriptionally inactive state. In addition to the removal of

genome size. Specificity for transcriptional activation

certain acetyl groups, new covalent modification of his­

can be improved if each of several positive-regulatory

tones marks chromatin as transcriptionally inactive. 9 For example, Lys of histone H3 is often methylated in

form a complex in order to become active. The average

heterochromatin.

number of regulatory sites for a gene in a multicellular

proteins must bind specific DNA sequences and then

There are five known families of enzyme complexes

organism is probably at least five. The requirement for

that actively move or displace nucleosomes, hydrolyzing

binding of several positive-regulatory proteins to spe­

ATP in the process, three of which are particularly im­

cific DNA sequences vastly reduces the probability of

portant in transcriptional activation (Table 28-2 ; see the

the random occurrence of a functional juxtaposition of

table footnote for an explanation of the abbreviated

all the necessary binding sites. In principle, a similar

names of the enzyme complexes described here) .

strategy could be used by multiple negative-regulatory

SWI/SNF, found in all eukaryotic cells, contains at least

elements, but this brings us to the second reason for the

six core polypeptides that together remodel chromatin

use of positive regulation: it is simply more efficient. If

so that nucleosomes become more irregularly spaced,

the -29,000 genes in the human genome were nega­

and stimulate the binding of transcription factors. The

tively regulated, each cell would have to synthesize, at

complex includes a component called a bromodomain

all times , this same number of different repressors (or

near the carboxyl terminus of the active ATPase sub­

many times this number if multiple regulatory elements

unit, which interacts with acetylated histone tails .

were used at each promoter) in concentrations suffi­

SWI/SNF i s not required for the transcription o f every

cient to permit specific binding to each "unwanted"

NURF, a member of the ISWI family, remodels

gene. In positive regulation, most of the genes are usu­

gene.

chromatin in ways that complement and overlap the ac­

ally inactive (that is, RNA polymerases do not bind to

tivity of SWI/SNF. These two enzyme complexes are cru­

the promoters) and the cell synthesizes only the activa­

cial in preparing a region of chromatin for active

tor proteins needed to promote transcription of the sub­

transcription. Some members of a third family, SWRl ,

set of genes required in the cell at that time. These

are involved in deposition of the H2AZ histone variant in

arguments notwithstanding, there are examples of neg­

transcriptionally active chromatin.

ative regulation in eukaryotes, from yeasts to humans,

In the other families of chromatin remodelers , some

as we shall see.

are required to reorder nucleosomes within chromatin when genes are being silenced. The net effect of chro­

DNA-Binding Activators and Coactivators Facilitate

matin remodeling is to make a segment of the chromo­

Assembly of the General Transcription Factors

some more accessible and to "label" (chemically modify) it so as to facilitate the binding and activity of transcrip­ tion factors that regulate expression of the gene or

To continue our exploration of the regulation of gene expression in eukaryote s , we return to the interactions

genes in that region.

between promoters and RNA polymerase II (Pol II) , the

Many Eu karyotic Promoters Are Positively Regulated

mRNAs. Although many (but not all) Pol II promoters

As already noted, eukaryotic RNA polymerases have lit­

with their standard spacing (see Fig. 26-9) , they vary

tle or no intrinsic affinity for their promoters; initiation

greatly in both the number and the location of additional

of transcription is almost always dependent on the action

sequences required for the regulation of transcription.

enzyme responsible for the synthesis of eukaryotic include the TATA box and Inr (initiator) sequences,

28.3 Regu lation of Gene Expression in E u karyotes

These additional regulatory sequences are usually called enhancers in higher eukaryotes and upstream activa­ tor sequences (UASs) in yeast. A typical enhancer may be found hundreds or even thousands of base pairs upstream from the transcription start site, or may even be downstream, within the gene itself. When bound by the appropriate regulatory proteins, an enhancer in­ creases transcription at nearby promoters regardless of its orientation in the DNA. The UASs of yeast function in a similar way, although generally they must be posi­ tioned upstream and within a few hundred base pairs of the transcription start site. An average Pol II promoter may be affected by a half-dozen regulatory sequences of this type, and even more-complex promoters are quite common (see Fig. 1 5-23, for example) . Successful binding of active RNA polymerase II holoenzyme at one of its promoters usually requires the action of other proteins ( Fig. 28-29) , of four types: ( 1 ) transcription activators, which bind t o enhancers or UASs and facilitate transcription; (2) chromatin modi­ fication and remodeling proteins, described above; (3) coactivators; and (4) basal transcription fac­ tors (see Fig. 26-10, Table 26-2) , required at every Pol II promoter. The coactivators act indirectly-not by bind­ ing to the DNA-and are required for essential commu­ nication between the activators and the complex composed of Pol II and the basal (or general) transcrip­ tion factors. Furthermore, a variety of repressor pro­ teins can interfere with communication between the RNA polymerase and the activators, resulting in repres­ sion of transcription (Fig. 28-29b) . Here we focus on the protein complexes shown in Figure 28-29 and on how they interact to activate transcription. Transcription Activators The requirements for acti­ vators vary greatly from one promoter to another. A few activators are known to facilitate transcription at hun­ dreds of promoters, whereas others are specific for a few promoters. Many activators are sensitive to the binding of signal molecules, providing the capacity to activate or deactivate transcription in response to a changing cellu­ lar environment. Some enhancers bound by activators are quite distant from the promoter's TATA box. How do the activators function at a distance? The answer in most cases seems to be that, as indicated earlier, the interven­ ing DNA is looped so that the various protein complexes can interact directly. The looping is promoted by certain nonhistone proteins that are abundant in chromatin and bind nonspecifically to DNA. These high mobility group (HMG) proteins (Fig. 28-29; "high mobility" refers to their electrophoretic mobility in polyacrylamide gels) play an important structural role in chromatin re­ modeling and transcriptional activation. Coactivator Protein Complexes Most transcription requires the presence of additional protein complexes. Some major regulatory protein complexes that interact with Pol II have been defined both genetically and bio-

(a)

G 1 3�

Transcription

HMG proteins

Preinitiation complex (PIC)

DNA Enhancers

Transcription activators

Enhancers FIGURE 28-29 Eukaryotic promoters and regulatory proteins. RNA polymerase I I and its associated basal (general) transcription factors

form a preinitiation complex at the TATA box and l n r site of the cognate promoters, a process fac i l itated by transcription activators, acting through mediator. (a) A composite promoter with typical sequence elements and protein complexes found in both yeast and higher eu­ karyotes. The carboxyl-term i na l domain (CTD) of Pol II (see Fig. 2 6-1 0) is an important point of i nteraction with medi ator and other protein comp lexes. The histone modification enzymes catalyze methylation and acetylation; the remodeling enzymes alter the content and place­ ment of nucleosomes. For the transcription activators, DNA-b inding domains are shown i n green, activation domains i n pink. The i nterac­ tions symbo l i zed by blue arrows are di scussed in the text. (b) Eukary­ otic transcriptional repressors function by a range of mechanisms . Some bind directly to DNA, displacing a protein complex requi red for activation; others i nteract with various parts of the transcription or ac­ tivation complexes to prevent activation. Possible poi nts of i nteraction are indicated with red arrows.

chemically. These coactivator complexes act as interme­ diaries between the transcription activators and the Pol II complex. The principal eukaryotic coactivator consists of 20 to 30 or more polypeptides in a protein complex called mediator (Fig. 28-29) ; many of the 20 core polypep­ tides are highly conserved from fungi to humans. An additional complex of four subunits can interact with mediator and inhibit transcription initiation. Mediator binds tightly to the carboxyl-terminal domain (CTD) of

� 14�

Regu lation of Gene Expression

the largest subunit of Pol II. The mediator complex is required for both basal and regulated transcription at promoters used by Pol II, and it also stimulates phos­ phorylation of the CTD by TFIIH (a basal transcription factor). Transcription activators interact with one or more components of the mediator complex, with the precise interaction sites differing from one activator to another. Coactivator complexes function at or near the promoter's TATA box. Additional coactivators, functioning with one or a few genes, have also been described. Some of these op­ erate in conjunction with mediator, and some may act in systems that do not employ mediator. TATA-Binding Protein The first component to bind in the assembly of a preinitiation complex (PIC) at the TATA box of a typical Pol II promoter is the TATA­ binding protein (TBP). The complete complex in­

cludes the basal transcription factors TFIIB, TFIIE, TFIIF, TFIIH; Pol II; and perhaps TFIIA. This minimal PIC, however, is often insufficient for the initiation of transcription and generally does not form at all if the promoter is obscured within chromatin. Positive regulation, leading to transcription, is imposed by the activators and coactivators. We can now begin to piece together the sequence of tran­ scriptional activation events at a typical Pol II promoter (Fig. 28-:JO). The exact order of binding of some com­ ponents may vary, but the model in Figure 28-30 illus­ trates the principles of activation as well as one common path. Many transcription activators have significant affin­ ity for their binding sites even when the sites are within condensed chromatin. The binding of activators is often the event that triggers subsequent activation of the pro­ moter. Binding of one activator may enable the binding of others, gradually displacing some nucleosomes. Crucial remodeling of the chromatin then takes place in stages, facilitated by interactions between acti­ vators and HATs or enzyme complexes such as SWI/SNF (or both) . In this way, a bound activator can draw in other components necessary for further chromatin remodeling to permit transcription of specific genes. The bound activators interact with the large mediator complex. Mediator, in turn, provides an assembly surface for the binding of first TBP (or TFIID), then TFIIB, and then other components of the PIC including RNA poly­ merase II. Mediator stabilizes the binding of Pol II and its associated transcription factors and greatly facilitates formation of the PIC. Complexity in these regulatory cir­ cuits is the rule rather than the exception, with multiple DNA-bound activators promoting transcription. The script can change from one promoter to an­ other, but most promoters seem to require a precisely ordered assembly of components to initiate transcrip­ tion. The assembly process is not always fast. At some genes it may take minutes; at certain genes of higher eu­ karyotes the process can take days.

Activator

.('_::t. ,/ .::S I Enhancer



/:----

1

DNA Mediator Modification and remodeling enzymes

'TATA

TBP

Inr

and

TFIIB

TFIIB

�-------:'ican Biology Teacher (March) 35, 125-129.

CHAPTER 2 p. 43 Linus Pauling (1939) The Nature of the Chemical Bond and the Structure of Molecules and Crystals: An Introduction to Modem Structural Chemistry, Cornell University Press, Ithaca, NY; Figure 2-9 PDB ID 1A3N, Tame, J. & Vallone, B. (1998) Deoxy human hemoglobin (primary citation not available); Figure 2-10 Adapted from Nicolls, P. (2000) Introduction: the biology of the water molecule. Cell. Mol. Life Sci 57, 987, Fig 6a (redrawn from information in the PDB and a Kinemage file published by Martinez, S.E , Huang, D , Ponomarev, M , Cramer, W.A., & Smith, J L. (1996) The heme redox center of chloroplast cytochromefis linked to a buried five-water chain. Protein (1928) Poss·tble

Sci 5, 1081); Box 2-1 J B S Haldane

Worlds, Harper and Brothers, New York and London, pp

113-126; p. 66 Jon Bertsch/Visuals Unlimited.

A , Bulliard, V., Cerutti, L., De Castro, E , Langendijk-Genevaux, P,S , Pagni, M , & Sigrist, C J.A (2006) The PROSITE database. Nucleic Acids Res 34, D227; WebLogo from http://weblogo berkeley edu, Crooks, GE , Hon, G , Chandonia, J.M , & Brenner, SE. (2004) WebLogo: a sequence logo generator,

Genome Res !4, 1188; Figures 3-30, 3-31, 3-32 Adapted from Gupta, R.S. (1998) Protein phylogenies and signature sequences: a reappraisal of evolu­ tionary relationships among archaebacteria, eubacteria, and eukaryotes

Microbial Mol Biol. Rev 62, 1435, Figs 2, 7, II, respectively; Figure 3-33 Adapted from Delsuc, F , Brinkmann, H , & Philippe, H (2005) Phylogenomics and the reconstruction of the tree of life. Nat. Rev. Genet 6, 366; p. 1 1 1, problem 11 See citation for Box 3-3 Figure I, document lD PDOC00270 (1958) A three-dimensional model

of the myoglobin molecule obtained by x-ray analysis. Nature 181, 662-666;

Figure 4-1 PDB ID 6GCH, Brady, K , Wei, A , Ringe, D , & Abeles, R.H. (1990) Structure of chymotrypsin-trifiuoromethyl ketone inhibitor complexes: comparison of slowly and rapidly equilibrating inhibitors

Biochemistry 29,

7600; glycine coordinates from Sybyl; p. 1 15 (Pauling) Corbis/Bettmann; (Corey) AP/Wide World Photos; Figure 4-3 Adapted from Creighton, T E (1984) Proteins, p. 166

© 1984 by W

H. Freeman and Company. Reprinted

by permission; Figure 4-4b,c PDB ID 4TNC, Satyshur, K.A., Rao, S T., Pyzalska, D., Drendel, W , Greaser, M ., & Sundaralingam, M. (1988) Refined structure of chicken skeletal muscle troponin C in the two-calcium state at 2-angstroms resolution. J.

Biol Chem 263, 1628; Figure 4-8a See

citation for Figure 4-3; Figure 4-Sb Courtesy of Hazel Holden, University of Wisconsin-Madison, Department of Biochemistry and Enzyme Institute;

Figure 4-11 PDB ID !CGD (modified), Bella, J , Brodsky, B., & Berman, H M. (1995) Hydration structure of a collagen peptide Structure 3, 893; Figure 4-12 Science Source/Photo Researchers; p. 126 Ethel Wedgwood (1906) The Merrwirs of the Lord of Joinville. A New English Version, E P Dutton and Company, New York; (Lind) Courtesy of the Royal College of Physicians of Edinburgh; Figure 4-13a PDB ID ISLK (model), Fossey, S A., Nemethy, G,, Gibson, K.D., & Scheraga, H A. (1991) Conformational energy studies of 13-sheets of model silk fibroin peptides: I Sheets of poly(Ala-Gly) chains.

Biopolymers 3!, 1529; Figure 4-13b Dr. Dennis KunkeVPhototake NYC; Figure 4-15 PDB ID IMBO; Phillips, S.E V (1980) Structure and refinement of oxymyoglobin at I 6 angstroms resolution J.. Mol. Bioi 142, 531; Figure 4-17b PDB ID 7AHL; Song, L., Hobaugh, M R, Shustak, C , Cheley, S, Bayley, H ,

& Gouaux, J.E

(1996) Structure of staphylococcal a hemolysin, a

heptameric transmembrane pore. Science 274, 1859; Box 4-5 Figure 1a,b,c George N. Phillips, Jr., University of Wisconsin-Madison, Department of Biochemistry; Box 4-5 Figure 1d PDB ID 2MBW; Brucker, E.A., Olson, J.S , Phillips, G N., Jr., Dou,

Y, & Ikeda-Saito, M

(1996) High resolution crystal

structures of the deoxy·, oxy-, and aquomet· forms of cobalt myoglobin

J..

Bioi Chem 271, 25,419; Box 4-5 Figures 2, 3a Volkman, B F., Alam, S.L., Satterlee, J.D., & Markley, J L (1998) Solution structure and backbone

dynamics of component IV-glycera dibranchiata monomeric hemoglobin-CO.

Biochemistry 37, 10,906; Box 4-5 Figure Sb,c Created by Brian Volkman, National Magnetic Resonance Facility at Madison, using MOLMOL; PDB ID IVRF (b) and IVRE (c), see citation for Box 4-5 Figures 2, 3a; Figure 4-18 PDB ID 4TNC, see citation for Figure 4-4b,c; Figure 4-l9c PDB ID lDNP, Park, H.W., Kim, S.T , Sancar, A.,

& Deisenhofer, J

DNA photolyase from Escherichia

(1995) Crystal structure of

coli Science 268, 1866; Figure 4-20 PDB

1., & Reed, G.H. 2 (1994) Structure of rabbit muscle pyruvate kinase complexed with Mn +, K+,

ID IPKN, Larsen, T.M., Laughlin, L.T., Holden, H.M., Rayment,

CHAPTER 3

p. 71 J J Berzelius (1838) Letter to G. J Mulder In H B. Vickery (1950) The origin of the word protein Yale Journal of Biology and Medic-ine 22, 387-393; Figure 3-1a Runk/Schoenburger/Grant Heilman Photography; Figure 3-1b Bill Longcore/Photo Researchers; Figure 3-1c Animals Animals; p. 72 (Dayhoff) Courtesy of Ruth E Dayhoff; Figure 3-18b Julia Cox, University of Wisconsin-Madison, Department of Biochemistry;

Figure 3-2 1b Patrick H O'Farrell, University of California Medical Center, San Francisco, Department of Biochemistry and Biophysics; Figure 3-23 PDB ID 1HGA, Liddington, R , Derewenda, Z., Dodson, E., Hubbard, R.,

228, 551; p. 94 (Sanger)

& Wilm, (1995) Electrospray mass spectrometry for protein characterization

CHAPTER 4 p. 1 13 J. C. Kendrew et a!

p. 1 Fran

pi = 1; carboxylate groups; Asp and Glu

13. Lys, His, Arg; negatively charged phosphate groups in DNA inter­

H+

act with positively charged side groups in histones.

14. (a) (Glu)20 (b) (Lys-Aia)3 (c) (Asn-8er-His) 5 (d) (Asn-Ser-His)5

1

coo-

I HN' l + j-CH2-CH-NH3 N H +

2

elements of water are lost when a peptide bond

forms, so the molecular weight of a Trp residue is not the same

the Henderson-Hasselbalch equation,

pKR

=

6.0

\

H-

>

15. (a) Specific activity after step 1 is 200 units/mg; step 2, 600 units/mg; step 3, 250 units/mg; step 4, 4,000 units/mg; step 5, 15,000 units/mg; step 6, 15,000 units/mg (b) Step 4 (c) Step 3 (d) Yes. Specific activity did not increase in step 6; SDS poly­ acrylamide gel electrophoresis

+

[As-4]

Abbreviated Solutions to Problems

16. (a) [NaCl]

=

0.5 mM (b) [NaCl]

=

0.05 mM.

17. C elutes first, B second, A last. 18. Tyr-Gly-Gly-Phe-Leu

19.

/ Orn

Phe

Leu-Tyr-Glx-Leu-Glx-Asx-Tyr-Cys-Asn-C

Pro

t

t

Val

Pro

\

I Orn

- Leu

v

The arrows correspond to the orientation of the peptide bonds, -CO � NH-.

20. 88% , 97% . The percentage (x) of correct amino acid residues re­ leased in cycle n is x,jx All residues released in the first cycle are correct, even though the efficiency of cleavage is not perfect.

2 1 . (a) Y ( l ) , F (7), and R (9) (b) Positions 4 and 9; K (Lys)

is more common at 4, R (Arg) is invariant at 9 (c) Positions 5 and 1 0; E (Glu) is more common at both positions (d) Position 2; S (Ser)

22. (a) The protein to be isolated (citrate synthase, CS) is a rela­

tively small fraction of the total cellular protein. Cold tempera­ tures reduce protein degradation; sucrose provides an isotonic environment that preserves the integrity of organelles during ho­ mogenization. (b) This step separates organelles on the basis of relative size. (c) The first addition of ammonium sulfate removes some unwanted proteins from the homogenate. Additional am­ monium sulfate precipitates CS. (d) To resuspend (solubilize) CS, ammonium sulfate must be removed under conditions of pH and ionic strength that support the native conformation. (e) CS molecules are larger than the pore size of the chromatographic geL Protein is detectable at 280 nm because of absorption at this wavelength by Tyr and Trp residues. (f) CS has a positive charge and thus binds to the negatively charged cation-exchange col­ umn. After the neutral and negatively charged proteins pass through, CS is displaced from the column using the washing so­ lution of higher pH, which alters the charge on CS. (g) Different proteins can have the same pl. The SDS gel confirmed that only a single protein was purified. SDS is difficult to remove completely from a protein, and its presence distorts the acid-base properties of the protein, including pi

23. (a) Any linear polypeptide chain has only two kinds of free

amino groups: a single a-amino group at the amino terminus, and an E-amino group on each Lys residue present. These amino groups react with FDNB to form a DNP-amino acid de­ rivative. Insulin gave two different a-an1ino-DNP derivatives, suggesting that it has two amino termini and thus two polypep­ tide chains-one with an amino-terminal Gly and the other with an amino-terminal Phe. Because the DNP-lysine product is E-DNP-lysine, the Lys is not at an amino terminus. (b) Yes. The A chain has amino-terminal Gly; the B chain has amino-terminal Phe; and (nonterminal) residue 29 in the B chain is Lys. (c) Phe-Val-Asp-Glu-. Peptide B1 shows that the amino-terminal residue is Phe. Peptide B2 also includes Val, but since no DNP­ Val is formed, Val is not at the amino terminus; it must be on the carboxyl side of Phe. Thus the sequence of B2 is DNP­ Phe-Val. Sinlilarly, the sequence of B3 must be DNP-Phe-Vai-Asp, and the sequence of the A chain must begin Phe-Vai-Asp-Glu-. (d) No. The known amino-terminal sequence of the A chain is Phe-Val-Asn-Gin-. The Asn and Gin appear in Sanger's analy­ sis as Asp and Glu because the vigorous hydrolysis in step (J) hydrolyzed the amide bonds in Asn and Gln (as well as the peptide bonds), forming Asp and Glu. Sanger et al. could not distinguish Asp from Asn or Glu from Gin at this stage in their analysis. (e) The sequence exactly matches that in Fig. 3-24. Each peptide in the table gives specific information about which Asx residues are Asn or Asp and which Glx residues are Glu or Gln.

10

5

1

\

Val

Phe "'--

N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-

Leu -._,.

l

Acl . residues 20-2 1 . This is the only Cys-Asx sequence in the A chain; there is -1 amido group in this peptide, so it must be Cys-Asn:

20

15

Apl5: residues 1 4-1 5-1 6. This is the only Tyr-Glx-Leu in the A chain; there is 1 amido group, so the peptide must be Tyr-Gln-Leu: -

N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-

10

5

1

Leu-Tyr-Gln-Leu-Glx-Asx-Tyr-Cys-Asn-C

20

15

Apl4: residues 1 4-15-16-1 7 . It has - 1 amido group, and we al­ ready know that residue 1 5 is Gln, so residue 1 7 must be Glu: N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-

10

5

1

Leu-Tyr-Gln-Leu-Glu-Asx-Tyr-Cys-Asn-C

20

15

Ap3: residues 18-19-20-2 1 lt has -2 amido groups, and we know that residue 2 1 is Asn, so residue 1 8 must be Asn: N-Gly-Ile-Val-Glx-Glx-Cys-Cys-Ala-Ser-Val-Cys-Ser-

10

5

1

Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C

20

15

Apl: residues 1 7- 18-- 1 9-20-21 , which is consistent with residues 1 8 and 2 1 being Asn. Ap5pal: residues 1-2-3-4. It has -0 amido group, so residue 4 must be Glu: Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C

20

15

Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C

20

15

Ap5: residues 1 through 1 3. It has - 1 amido group, and we know that residue 14 is Glu, so residue 5 must be Gln: N-Gly-Ile-Val-Glu-Gln-Cys-Cys-Ala-Ser-Val-Cys-Ser-

ro

5

1

Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-C

15

20

Chapter 4

1. (a) Shorter bonds have a higher bond order (are multiple rather than single) and are stronger. The peptide C-N bond is stronger than a single bond and is midway between a single and a double bond in character. (b) Rotation about the peptide bond is diffi­ cult at physiological temperatures because of its partial double­ bond character.

2. (a) The principal structural units in the wool fiber polypeptide (a-keratin) are successive turns of the a helix, at 5 .4 A intervals; coiled coils produce the 5.2 A spacing. Steaming and stretching

the fiber yields an extended polypeptide chain with the {3 confor­ mation, with a distance between adjacent R groups of about 7.0 A. As the polypeptide reassumes an a-helical structure, the fiber shortens. (b) Processed wool shrinks when polypeptide chains are converted from an extended f3 conformation to the native a-helical conformation in the presence of moist heat. The structure of silk-,6 sheets, with their small, closely packed amino acid side chains-is more stable than that of wool.

3. -42 peptide bonds per second

4. At pH > 6, the carboxyl groups of poly(Glu) are deprotonated; repulsion among negatively charged carboxylate groups leads to

Abbreviated Solutions to Problems

unfolding. Similarly, at pH 7, the amino groups of poly(Lys) are protonated; repulsion among these positively charged groups also leads to unfolding.

5. (a) Disulfide bonds are covalent bonds, which are much stronger than the noncovalent interactions that stabilize most proteins. They cross-link protein chains, increasing their stiffness, me­ chanical strength, and hardness (b) Cystine residues (disulfide bonds) prevent the complete unfolding of the protein

6. (a) Bends are most likely at residues 7 and 1 9 ; Pro residues in the cis configuration accommodate turns well. (b) The Cys residues at positions 13 and 24 can form disulfide bonds. (c) External surface: polar and charged residues (Asp, Gin, Lys) ; interior: nonpolar and aliphatic residues (Ala, lie); Thr, though polar, has a hydropathy index near zero and thus can be found either on the external surface or in the interior of the protein.

7. 30 amino acid residues; 0.87 8. Myoglobin is all three. The folded structure, the "globin fold," is a motif found in all glob ins. The polypeptide folds into a single domain, which for this protein represents the entire three­ dimensional structure.

9. The bacterial enzyme is a collagenase; it destroys the connective­ tissue barrier of the host, allowing the bacterium to invade the tissues. Bacteria do not contain collagen. 10. (a) The number of moles of DNP-valine formed per mole of pro­ tein equals the number of amino termini and thus the number of polypeptide chains. (b) 4 (c) Different chains would probably run as discrete bands on an SDS polyacrylamide gel. 1 1 . (a); it has more amino acid residues that favor a-helical struc­ ture (see Table 4-1 ) .

[As-s]

chaperones for proper folding; these are not present in the study buffer. (7) In cells, HIV protease is synthesized as part of a larger chain that is then proteolytically processed; the protein in the study was synthesized as a single molecule. (c) Because the en­ zyme is functional with Aba substituted for Cys, disulfide bonds do not play an important role in the structure of HIV protease . (d) Model l · it would fold like the 1-protease. Argument for: the covalent structure is the same (except for chirality) , so it should fold like the L-protease. Argument against: chirality is not a trivial detail; three-dimensional shape is a key feature of biological molecules. The synthetic enzyme will not fold like the 1-protease. Model 2: it would fold to the mirror image of the 1-protease . For: because the individual components are mirror images of those in the biological protein, it will fold in the mirror­ image shape . Against: the interactions involved in protein fold­ ing are very complex, so the synthetic protein will most likely fold in another form. Model 3. it would fold to something else. For: the interactions involved in protein folding are very com­ plex, so the synthetic protein will most likely fold in another form. Against: because the individual components are mirror images of those in the biological protein, it will fold in the mirror­ image shape. (e) Model l . The enzyme is active, but with the enantiomeric form of the biological substrate, and it is inhibited by the enantiomeric fmm of the biological inhibitor. This is consistent with the D-protease being the mirror image of the L-protease. (f) Evans blue is achiral; it binds to both forms of the enzyme . (g) No. Because proteases contain only L-amino acids and recog­ nize only 1-peptides, chymotrypsin would not digest the D-protease. (h) Not necessarily. Depending on the individual enzyme, any of the problems listed in (b) could result in an inactive enzyme.

1 2 . ( a ) Aromatic residues seem t o play an important role i n stabiliz­ ing amyloid fibrils. Thus, molecules with aromatic substituents may inhibit amyloid formation by interfering with the stacking or association of the aromatic side chains (b) Amyloid is formed in the pancreas in association with type 2 diabetes, as it is in the brain in Alzheimer's disease. Although the amyloid fibrils in the two diseases involve different proteins, the fundamental structure of the amyloid is similar and similarly stabilized in both, and thus they are potential targets for similar drugs designed to disrupt this structure.

13. (a) NFKB transcription factor, also called RelA transforming factor. (b) No You will obtain similar results, but with additional related proteins listed. (c) The protein has two subunits. There are multiple variants of the subunits, with the best-characterized being 50, 52, or 65 kDa. These pair with each other to form a variety of homodimers and heterodimers. The structures of a number of different variants can be found in the PDB. (d) The NFKB transcription factor is a dimeric protein that binds specific DNA sequences, enhancing transcription of nearby genes One such gene is the immunoglobulin K light chain, from which the transcription factor gets its name.

14. (a) Aba is a suitable replacement because Aba and Cys have approximately the same sized side chain and are similarly hy­ drophobic However, Aba cannot form disulfide bonds so it will not be a suitable replacement if these are required (b) There are many important differences between the synthesized protein and HIV protease produced by a human cell, any of which could result in an inactive synthetic enzyme: (l ) Although Aba and Cys have similar size and hydrophobicity, Aba may not be similar enough for the protein to fold properly. (2) HlV protease may re­ quire disulfide bonds for proper functioning (3) Many proteins synthesized by ribosomes fold as they are produced; the protein in this study folded only after the chain was complete. (4) Pro­ teins synthesized by ribosomes may interact with the ribosomes as they fold; this is not possible for the protein in the study (5) Cytosol is a more complex solution than the buffer used in the study; some proteins may require specific, unknown proteins for proper folding. (6) Proteins synthesized in cells often require

Chapter 5

1. Protein B has a higher affinity for ligand X; it will be half­ saturated at a much lower concentration of X than will protein A 1 09 M- 1 . 106 M - \ protein B has Ka Protein A has Ka =

=