Molecular Cell Biology (Lodish, Sixth Edition)

  • 52 25,973 10
  • Like this paper and download? You can publish your own PDF file online for free in a few minutes! Sign Up

Molecular Cell Biology (Lodish, Sixth Edition)

Iro ^/\aN { u e d u o l p u e u e u a o r J ' H' M =t erepnslel^|lned q6eoldopplH reLl)slorg {uoq}uv llo)s 'd ^^aqlle

30,463 26,260 182MB

Pages 1265 Page size 606.48 x 787.92 pts Year 2008

Report DMCA / Copyright

DOWNLOAD FILE

Recommend Papers

File loading please wait...
Citation preview

Iro ^/\aN

{ u e d u o l p u e u e u a o r J ' H' M

=t

erepnslel^|lned q6eoldopplH reLl)slorg {uoq}uv llo)s 'd ^^aqllen re6err)^luolA rosre)'v s!rq) )ra8 plourv qslpol{anre;1

NOIIIC] HIXIS

ADOtOtslll)

uvrn)llol l

ADOIOIIlll)

uvln)1101 1

o1{6olounuuur 1ln pue lilrsranrulprerupH1esluapnlselenpetbtepun saqleeiq6ao16lC ao] Llrorlpueul saqsrn6urlsrp uLelsr{s ounuJuirno s,iean aq} pue sasuodsel aunulLur lno ape^oo1{oldr-uasasntrn 6urpea;Epponn all] jo auO Ll).reasag lPq} s)tpP]snouP^aql setpnisq6ao14rC lorneqaquralslsaunuur ur sraq)rpasa.r lp)tpauJorB .lo,olntrlsulpeallellqMaql to roqurau e pue {bolouqrol}o a}n}rlsuls}lasnq)esspnJ eql le I6olor€lo rossa}oldsl Hg3gld ICOIH

{1rsranru6l o1,i6olorqllal soq)patlaq)s}argr6 lsea{ 6urppnq llourof }p s}uapnlsalenperO 'sr"uels{s ')1aue6'le)ruJeq)orq oq] pue s;1e> alPrqa].ia^ oM} ut seq>eordde slro;dxa {roletoqel letlaqllda lapoLlr lerrbolorq llal pue srq')JoMslql lol )lllell auerqujaur pue {1ue;odlla) o} uor}plelur sluauodtlotasoq}}o suot})un}1e)6o1orq pue aql oullept)nla uotalalsoy{rul}lP aql slueuodt-uor rrnau6urzuel:ereq)pue 6ur,!r1uep; lot uMou) sr fuo1ejoqe; slp 16o;orgJeln)alof\jpue ;o 11am sl UjH)SIIUS ANOHINV llaf +o aln]rlsulllaurof aq] ,torollalC oler)ossvpue Ilrsranru6l lleulof le {6o1org11a1 ,tolosserrord

pro}ue}S}e {1rsranru61 sluapnlsalenpel6o1 {6o1otqle1uau-rdolanep pup 's}uapn}sle)rpauro} srxsrueqleur espesrppue luauldolanap 'sluapnlsalenpet6tapun o1{6o;orq pue saq)pa}t}o)S rC ra)ue) ur srole;nbet salolaq} leluauLdolanep lla) leluau.rdolanap }o 'sl1aua6pue {6o1orq 6uttenotslp to; pue saua6xoqoaLuoq pue 6urleu6rs ut )lom lla)-llal]o spaJeur ,i;.re;ntr;red leluaudoqanap slq ro] uMou) st eg ,i6o1ot6lelueu.rdo1ena6 ro; IlaDo5 aql 1o luaprserdgsede pue sa)uaDspup s].rv1o ^LUeperyueltraLrlvaql pue sa)url)S ILuape:y aq] raquau]p sr prennog aH eln]rlsul saq6np pue aut)tpan aq] ]e lolebtlsa^Ul ;o leuorlpN ]o le)rpe/\ .d pue 's)r}auag[6o;o19;e1uaudo1ane6 lo looqls ,{ltstantulplo}ue}S1e buueeur6uaorg +orossalordsl I1"O)S M]HItVl l

rolda)arICH aq] 6urpnpur 'sllal aq1ro1luelrodurrsuralordrolderarpazuapeleqlpup pauol)seq pue snletedde ]o lno pue olut lololsaloq) ]o ]uaLUa^ouJ t61o9eqr q6notql6ur1:rger1 auerqLxotr 6urpuelsrapun Jno o] suorlnqrlluol epeLuseq,loietoqe;stH spleMesnoJeuJnu lo pa^la)alseqaq 'sasrnol{6o1otq-11ar alenper6se se r{6o;orslqd ueunq pup ,i6o;olqelenpetbtapun 6utq)ea}a^rlp^ouul lloM }o srqro1 {6o1ouq)e1 aq} }e ^6010rg peaqetrqM sl UlgllU) AINO6 }o aln}tlsuls}}asnqtessen 1oluauyeda6 aq} ur .rosso}old

srea{{ueul ro; selenpet6tepun o1s:r1eua6 lq6ne} spqoq olaqM1ll }e lo}p)npa alenpelblapun dot peztuOorar quaulppduol e se sr lasrp) 16 rie,rnqled fuo1ar>as aq] polols pue paplo+ aq] ut ete suralold +o fuoletlespue auPJqLuor.u pazrsaqlu{s ,{lrrneu ,rnoq sasserord )rspqaq} puelsrapuno} spoqtau letr6olorq11etpue >r1eua6 sasn 1o fuoleloqe1 sr;1,i6olouq:a1 oql le l6olorg1o lueuyeda6 oq++o peaHpue rossalordsl UISIV) .V SIUH) +o aln]rlsulsuosnq)essen

snal)nuaql 1o16olorqlla) ut aslno)pa)ue^pe ue pue ,{6olotrnpue ,i6olorqrelnlrlour ur sesrno)fuo1:nporlursaq)pa}aH slossatddns rouJnlpue seua6otuo{q pepotua slopel uotldtlrsuPl] uo relnttpedut 6utsn:o1'slla)uprlpuureur ur uorlpr]rur uorldu:sue;l a1e;n6et .reln)alouJ ]pLl]suotl)elalut alll salpnlsfuo1e:oqe; srH sosnJ|^ ut lorluo)aueblo; sr.usrupqfauj VNU]o srala^otsrp 1o pue 6ur>rlds ;eurbuoaq] ,o auo st aH sa)ual)SpuPsUV {uLapely ue)rlauv aq} Molla+ e osle sr .rC salabuy sol 'ptuJo}tlpJ eq} }e a}n}tlsul 1o }o )ra€ lo ^}tsla^tun ,i6o1org te;nralonaql +oraqureu.r e pue s)rlauogreln)alo/\pue ,{6o1ounu.rLll I6o;orqortr4}o lossa}oldst )Ulg olONuV {6o;ouqtalorqpue ,i6o1orq lla) ut saenot alenperbpue elenpel6lapunsaq)Pa}qstpol t6 uotleraylord raql suralotd pat+tluapt pue spq slla) ulels trlarodoleu-raq Uoddns serpnls 1eq1 lanou oslefuoleloqe;stg stolda:at pue urlarodorqytaoll] se q)ns 'suralotdtolda:et a)efns-lla) srslleueleuor]:un1pue B-lgl leJo^as lo 'ri6o1ors,{qd 6uruo;laql uo puP'suraloldete;rns-11er IueLu1o srsaqlulsorq aq] ^l.rpln)rupd auelqulaL!-llo) uo 1roMsrqro+umou} to1{1arto5ueluaurvaq} }o (t002)}uoprsard llaMsl oH {6o1otg11a1 spMpue se)uat)Spue suv ,roILlapety ueluourvaLi}pue p sa)ual)S {uLepe:y aq} raquraur qsrpol osle sr JC rl)reesau 1o leuotleN }o lp)tpaurot€.io}e}n}t}sulpeaqo}tqMoq} +o laqulorx e pue ribo;ouqlal]o aln]tlsuls]]osnq)esspl4 aq] ]e 6uuaaurbuaorg ]o Jossaloldpue ri6olor6]o lossaloldsl HSIOOI AI1UVH

SUOHINV]HI INOSV

PusLIsHgn: SaraTenney ExecurrvE Eonon: Katherine Ahr DpvEr-opneNrRI- Eorrons: Matthew Tontonoz, Erica PantagesFrost, Elizabeth Rice AssocIRrp Pnoyrcr MexecBR: Hannah Thonet AssrsreNr EorroR: Nick Tymoczko AsssocrerEDnacton op MeRrrrrNc: Debbie Clare SeNIoRPno;ecr Eonon: Mary Louise Byrd Tsxr DpsrcNBR: Marsha Cohen Pacp Mnreup: Aptara, Inc. CovpR Drsrcrs:BlakeLogan IlLuslReltoN CooRorNetoR: SusanTimmrns ILrustR,q.rroNs: Nerwork Graphics, Erica Beade,H. Adam Steinberg Puoro Eorron: Cecilia Varas PHoro RpseencHrn: Christina Micek PRooucnoN CooRoneton: Susan\7ein Mron RNo Suppr-rvENTSEDrroR: Hannah Thonet Mron DEvgLoplns: Biostudio, Inc., Sumanas,Inc. CotvtposrrloN: Aptara, Inc. MeNupRcruRrNG: RR Donnelley & SonsCompany

About the cover: Mitotic PtK2 cellsin late anaphasestainedblue for DNA and greenfor tubulin. Courtesyof Torsten\gittman. Library of CongressCataloging-in-PublicationData Molecular cell biology I Harvey Lodish . . . [et al.]. -6th ed. p. cm. Includesbibliographicalreferencesand index. 1. Cytology. 2. Molecular biology. I. Lodish, Harvey F. QH581.2.M6552007 57L5-dc22 2007006188 ISBN-13: 97 8-0-7167-7601-7 ISBN-10:0-7167-7 601-4 @ 1986,1.990,1995,2000,2004,2008 by tJf.H. Freemanand Company All rights reserved. Printed in the United Statesof America Secondprinting W. H. Freemanand Company 41 Madison Avenue,New York, NY 10010 Houndmills, Basingstoke RG21 6XS, England

www.whfreeman.com

To our studentsand to our teachers, from whom we continueto learn, and to our families,for their support, and love encouragement,

PREFACE

I n writing the sixth edition of Molecular Cell Biology I we have incorporated many of the spectacularadvances I made over the past four years in biomedical science,driven in part by new experimental technologiesthat have revolutionized many fields. High-velocity techniquesfor sequencing DNA, for example,have generatedthe completesequence of dozens of eukaryotic genomes;these in turn have led to important discoveriesabout the organization of the human genome and regulation of gene expression,as well as novel insights into the evolution of life-forms and the functions of individual members of multiprotein families. New imaging techniqueshave generated profound revelations about cell organization and movement, and new molecular structures have greatly increased our understanding of life processes such as cell-cell signaling, photosynthesis, gene transcription, and chromatin structure.

what we know. A number of experimental organisms,from yeaststo worms to mice, are used throughout so the student can seehow discoveriesmade with a "lower organism" can Iead directly to insights even about human biology and disease.This experimental approach, evident in the text itself, has also been thoroughly integrated into the pedagogical framework. For example:

New Author Team

r Updated Perspectives for the Future essays explore potential applications of future discoveriesand unanswered questions that lie ahead in research.

Two new authors have been instrumental in refocusing this book toward these exciting new developments. Anthony Bretscher of Cornell University is known for identifying and characterizing new components of the actin cytoskeleton and elucidating their biological functions in relation to cell polarity and membrane traffic. Hidde Ploegh, of the Massachusetts Institute of Technologg has made major contributions to our understanding of immune system behavior, particularly in regard to the various tactics that viruses employ to evade our immune responsesand the ways our immune systemresponds. Both authors are widely recognized for their researchas well as their classroomteachingabilities. 'We are grateful to Paul Matsudaira, Jim Darnell, Larry ZipurskS and David Baltimore for their exceptional contributions to the previous editions of Molecular Cell Biology. Much of their vision and insight is apparent at many places in this book.

Experimental Emphasis The hallmark of Molecular Cell Biology has always been the use of experiments to teach students how we have learned

r Experimental Figures lead students through important experimental results. r Classic Experiments essaysfocus on historically important and Nobel Prize-winningexperiments. r New and revised Analyze the Data problems at the end of each chapter require the student to synthesizereal experimental data to answer a seriesof questions.

showsthe locationof DNAand multiple microscopy Fluorescence et al, 2006,Science BNG Giepmans proteins withinthe samecell.lFrom 3'12:217 |

vtl

New Discoveries, New Methodologies

Coiled-coilstalk

Motor head Microtubule

Necklinkers

(+)

Methodological advances continue to expand and enrich our knowledge of molecular cell biology and lead to new understanding. Following are just a selection of the new experimental methodologiesand cutting-edgescienceintroduced in this edition: r Expanded coverage of proteomics, including organelle proteome profiling and advances in mass spectroscopy (Chapter 3)

I ForwardmotorbindsB-tubulin, ADP ^ releasing

p ForwardheadbindsATP

?

r Expanded coverageof RNAi, including the use of shRNAs to inhibit any gene of interest in a cultured cell or organism (Chapters5, 8) r Updated discussionsof chromatin, including structure and condensation(Chapter 6), control of geneexpressionby chromatin remodeling (Chapter 71, and chromatin-remodeling proteins and tumor development(Chapter 25) r Evolution (Chapter 6)

p

Conformationalchangein necklinkercausesrear head to swing forward

of chromosomes and the mitochondrion

r New molecular models, including pre-initiation complex and mediator complex (Chapter 7); annular phospholipids (Chapter 1,0);Caz* ATPase (Chapter 11); rhodopsin, transducin, and protein kinase A (Chapter 15); and myosin ATPase (Chapter 17) r Latest advancesin light and electron microscopy, including cryoelectron tomography (Chapter 9) r Reactive oxygen species(ROS) (Chapter 12)

ADB [ rue* forwardheadreleases ^ trailingheadhydrolyzesATP V and releases P.

r Role of supercomplexesin electron transport (Chapter 12) r Human epidermal growth factor receptors (HERs) and treatment of cancer (Chapter 16) r Myosin ATPasecycle (Chapter 17) r Kinesin-1MPase cycle (Chapter 18) r Use of retrovirus infection for tracing cell lineage (Chapter 21) r Axon guidance molecules (Chapter 23) r Somaticgenerearrangementin immune cells (Chapter 24) r Cancer stem cells (Chapter25) r Use of DNA (Chapter25)

Figure18-22 Kinesin-1 usesATPto "walk" downa microtubule

vill

PREFACE

microarray analysis in tumor typing

XI

l)vl tud

'JPalre^o PunoJ0q UEJuonrpo qxrs oql ur seldr.uExeIEJrpau arll Jo rsII aleldruoJ v .luau -uorr^uo rElnllotrErlxe rrar{l ur selErpdqoqfff, pup surelord ol puB sllor reqlo ol sllal lreuuof, pu? .usrloqElou alEurprooJ 'uorldtrcsuerl 'slueulelour VNC alelnSor 1ac ezdptec leql saxalduroc-sy1ao ur saxalduroc ulolo.rdrrpur Jo Surpuelsrapun polrerop e uo e8urq suonecqdde osaql Jo dueyrg .8urureo1 ere doql eruerrs f,rseq eql ;o suonecrldde leolurp oql roJ uorlerca.rddeup stuepnls errr8ol eleudordde a;aqm sreldeqr eqt lnoq8norql uo^ol\ e.reselduexe lelrperu esaql .sossasrp ueunq luecrlruSrsJoqro pu€ JafupJ Jo' sluauleeJl ,/\^.ou ol pel azreqlSolorq relntalol'u puE rEFIIel Jrs?qur secuelpu due141

'uaq) pue uosraur] Ie]nltlsulq)-teosau le)pauotguo]sog [ 3 1oIsaynoSl sllol al)snu'tolut slla) (lselqo^Lu)a]tllalesasnou.l fueurrd ]o arnllnl ur uotlerluola]]lC0€-6 eln611lelueuuedxS

a)uenelau le)tpaw -relotrr

'Iuolsds eunrurur olprgalra^ aqf or dSolorq IIar Jeln r ;o soldrcur.rdsarldde (y7 nlderla) .,d3oyounurur1,,

'uorldaf,ardrosuas pue Surpur; r{l?d ur sef,uE^pplso Ipuoxe -tel agr Surpnycur's11acpazrpnods aseql dSolorq ;o [e] aqr 1o aSerairocperJrunseprrrord(97 raldeq3) ..slle] e^raN,, r 'tuaurdole,rep uErI?luruEru uo snJoJpaseerf,urr{lr^,\(uorlptu.ro;u.rauedq8norql uorlezr -lrlroJ uro{ luerudola,rep sleluoruppunJor{l sruaso.rd(77 Jo ;erdBr{J) ,.luarudola,taq;o dSolorg IIaJ relnreloW ar{J" r

eerqt sepnlrur KSoTotgila) nlrcapw

:sraldeqr rvrau Jo uourpe qrxrs aql

sraldeq) /naN I p]eogprpMvuosltNUpuualaq-L]o Isa]Jnofl 'talrnuord eleuJa]pue a1eu.r 6ulnnoqs11ar66a ueunq paztltyal

'uorl€ruJoJur IEuorlrpPPr.lfnru ot srolfnJlsur pue sluapnls Darrp leql selr -ru? ^\erleJ e,Lrsueqa.rduroJ pu€ serpnls {reurpuel Jo sef,ue -raJeJ rsrl olep-ot-dn uE spr{ retdeqr r{leg 'lprralpru ^\au Jo .sretdeqc to uorrrppp aqt roJ uoor e>lerrrol sn Surlgeue ,tg scrdol Iueur ;o a8ereloc pasnf,ol Iereles SurzrueS.roa.r 'sesJnof, lsoru Jo uorlBzrue8ro Pu? peulluparls osle ql{r eql rorrru PUEIErraleu polplor alrun 01 slueluoJ Jo elqBl aql pasr^al a^pq o^\ 'drlunoo agl punoJ€ ruor; dSoyorq IIel to srossayord691 ue{r erotu r{tr^. uorlellnsuof, uI

uollezrue6lg nnel reldeqr qlee Jo derupeor peor-ol-dsea ue eprrrord mou sEurpeeqpatuauo-ldeJuoJ JEOIJ 'alqrssod Jaleregl\ uo8rel Sur;rourer's8urpvaqpue ]xel aqr par;qdurs osle e^Eq 3/N 'Oruof,01 sr lpq^{ Jot uorlEpunoJ pllos e epr^ -ord pue arnlrrd 8rq eqr stuapnls e,rr8deql teql aJnsSur4rur 'sarerlrJeao ralduqc aql parrordurr aAEq olt ,relncrlred u1 'olqrssalJearotu sluar.urradxa pue sldaruoc eqr qroq Sunleru ol luerullturuor Jno porJrsuoluralerl e.ry\pue 'sleluaurepun; eql Jo suorleueldxe reelJ roJ poau .sluepnls qlr^\ sluaurdo -la^ap lrJnuaps lselel eql;o a8eraloJ Jno arueleq ol peln o^prl o/N 'alqeqceordde aJoru sluopnls ro; Sullunep eg uEf, leqt Ierraleru o{pru ol op uer'sluepnls alenper8 pue olen -perS.rapunqloq paruarredxesE ,er\,r. req^ pe)se to srer.{Jeal pue IJEq dels e ualel a^Er{olr uorlrpo qlxrs eql 3ur1r.rmu1

f1r;rqrssa))V pue [1r.re11 poseat)ul

'd) dlr,rr1ce eseroruolel pue puotselqornaN OVtt sluaurt?eJlreJuef,ls?arfl ftttt'd) (Ogtt 'd) sarderaqlraruer raqlo pue le^ealC (Stf 'd) seuroqdrudl srsdleuederreonrly'q pue t 'd) sarderaqtref,uef,se suralord lernlBu 3_ursn

(gttf

(rrrro)

l)vl I ud

rc99'd) seleq?Ic (SSS'd) eur8ue pue uuac.{y3orlr51 'd) sutalo.rd.C pue sulxol IEIJelreg G* (tEg 'd) (ggE) .rolcel qr.to.r8 prlaqrrda PUPreruer lseorg .d) luetulEert Erullrsv GZg

(sog'o)

pue (g4) enualo.ralseloqrraddqIETTnUEJ sllol ruelsreJuef,d;pueprot posnore stsotuorletuBldsuerl Ioralsalor.{r'ICI'I 'd) aSerolsleurososdl ses€oslp (tOtt 'd) sourrre1 ftOg (SeS'd) srsorqr;rrrsd3 (f eOt 'd) uorssarddnsounuul ( S S S ' d )s e l l l l e l u r o u q e (geOt'd) ssouJEOC (ezord) IerretoruprJ ot peel uec dlquresseaurostxorede^Illoleq (SSS'd) 3urp1o;snuutalord pue eruas,{qdurg s.rat.rodsuerl Jret{lpup sJeDrrusuEJlornau taBrel s8n.rq 'd) sarpoular 'd) (eOS srsoldcoxa Jotlrusu?JtoJneu pue rusrlntog luqreq pue dlr,rtloerelrodtluB dCV/dIV kZOt (ZOS'd) rrxol dlq8rq eq uer (595) sercadsua8dxo a^Ilreeg (Sf Ot 'd) urladur leraqdrradlaS.relseseesrpeunuurolnv (Set 'd) uotlertdsar relnllol sllgil{ul aprued3 (ltOt 'd) srsorelf,sa1drrp7,q 'd) uorrerpdqappur Eraloq3 'd) snsrelul snlls pue dl4rualur a1ery fiw GSe 'd) sllar ruets slueldsupn ,,trrorreru ouog pue QgV'dl suollJeJluor elJsnlu uPOqPUEasEdIV *Y*3N 6Ze (SSl 'd) sISorqIJorlsdcpue suralord3gy rrlrrpua6l (Ste 'd) spuno^,\uDIs sllel J IEeq leturaprda 'dl sller ruots asn rnnederogl GVV'd) snpldrsursaloqelPpue'utsserdosezr'utrodenby ftte 1o 'dl (eeg 'd) reJu€r pue slurod>paqeapdc-1ya3 k* loretsalol{r PUEsrsorelrsorol{lv sqre5-de1 (te S 'd) surelord .rosserddns-rorunl 0n.' d) aseesrP (SSg 'd) sroruef,uelunq pue dezngredUOIUI (ZSS'd) sertrleurouqe OVt.'d) (ng) snrr,r'dcuarcrlepounulul uelunH leluaurdola,rappup JeJueJsosnpf uorlcunlsrp-uop 'd) eltuessel€ql (ZgS'd) euolselqourler.,(retrpa.ra11 \Vt. (OlE 'd) soseeslplectSolornaupue suot8ar salIIIel€sorJIW (qqS 'd) saseasrpaldrrynuresnef,suorlelnru VNW-I (ggg 'd) dqdorre elrsnlu leurds pue Surddrls uoxg ( ggS'd) .,(cuercr;ap uorsaqpe-eldrolne-I (SeZ' d) auro.rpudss,eu,,{e1co3 (ses'd) PuE ulnsoluou8rd euraporay ,(qdo.rrsdpJelnf,snu ouuoglnq pue 'uolela4sordc'p,q3g_eq1 6eZ'd) rarueJ sesnetsaua8ut &r.LrperossardarJo oluosqv ftgZ'd) refuef, leart ol srollqlqul oseJetuololueunq Surs;1 Uze'a) G.VZ' d) slsoleruorqlJornoN asnel VN(lluI uI suollelnry ftVZ'd) sasEOSIP 6VZ' d) souosoqlr orlosotdr uo slleJJeruereJllPe^EI{sJIloIqIluV puE lErJPuoqf,olltu 'd) dueru sasnecsluatualo11 ;o lrrrtqolN cueua8 sespeslp fttZ relnJsntuorneuosner selIIIelEsorf,I6 GZZ'dl seseoslp (SOZ'd) srsorqltcrlsdr dpnls ol POSnare erllu lno{rou) ueunq esnel salalp luelnry (Se 'd) seseaslp f 'd) sasncnnaderaqr qtt A Get suralord ueunq azrseqludssenbruqcalVNC lueulqluofeg sarqdonsdprplnf,sntulelrue8uoc osner suortetnu ua8e11o3 gZg 'd) stlaJapensslt-elllrouuoo pup d,Lrncg kZe'dl ernlreJ IPuer ot PEelspaJaPauErgrueu luouosEq rElnreuolc upunq rq8rarseelt? esner seue8utxauuo3 (etS 'd) sos€osrp (Sf S 'd) eseosrppue uodsuun relnllerered (gf S 'd) oseasrpurIS pue urelSoursapuIreI{p€J Ge t'd) saseosrpdueu asnecsuorletnur ururel y-add1 (OSZ'd) sreprosrpdrosuasesner slJOJeperlrc dreurtr4 Ogt'd) osposrpleel ot ullnqru roage s8nrq

(ee rd)

6w'a)

eunrperrl uI slool crtsou8erp p;raltod a.le sdel.leo.rc1uVNCI sarqtedodtuorprerrrqdorlraddq asnecsuoll€lnru ulelord Itgt'd) fitt' d) dqdorrsdp rplnf,snlu ouuel{f,nq Erreletupue EItuouEIIel-oPIlIs llotte solelleurqolSouleg (OgZ 'd) serrueuecrldroraqd5 (fSt 'd) sller rno IrElrE AdH pue AIH sE t{f,nssasnrl1 GOt'd) IorelsalollJpue slsoralf,soreqtv 'd) uDls raf,uef, PuE urelsdsrredal-uotstcxoaPuoollnN 9O t' a) aseesrps(rer.ureqzlv (Stt (Slt 'd) raf,ueruolo3 gOt'd) aspasrpueaq pue ref,uerlrotlp saseetordWVCy (ZS 'd) dde.raqloueqf,uI POSnare sJollqlqul auoseetord r{lrrq osnef,suolletntu Surleu8rsSoqe8pag (OOZ'd) sDOJOp (lS 'd) dllrtlce utalord llqgul uec s8n.rq (Ug 'd) rof,uet ueunq pue eua8NEId (tt'd) 8urp1o;sruutalord Jo soseeslq (SSS'd) rerupl upunq pue suralord se6 ueIIEIuLu€t{ 'dl (gg 'O) uorlef,Ipeu uI sretuosloorols eua8 pu€ reruer lseerg ftSg Tagg eql Io uorrprr;r1drue 'd) strods ecuernpuepup unarodorqldrg Gtg 'd) :erer.rdorddesE lxal oql ul dde.raqr lZtg 'xel eql readde suorleleJJof,IEJIurll JaJeIJqIEUoIIIpPV raf,uef,pup (JSI-C) rorce; Surrelnurrls-duolocailoolnuerg 'd) srorunt upunq pue uortrqlqur qrmor8 'gg1 ur uortecrldde I€f,IuIIr e Jo lrels eql sleu8rsuorl sIr{I fttg

sNorlv)llddv

1v)lNll)

MEDIA AND SUPPLEMENTS to-use format. Visit http://ebooks.bfwpub.com more.

For Students Companion Web Site www.whfreeman. com,/lodish5e NEW: Podcastsnarrated by the authors give students a deeperunderstanding of key figures in the text and a senseof the thrill of discovery. r NEW: Now available for your MP3 player or personal computer, more than 1,25animations and researchvideos show the dynamic nature of key cellular processesand important experimental techniques.The animations were storyboarded by the textbook authors in conjunction with BioStudio, Inc., and programmed by Sumanas,Inc. r Classic Experiment essaysfocus on classicgroundbreaking experiments and explore the investigativeprocess. r Online Quizzing is provided, including multiple-choice and short answer questions. -4), written Student SolutionsManual (ISBN:1-4292-01.27 'Wong, Richard Walker, Glenda by Brian Storrie, Eric A. Gillaspn and Jill Sible of Virginia Polytechnic Institute and State University and updated by Cindy Klevickis of James Madison University and Greg M. Kelly of the University of Western Ontario, contains complete workedout solutions to all the end-of-chapter problems in the textbook. NEW: eBook (ISBN: 1,-4292-0955-0)New to the sixth edition, this customizable eBook fully integrates the complete contents of the text and its interactive media in a format that features a variety of helpful study tools, including fulltext searching,note-taking, bookmarking, highlighting, and more. Easily accessibleon any Internet-connectedcomputer via a standard rWebbrowser, the eBook enablesstudents to take an active approach to their learning in an intuitive, easy-

to learn

For Instructors Companion Web Site www.whfreeman.com/lodish6e All the student resources,plus: r All figures and tables from the book in ipeg and layered PowerPoint formats, which instructors can edit or project section by section, allowing students to follow underlying concepts.Optimized for lecture-hall presentation' including enhancedcolors, enlarged labels, and boldface rype. r Test Bank in editable Microsoft'Word format now featuringnetu and reuisedquestionsfor every chapter.The test bank is written by Brian Storrie of the University of Arkansas for Medical Sciencesand Eric A. Wong, Richard Walker, Glenda GillaspS and Jill Sible of Virginia Polytechnic Institute and StateUniversity and revisedby Cindy Klevickis of JamesMadison University and Greg M. Kelly of the University of Ontario. r Additional Analyze the Data problems are available in PDF format. r NEW: Lecture-ready Personal ResponseSystem "clicker" questions are available as Microsoft'Word files and Microsoft PowerPoint slides. Instructor's Resource CD-ROM (ISBN: 1'-4292-0126-6) includesall the instructor's resourcesfrom the Web site' including all the illustrations from the text, animations, videos, test bank files, clicker questions, and the solutions manual files. 'l'-4292-0477-X) conOverhead tansparency Set (ISBN: for optimized text' the from key illustrations tains 250 presentation. lecture-hall

17 ,7 ,L Cell Mlgra:1jon Coordlnates Fore Gen.radon Adheslon and M€mbdne Rccvdlng

wlth Cell

II !

i{r

eBook bfwpu b.com http://ebooks.

[email protected]'[email protected]'*dq

FlWre L7,38,tu9 4, 4. I

)a:99 -, w,P" : :l9Y t !i,'Pn.by yl:-'-'l].y?

.dh.t. b t 6. att lLrt t.6. l.^.lltpo4t. be foalrdh.tto^t (2) ftr 6. rlb,bdh ^ 6. att bodr 6. b dol d6. t..t d Aott

PREFACE

'

ACKNOWLEDGMENTS In updating, revising and rewriting this book, we were given 'We invaluable help by many colleagues. thank the following people who generouslygave of their time and expertiseby making contributions to specific chapters in their areas of interest, providing us with detailed information about their courses, or by reading and commenting on one or more chapters: Steven Ackerman, (Jniuersity of Massacbusetts,Boston Richard AdIe4 IJniuersity of Michigan, Dearborn Karen Aguirre, Coastal Carolina lJniuersity Jeff Bachant, Uniuersity of California, Riuerside Kenneth Balazovich, Uniuersity of Michigan Ben A. Barres, Stanford Uniuersity Karen K. Bernd, Dauidson College Sanford Bernstein, San Diego State (Jniuersity Doug Black, Howard Hughes Medical Institute and (Jniuersity of California, Los Angeles Richard L. Blanton, North Carolina State (Jniuersny Justin Blau, New York [Jniuersity Steven Block, Stanford IJniuersity Jonathan E. Boyson, Uniuersity of Vermont Janet Braam. Rice Uniuersity Roger Bradleg Montana State Uniuersity IilTilliam S. Bradshaq Brigham Young (Jniuersity Gregory G. Brown, McGill (Jniuersity \Tilliam J. Brown, Cornell IJniuersity Max M. Burger, Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland David Burgess,Boston College Robin K. Cameron, McMaster [Jniuersity \7. Zacheus Cande, (Jniuersity of California, Berkeley Steven A. Carr, Broad lnstitute of Haruard (Jniuersity and Massacbusetts Institute of Technology Alice Y. Cheung, IJniuersity of Massacbusetts, Amberst Dennis O. Clegg, Uniuersity of California, Santa Barbara Paul Clifton, Utah State IJniuersity Randy \7. Cohen, California State [Jniuersity, Northridge Richard Dickerson, (Jniuersity of California, Los Angeles Patrick J. DiMario, Louisiana State Uniuersity Santosh R. D'Mello, [Jniuersity of Texas, Dallas Chris Doe, HHMI and [Jniuersity of Oregon Robert S. Dotson, Tulane [Jniuersity 'Sfilliam Dowhan, IJniuersity of Texas-Houston Medical School Gerald B. Downes, (Jniuersity of Massachusetts,Amherst Erastus C. Dudley, Huntingdon College Susan Dutcher, V/ashington (Jniuersity School of Medicine Matt Elrod-Erickson, Middle TennesseeState Uniuersity Susan Ely, Cornell Uniuersity Charles P. Emerson Jr., Boston Biomedical ResearchInstitute Irene M. Evans, Rochester Institute of Technology James G. Evans,.Whitehead Institute Bio Imaging Center, Massachusetts Institute of Technology Marilyn Gist Farquhar, Uniuersity of California, San Diego

X

PREFACE

Xavier Fernandez-Busquets, Bioengineering Instituteof Catalonia, Uniuersitatde Barcelona,Spain TerrenceG. Frey,San Diego State Uniuersity Margaret T. Fuller,Stanford UniuersitySchoolof Medicine KendraJ. Golden, WbitmanCollege David S. Goldfarb,RochesterUniuersity Martha J. Grossel,ConnecticutCollege LawrenceI. Grossman,WayneStateUniuersitySchoolof Medicine Michael Grunstein, Uniuersityof California, Los Angeles, Schoolof Medicine Barry M. Gumbiner, Uniuersityof Virginia 'Wei Guo, Uniuersityof Pennsyluarua Leah Haimo, Uniuersityof California, Riuerside Heidi E. Hamm, Vanderbilt(JniuersityMedicalSchool Craig M. Hart, Louisiana State Uniuersity Merill B. Hille, Uniuersityof Washington Jerry E. Honts, Drake Uniuersity H. Robert Horvitz, Massachusetts Institute of Technology Richard Hynes, Massachusetts lnstitute of Technologyand Howard HughesMedical Inshtute Harry Itagaki,Kenyon College ElizabethR. Jamieson,Smitb College Marie A. Janicke,State Uniuersityof New York, Buffalo Bradley'W.Jones,Uniuersityof Mississippi Mark Kainz, ColgateUniuersity Naohiro Kato, Louisiana State Uniuersity Amy E. Keating, Massachusetts lnstitute of Technology CharlesH. Keith, Uniuersityof Georgia Thomas C. S. Keller lll, Florida State Uniuersity 'V/estern Greg M. Kelly, Uniuersityof Ontario StephenKendall, California State Uniuersity,Fullerton FelipeKierszenbaum, MichiganStateUniuersity Cindy Klevickis,JamesMadison lJniuersity Brian Kobilka, StanfordUniuersityMedicalSchool. Martina Koniger, WellesleyUniuersfiy CatherineKoo, Caldwell College Keith G. Kozminski, Uniuersityof Virginia StevenI(. IJHernault, Emory Uruuerstty Douglas Lauffenburger, Massacbusetts Institute of Tecbnology RobertJ. Lefkowitz, HHMI and Duke UniuersityMedical School R. L. Levine,McGill Uniuersity FangJu Ltn, CoastalCarolina [Jniuersity ElizabethLord, Uniuersityof California, Riuerside Liqun Luo, StanfordUniuersity Grant MacGregor, Uniuersityof California, Iruine Jennifer O. Manilay, IJniuersityof California, Merced Barry Margul ies,Towson Uniuer stty C. William McCurdy, Uniuersityof California, Dauis, and LawrenceBerkeleyNational Laboratory Dennis \il/. McGee, State Uniuersityof New York, Binghamton JamesMcGrath, RochesterSchoolof Medicine David D. McKemy, Uniuersityof SouthernCalifornia Roderick MacKinnon, Rockefeller(Jniuersity JamesA. McNew, Rice Uniuersity

X

l)vl lud

'uoqey{ auuv eJr.^ A,tt (qBaop applfl:raqelN snel) pue reslp) elpq 'V sresl^pepue 'e1rrEpuerpraHs.rorq8nep pue acruef e;rrrr dru (nqtslatg ftuoqluy) :rnpred no1 .fue141 rasr^pe pue ';dolssralXer1Jsnq'11oo5re1a4'uor5 erlnf 'loc5 ulorurl te11ng (*rttnt) lare8rey,q(nocg '4 maqtlpw\ fre8err; enqsof pue 'reSorry ueqreuofte8err;4perpllry ta8arry ,(e['1 te8arry lcueg Qa8auy {,1uoyl :lltaN,O dqrel e;r.u f,ut (nsruy 'V sltqJ) :d;eq5 1q4 pue 'uorde13 pr,req 'grrur5 euqe8uy '1rag dalrrqg '>1rag.furaf t1e5 a;rrrrdru (4ng plouty) qooq sqt Jo suorlrpalsrrJ erll uo Surler -oqpllor ro; IIeureCurrf pue erourlleg pr^pq osle pue lreuuerg .,{aupd5 prre:epur.ZuolroN srolurur :l.poqea4trlor1 pup f,pEsIpu€ 'dpoqea4ernrg 'qsrpol arueqdar5 pue lqsrpol s€rqoJpue 'engsof 'erqdo5pue 'rpreqlSurlsrr)',{rpo'I uruery lgaurat5.4aerpuv pse ?ururgpue rrrg rpraH uerplrrllpuerSpue uarppqclur pup traurets 'e;r.trdu f :^\oul e.trterl^{ Jo qcnu sn 3ut e1aue4 (tls1pol Kan,wyfl -qJeatpue serpnlsrno ur sn SurSernocue roJ sresrlpepue sJolueu Jno ol pue looq E r{Jnsuo lJolr\ ol selet tr eurt eqt sn Surluer8 roJ pue sn SurrrdsurroJ sarTnupt rno ot slueql lercadsAlleurg ^rolEroqElIoJS aql to sreq 'qs1e16 'uostelN 'rg8ru; aqnf -ueru te11er1X blcmg pup qog qrr51 'srue8our41o;a8roeg 'sue,rgsauref'3uE 'uerrouoqauuy 1ore3 'qsngauerq 'unoJueurgd1e5:t1elsu,^,orno ot slueqf d.re141 'u^ers glnu PUPorroilr^rQ eruosAIIPIT -adsa luorlrpe srql ur af,uenltur ol enurluof, uonrpe eqt ot suon qry$ -nqrrluof, eIq erN esor{.4a esoqr a8pal,v'oulre ol pFo.{\ Ferrp 'ue.r8ordlre aql Surcuequa ur >lro^rrag pue 8urdo1e,r,ap scrqderg ro; (ruoc'srrqderC3flW'.{\^\rrr) f,{IW Jo epeogEruE pue slapou rplnrelou InJrrnpaq srq pue rq8rsurlerr ;o tuaudola,rep -So8epadsrqro; Sragurelsruepv 'H or palgepuroslpare elN 'uoItIPe slql uI euoP arr.no.,{ 1Iero; nod IUPqJ 'srotrpoolqeireuer aredaql 'a)r5 qtaqezrTg pue 'tsorg sa8etu€d eJuE 'zouoluol .e\aquew 'sJotrpalxel Jno to lueulruruof, eIII plno.4 a^4.'relnctlredu1 pu? tuelel egr a8pal-rnouTre.or ^e.t\ JeAeur slarxereqr {ooq 3 elnP -ord ot eruruelo lJo.ry\ol sseu8uqp.Lr Jrer{tJoJpue Joqel rreql JoJ urel[ uesns pue 'seren eqrca3 'o1zcouil1 1c151'suturutl uesn5 'tauoql ere5'>1aqcse1 uare;tr'udetg qrna'pa51.g qeuueH'lauuel 'IerlIN purlsrrrl3'ue3o1a>1e19 'uago3 Eqsrery'are13atqqeq IIIS 'prdg esrnol .fue1aq tqy ete) Tueqr e26 dueduro3 pup uerueerC 'H 'lA.tE sraulredSurqsqqnd rno Jo uolleroqellorpaDrluurof, pue IntereJaqt rnoqtr-a alqrssoduaeqa^Eqtou plno^\ uolllpasIqI 'stseJpodpue sluarurredxg Jrss?l3er{tto lueur -do1a.rap rar{ roJ euozrrv drrsra^runer{tJo apueze1psl.1or InJ Jo -ater8 euIIuOegt to uolsl^erreq osye ar€ elN'sualgord Surzzrn| erur8rrnto elqls illf .ro; dlrsralrun elels pue elnlrlsul cruqcat.(1o4 ot pue 'suorlsanb4ueg lsel pue sruelqo;dsldacuo3 erll -t\el^a1 ^\eu tuallaf,xe 1o drgsroqtne rrer{t JoJ oIJEtuO 1o llrsre.,rrun aql 1o 1.11a;'yq Sarg pue dtrsrerrrun uosrperyseuef ;o sDlrl^el) ,(pur3 or 'suralqord eteq eqt ezlleuy .treu }o tuaurdola.tap Jer{JoJ'aprsra,rrg'erurotrle3 ;o ,{trs:a,rruner{l Jo ourreH qee'I ol uorlercerddepue apnlrter8rno sserdxaol aIrTosle pFo.a.rel6 otuol.uvuos 1p nrua) qqpaH soxal Jo Kysnnrun aqa'neS aauaUA KSolouqcal]o ainfl$ul s$asnq)ossow'uJ" 'g IOeIITIIAJ hplnog 'opo.to!o)]o r("trsnmug'enySutq 'yq dreS Klrsnntup umotg'1assa15

Kltsnnru1 sur4dog suqo['pue1pue16.{lrerrag puu IWHH'uoury elqa8uy r(4o1ouqta1 Jo aluttsul silasnq)pssow erte13 Kltsn nruI auorpul'1ezr1e16 Knstanrunilaurc)'r3on 1 rello1 uoleuoq8utg'4to7 mayl]o K"ysnmu1ata75'>1rtlsngue1 'C uegod teuqsre4 qqetlurv puolCtoytg Jo K11stanr.u2 qlaq€zllg a,Lowqupms'ua11en a8a11o2 oluona Jo Klts.tantun'adadorl luorul1 trll'saqurol'W lreqoU 02 or.utB Klrs.tantun qqoamuoLuLu puvpaz may7'uo13u41a1yt 'uo13ur11ary tlrsnnrun or.to::r1'a1rrrd5-alepsaeI In€d Jo 'S oBarq uog 'otu.to]ttp) /o ftqstamu1 pup IWHH to1.{e1 uesns aurnt 1' orut oJt1o2 ] o Klrsn nr'un' e nda8eel aule3 autntl 'orutoJtlo2]o Kysnntu1 'ur1ten43euIlsIrLIJ K7ls n nr.u 2 auu)tpauag'qretu11el5ef,Iuore1 Knsnruu7 stnoj lutos'reruad5uesn5 autxpaytrJo poqzs i('1rsnntu1stno7 luros',{rl.us 'S dro8arg 'a1eu5'1 ueqder5 sala&uyso7'pxutoJllp3Jo t("xtstantu4 'W sef,urq aprshntd 'o1u.toJ11o3 Jo K|rstantu1'ItP"lS Krysnntu7uolSutqsoly uh$a6 tpun3-q8ut5 nuy qleqeztlg3ut1-ue1 qun Jo.Klrs'tantug'nrq5 lvtshntun anp.tnd'uerureqs'vslno'I ue8ro141 KSolouqtal]o anr$ul silasnq)ossory'3uag5 Kyuantug a1ol5uol8urqsrr11'uap1aq5'V llrg eualreyq n ntu2'zvret15 ouatpulutaqwo5 ]o r(1ts euetq [.to1,rtr ,g Luollllg Jo a8a11o3'sa1eq5 uospw a8nag'ore5 pleuoq K1ts.tanru1 'V pl^e( maN'ouellqf,f,If,S K4snnr.un 4rcI KTlsnntunptoJuolg'roPIeuqrS PI^€Q auotpayl pozps {4rsnntun uo1Sutqsaytte;aeqc5ueaf Jo s.ta ntun aw I g otuon1rtsuua7' AtueS'J eulerro'I K1r Kysnntun umola8toag'plemuasoa'C auuy 'Q silasnq)psspry'Srequesog rreqog KSolouqcalJo ag1t1su1 Kltsnnrun p.toJuolS'r8reqoa lelea auntpayy ]o loo.Ps sllodzuolPulJo Kltsnntug'a4rtg '; dre141 Kpsnntu2 ploJuolg'tlol€d retlreg I€I KqsnnruI ilautoJ'eudnr4 przreq K4snu.un axpisouptstnoTSaJFd uelsrl) xnaq'aru.toJlp) Jo r(puanr.u2{1s1e,rtr4uruetrJ aBa11o3 lsnqutv'etlJo4 f,IuIuoC Iooqzslwtpaw plPnrPH'tuou8t4EJsef,uerC '11uredrp Kala4ng'otutoJuo1]o KlrsnntuJlPuPIWHH'1ale4 Kltsnntun p.toJuolg'org duoqtuy 'W pnnw 'orutoJno3]o K'ltsnuun'snlclg P1r'eC Kystanr.u 2 p toluoqS'assn51 leog uosxpow'utsuocst6 Jo tbrs,lanrun'IqurelN'y'q sauref ouoztty Jo rtpstantun 'uroq8r51uely ( dt11tq4 uBtpdtupq) -oupqI n stoutll I o K1tst a,uu n'>1reur.la'a51 Kysnruug 3uno7 utaqSt.tg'leun1A1';tr uordg ueg uoualrytr 1at4snntu7 a1o1goru'tolr1o3'derrn141 tsure4 po q?SPzrPaWpn/t.tt2H'egloo141 eletued rtp.sn ntun ap 75 otuon1Ksuua4' 11eqtl1tl1 KTts n nrun ptqtunp) SellIWqFqEzIIE aunrpaYg Jo loops eue[1t[1 K1tst antu2 ptoJualSPuP IW H H'ctrro1ua1t141 oBatq uog 'otutoJllo) ]o Kttsnnrup Jeyq erueqdel5

CONTENTS IN BRIEF

Part I 1. 2. 3. Part ll 4. 5. 6. 7. 8. Part lll 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.

Chemical and MolecularFoundations1 L i f e B e g i n sw i th C e l l s 1 C h e mi caFl o u n d a ti o n s3 1 ProteinStructureand Function 63

Genetics and MolecularBiology 111 B a s i cM o l e c u l aG r e n e t i cM e c h a n i s m1s 1 1 M o l e cu l a Ge r n e ti cT e ch n i ques1G5 G e n e s,Ge n o mi cs, a n d C h rom osomes 215 Transcriptional Controlof Gene Expression269 Post-transcriptional GeneControl 323

CeflStructureand Function 371 V i su a l i zi n gF, ra cti o n a ti n g, and Cultur ingCells 371 BiomembraneStructure 409 Transmembrane Transportof lonsand small Molecures437 C e ll u l a rE n e rg e ti cs4 7 9 M o vi n gP ro te i n si n to Me mbr anes and Or ganelles533 VesicularTraffic,Secretion,and Endocytosis579 C e llS i g n a l i n gl : S i g n a T l ra nsduction and Shor t- Ter m CellularResponses 62 3 c e l l si g n a l i n gl l : si g n a l i n gPathways That contr ol GeneActivity 665 C e l lOrg a n i za ti o n a n d Mo v ementl: M icr ofilaments713 C e l lOrg a n i za ti o n a n d Mo v ementll: Micr otubules and Inter m ediate Filaments157 I n t e g ra ti n gC e l l si n to T i ssues801

Part lV CellGrowth and Development847 20. Regulatingthe EukaryoticCellCycle 847 21. 22. 23. 24. 25.

C e l lB i rth ,L i n e a g ea, n d D e ath 905 T h e Mo l e cu l a C r e l lB i o l o g yof Developm entg4g N e rveC e l l s 1 0 0 1 l m m u n o l o g y1 0 5 5 Cancer 1107

CONTENTS

PartI Chemical and MolecularFoundations

E

The Diversityand Commonality of Cells

18

C e l l sG r o w a n d D i v i d e

WITHCELLS 1 L I F EB E G I N S

CellsDie from AggravatedAssaultor an Internal Program 19

1

!!|

InvestigatingCellsand Their Parts 20

All CellsAre Prokaryoticor Eukaryotic

1

U n i c e l l u l aO r r g a n i s m sH e l p a n d H u r t U s

4

VirusesAre the Ultimate Parasites

6

Cell BiologyRevealsthe Size,Shape,Location, 20 and Movementsof Cell Components Biochemistryand BiophysicsRevealthe Molecular Structureand Chemistryof PurifiedCell Constituents 21

C h a n g e si n C e l l sU n d e r l i eE v o l u t i o n

6

of DamagedGenes 22 GeneticsRevealsthe Consequences

EvenSingleCellsCan HaveSex

7

We Developfrom a SingleCell

8

GenomicsRevealsDifferencesin the Structure of EntireGenomes and Expression

23

DevelopmentalBiologyRevealsChangesin the Propertiesof Cellsas They Specialize

23

Stem Cells,Fundamentalto FormingTissues and Organs,Offer MedicalOpportunities

@The

Choosingthe Right ExperimentalOrganismfor the Job 25 BiologicalStudiesUse Multiple The Most Successful 27 Approaches

M o l e c u l eos f a c e l l

Small MoleculesCarryEnergy,TransmitSignals, a n d A r e L i n k e di n t o M a c r o m o l e c u l e s ProteinsGive CellsStructureand Perform Most CellularTasks

'

s|

on Evolution 28 A GenomePerspective

10

Metabolic Proteins,the GeneticCode,and Organelle StructuresAre NearlYUniversal

't1

The Genome ls Packagedinto Chromosomesand R e p l i c a t e dD u r i n gC e l lD i v i s i o n

Darwin'sldeasAbout the Evolutionof Whole Animals Are Relevantto Genes

12

Mutations May Be Good, Bad, or lndifferent

13

Many GenesControllingDevelopmentAre Remarkably 28 S i m i l a ri n H u m a n sa n d O t h e r A n i m a l s Human Medicinels Informed by Researchon Other 29 Organisms

NucleicAcidsCarryCoded Information for Making Proteinsat the Right Time and Place

E

Thework of cells

28

14

C e l l sB u i l da n d D e g r a d eN u m e r o u sM o l e c u l e s and Structures

15

Animal CellsProduceTheir Own External E n v i r o n m e nat n d G l u e s

16

CellsChangeShapeand Move

16

CellsSenseand Send Information

16

covalent Bondsand Noncovalent lnteractions

to CellsRegulateTheir Gene Expression M e e t C h a n g i n gN e e d s

17

the Structureof an Atom Determines TheElectronic of CovalentBondslt CanMake 33 Numberand Geometry

31

FOUNDATIONS 2 CHEMICAL ![

CONTENTS

.

32

E l e c t r o n sM a y B e S h a r e dE q u a l l yo r U n e q u a l l y i n C o v a l e n tB o n d s

34

L i f e D e p e n d so n t h e C o u p l i n go f U n f a v o r a b l eC h e m i c a l Reactionswith EnergeticallyFavorableReactions 57

CovalentBondsAre Much Strongerand More StableThan NoncovalentInteractions

Hydrolysisof ATPReleases SubstantialFreeEnergy and DrivesMany CellularProcesses

lonic InteractionsAre Attractionsbetween Oppositely C h a r g e dl o n s 36 HydrogenBondsDeterminethe Water Solubility o f U n c h a r g e dM o l e c u l e s 37

ATPls GeneratedDuring Photosynthesis and Respiration 59 N A D - a n d F A DC o u p l eM a n y B i o l o g i c aO l xidation and ReductionReactions

Van der Waals InteractionsAre Causedby T r a n s i e nD t iooles

37

The HydrophobicEffectCausesNonpolar Moleculesto Adhere to One Another

38

3 P R O T E ISNT R U C T U R ED AN FUNCTION

M o l e c u l a rC o m p l e m e n t a r i tM y e d i a t e dv i a NoncovalentInteractionspermitsTight, H i g h l yS p e c i f i cB i n d i n go f B i o m o l e c u l e s

3e

![

C h e m i c alB u i l d i n gB l o ckso f C e i l s

@

A m i n o A c i d sD i f f e r i n gO n l y i n T h e i rS i d eC h a i n s ComposeProteins

40 41

FiveDifferent NucleotidesAre Usedto Build N u c l e i cA c i d s Monosaccharides Joined by GlycosidicBonds Form Linearand Branchedpolysaccharides

44

PhospholipidsAssociateNoncovalentlyto Form the BasicBilayerStructureof Biomembranes

C h e m i c aEl q u i l i b ri u m

49

EquilibriumConstantsReflectthe Extentof a ChemicalReaction

50

![

Hierarchical Structureof proteins

SecondaryStructuresAre the Core Elements of ProteinArchitecture

66

Overall Foldingof a PolypeptideChainYields Its TertiaryStructure

67

Different Waysof Depictingthe Conformationof ProteinsConveyDifferent Typesof Information

68

StructuralMotifs Are RegularCombinationsof Secondaryand TertiaryStructures

68

S t r u c t u r aal n d F u n c t i o n aD l o m a i n sA r e M o d u l e s of TertiaryStructure

70

ProteinsAssociateinto Multimeric Structuresand M a c r o m o l e c u l aAr s s e m b l i e s

72

Membersof Protein FamiliesHavea Common EvolutionaryAncestor

72

![

BiologicalFluidsHaveCharacteristic pH Values

51

P l a n a rP e p t i d eB o n d sL i m i tt h e S h a p e si n t o Which ProteinsCan Fold

B i o c h e m i caEl n e rg e ti cs

@

SeveralFormsof EnergyAre lmportant in BiologicalSystems CellsCan TransformOne Typeof Energyinto Another The Changein Free EnergyDeterminesthe Direction of a ChemicalReaction The AG'' of a ReactionCan Be Calculated from lts K"o The Rateof a ReactionDependson the Activation EnergyNecessary to Energizethe Reactantsinto a TransitionState

xvi

.

coNTENTs

64 65

50

B u f f e r sM a i n t a i nt h e p H o f I n t r a c e l l u l aar n d E x t r a c e l l u l aFrl u i d s

63

The PrimaryStructureof a Protein ls lts Linear Arrangementof Amino Acids

ChemicalReactionsin CellsAre at SteadyState DissociationConstantsof Binding ReactionsReflect the Affinity of InteractingMolecules Hydrogenlons Are Releasedby Acidsand Taken Up by Bases

57

50

52 52

ProteinFolding

74 74

I n f o r m a t i o nD i r e c t i n ga P r o t e i n ' sF o l d i n gl s E n c o d e di n l t s A m i n o A c i d S e q u e n c e

74 Foldingof Proteinsin Vivo ls Promotedby Chaperones 7 5 AlternativelyFoldedProteinsAre lmplicatedin Diseases 77

54

ProteinFunction

78

S p e c i f i cB i n d i n go f L i g a n d sU n d e r l i e st h e Functionsof Most Proteins

7g

EnzymesAre Highly Efficientand SpecificCatalysts

79

An Enzyme'sActive Site BindsSubstratesand CarriesOut Catalysis

g0

SerineProteasesDemonstrateHow an Enzyme'sActive Site Works

g1

Enzymesin a Common PathwayAre Often physically Associatedwith One Another

g4

!f, 54 55 55 56

56

EnzymesCalledMolecularMotors ConvertEnergy into Motion

!E-

!l|

r.r RegulatingProteinFunctionl: ProteinDegradation

RegulatedSynthesisand Degradationof Proteins is a FundamentalPropertyof Cells

CentrifugationCan SeparateParticlesand MoleculesThat Differ in Massor Density

86 86

The Proteasomels a ComplexMolecularMachine Usedto DegradeProteins Ubiquitin Marks CytosolicProteinsfor Degradation in Proteasomes

RegulatingProteinFunctionll: Noncovalentand Covalent Modifications NoncovalentBinding PermitsAllosteric, or Cooperative,Regulationof Proteins

Purifying,Detecting,and Proteins Characterizing

85

SeparatesMoleculeson the Basis Electrophoresis Ratio of Their Charge-to-Mass Liquid ChromatographyResolvesProteinsby Mass,Charge,or BindingAffinitY

92 92 94 96

Highly SpecificEnzymeand Antibody AssaysCan Detect IndividualProteins Toolsfor Detecting Are Indispensable Radioisotopes M o l e c u l e s Biological MassSpectrometryCan Determinethe Mass and Sequenceof Proteins

101

88

Protein PrimaryStructureCan Be Determinedby ChemicalMethods and from Gene Sequences

103

89

Protein Conformationls Determinedby Sophisticated 103 PhysicalMethods

88

NoncovalentBindingof Calciumand GTPAre Widely UsedAs AllostericSwitchesto Control ProteinActivity 90 Phosphorylationand DephosphorylationCovalently RegulateProteinActivitY

91

ProteolyticCleavagelrreversiblyActivatesor lnactivatesSome Proteins

91

Higher-OrderRegulationIncludesControl of Protein Locationand Concentration

92

g

98 99

105

Proteomics

Proteomicsls the Studyof All or a LargeSubset of Proteinsin a BiologicalSYstem AdvancedTechniquesin MassSpectrometryAre Criticalto ProteomicAnalYsis

105 106

Partll Geneticsand MolecularBiologY 4 B A S I CM O L E C U L AGRE N E T I C MECHANISMS @

structureof NucleicAcids

111 113

Organizationof GenesDiffersin Prokaryoticand EukaryoticDNA to EukaryoticPrecursormRNAsAre Processed l RNAs F o r mF u n c t i o n am the Number of AlternativeRNA Splicinglncreases from a SingleEukaryoticGene ProteinsExpressed

A NucleicAcid Strand ls a LinearPolymerwith End-to-EndDirectionality

113

@

N a t i v eD N A l s a D o u b l eH e l i xo f C o m p l e m e n t a r y A n t i p a r a l l eS l trands

114

DNA Can Undergo ReversibleStrandSeparation

115

MessengerRNA CarriesInformation from DNA in a Three-LetterGeneticCode The FoldedStructureof IRNA Promoteslts Decoding

TorsionalStressin DNA ls Relievedby Enzymes

117

Different Typesof RNA ExhibitVarious ConformationsRelatedto Their Functions

118

@ T r a n s c r i p t i o n o f P ro te i n -C o d i ng Genesand Formationof Functional 120 MRNA A TemplateDNA Strand ls Transcribedinto a ComplementaryRNA Chain by RNA Polymerase

120

122 123 125

The Decodingof mRNAbY tRNAs 127

Functions NonstandardBasePairingOften OccursBetween C o d o n sa n d A n t i c o d o n s Amino Acids BecomeActivatedWhen Covalently L i n k e dt o t R N A s

@

StepwiseSynthesisof Proteins on Rabosomes

Machines RibosomesAre Protein-Synthesizing

CONTENTS

127 129 130 131

132 132

XVII

Methionyl-tRNA,tttRecognizes the AUG StartCodon T r a n s l a t i o nI n i t i a t i o nU s u a l l yO c c u r sa t t h e F i r s t A U G f r o m t h e 5 ' E n do f a n m R N A D u r i n gC h a i nE l o n g a t i o nE a c hl n c o m i n g Aminoacyl-tRNAMovesThrough Three RibosomalSites Translationls Terminatedby ReleaseFactors When a Stop Codon ls Reached Polysomesand RapidRibosomeRecyclingIncrease the Efficiencyof Translation

DNAReptication

!f|

133 133

E! 135

166

137

166

138

Segregationof Mutations in BreedingExperiments RevealsTheir Dominanceor Recessivity

167

ConditionalMutations Can Be Usedto Study EssentialGenesin Yeast

EO

139 140

Duplex DNA ls Unwound and Daughter StrandsAre Formedat the DNA ReplicationFork

't41 141 143

Recessive Lethal Mutations in DiploidsCan Be l d e n t i f i e db y I n b r e e d i n ga n d M a i n t a i n e di n Heterozygotes

171 ComplementationTestsDetermineWhether Different 't7 Recessive Mutations Are in the SameGene 1 Double Mutants Are Usefulin Assessing the Order in Which ProteinsFunction 171 GeneticSuppression and SyntheticLethalityCan RevealInteractingor Redundantproteins 173 GenesCan Be ldentified by Their Map position on the Chromosome 174

D N A R e p a i ra n d R e co mb i n a ti o n 145

!!|

p|

DNA Polymerases IntroduceCopyingErrors and Also CorrectThem

145

C h e m i c aal n d R a d i a t i o nD a m a g et o D N A C a n Leadto Mutations

145

H i g h - F i d e l i tD y N A E x c i s i o n - R e p aSiyr s t e m s Recognize a n d R e p a i rD a m a g e B a s eE x c i s i o n R e p a i r sT . G M i s m a t c h eas n d D a m a g e dB a s e s

147

MismatchExcisionRepairsOther Mismatchesand S m a l lI n s e r t i o n a s nd Deletions

147

NucleotideExcisionRepairsChemicalAdducts That Distort Normal DNA Shape Two SystemsUtilize Recombinationto Repair D o u b l e - S t r a nB d r e a k si n D N A H o m o l o g o u sR e c o m b i n a t i oC n a n R e o a i rD N A D a m a g ea n d G e n e r a t eG e n e t i cD i v e r s i t y

s f th e C e l l u l a r @ V i r u s e s : pa ra si te o GeneticSystem Most Viral Host RangesAre Narrow Viral CapsidsAre RegularArraysof One or a Few Typesof protein

147

148 149 150

154

'

CONTENTS

DNACloningand Char acter i z ati on176

RestrictionEnzymesand DNA LigasesAllow Insertionof DNA Fragmentsinto CloningVectors

176

E. coli PlasmidVectorsAre Suitablefor Cloning lsolatedDNA Fragments

178

cDNA LibrariesRepresentthe Sequences of Protein-CodingGenes

179 cDNAsPreparedby ReverseTranscriptionof Cellular mRNAsCan Be Clonedto GeneratecDNA Libraries 1 8 1 DNA LibrariesCan Be Screenedby Hybridization to an Oligonucleotidp erobe 181 YeastGenomicLibrariesCan Be Constructedwith ShuttleVectorsand Screenedby Functionar Complementation 182 Gel Electrophoresis Allows Separationof Vector DNA from Cloned Fragments 184 Cloned DNA MoleculesAre SequencedRapidly by the DideoxyChain-Termination Methoc 187 The PolymeraseChain ReactionAmplifiesa Specific DNA Sequencefrom a ComplexMixture 188

154 154

VirusesCan Be Clonedand Counted in plaqueAssays 1 5 5 LyticViral Growth CyclesLeadto the Death of Host Cells 1 5 5 Viral DNA ls Integrated into the Host-CellGenome in SomeNonlyticViral Growth Cycles 158

XVIII

GeneticAnalysisof Mutationsto ldentifyand StudyGenes

R e c e s s i vaen d D o m i n a n tM u t a n t A l l e l e sG e n e r a l l y HaveOppositeEffectson Gene Function

D N A P o l y m e r a s eR s e q u i r ea p r i m e r t o I n i t i a t e Replication

SeveralProteinsParticipatein DNA Replication D N A R e p l i c a t i o nU s u a l l yO c c u r sB i d i r e c t i o n a l lfyr o m E a c hO r i g i n

5 M O L E C U L AGRE N E T T C E C H N T Q U1E6Ss

ff|

UsingClonedDNA Fragments to Study GeneExpression

191

HybridizationTechniquespermit Detection of SpecificDNA Fragmentsand mRNAs

't91

DNA MicroarraysCan Be Usedto Evaluatethe Expression of Many Genesat One Time

192

ClusterAnalysisof Multiple ExpressionExperiments ldentifies Co-regulatedGenes

193

N o n p r o t e i n - C o d i nG g e n e sE n c o d eF u n c t i o n a l RNAs

SystemsCan ProduceLarge E. coli Expression Quantitiesof Proteinsfrom ClonedGenes VectorsCan Be Designedfor PlasmidExpression U s ei n A n i m a l C e l l s

Or ganization Chr om osomal of Genesand NoncodingDNA

196

222

223

s o n t a i nM u c h G e n o m e so f M a n y O r g a n i s m C N o n f u n c t i o n aD l NA

l d e n t i f y in ga n d L o ca ti n gH u ma n Disease Ge n e s

DNAsAre Concentrated Most Simple-Sequence in SpecificChromosomalLocations

224

199

DNA FingerprintingDependson Differences DNAs in Length of SimPle-Sequence

225

D N A P o l y m o r p h i s mAsr e U s e di n L i n k a g e - M a p p i n g H u m a nM u t a t i o n s

200

SpacerDNA Occupiesa Significant Unclassified Portion of the Genome

225

LinkageStudiesCan Map DiseaseGeneswith a Resolutionof About 1 Centimorgan

201

FurtherAnalysisls Neededto Locatea DiseaseGene i n C l o n e dD N A

202

f[

Show One of Three Major Many InheritedDiseases Patternsof Inheritance

198

]f|

M a n y I n h e r i t e dD i s e a s eRs e s u l ft r o m M u l t i p l eG e n e t i c 203 Defects

ffl

Inactivatingthe Functionof S p e c i f i cGe n e si n E u ka ryo te s

Normal YeastGenesCan Be Replacedwith Mutant A l l e l e sb y H o m o l o g o u sR e c o m b i n a t i o n

204 205

Transcriptionof GenesLigatedto a Regulated PromoterCan Be ControlledExperimentally SpecificGenesCan Be PermanentlyInactivatedin t h e G e r m L i n eo f M i c e

207

SomaticCell RecombinationCan InactivateGenes in SpecificTissues

208

D o m i n a n t - N e g a t i vAel l e l e sC a n F u n c t i o n a l l y l n h i b i t S o m eG e n e s RNA InterferenceCausesGene Inactivationby g RNA D e s t r o y i n gt h e C o r r e s p o n d i nm

6 G E N E SG , E N O M I C SA, N D CHROMOSOMES

][

EukaryoticGeneStructure

(Mobile)DNA Transposable Elem ents

Movement of Mobile ElementsInvolvesa D N A o r a n R N AI n t e r m e d i a t e

226

Are Presentin Prokaryotes DNA Transposons and Eukaryotes

227

BehaveLike Intracellular LTRRetrotransposons Retroviruses Transposeby a Distinct Non-LTRRetrotransposons Mechanism RNAsAre Found in Genomic Other Retrotransposed DNA M o b i l e D N A E l e m e n t sH a v eS i g n i f i c a n t l Iyn f l u e n c e d Evolution

@

215 217

Most EukaryoticGenesContain Intronsand Produce m R N A sE n c o d i n gS i n g l eP r o t e i n s

217

n nits S i m p l ea n d C o m p l e xT r a n s c r i p t i oU A r e F o u n di n E u k a r y o t i cG e n o m e s

217

P r o t e i n - C o d i nG g e n e sM a y B e S o l i t a r yo r B e l o n g t o a G e n eF a m i l y

219

HeavilyUsedGene ProductsAre Encodedby Multiple 221 Copiesof Genes

229 230 234 234

236

or ganelleDNAs

M i t o c h o n d r i aC o n t a i nM u l t i p l e m t D N A M o l e c u l e s

210

226

mtDNA ls InheritedCytoplasmically The Size,Structure,and Coding Capacityof mtDNA Vary ConsiderablyBetweenOrganisms Productsof MitochondrialGenesAre Not Exported M i t o c h o n d r i aE v o l v e df r o m a S i n g l eE n d o s y m b i o t i c Bacterium EventInvolvinga Rickettsia-like

237 237 238 240

240

MitochondrialGeneticCodesDiffer from the StandardNuclearCode

240

Mutations in MitochondrialDNA CauseSeveral G e n e t i cD i s e a s eisn H u m a n s ChloroplastsContain LargeDNAsOften Encoding M o r e T h a n a H u n d r e dP r o t e i n s

242

Anal Ys i s Genome- wide Genom ics: of GeneStructureand Expression 243 SuggestFunctionsof Newly StoredSequences ldentified Genesand Proteins

CONTENTS

243

xtx

Comparisonof RelatedSequences from Different SpeciesCan Give Cluesto Evolutionary Relationships Among proteins G e n e sC a n B e l d e n t i f i e dW i t h i n G e n o m i cD N A Sequences

244

S m a l lM o l e c u l e sR e g u l a t eE x p r e s s i oonf M a n y BacterialGenesvia DNA-BindingRepressors and Activators

273

244

TranscriptionInitiation from Some Promoters RequiresAlternativeSigmaFactors

273

Transcriptionby osa-RNAPolymerasels Controlled by ActivatorsThat Bind Farfrom the Promoter

274

Many BacterialResponses Are Controlledby Two-ComponentRegulatorySystems

275

T h e N u m b e ro f P r o t e i n - C o d i nG g e n e si n a n Organism'G s e n o m el s N o t D i r e c t l yR e l a t e d to lts BiologicalComplexity S i n g l eN u c l e o t i d eP o l y m o r p h i s masn d G e n eC o p y Number VariationAre lmportant Determinants of DifferencesBetween Individualsof a Species

246

@ St r u c t u r alOrg a n i za ti o n of EukaryoticChromosomes

][

ChromatinExistsin Extendedand CondensedForms Modificationsof HistoneTailsControl Chromatin Condensationand Function NonhistoneProteinsProvidea StructuralScaffold for Long ChromatinLoops A d d i t i o n a lN o n h i s t o n ep r o t e i n sR e g u l a t e Transcriptionand Replication

247 248

276

250

Three EukaryoticPolymerases CatalyzeFormation of Different RNAs

278

254

The LargestSubunit in RNA Polymerasell Hasan EssentialCarboxyl-Terminal Repeat

2s6

ChromosomeNumber;Size,and Shapeat Metaphase Are Species-Specific 257 During Metaphase,ChromosomesCan Be D i s t i n g u i s h ebdy B a n d i n gp a t t e r n sa n d C h r o m o s o m eP a i n t i n g 25g C h r o m o s o m eP a i n t i n ga n d D N A S e q u e n c i n g Reveal the Evolutionof Chromosomes 259 InterphasePolyteneChromosomesArise by DNA A m p l i fi c a t i o n 260 Three FunctionalElementsAre Requiredfor Replication a n d S t a b l eI n h e r i t a n c eo f C h r o m o s o m e s 261 CentromereSequences Vary Greatlyin Length 263 Addition of TelomericSequencesby Telomerase PreventsShorteningof Chromosomes

263

7 TRANSCRIPTIONALCONTROL O F G E N EE X P R E S S I O N 269 Controlof GeneExpression in Bacteria

W

271

TranscriptionInitiation by BacterialRNA polymerase RequiresAssociationwith a SigmaFactor 271 Initiation of /ac Operon TranscriptionCan Be Repressed and Activated 271

XX

O

CONTENTS

276

RegulatoryElementsin EukaryoticDNA Are Found Both Closeto and Many KilobasesAway from TranscriptionStart Sites

M o r p h o l og ya n d F u n cti o n aEl l e m ents o f E u k a r y o ti C c h ro mo so me s 257

@

overview of EukaryoticGene Controland RNAPolymerases

279 RNA Polymerasell InitiatesTranscriptionat DNA SequencesCorrespondingto the 5' Cap of mRNAs 280

E

Regulator ysequences in pr ote i nCodingGenes 282

The TATABox, Initiators,and CpG lslandsFunction as Promotersin EukaryoticDNA

282

Promoter-Proximal ElementsHelp Regulate EukaryoticGenes

282

Distant EnhancersOften Stimu late Transcription by RNA Polymerasell

284

Most EukaryoticGenesAre Regulatedby Multiple Transcription-Control Elements

s @Activator s and Repr essorof Transcription

286

Footprintingand Gel-ShiftAssaysDetect protein-DNA Interactions 286 ActivatorsAre Modular ProteinsComposed of DistinctFunctionalDomainsand promote Transcription 288 Repressors Inhibit Transcriptionand Are the FunctionalConverseof Activators

290

D N A - B i n d i n gD o m a i n sC a n B e C l a s s i f i eidn t o NumerousStructuralTypes

290

StructurallyDiverseActivation and Repression DomainsRegulateTranscription

293

TranscriptionFactorInteractionsIncrease Gene-ControlOptions

294

M u l t i p r o t e i nC o m p l e x e F s o r mo n E n h a n c e r s

295

TranscriptionInitiation by RNA Polymerasell GeneralTranscriptionFactorsPositionRNA Polymerasell at Start Sitesand Assistin Initiation

296

@

GENE 8 POST- TRANSCRIPTIONAL CONTROL

Formationof HeterochromatinSilencesGene at Telomeres,Near Centromeres, Expression and in Other Regions

299

Can Direct HistoneDeacetylationand Repressors Methylation at SpecificGenes

303

ActivatorsCan Direct HistoneAcetylationand Methylation at SpecificGenes

305

FactorsHelp Activate or Chromatin-Remodeling RepressTranscription

306

HistoneModificationsVary Greatlyin Their Stabilities 307 307

Transcriptionof Many GenesRequiresOrdered Binding 308 and Functionof Activatorsand Co-activators The YeastTwo-HybridSystemExploitsActivator Flexibility to DetectcDNAsThat EncodeInteractingProteins 310

E

312

ResponseElementsContain Inverted Nuclear-Receptor 313 or Direct Repeats Hormone Bindingto a NuclearReceptorRegulateslts 313 Activity as a TranscriptionFactor

![

RegulatedElongationand Terminationof Transcription

314

Transcriptionof the HIV Genome ls Regulatedby an Antitermination Mechanism

315

Pausingof RNA Polymerasell Promoter-Proximal Occursin Some RapidlyInducedGenes

316

@

f[

other EukaryoticTranscription Systems

TranscriptionInitiation by Pol I and Pol lll ls Analogousto That by Pol ll

315 316

of EukaryoticPre-mRNA325 Processing

The 5' Cap ls Added to NascentRNAsShortlyAfter TranscriptionInitiation

325

A DiverseSet of Proteinswith ConservedRNA-B|nding 326 DomainsAssociatewith Pre-mRNAs SplicingOccursat Short,ConservedSequencesin Pre-mRNAsvia Two TransesterificationReactions

329 330

with Pre-mRNA During Splicing,snRNAsBase-Pair Assembledfrom snRNPsand a Spliceosomes, Pre-mRNA,CarryOut SPlicing

330

C h a i nE l o n g a t i o nb y R N AP o l y m e r a slel l s C o u p l e d Factors to the Presenceof RNA-Processing

333

SRProteinsContributeto Exon Definition in Long Pre-mRNAs Group ll Introns ProvideCluesto the Self-Splicing Evolutionof snRNAs

334

3' Cleavageand Polyadenylationof Pre-mRNAs 335 Are Tightly CouPled DegradeRNAThat ls Processed NuclearExonucleases 336 Out of Pre-mRNAs

Regulationof Transcription-Factor 311 Activity

All NuclearReceptorsSharea Common Domain Structure

323

298

o f T ra n sc r iption M o l e c u l a Me r ch a n i sms 299 and Activation Repression

The Mediator ComplexFormsa MolecularBridge BetweenActivation Domainsand Pol ll

317

296

SequentialAssemblyof ProteinsFormsthe Pol ll TranscriptionPreinitiationComplexin Vitro In Vivo TranscriptionInitiation by Pol ll Requires Additional Proteins

Mitochondrialand ChloroplastDNAsAre RNA Transcribedby Organelle-Specific Polymerases

Regulation of Pre-mRNA Processing

337

AlternativeSplicingls the PrimaryMechanismfor RegulatingmRNA Processing

337

A Cascadeof RegulatedRNA SplicingControls DrosophilaSexualDifferentiation

338

and ActivatorsControl Splicing SplicingRepressors at AlternativeSites

339

of RNA Editing Alters the Sequences SomePre-mRNAs

340

]f|

Transportof mRNAAcrossthe NuclearEnveloPe

341

NuclearPore ComplexesControl lmport and Export 342 from the Nucleus Are Not Exportedfrom in Spliceosomes Pre-mRNAs 345 the Nucleus HIV Rev Protein Regulatesthe Transportof Unspliced 346 Viral mRNAs

CONTENTS

'

xxi

CytoplasmicMechanisms of posttranscriptionalControl 347

f!|

Micro RNAsRepressTranslationof SpecificmRNAs RNA InterferenceInducesDegradationof precisely ComplementarymRNAs CytoplasmicPolyadenylationpromotesTranslation of SomemRNAs

Localizationof mRNAsPermitsProductionof Proteinsat SpecificRegionsWithin the Cytoplasm

357

347

Processing of rRNAand IRNA

358

349

f[

351

Pre-rRNAGenesFunctionas NucleolarOrganizers a n d A r e S i m i l a ri n A l l E u k a r y o t e s

359

Small NucleolarRNAsAssistin Processing Pre-rRNAs

360 363

Degradationof mRNAsin the CytoplasmOccurs by SeveralMechanisms

352

ProteinSynthesisCan Be GloballyRegulated

353

Self-Splicing Group I IntronsWere the First Examplesof CatalyticRNA

356

Pre-tRNAsUndergo ExtensiveModification in the Nucleus

363

357

N u c l e a rB o d i e sA r e F u n c t i o n a l lS y p e c i a l i z eN d uclear Domains

3G4

Sequence-Specific RNA-BindingproteinsControl SpecificmRNATranslation SurveillanceMechanismspreventTranslationof lmproperlyProcessed mRNAs

Partlll CellStructureand Function 9 V I S U A L I Z IN G, F R A C T ION A T IN G, A N D C U L T U R I NC GE L L S 371 Organellesof the EukaryoticCell

lll

372

Phase-Contrast and DifferentiallnterferenceContrast MicroscopyVisualizeUnstainedLivingCells 381 Fluorescence MicroscopyCan Localizeand euantify S p e c i f i cM o l e c u l e si n L i v eC e l l s 382 l m a g i n gS u b c e l l u l aDr e t a i l sO f t e n R e q u i r e tsh a t t h e SamplesBe Fixed,Sectioned,and Stained

T h e P l a s m aM e m b r a n eH a sM a n y C o m m o nF u n c t i o n s in All Cells 372 EndosomesTake Up 5oluble Macromolecules from the Cell Exterior 372

lmmunofluorescence MicroscopyCan Detect Specific Proteinsin FixedCells

38s

Confocaland DeconvolutionMicroscopyEnable Visualizationof Three-Dimensional Objects

386

Lysosomes Are Acidic OrganellesThat Contain a Batteryof DegradativeEnzymes

Graphicsand lnformaticsHaveTransformed Modern Microscopy

373

Peroxisomes DegradeFattyAcidsand ToxicCompounds 374 The EndoplasmicReticulumls a Network of InterconnectedInternal Membranes 375 The Golgi ComplexProcesses and SortsSecreted a n d M e m b r a n ep r o t e i n s

376

P l a n tV a c u o l e sS t o r eS m a l lM o l e c u l e sa n d E n a b l ea C e l lt o E l o n g a t eR a p i d l y

Eil

ElectronMicroscopy: Methods and Applications

388

Resolutionof Transmission ElectronMicroscopyis VastlyGreaterThan That of Light Microscopy

3gg

377

T h e N u c l e u sC o n t a i n st h e D N A G e n o m e ,R N A SyntheticApparatus,and a FibrousMatrix

CryoelectronMicroscopyAllows Visualizationof ParticlesWithout Fixationor Staining

399

378

MitochondriaAre the PrincipalSitesof ATp Productionin Aerobic NonphotosyntheticCells

378

ElectronMicroscopyof Metal-CoatedSpecimens Can RevealSurfaceFeaturesof Cellsand Their Components

390

ChloroplastsContain Internal Compartmentsin Which Photosynthesis Takesplace

379

!!| g

L i g h t M i cro sco p y: vi su a l i zi n gC ell Structureand Localizingproteins W i t h i n C el l s 380

The Resolutionof the Light Microscopels About 0.2 pm

xxii

.

coNTENrs

381

Purificationof Cell Organelles

391

Disruptionof CellsReleases Their Organelles and Other Contents

391

CentrifugationCan SeparateMany Typesof Organelles

392

Organelle-Specific AntibodiesAre Usefulin P r e p a r i n gH i g h l yP u r i f i e dO r g a n e l l e s

393

l s o l a t i o nC , u l tu re a , n d Differentiation 394 of MetazoanCells Flow CytometrySeparatesDifferent CellTypes

394

C u l t u r eo f A n i m a l C e l l sR e q u i r e sN u t r i e n t - R i c h M e d i a a n d S p e c i aSl o l i dS u r f a c e s

395

P r i m a r yC e l lC u l t u r e sC a n B e U s e dt o S t u d yC e l l Differentiation

396

P r i m a r yC e l lC u l t u r e sa n d C e l lS t r a i n sH a v ea F i n i t e L i f eS p a n

396

TransformedCellsCan Grow Indefinitelyin Culture

397

SomeCell LinesUndergo Differentiationin Culture

398

H y b r i dC e l l sC a l l e dH y b r i d o m a sP r o d u c eA b u n d a n t M o n o c l o n aA l ntibodies

400

HATMedium ls CommonlvUsedto lsolate HybridCells

402

organelles 407 Cnsstc ExprRturrur9.1 separating

ET R U C T U R E 1 O B I O M E M B R A NS s[

409

B i o m e mb ra n e L s:i p i dC o mp o sition 411 a n i za ti o n a n d S t r u ctu raOrg l

P h o s p h o l i p i dSsp o n t a n e o u s lFyo r mB i l a y e r s

411

B i l a y e r sF o r ma S e a l e dC o m p a r t m e n t Phospholipid S u r r o u n d i n ga n I n t e r n a lA q u e o u sS p a c e

411

M o t i f s H e l pT a r g e tP e r i p h e r a l Lipid-Binding Proteinsto the Membrane

427

ProteinsCan Be Removedfrom Membranes by Detergentsor High-SaltSolutions

427

$f,

sphingolipids, Phospholipids, SYnthesis andCholesterol: Movement and Intracellular

429

Fatty AcidsSynthesisls Mediated by Several lmportant Enzymes

430

SmallCytosolicProteinsFacilitateMovement of FattyAcids Incorporationof Fatty Acids into Membrane Lipids TakesPlaceon OrganelleMembranes

430 431

F l i p p a s eM s o v e P h o s p h o l i p i df sr o m O n e M e m b r a n e Leafletto the OppositeLeaflet

431

Cholesterolls Synthesizedby Enzymesin the Cytosol and ERMembrane

432

Cholesterola nd Phospholi pids Are Transported BetweenOrganellesby SeveralMechanisms

433

1 1 T R A N S M E M B R A NTER A N S P O R T OF IONSAND SMALLM OLECU LES437

E

overview of Membrane Transport

l lasses B i o m e m b r a n eC s o n t a i nT h r e eP r i n c i p aC of Lipids

415

M o s t L i p i d sa n d M a n y P r o t e i n sA r e L a t e r a l l yM o b i l e in Biomembranes

416

O n l y S m a l lH y d r o p h o b i cM o l e c u l e sC r o s sM e m b r a n e s 438 b y S i m p l eD i f f u s i o n

L i p i dC o m p o s i t i o nI n f l u e n c etsh e P h y s i c a l Propertiesof Membranes

418

Membrane ProteinsMediate Transportof Most Moleculesand All lons Across Biomembranes

Lipid Compositionls Different in the Exoplasmic and CytosolicLeaflets

419

s l u s t e rw i t h S p e c i f i c C h o l e s t e r oal n d S p h i n g o l i p i dC P r o t e i n si n M e m b r a n eM i c r o d o m a i n s

420

ProteinComponents Biomembranes: 421 and BasicFunctions

@

438

439

uniport Transportof Glucose and Water

441

Most TransmembraneProteinsHave M e m b r a n e - S p a n n i nagH e l i c e s

SeveralFeaturesDistinguishUniport Transportfrom S i m p l eD i f f u s i o n GLUT1UniporterTransportsGlucoseinto Most M a m m a l i a nC e l l s s F a m i l yo f S u g a r T h e H u m a nG e n o m eE n c o d e a TransportingGLUTProtetns

M u l t i p l e B S t r a n d si n P o r i n sF o r m M e m b r a n e - S p a n n i n"gB a r r e l s "

424

TransportProteinsCan Be EnrichedWithin Artificial M e m b r a n e sa n d C e l l s

CovalentlyAttached HydrocarbonChainsAnchor Some Proteinsto Membranes

424

$[|

ProteinsInteractwith Membranesin Three Different Ways

s re A l l T r a n s m e m b r a nPer o t e i n sa n d G l y c o l i p i dA A s y m m e t r i c a l lO y r i e n t e di n t h e B i l a y e r

421

OsmoticPressureCausesWater to Move Across Membranes AquaporinsIncreasethe Water Permeabilityof Cell Membranes

CONTENTS

O

44'l 442 443 443 4M 4M

xxiii

pumpsand the ATP-powered I n t r a c el l u l al ro n i cE n vi ro n me nt 447

@

Different Classes of PumpsExhibitCharacteristic Structuraland Functionalproperties ATP-Poweredlon PumpsGenerateand M a i n t a i nl o n i cG r a d i e n t sA c r o s sC e l l u l a r Membranes MuscleRelaxationDependson Ca2*ATpases That Pump Ca" from the Cytosolinto the S a r c o p l a s mR i ce t i c u i u m CalmodulinRegulates the plasmaMembrane Ca'* PumpsThat Control CytosolicCa2+ Concentrations N a - / K - A T P a s eM a i n t a i n st h e I n t r a c e l l u l aN r a* a n d K * C o n c e n t r a t i o nisn A n i m a l C e l l s V-ClassH* ATPases Maintain the Acidity of Lysosomes and Vacuoles BacterialPermeases Are ABC proteinsThat lmport a Variety of Nutrientsfrom the Environment

N o n g a te dto n C h a n n e l a s n d th e potential RestingMembrane

SelectiveMovement of lons Createsa TransmembraneElectricpotential Difference T h e M e m b r a n eP o t e n t i a li n A n i m a l C e l l sD e p e n d s Largelyon Potassiumlon MovementsThrough O p e n R e s t i n gK + C h a n n e l s

467

Na*-LinkedCa2*Antiporter ExportsCa2* from C a r d i a cM u s c l eC e l l s 447

448

449

451 452 453

454

The Approximately50 MammalianABCTransporters PlayDiverseand lmportant Rolesin Cell and O r g a nP h y s i o l o g y 455 C e r t a i nA B CP r o t e i n s" F l i p ' ,p h o s p h o l i p i d s and Other Lipid-SolubleSubstratesfrom One Membrane Leafletto the Opposite Leaflet 456

El

BacterialSymporterStructureRevealsthe Mechanismof SubstrateBinding

SeveralCotransportersRegulate CytosolicpH

468

A PutativeCation ExchangeProtein Playsa K e y R o l ei n E v o l u t i o no f H u m a nS k i n Pigmentation

469

NumerousTransportProteinsEnablePlant Vacuolesto AccumulateMetabolitesand lons

469

ft|

Transeprrnerar Transporr

Multiple TransportProteinsAre Neededto Move Glucoseand Amino AcidsAcross Epithelia

471

SimpleRehydrationTherapyDependson the OsmoticGradientCreatedby Absorption o f G l u c o s ea n d N a +

411

ParietalCellsAcidify the StomachContentsWhile M a i n t a i n i n ga N e u t r a lC y t o s o l i cp H

472

Cusslc ExprntueruT 11.1 stumbting Upon ActiveTransport

477

12 CELLULAR ENERGETICS 458

@ 458

470

FirstStepsof Glucoseand Fatty Acid CatabolismGlycolysis : and the CitricAcid €ycle

479

480

(Stagel), CytosolicEnzymes During Glycolysis ConvertGlucoseto Pyruvate

481

460

lon ChannelsContain a SelectivityFilter Formed from ConservedTransmembraneSegments

The Rate of Glycolysis ls Adjustedto Meet the Cell'sNeed for ATP

483

461

Glucosels FermentedUnder AnaerobicConditions

PatchClampsPermit Measurementof lon M o v e m e n t sT h r o u g hS i n g l eC h a n n e l s

485

463

U n d e r A e r o b i cC o n d i t i o n s ,M i t o c h o n d r i a E f fi c i e n t l yO x i d i z eP y r u v a t ea n d G e n e r a t e ATP (Stagesll-lV)

485

464

MitochondriaAre DynamicOrganelleswith Two Structurallyand FunctionallyDistinctMembranes

485

464

In Stagell, Pyruvatels Oxidizedto CO2and HighEnergyElectronsStored in ReducedCoenzymes

487

Novel lon ChannelsCan Be Characterizedby a Combinationof Oocyte Expression and P a t c hC l a m p i n g N a - E n t r yi n t o M a m m a l i a nC e l l sH a sa N e g a t i v e Changein FreeEnergy(AG)

Cotransportby symportersand Antiporters

@|

N a * - L i n k e dS y m p o r t e r lsm p o r t A m i n o A c i d sa n d G l u c o s ei n t o A n i m a l C e l l sA g a i n s tH i g h ConcentrationGradients

xxiv

.

coNTENTs

465

466

Transportersin the Inner MitochondrialMembrane H e l p M a i n t a i nA p p r o p r i a t eC y t o s o l i a c nd Matrix Concentrationsof NAD* and NADH MitochondrialOxidation of Fatty AcidsGenerates ATP PeroxisomalOxidation of Fatty AcidsGenerates No ATP

491

@ Th e

El e ctro nT ra n sp o rtch a i n a n d Generationof the Proton-Motive 493 Force

the StepwiseElectronTransportEfficientlyReleases EnergyStored in NADH and FADH2

493

ElectronTransportin Mitochondria ls Coupledto P r o t o nP u m p i n g

493

ElectronsFlow from FADH2and NADHto 02 Through Four Multiprotein Complexes

PhotoelectronTransportfrom EnergizedReactionCenterChlorophylla Producesa Charge Separation

514

I n t e r n a lA n t e n n a a n d L i g h t - H a r v e s t i n g C o m p l e x e sI n c r e a s et h e E f f i c i e n c yo f Photosynthesis

515

494

MolecularAnalysisof Photosystems

517

ReductionPotentialsof ElectronCarriersFavor ElectronFlow from NADH to 02

499

The SinglePhotosystemof PurpleBacteria Generatesa Proton-MotiveForcebut No 02

517

ExperimentsUsing PurifiedComplexesEstablished the Stoichiometryof Proton Pumping

499

The Q CycleIncreases the Numberof Protons Translocated as ElectronsFlow Through C o m p l e xl l l

LinearElectronFlow Through Both Plant Photosystems, PSlland PSl,Generatesa Proton-MotiveForce, 519 02, and NADPH

500

A n O x y g e n - E v o l v i nC g o m p l e xl s L o c a t e do n t h e L u m i n a lS u r f a c eo f t h e P S l lR e a c t i o n Center

520

CellsUse Multiple Mechanismsto ProtectAgainst Damagefrom ReactiveOxygenSpeciesDuring PhotoelectronTransPort

521

CyclicElectronFlow Through PSIGeneratesa Proton-MotiveForcebut No NADPHor 02

522

I and ll Are RelativeActivitiesof Photosystems Regulated

523

The Proton-MotiveForcein Mitochondria ls Due Largelyto a Voltage GradientAcrossthe Inner Membrane ToxicBy-productsof ElectronTransportCan D a m a g eC e l l s

[[

Harnessingthe Proton-Motive F o r c ef o r E n e rg y-R e q u i ri n g Processes

502 502

503

[[l

The Mechanismof ATPSynthesisls Shared Among Bacteria,Mitochondria,and Chloroplasts

505

ATPSynthaseComprisesTwo Multiprotein ComplexesTermedFeand F1

505

During co2 Metabolism Photosynthesis

524

RubiscoFixesCO2in the ChloroplastStroma

525

Synthesisof SucroseUsing FixedCO2ls Completed in the Cytosol

525

506

Light and RubiscoActivaseStimulateCO2 Fixation

525

ATP-ADPExchangeAcrossthe Inner Mitochondrial Membrane ls Poweredby the Proton-Motive Force

s09

Which Competeswith Photorespiration, ls Reducedin PlantsThat Fix Photosynthesis, CO2by the C4PathwaY

527

R a t eo f M i t o c h o n d r i aO l x i d a t i o nN o r m a l l yD e p e n d s on ADP Levels

510

Brown-FatMitochondria Usethe Proton-Motive Forceto GenerateHeat

510

Rotation of the Ft 1 Subunit,Driven by Proton Movement Through F6,Powers ATPSynthesis

@

1 3 M O V I N GP R O T E I NISN T O A N D O R G A N E L L E Ss33 MEMBRANES

Ph o t o s yn th e siasn d L i g h t-A b sor bing Pigments

ThylakoidMembranesin ChloroplastsAre the Sites in Plants of Photosynthesis

511 511

Occur Three of the Four Stagesin Photosynthesis O n l y D u r i n gl l l u m i n a t i o n

511

EachPhoton of Light Hasa DefinedAmount of Energy

513

Comprisea ReactionCenterand Photosystems Complexes AssociatedLight-Harvesting

514

$[

of secretoryProteins Translocation 535 Acr ossthe ERMembr ane

A HydrophobicN-TerminalSignalSequenceTargets NascentSecretoryProteinsto the ER

536

CotranslationalTranslocationls lnitiated by Two Proteins GTP-Hydrolyzing

537

Passageof Growing PolypeptidesThrough the Transloconls Driven by EnergyReleasedDuring Translation

539

CONTENTS

.

XXV

ATPHydrolysisPowersPost-translational Translocationof SomeSecretoryProteinsin yeast

Insertionof proteinsinto the E RM e mb ra n e

$[

540

542

543 InternalStop-Transfer and Signal-AnchorSequences proteins DetermineTopologyof Single-Pass 544 M u l t i p a s sP r o t e i n sH a v eM u l t i p l e I n t e r n a l TopogenicSequences 546 A P h o s p h o l i p iA d n c h o rT e t h e r sS o m eC e l l - S u r f a c e Proteinsto the Membrane 547 The Topologyof a Membrane ProteinOften Can Be Deducedfrom lts Sequence 547

A Preformed/V-LinkedOligosaccharide ls Added to M a n y P r o t e i n si n t h e R o u g hE R O l i g o s a c c h a r i dSei d eC h a i n sM a y p r o m o t eF o l d i n g and Stabilityof Glycoproteins D i s u l f i d eB o n d sA r e F o r m e da n d R e a r r a n g e db y P r o t e i n si n t h e E RL u m e n C h a p e r o n eas n d O t h e r E Rp r o t e i n sF a c i l i t a t eF o l d i n g and Assemblyof Proteins lmproperlyFoldedProteinsin the ERlnduce Expression of Protein-FoldingCatalysts U n a s s e m b l eodr M i s f o l d e dP r o t e i n si n t h e E RA r e Often Transportedto the Cytosolfor Degradation

550

ss2

coNTENTs

569

Largeand Small MoleculesEnter and Leavethe Nucleusvia NuclearPoreComplexes

570

lmportinsTransportProteinsContainingNuclearL o c a l i z a t i oS n i g n a l si n t o t h e N u c l e u s

571

ExportinsTransportProteinsContainingNuclear-Export S i g n a l so u t o f t h e N u c l e u s 573 573

1 4 V E S I C U L ATRR A F F I CS, E C R E T I O N , AND ENDOCYTOSIS 579 Techniques for Studyingthe SecretoryPathway

s80

Transportof a protein Through the Secretory pathway Can Be Assayedin tiving Cells

5g2

YeastMutants Define Major Stagesand Many Componentsin VesicularTransport

584

Cell-FreeTransportAssaysAllow Dissectionof I n d i v i d u aS l t e p si n V e s i c u l aTr r a n s p o r t

585

![ ss2 555

556

and Chloroplasts

.

Transportinto and out of the Nucleus

s[

552

A m p h i p a t h i cN - T e r m i n aSl i g n a lS e q u e n c eD sirect Proteinsto the MitochondrialMatrix 558 M i t o c h o n d r i aP l r o t e i nl m p o r t R e q u i r e sO u t e r - M e m b r a n e R e c e p t o ras n d T r a n s l o c o ni sn B o t h M e m b r a n e s 559 Studieswith ChimericProteinsDemonstratelmportant Featuresof Mitochondriallmport 550 T h r e eE n e r g yI n p u t sA r e N e e d e dt o l m p o r t P r o t e i n s into Mitochondria 501 Multiple Signalsand PathwaysTarget Proteinsto SubmitochondrialCompartments 561 T a r g e t i n go f C h l o r o p l a sSt t r o m a lP r o t e i n sl s S i m i l a rt o lmport of MitochondrialMatrix Proteins 565 ProteinsAre Targetedto Thylakoidsby Mechanisms Relatedto TranslocationAcrossthe Bacterial I n n e rM e m b r a n e 565 xxvi

s68

549

Sortingof Proteinsto Mitochondria 557

E!|

P e r o x i s o m aM l e m b r a n ea n d M a t r i x P r o t e i n sA r e Incorporated by Different Pathways

Most mRNAsAre Exportedfrom the Nucleusby a R a n - l n d e p e n d e nMt e c h a n i s m

Pr o t e i nMo d i fi ca ti o n s, F o l d i n g, and Quality Control in the ER

Sortingof Peroxisomal Proteins sG7

CytosolicReceptorTargetsProteinswith an SKL Sequenceat the C-Terminusinto the Peroxisomal Matrix

SeveralTopologicalClasses of Integral Membrane ProteinsAre Synthesizedon the ER

s[

s[

@

M olecularMechanisms of Vesicular Traffic

Assembryof a protein coat DrivesVesicle F o r m a t i o na n d S e l e c t i o no f C a r g o Molecules A ConservedSet of GTPaseSwitch proteinsControls Assemblyof Different VesicleCoats T a r g e t i n gS e q u e n c e os n C a r g o p r o t e i n sM a k e S p e c i f i cM o l e c u l a rC o n t a c t sw i t h C o a t Proteins

585

5g6 5g7

588

Rab GTPases Control Dockingof Vesicleson Target Membranes PairedSetsof SNAREproteinsMediate Fusionof Vesicleswith Target Membranes

591

Dissociationof SNAREComplexesAfter Membrane F u s i o nl s D r i v e nb y A T PH y d r o l y s i s

5g1

589

@

EarlyStagesof the Secretory Pathway

592

COPIIVesiclesMediate Transportfrom the ER to the Golgi COPIVesiclesMediate RetrogradeTransportwithin t h e G o l g ia n d f r o m t h e G o l g i t o t h e E R

ss4

AnterogradeTransportThrough the Golgi Occurs by CisternalMaturation

595

@

Later stages of the secretory Pathway

597

VesiclesCoatedwith Clathrinand/or Adapter Proteins 598 Mediate SeveralTransportSteps

l: SIGNAL 1 5 C E L LS I G N A L I N G AND SHORT- T ER M TRANSDUCTION 623 RESPONSES CELLULAR [[

Signalto cellular FromExtracellular 625 Response

Signaling S i g n a l i n gC e l l sP r o d u c ea n d R e l e a s e Molecules

625

SignalingMoleculesCan Act Locallyor at a Distance

625

B i n d i n go f S i g n a l i n gM o l e c u l e sA c t i v a t e s Receptorson Target Cells

626

D y n a m i nl s R e q u i r e df o r P i n c h i n gO f f o f C l a t h r i n Vesicles

599

$[

Mannose6-PhosphateResiduesTargetSoluble Proteinsto Lysosomes

600

ReceptorProteinsBind LigandsSpecifically

627

RevealedKey Study of LysosomalStorageDiseases Componentsof the LysosomalSorting Pathway

602

The DissociationConstantls a Measureof the Affinity of a Receptorfor lts Ligand

628

ProteinAggregation in the trans-GolgiMay Function in Sorting Proteinsto RegulatedSecretoryVesicles 602

BindingAssaysAre Usedto Detect Receptorsand DetermineTheir Affinities for Ligands

628

Some ProteinsUndergo ProteolyticProcessing After Leavingthe trans-Golgi

603

SeveralPathwaysSort Membrane Proteinsto the Apical or BasolateralRegionof PolarizedCells

to a SignalingMolecule MaximalCellularResponse UsuallyDoesNot RequireActivationof All Receptors

629

604

Sensitivityof a Cellto ExternalSignalsls Determined by the Number of SurfaceReceptorsand Their 631 Affinity for Ligand

Receptor-Mediated Endocytosis 606

631 ReceptorsCan Be Purifiedby Affinity Techniques ReceptorsAre FrequentlyExpressedfrom Cloned Genes 6 3 1

!f|

CellsTake Up Lipidsfrom the Blood in the Form of Large,Well-Defined LipoproteinComplexes

608

The Acidic pH of Late EndosomesCausesMost Receptor-Ligand Complexesto Dissociate

610

[!|

DirectingMembraneProteins and CytosolicMaterialsto the Lysosome

MultivesicularEndosomesSegregateMembrane ProteinsDestinedfor the Lysosomal Membranefrom ProteinsDestinedfor LysosomalDegradation

627

606

Receptorsfor Low-DensityLipoproteinand Other LigandsContain Sorting SignalsThat Target Them for Endocytosis

The EndocyticPathwayDeliverslron to Cellswithout Complex Dissociationof the Receptor-Transferrin in Endosomes

studying cell-Surface Receptors

611

Highly ConservedComPonents Signal-Transduction of Intracellular 632 Pathways GTP-BindingProteinsAre FrequentlyUsedAs On/Off Switches are Employedin Protein Kinasesand Phosphatases Virtually All SignalingPathways Carryand Amplify Signalsfrom SecondMessengers Many Receptors

612

612

RetrovirusesBud from the PlasmaMembrane by a Process Endosomes 614 Similarto Formationof Multivesicular

14.1 Following a Protein Cnsstc ExprRturruT 621 out of thecell

s!|

633 634 634

of G ProteinGeneralElements 535 SYstems RecePtor Coupled

G Protein-CoupledReceptorsAre a Largeand Diverse 635 Familywith a Common Structureand Function G Protein-CoupledReceptorsActivate Exchangeof G T Pf o r G D Po n t h e a S u b u n i to f a T r i m e r i cG 637 Protein Different G ProteinsAre Activated by Different GPCRs 539 and ln Turn RegulateDifferent EffectorProteins

CONTENTS

.

xxvii

G Protein-Coupled Receptors T h a t R eg u l a tel o n C h a n n e l s

640

AcetylcholineReceptorsin the Heart Muscle Activate a G ProteinThat OpensK+ Channels

641

Light ActivatesG..-CoupledRhodopsins

641

Activationof RhodopsinInducesClosingof cGMP-GatedCation Channels

642

[f|

Rod CellsAdapt to Varying Levelsof Ambient Light Becauseof Opsin Phosphorylationand Binding of Arrestin

644

G Protein-GoupledReceptorsThat Activateor Inhibit Adenylyl Cyclase 646

$!|

Adenylyl Cyclasels Stimulatedand Inhibited by Different Receptor-Ligand Complexes

646

StructuralStudiesEstablishedHow G,,.GTpBinds to and ActivatesAdenylyl Cyclase

646

cAMP ActivatesProtein KinaseA by Releasing CatalyticSubunits

547

GlycogenMetabolismls Regulatedby Hormone-lnducedActivation of Protein KinaseA

648

cAMP-MediatedActivation of Protein KinaseA ProducesDiverseResponses in Different Cell Types

649

S i g n a lA m p l i f i c a t i o nC o m m o n l yO c c u r si n M a n y SignalingPathways

550

S e v e r aM l e c h a n i s mD s o w n - R e g u l a tS e ignaling from G Protein-CoupledReceptors

651

Anchoring ProteinsLocalizeEffectsof cAMp to SpecificRegionsof the Cell

ActivatePhospholipase C

PhosphorylatedDerivativesof InositolAre lmportant SecondMessengers C a l c i u ml o n R e l e a s e from the Endoplasmic Reticulumis Triggeredby lp3 The Ca2*/Calmodulin ComplexMediatesMany CellularResponses to ExternalSignals Diacylglycerol(DAG)Activatesprotein KinaseC, Which RegulatesMany Other proteins Signal-lnducedRelaxationof VascularSmooth Musclels Mediated by cGMp-Activated Protein KinaseG

Clnsstc ExprnlveruT 15.1 TheInfancy of signal Transduction-GTPStimulationof cAMP Synthesis 663

15 CELL-SIGNALIN l lG : SIGNALING PATHWAYSTHAT C O N T R O L GENE ACTIVITY 66s

sl|

IntegratingResponses of cells t o En v i ro n me n taInl fl u e n ce s

'

CONTENTS

668 668

RadioactiveTaggingWas Usedto ldentify TGFp Receptors

669

ActivatedTGFBReceptorsPhosphorylateSmad TranscriptionFactors

670

NegativeFeedbackLoopsRegulateTGFB/Smad Signaling

671

Lossof TGFBSignalingPlaysa Key Role in Cancer

671

sf|

cytokineReceptors andthe JAK/STAT Pathway

672 672

CytokineReceptorsHaveSimilarStructuresand Activate SimilarSignalingPathways

673

JAK KinasesActivate STATTranscriptionFactors

674

654

ComplementationGeneticsRevealedThat JAK and STATProteinsTransduceCytokine Signals

677

654

Signalingfrom CytokineReceptorsls Regulated by NegativeSignals

678

655

Mutant ErythropoietinReceptorThat Cannot Be TurnedOff Leadsto IncreasedNumbersof Erythrocytes

679

553

6s6

656

657

Integrationof Multiple SecondMessengersRegulates Glycogenolysis 557

XXVIII

Activation of Smads

A TGFBSignalingMoleculels Formedby Cleavage of an InactivePrecursor

ReceprorTyrosrneKrnases

679

L i g a n dB i n d i n gL e a d st o P h o s p h o r y l a t i oann d Activation of IntrinsicKinasein RTKs

680

Overexpression of HER2,a Receptor TyrosineKinase,Occursin Some Breast Cancers

680

s[ $f|

TGFFReceptors and the Direct

CytokinesInfluenceDevelopmentof Many Cell Types

G Protein-coupled Receptors That

sfl

I n s u l i na n d G l u c a g o nW o r k T o g e t h e rt o M a i n t a i na StableBlood GlucoseLevel

HedgehogSignalingRelievesRepressionof Target Genes

D o m a i n sA r e l m p o r t a n tf o r B i n d i n gS i g n a l Conserved TransductionProteinsto ActivatedReceptors Down-regulationof RTKSignalingOccursby Endocytosis and LysosomalDegradation

683

@

700

PathwaysThat InvolveSignal - l nduc ed 703 ProteinCleavage

o f R a sa n d MA P K i n ase @ Act i v a t i o n 584 Pathways

Degradationof an Inhibitor ProteinActivatesthe NF-rBTranscriptionFactors

703

Ras,a GTPaseSwitch Protein,CyclesBetweenActive and InactiveStates

68s

Ligand-ActivatedNotch ls CleavedTwice,Releasing a TranscriptionFactor

705

ReceptorTyrosineKinasesAre Linkedto Rasby Adapter Proteins

685

GeneticStudiesin Drosophilaldentified Key Proteinsin the Ras/MAP Signal-Transducing KinasePathway

685

Binding of SosProteinto InactiveRasCausesa ConformationalChangeThat ActivatesRas

587

SignalsPassfrom Activated Rasto a Cascadeof Protein Kinases

688

MAP KinaseRegulatesthe Activity of Many Transcription 690 Genes FactorsControlling Early-Response G Protein-CoupledReceptorsTransmitSignalsto MAP Kinasein YeastMating Pathways

691

ScaffoldProteinsSeparateMultiple MAP Kinase Pathwaysin EukaryoticCells

692

The Ras/MAPKinasePathwayCan InduceDiverse C e l l u l a rR e s p o n s e s

693

sf|

Phosphoinositides as signal Transducers

Phospholipase C" ls Activatedby SomeRTKsand CytokineReceptors

694

6e4

Recruitmentof Pl-3 Kinaseto Hormone-Stimulated ReceptorsLeadsto Synthesisof Phosphorylated Phosphatidyl inositols in the Plasma Accumulationof Pl 3-Phosphates Membrane Leadsto Activation of SeveralKinases 695 Activated Protein KinaseB InducesMany CellularResponses

696

The Pl-3KinasePathwayls NegativelyRegulated by PTENPhosphatase

s!|

698

Arrestin ActivatesSeveralKinaseCascades 698 GPCR-Bound Wnt SignalsTrigger Releaseof a Transcription Factorfrom CytosolicProteinComplex

RegulatedIntramembraneProteolysisof SREBP a TranscriptionFactorThat Acts to Releases Maintain Phospholipidand CholesterolLevels

1 7 C E L LO R G A N I Z A T I OANN D 713 M O V E M E N Tl : M I C R O F I L A M E N T S

@

and Actin Microfilaments Structures

715

Actin ls Ancient,Abundant, and Highly Conserved G-ActinMonomersAssembleinto Long, Helical F-ActinPolymers

717

F-ActinHasStructuraland FunctionalPolarity

718

@

Dynamicsof Actin Filaments

717

718

Actin Polymerizationin Vitro Proceedsin Three Steps 7 1 9 Actin FilamentsGrow Fasterat (+) EndsThan at 720 (-) Ends Actin FilamentTreadmillingls Acceleratedby P r o f i l i na n d C o f i l i n Providesa Reservoirof Actin for Thymosin-B4 Polymerization CappingProteinsBlockAssemblyand Disassembly a t A c t i n F i l a m e n tE n d s

Activationof GeneTranscription Cell-Surface by Seven-spanning 697 Receptors

CREBLinkscAMP and Protein KinaseA to Activation of GeneTranscription

CatalyzeCleavageof Many Matrix Metalloproteases 706 S i g n a l i n gP r o t e i n sf r o m t h e C e l lS u r f a c e InappropriateCleavageof Amyloid PrecursorProtein Can Leadto Alzheimer'sDisease

@

of Actin Filament Mechanisms AssemblY

F o r m i n sA s s e m b l eU n b r a n c h e dF i l a m e n t s The Arp2/3 ComplexNucleatesBranchedFilament Assembly lntracellularMovementsCan Be Poweredby Actin Polymerization

CONTENTS

721 722 722

723 723 724 726 xxix

ToxinsThat Perturbthe Pool of Actin Monomers Are Usefulfor StudyingActin Dynamics

726

ChemotacticGradientsInduceAltered Phosphoinositide LevelsBetweenthe Front and Backof a Cell 750

Cnsstc ExpenlvlrruT 17.1 Looking at Muscle

o r g a n i z a ti o no f A cti n -B a secellular d Structures 728

@

C r o s s - L i n k i nPgr o t e i n sO r g a n i z eA c t i n F i l a m e n t si n t o Bundlesor Networks

728

Adaptor ProteinsLink Actin Filamentsto Membranes

728

Myosins: Actin-Based Motor Proteins

fifl

Contraction

755

1 8 C E L LO R G A N I Z A T I OANN D M O V E M E N Tl l : M I C R O T U B U L E S AND INTERMEDIATE FILAM EN T S 757 [[

731

Micr otubuleStr uctur eand Or ganization

758

732

MicrotubuleWalls Are PolarizedStructuresBuilt f r o m a B - T u b u l i nD i m e r s

758

M y o s i n sM a k e U p a L a r g eF a m i l yo f MechanochemicalMotor proteins

733

MicrotubulesAre Assembledfrom MTOCsto GenerateDiverseOrganizations

760

C o n f o r m a t i o n aCl h a n g e si n t h e M y o s i nH e a d CoupleATPHydrolysisto Movement

736

Myosin HeadsTake DiscreteStepsAlong Actin Filaments

736

MyosinV Walks Hand Over Hand Down an Actin Filament

MicrotubulesAre DynamicStructuresDue to Kinetic Differencesat Their Ends

763

737

I n d i v i d u aM l i c r o t u b u l e sE x h i b i tD y n a m i cI n s t a bIi t y

763

LocaIized A s s e m b l ya n d " S e a r c h - a n d - C a p t u r e " H e l p O r g a n i z eM i c r o t u b u l e s

766

DrugsAffecting Tubulin PolymerizationAre Useful Experimentallyand to Treat Diseases

766

M y o s i n sH a v eH e a d ,N e c k ,a n d T a i l D o m a i n sw i t h DistinctFunctions

Myosin-poweredMovements

@

M y o s i nT h i c kF i l a m e n t sa n d A c t i n T h i n F i l a m e n t s i n S k e l e t aM l u s c l eS l i d eP a s tO n e A n o t h e r D u r i n gC o n t r a c t i o n

738

ftf|

738

[f!

S k e l e t aM l u s c l el s S t r u c t u r e db y S t a b i l i z i n ga n d ScaffoldingProteins

740

Contractionof SkeletalMusclels Regulatedby Ca2* a n d A c t i n - B i n d i n gP r o t e i n s

740

Actin and Myosin ll Form ContractileBundlesin N o n m u s c l eC e l l s

741 Myosin-DependentMechanismsRegulate C o n t r a c t i o ni n S m o o t hM u s c l ea n d N o n m u s c l eC e l l s 742 Myosin-V-Bound VesiclesAre CarriedAlong Actin Filaments 743

Microtubule Dynamics

762

Regulationof MicrotubuleStructure and Dynam ics 767

MicrotubulesAre Stabilizedby Side-and End-Binding Proteins

767

M i c r o t u b u l e sA r e D i s a s s e m b l ebdy E n d B i n d i n g and SeveringProteins

768

@

Kinesinsand Dyneins:Micr otubul eBasedMotor Proteins 769

Organellesin AxonsAre TransportedAlong Microtubulesin Both Directions

769

Kinesin-1PowersAnterogradeTransportof VesiclesDown Axons Toward the (+) End of Microtubules

770

745

KinesinsForm a LargeProtein Familywith Diverse Functions

771

747

Kinesin-l ls a Highly Processive Motor

772

C e l lM i g r a t i o nI n v o l v e st h e C o o r d i n a t eR e g u l a t i o n of Cdc42,Rac,and Rho

748

Dynein Motors TransportOrganellesTowardthe (-) E n do f M i c r o t u b u l e s

774

Migrating CellsAre Steeredby Chemotactic Molecules

750

Kinesinsand DyneinsCooperatein the Transport o f O r g a n e l l eT s hroughout he Cell

715

c e l l M i g r a t i o ns: i g n a l i n ga n d Chemotaxis

@

C e l lM i g r a t i o nC o o r d i n a t e F s o r c eG e n e r a t i o nw i t h C e l lA d h e s i o na n d M e m b r a n eR e c y c l i n g The SmallGTP-BindingProteinsCdc42,Rac,and Rho Control Actin Organization

XXX

.

CONTENTS

745

fifl

Ciliaand Flagella: Microtubule777 BasedSurfaceStructures

E u k a r y o t i cC i l i aa n d F l a g e l l aC o n t a i nL o n g D o u b l e t MicrotubulesBridged by Dynein Motors

777

r e a t i n gA r e P r o d u c e db y C i l i a r ya n d F l a g e l l a B C o n t r o l l e dS l i d i n go f O u t e r D o u b l e t Microtubules

778

IntraflagellarTransportMoves Material Up and D o w n C i l i aa n d F l a g e l l a

779

Defectsin IntraflagellarTransportCauseDisease by Affecting SensoryPrimaryCilia

780

Microfilamentsand MicrotubulesCooperateto TransportMelanosomes Cdc42Coordi nates M icrotubules and M icrofi laments D u r i n g C e l lM i g r a t i o n

1 9 I N T E G R A T I NCGE L L SI N T O TISSUES

$[

797

801

cell- celland cell- Matr ixAdhes i on: 803 An Overview

C e l l - A d h e s i oM n o l e c u l e sB i n dt o O n e A n o t h e r a n d t o I n t r a c e l l u l aPr r o t e i n s

803

782

805

C e n t r o s o m eD s u p l i c a t eE a r l yi n t h e C e l lC y c l ei n Preparationfor Mitosis

The ExtracellularMatrix Participatesin Adhesion, S i g n a l i n ga, n d O t h e r F u n c t i o n s

783

807

of The Mitotic SpindleContainsThree Classes Microtubules

The Evolutionof MultifacetedAdhesionMolecules Enabledthe Evolutionof DiverseAnimal Tissues

784

M i c r o t u b u l eD y n a m i c sI n c r e a s eDs r a m a t i c a l l y in Mitosis

784

$!|

Mitosis

MitosisCan Be Dividedinto Six Phases

781

l u r i n gM i t o s i s M i c r o t u b u l e sT r e a d m i l D

785

The KinetochoreCapturesand HelpsTransport Chromosomes

786

DuplicatedChromosomesAre Aligned by Motors a n d T r e a d m i l l i n gM i c r o t u b u l e s

788

to Polesby AnaphaseA MovesChromosomes Microtubule Shortening

789

AnaphaseB SeparatesPolesby the Combined A c t i o n o f K i n e s i n sa n d D y n e i n

789

s o n t r i b u t et o S D i n d l e A d d i t i o n a lM e c h a n i s mC Formation

789

CytokinesisSplitsthe DuplicatedCell in Two

789

e h e i r M i c r o t u b u l e sa n d P l a n tC e l l sR e o r g a n i z T B u i l da N e w C e l l W a l li n M i t o s i s

790

$fl

IntermediateFilaments

791

@

Junctio ns cell- celland celI- ECM and TheirAdhesionMolecules 808

, nd t p i c a l ,L a t e r a l a E p i t h e l i aC l e l l sH a v eD i s t i n c A BasalSurfaces

808

ThreeTypesof JunctionsMediate Many Cell-Cell and Cell-ECMInteractions

809

l l d h e s i o n si n A d h e r e n s C a d h e r i n sM e d i a t eC e l l - C e A J u n c t i o n sa n d D e s m o s o m e s

810

Tight JunctionsSealOff Body Cavitiesand Restrict D i f f u s i o no f M e m b r a n eC o m p o n e n t s

814

Adhesionsin EpithelialCells 816 IntegrinsMediateCelI-ECM s llow Small G a p J u n c t i o n sC o m p o s e do f C o n n e x i n A Moleculesto PassDirectlyBetweenAdjacent Cells 817

M atr ix l: The Extr acellular The BasalLamina

820

l a m i n aP r o v i d e sa F o u n d a t i o nf o r The BasaL Assemblyof Cellsinto Tissues

820 821

IntermediateFilamentsAre Assembledfrom S u b u n i tD i m e r s

792

M a t r i x P r o t e i n ,H e l p s L a m i n i n ,a M u l t i a d h e s i v e Cross-linkComponentsof the BasalLamina

Intermediate FilamentsProteins Are Expressed Manner in a Tissue-Specific

792

Type lV Collagenls a Major Structural Sheet-Forming 821 l amina C o m p o n e n to f t h e B a s a L

I n t e r m e d i a t eF i l a m e n t sA r e D y n a m i c

795

Defectsin Laminsand KeratinsCauseManv Diseases 795

[[

coordinationand cooperation between CytoskeletalElements 796

Proteins lntermediateFilament-Associated C o n t r i b u t et o C e l l u l a rO r g a n i z a t i o n

796

Components Perlecan,a Proteoglycan,Cross-links Receptors of the BasalLaminaand Cell-Surface

@The

Mra t r i xl l : Extracellula Connectiveand Other Tissues

s r e t h e M a j o r F i b r o u sP r o t e i n s F i b r i l l a rC o l l a g e n A in the ECMof ConnectiveTissues

CONTENTS

824

825 825

XXXI

F i b r i l l a rC o l l a g e nl s S e c r e t e da n d A s s e m b l e di n t o FibrilsOutsideof the Cell

926

ConnectionsBetweenthe ECMand Cytoskeleton Are Defectivein MuscularDystrophy

835

T y p eI a n d l l C o l l a g e n A s ssociate with Nonfibrillar Collagensto Form DiverseStructures

826

l g C A M sM e d i a t eC e l l - C e l l A d h e s i oi n N e u r o n a l and Other Tissues

836

LeukocyteMovement into Tissuesls Orchestrated by a Precisely Timed Sequenceof Adhesive Interactions

837

Proteoglycans and Their ConstituentGAGsPlay DiverseRolesin the ECM

827

HyaluronanResists Compression, Facilitates Cell Migration, and GivesCartilagelts Gel-likeProperties 829 FibronectinsInterconnectCellsand Matrix, Influencing Cell Shape,Differentiation,and Movement 830

AdhesiveInteractionsin Motile a n d N o n mo ti l eC e l l s

[[

I n t e g r i n sR e l a yS i g n a l sB e t w e e nC e l l sa n d T h e i r T h r e e - D i m e n s i o nE an l vironment

p[

PtantTissues

839

T h e P l a n tC e l lW a l l l s a L a m i n a t eo f C e l l u l o s eF i b r i l s in a Matrix of Glycoproteins

833 833

Regulationof Integrin-MediatedAdhesionand S i g n a l i n gC o n t r o l sC e l l M o v e m e n t

Looseningof the Cell Wall PermitsPlant Cell Growth

840

Plasmodesmata DirectlyConnectthe Cytosolsof A d j a c e n tC e l l si n H i g h e rP l a n t s Only a Few AdhesiveMoleculesHave Been ldentified in Plants

841

PartlV CellGrowth and Development 20 R E G U L AT IN T GH E E U K A R Y OT IC C E L LC Y C L E 847 Overviewof the CellCycle and lts Control

E[

849

The Cell Cyclels an Ordered Seriesof Events L e a d i n gt o C e l lR e p l i c a t i o n

849

RegulatedProtein Phosphorylationand DegradationControl Passage Through the Cell Cycle

849

DiverseExperimentalSystemsHave Been Usedto ldentify and lsolateCell-Cycle Control proteins

851

MPF Activity

853

Maturation-PromotingFactor(MpF)Stimulates Meiotic Maturation in Oocytesand Mitosis i n S o m a t i cC e l l s

854

Mitotic CyclinWas Firstldentified in EarlvSea U r c h i nE m b r y o s

856

CyclinB Levelsand KinaseActivity of MitosisPromoting Factor(MPF)ChangeTogetherin CyclingXenopusEgg Extracts Anaphase-Promoting Complex(APC/C)Controls Degradationof Mitotic Cyclinsand Exit from Mitosis

.

CONTENTS

8s6

8s8

Cyclin-Dependent KinaseRegulation Dur ingMitosis 8s9

MPFComponentsAre ConservedBetween Lower and Higher Eukaryotes

860

Phosphorylationof the CDKSubunit Regulatesthe KinaseActivity of MPF

851

ConformationalChangesInducedby Cyclin Binding and PhosphorylationIncrease MPFActivity

862

@

Controlof Mitosisby Cyclinsand

@

![fl

MolecularMechanisms for Regulating Mitotic Events

864

Phosphorylationof NuclearLaminsand Other ProteinsPromotesEarlyMitotic Events

864

U n l i n k i n go f S i s t e rC h r o m a t i d sI n i t i a t e sA n a p h a s e

867

ChromosomeDecondensationand Reassembly of the NuclearEnvelopeDependon Dephosphorylation of MPFSubstrates

870

!!f|

Cyclin-cDK and Ubiquitin-protein Ligase Control of S phase

872

A Cyclin-Dependent Kinase(CDK)ls Criticalfor S-PhaseEntry in S. cerevisiae

872

Three G1CyclinsAssociatewith 5. cerevrsrae CDK to Form S-Phase-Promoting Factors

874

Degradationof the S-Phase Inhibitor TriggersDNA Replication Multiple CyclinsRegulatethe KinaseActivity of 5. cerevisiaeCDK During Different Cell-CyclePhases 877 Replication a t E a c hO r i g i n l s I n i t i a t e dO n l y O n c e During the Cell Cycle

!fil

877 |ffirhe

cell-cyclecontrolin Mammalian Cells

2 1 C E L LB I R T H L, I N E A G EA, N D DEATH

879

90s

Birthof cells:Stemcells, 905

N i c h e s ,a n d L i n e a g e

Stem CellsGive Riseto Both Stem Cellsand DifferentiatingCells

906

RestrictedDuring Cell FatesAre Progressively Development

907

The CompleteCell Lineageof C. elegansls Known

908

M a m m a l i a nR e s t r i c t i o n P o i n t l s A n a l o g o u st o STARTin Yeast Cells

880

Multiple CDKsand CyclinsRegulatePassage of M a m m a l i a nC e l l sT h r o u g ht h e C e l lC y c l e

881

HeterochronicMutants ProvideCluesAbout Control of Cell Lineage

909

RegulatedExpression of Two Classes of Genes R e t u r n sG eM a m m a l i a nC e l l st o t h e C e l lC y c l e

881

Cultured EmbryonicStem CellsCan Differentiateinto V a r i o u sC e l lT y p e s

911

Passage Through the RestrictionPoint Dependson Phosphorylationof the Tumor-Suppressor Rb Protein 882

Adult Stem Cellsfor Different Animal TissuesOccupy 912 S u s t a i n i n gN i c h e s

C y c l i nA l s R e q u i r e df o r D N A S y n t h e s iasn d C D K 1 for Entry into Mitosis

883

MeristemsAre Nichesfor Stem Cellsin Postnatal Plants

Two Typesof Cyclin-CDKInhibitorsContributeto Cell-Cycle Control in Mammals

883

@

!![

in cell-Cycle Checkpoints Regulation

The Presenceof UnreplicatedDNA PreventsEntry into Mitosis lmproper Assemblyof the Mitotic SpindlePrevents the Initiation of Anaphase ProperSegregationof Daughter Chromosomesls Monitored by the Mitotic Exit Network

884 888

92O

cell-Typespecificationin Yeast

921

Mati ng-TypeTranscription FactorsSpecify CellTypes

922

MCMl and a1-MCM1ComplexesActivate Gene Transcription

923

a2-MCMI and cr2-a1ComplexesRepressTranscription 923 888

PheromonesInduceMating of ct and a Cellsto G e n e r a t ea T h i r d C e l l T Y P e

923

889

Arrest of Cellswith DamagedDNA Depends Cell-Cycle 891 on Tumor Suppressors

!!|

and Differentiation Specification 924 of Muscle

EmbryonicSomitesGive Riseto Myoblasts

925

MyogenicGenesWere Firstldentified in Studieswith Cultured Fibroblasts

925

Two Classesof Regulatory FactorsAct in Concert to Guide Productionof MuscleCells

926

CohesinSubunit Recombinationand a Meiosis-Specific for the SpecializedChromosome Are Necessary 895 Segregationin Meiosis|

Differentiationof Myoblastsls Under Positiveand NegativeControl

927

Cell-CellSignalsAre Crucialfor Determinationand Migration of Myoblasts

928

SpecialPropertiesof Rec8Regulatelts Cleavagein M e i o s i sI a n d l l

896

bHLH RegulatoryProteinsFunctionin Creationof Other Tissues

929

The Monopolin ComplexCo-orientsSister Kinetochoresin Meiosis|

898

Tensionon SpindleMicrotubulesContributesto ProperSpindleAttachment

898

!![

Meiosis:A specialTypeof cell Division

Key FeaturesDistinguishMeiosisfrom Mitosis

892 892

Protein of G1Cyclinsand a Meiosis-Specific Repression 895 KinasePromote Premeiotic5 Phase

Emerging 20.1 cellBiology Cnsstc ExpenlueruT from the Sea:The Discoveryof Cyclins

903

@

Regulationof Asymmetric CellDivision

930

YeastMating-TypeSwitchingDependsupon AsymmetricCell Division

CONTENTS

930 '

xxxiii

ProteinsThat RegulateAsymmetryAre Localizedat OppositeEndsof Dividing Neuroblastsin Drosophila 9 3 1

cell Deathand tts Regulation

[email protected]

936

ProgrammedCell Death OccursThrough Apoptosis Neurotrophinspromote Survivalof Neurons

937

A Cascadeof CaspaseProteinsFunctionsin One Apoptotic Pathway

938

Pro-ApoptoticRegulatorsPermit CaspaseActivation in the Absenceof TrophicFactors

941

SomeTrophicFactorsInduceInactivationof a Pro-ApoptoticRegulator

942

Tumor NecrosisFactorand RelatedDeath Signals PromoteCell Murder by Activating Caspases

943

937

2 2 T H EM O L E C U L ACRE L LB I O L O G Y O FD E V E L O P M E N T 949

Controlof Body Segmentation: Themesand Variationsin Insects and Vertebrates 969 Early Drosophila Development ls an Exercisein Speed 970 TranscriptionalControl Specifiesthe Embryo's Anterior and Posterior

971

TranslationInhibitorsReinforceAnterior-Posterior Patterning

973

InsectSegmentationls Controlledby a Cascade of Transcription Factors

974

VertebrateSegmentationls Controlledby Cyclical Expression of RegulatoryGenes

977

DifferencesBetweenSegmentsAre Controlledby Hox Genes

978

Hox-GeneExpressionls Maintained by a Variety of Mechanisms

982

Flower DevelopmentRequiresSpatiallyRegulated Productionof TranscriptionFactors

983

!![ H i g h l i g h tso f D e ve l o p me n t

@

DevelopmentProgresses from Egg and Sperm to an EarlyEmbryo

As the EmbryoDevelops,Cell LayersBecomeTissues and Organs 951 GenesThat RegulateDevelopmentAre at the Heart of Evolution

Neural Development

985

N e u r u l a t i o nB e g i n sF o r m a t i o no f t h e B r a i na n d SpinalCord

986

950 9s0

952

cell-TypeSpecification in Early

SignalGradientsand TranscriptionFactorsSpecifyCell Typesin the NeuralTube and Somites 987 Most Neuronsin the BrainArise in the Innermost NeuralTube and Migrate Outward

988

LateralInhibition Mediated by Notch Signaling CausesEarlyNeural Cellsto BecomeDifferent

988

Gametogenesis and Fertilization g53

@

Growth and Patterningof Limbs 990

G e r m - l i n eC e l l sA r e A l l T h a t W e I n h e r i t

953

!![

FertilizationUnifiesthe Genome

955

Hox GenesDeterminethe Right Placesfor Limbsto Grow

990

958

Limb DevelopmentDependson Integration o f M u l t i p l e E x t r a c e l l u l aSri g n a lG r a d i e n t s

991

958

Hox GenesAlso Control Fine Patterning of Limb Structures

992

So Fa[ So Good

994

Genomiclmprinting ControlsGene Activation Accordingto Maternal or PaternalChromosome Origin Too Much of a Good Thing: The X Chromosomels Regulatedby DosageCompensation

cell Diversityand patterning

!f,

in EarlyVertebrateEmbryos

CleavageLeadsto the FirstDifferentiationEvents The Genomesof Most SomaticCellsAre Complete

Cussrc ExprRlueruT 22.1 UsingLethal

961 961

SignalGradientsMay InduceDifferent Cell Fates

963

SignalAntagonistsInfluenceCell Fatesand Tissue Induction

965

A Cascadeof SignalsDistinguishes Left from Right

956

.

coNTENTs

999

960

GastrulationCreatesMultiple TissueLayers,Which BecomePolarized

xxxiv

Mutationsto Study Development

959

23 NERVE CELLS !fl

Neurons andGlia:Building Blocksof the NervousSystem

1001

lOOz

Information FlowsThrough Neuronsfrom Dendrites to Axons 1003

NXXX

.

slNliNo)

I1r:r;rrad5sllqlqxl z90L 'asualaq aur-lpJtqI aql ,{lrunurur;anrldepy +o Iyunr.uur;anrldepy pue aleuul qlog sesseduo:u3 1eq1funtul o1 esuodsagxa;duol e sl uotleuuel+ul tgot

possoJ)eJV siaureg le)ruaq) pue le)tueq)a[ Jauv asue+ac]o aurl puo)es e sapt^oJd{lrunulur; eleuul

650I

sua6oqle6}sure6y esualac ,rolar{e1p.rr3e r u r o l s a u e p u n o gl e ) t u a q ) p u p l e ) t u e q ) a l sapol qdu{1 pue sonssrlut a)uaprseud1 a1e1 pue r{pogaq} }noq6nolql a}eln)lt) say{:o1na1

650I LS1L

sosualaolsoH lo /na!rua^o @

LSOI

saltsluaJa#tq 1e a1e:r;dagpue selnou luala#tC q6notql {pog eqr la1u3 sue6oq1e4

LSgl

vzol EZol EZOL €20r ZZ0l

ZZOL 0z0l 6t0l

ss0r

A9o]oNnwNtvz

8r0t 8t0t

suoxv aprng os;y uo1e1n6ey ;elueuldo;ana6 saln)alonj e)ueprn9 uoxv j|'osatltuel Jnol elv aJeql

gVOL

urnl ol euo) qlmorg eql asne) saln)alonja)ueptng uoxv

LVOL

EtOI

zvll

suotpauuo) uoxv +o uep{5 paJeprg ue polee^audeyl ;epaloulleu aql o r n p n J l sa ) u e p l n g {.rosua5pazuo}on e sl euo) qwoJg oql

0t0r

0t0r

vt0L €t0t €t 0 t Et0t t t0t

6ur1e6le1pue qlmoJg uoxv

6ur;;o.r1uo) :ssa))n5ol qled aql ]!!|

600r 600t

slopo pola6 slolderag +o eJoqlold V png elsel q)el ul slla) slasqns r{q pesua5eJV sa}sel ,{leuur.16 anrl +o u o t l o w p u e p u n o sp e l a o s l l a ) J e l J a u u l

9€0r vgol Z€OI

plro4 aql ;o sa6eur;sturoJslla) uor;6u e9 a;dr11 n yr1uloJ+uotleu.ro;uI palet6a1u1

6Z0L

a J n s s e Jpdu e ' q ) n o l 'plo) 'leaH 'uted palaq s1;a1fuosuesoueq)al4

t€0r

820r

fuo1sr11 fueuorln;on3pa;rragsa{3 slla) a^JeNanrlrsue5-1q6tl saJnleal a{3 aq1

LZOI

600r /00 t

900t

900t

leuueq) uol eLll ol alnqtlluol loyderag a u r ; o q : ; { 1 a r y) t u t } o ) t Na q } u ! s } ! u n q n So ^ t J l l V uotpeJluo) al)snlAol speel slauu eq) uorle) paleg-auIlor1tl{1e:yrro6u ruadg sol)rsan:r1deu{5 epl(rag louue) urueu{q 6urpel s1ue1ny1 {;3 sJellil.usueJloJneN +o a)eldnou Jo uorlepel6eq {q paleurulal s; sasdeu{51e 6ur;eu6r5 auerqruolAeu,tseld aql qllm sal)tsenrgtdeu{5 y + o u o t s n l s a l e ; n 6 a gu t a l o l d 6 u r p u r g - u n r : ; e 1 sJellil,usueJloJnoN

,to esealags.ra66rl1+ze) +o xnl+ul auelqual^ eruseldoql Jeeu peztle)o'lalv lalll,usuetlolnaN qllm pepeo'l sal)tsanrrldeu{5 sutelold 1.rodr1uy pelu!'l-+H {q sa;:rsel rrldeu{5 olur papodsue4 aJV sJe}}l,usuel}olnaN sornllnJls :r1deu{s1so6 pue trldeu{set6 1o {lquassy selrnbegsasdeu{5}o uotleruJoJ

sosdeu^S le uollet!unuuo) fl!| sasdeu{5pue sq}eaqsur;aIy1e)npold etlg suoxv paleur;a{y1ur opoN ol apoN LlJol+,,dr.un;,, sletlualoduotpv uotpnpuo) as;ndul ;o fir:o;a4 eql saseaJ)u;uorleur;a{61 rlrtolJuol el)olg elod uedg oql olul 1uaur6a56urlenrpeu;-leuueq)aql 'to luaue^ol u o r l e z u e ; o d e qa u e l q u a n j o t esuodsegur o^ol4 se)tleHn y5 6ursua5-a6e11o4 sernpnJls

Jelrulse^eHslauueLl) uol poleg-e6e11on 1;y dIV +oa)uesqvaql u! sletlualoduotpv {ue61pnpuo) ue) slle) o^JaN u o r l n u r u r cl n o q l l ^ {;;euorpelrprul palebedoJde.tv slet}ue}oduotpv sletluelod uorpv alelouag slouueq) *) pue +eN peleg - a 6 e 1 ; o 4 ; o6 u r s o 1 1 p u e 6 u r u e d g; e r l u e n b e 5 "tJ ol asol) sl lerlualod uorl)V aql +o apnlru6eyl aql

slla) o^raN ut sletlualod uotl)v lo uolle6edol6 eql pue slouueq) uot paleg-a6ellon

6ut;;eru5pue ,6utlsel ,6u!lpaH

LZOI

'6ur;aa3'6u;aa5 :slle)leuotlesuas ]ftfl

SZgL ole)tunwuo) ol suoJnaNlvtollVoslv suorpunpde9 SZOI

lerlualod uorl)V ue eleJaueD o] uotst)ec ouoN-lo-llv ue e)ey! sllo) o^JeN

s00I s00r €00r

@

suoJneNa;dr1;n61 ;o pasodtuol slrn)r) 6ur;eu6r5sesl urals{5sno^JoNeql sasdeu{5 er^ suolnaN uaa/V\lags/v\olJuotletuJolul slerlueloduotl)v polle) ^/\oll uol +o soslndse sa^olNuotleLuro+ul

peard5ue) pue a^rse^ulaJV slla) Jorunl lrlelselal4

G0t t

s;;a1burlera+rlordur aleur6r.rgfi;;ens1sJe)ue)

0l I I

slassanpool8 MaN +o uorleruJoJsal|nbeuqwoJg rotunl uorlelndod{1r.roury1; e ag ue) slle) uie}SJe)ue)

tttt

tltr

6 0 tt

Ja)ue) lo

lasuo aql pueslla) lounl Ell

LOLL

ulfNv) sz

)rleuos S0lt sauegurlnqo;6ounururl ;o luaura6uereau :auoauoraSsaua9o/nl u'?z lNlwtuldxf )tss\n) sua6oqled 1o I1er.rel e pure6y {ilunuu; o^rpa}ord lr)rll seur))en

l0 t t

slle) I pue I uaa/l^laSuolleroqello) serrnbagsarpoqrluvfirurgy-qbrp +o uorpnpord sg;a36urluasel6-ue61luy +o uotle^rpv ol speal s.rolda)aua)r'l-llol rro1uer.ua6e6u3 surauedreln)eloulor)et4pa^ueq-ue6oq1e6rto {1aue1 e a^ralrad slolderag a)ll-llol

660t 660t L6Ol

L6OL esuodseue^rldepv aql ur slla) uals^s-eunuul lo uolleroqellof @

?80r 280t z80t

t80t

sen) )rpeloueq)

960r s60t s60I v60l t50t

saurlouraq) {q peprnor4 ol asuodsegur a^ol4 say{ro>;na1

slle)8pueI+o

6801,

ur;nqolbounuurlue +o uorpod (qe)l aqf selqueseu.roldaraulla)-I aql lo alnpnrls aql

880r

SINIINO)

.

Inxxx

^emqled rrYbopu3 aql ol pale^tloq sua6rluy sluasard^eMqled )HlA ll ssel) suabgluv rr;osoy{1s}uesaJdAennqted)HtA I ssel) a)e+rnslla) eql ol palsod pue sllnpoJd )HlA r.llltvrpexa;duo3 e:y sluaulbeJl ulelord q)lrl6 {q ssa:o.r6oql sl uo!}eluesald uabtluy loldarag lle)-I eql qltm pelalul pue sua6gluveprlde6 purg seln)elon )Hu\l

6LOL salnrolol4)HtA +o sassel)putlstq onnl {q peplnD aly saryadold luale#tG qllm slla) I leuorpunJ papu5eu )Ht Pue r11;rad5 8/0 t ua6gluv sl slla) r rxoloil),to firnrpy 6ut11t;aq1 s4e.r9 pelag to ]derrv o] LLOI sat:ed5aues aql lo slenPl^lPul palelerun orvtl+o {rtttqv eq} seulura}a6 )HW eql 9L0l,

sL0l vL0l

ELOI ELOL

960r

sJeryel4a)eynS ,ro uorsse:dx3pue uolpnpo.rdautloy{3 lteLl1uo paseg sessel).rofe61aarql olur pepr^rqarv slla) I tG) s l l a ) a u n u u l r e q l o o 1s ; e u 6 1 5 apr^ord1eq1seurlop{1,ro{er.ry ue a)npord slle) I 5ty pue 6 u t t 1 >l o + p e z t l e t ) a d a toldarel-o3 gC) eql fure1 s;1a3I rrxolol{) uorle^rpv llnl ro+ ;eu6r5;o sed{.1onnl elrnbag slla) I uorpelas anrlebappue enrlrsod+o ssa)oJde q6norql do;anaq saln)elot 1961 6urzru6o)ag+o alqedel slla) I

t60t

uorlerluoJa#!cpue uorleJo+rloJd sre66u1s.roldareurtltrad5-ua6rluvet^ 6ur1eu615 s1uer.u6e5 auag f pue 'C h uaeMlaq suotpunf eql u! pepo)ul sanplsauelqerrenllaql ]|.o ^uen qllM esle^tc fua4 ery s-roldarag1;a3-1 s a u a gu r l n q o l 6 o u n u l u t ; ol Jelrursieuuel4 e ur pa6uerreagaJV saueg U)I

880r

tueudola^ao lle)-I pue ' sr ol da) au l la) -I's lto) L @

880t

LLOJ

690t

uo!leluaseJd

uabrtuvpue)HW.qL'ljEE eleyrl laql ur;nqo;bounuurl;o adllosl aql q)llms ue) slla) I 61 pelana5 6ur1e61o1 61punog-auelqulal46ut1e61uto.t; q)llrvrsslla) I 'esuodsegenrldepy ue 6utlnq rolda:eg lla) E-erd e ruoJ+lndul salrnbagluetudo;aneolla)-g salllul#v panordutlqltm serpoqlluv 'to uolpoles pue >t1euo5 uorleJauogaql sMollV uorlelnur.rad{;1 s1uau6a5aue9 f Pue 'q h sa^lo^ulsn)ol uteq)-^^eeHaqt ;o luaula6uelleag

auag f Puen lo s1uar.u6a5 {;qrrassysaltnbagauag uleq)-}q6llleuol}lunJV

luaudola^ec lle)-g pue 69Ot flrsre^rc fpoqrluv lo uollereuag|fff| saryedol6 leuorpunl 890r sll sauruJelaq uot6ag luelsuo) s,urlnqol6ounululuV l{1r:r;rrad5 LgOL altsgnbx3Jteql lol sluno)lv seln)eloy! r{poqtluy }o alnpnJ}S leuolsuaulO-eaJqIeql puog opr+lnslqe ^q LgOL pazrlrqelsslaaqs $ orv'r1 'to pasodu.tol plol )llslrepereq) e e^eH suleuoq urlnqo;6ounuul

990r s90I €90t

€90t

ut;nqo16ounuu1 'anbrul e se)npord petnqtJlstq{11euo13r llo) I q)el suotpunl luaJe#tc qll/v\qlel 'prx3 sad{1os;ur;nqo;6ounuull a;dt11nyr1 sureL{)rq6lt pue {aeag ;o 6ut}stsuo) arnpnJls paruasuo)e e^eH sut;nqo;6ounuu.t1

u o ll) u n l p u e a r n lr n r ls :su lln q o l6 0 u nuul

SpecificMutations TransformCulturedCells into Tumor Cells

1113

A Multi-hit Model of CancerInduction ls Supported by SeveralLinesof Evidence

1114

Successive OncogenicMutations Can Be Traced in Colon Cancers

1116

PatternsCan DNA MicroarrayAnalysisof Expression RevealSubtle DifferencesBetweenTumor Cells

1116

@ Th e

G e ne ti cB a si so f ca n ce r

1119

Gai n-of-FunctionM utationsConvertProto-oncogenes 1119 into Oncogenes VirusesContainOncogenesor Cancer-Causing Activate CellularProto-oncogenes

1121

Mutations in Tumor-Suppressor Loss-of-Function GenesAre Oncogenic

1123

Genes Inherited Mutations in Tumor-Suppressor lncreaseCancerRisk

1123

Aberrationsin SignalingPathwaysThat Control DevelopmentAre Associatedwith Many Cancers 1124

!fl

oncogenicMutationsin GrowthPromoting Proteins

1127

OncogenicReceptorsCan Promote Proliferationin the Absenceof External Growth Factors

1127

Viral Activators of Growth-Factor ReceptorsAct as Oncoproteins

1128

Many OncogenesEncodeConstitutivelyActive Proteins Sig nal-Transduction

1129

InappropriateProductionof NuclearTranscription FactorsCan InduceTransformation

11 3 0

M o l e c u l a rC e l lB i o l o g yl s C h a n g i n gH o w C a n c e r ls Treated

1132

MutationsCausingLossof and Gr owth- lnhibiting Controls Cell-Cycle

1134

from MutationsThat Promote UnregulatedPassage Gr to 5 PhaseAre Oncogenic

1134

MutationsAffecting ChromatinLoss-of-Function RemodelingProteinsContributeto Tumors

1135

Lossof p53 Abolishesthe DNA-DamageCheckpoint 1136 Apoptotic GenesCan Functionas Proto-oncogenes 1137 Genes or Tumor-Suppressor CheckpointsOften Leadsto Failureof Cell-Cycle T u m o rC e l l s i n Aneuploidy

1138

and CaretakerGenes Carcinogens 11 3 9 in Cancer CarcinogensInduceCancerby DamagingDNA

11 3 9

SomeCarcinogensHave Been Linkedto Specific Cancers

1139

Lossof DNA-RepairSystemsCan Leadto Cancer

1141

Contributesto TelomeraseExpression lmmortalizationof CancerCells

1143

GLOSSARY

G-1 l-1

INDEX

CONTENTS

.

xxxvtl

uorlnlo^l uo a^tlledsJadatuouag v

s u e d J r a q l p u e s l l a ) 6 u r 1 e 6 r 1 s a n u ; v't

0z

s't

8Z

vl o

I

slla) +o )ro^ aqf lla) e j|.oseln)alon aql slla) +o Alleuourruol pue Ilrstenrq eq1

E't

z'r t'L

I Nn r n o

:suropSur>1 rnot apnlrur selodre{ng .rrlodre4ne pue rr}o -dre4ord-s11acyo sad& o^\t stsrsuof,asrelrun pcrSolorq eq1 Jo

)llo^relnl ro )rlo^Jplord otv sllo) llv 'sllaf snorrB^ Jo uorlf,unt puE ernlrnrls Oqt ur serlrrpFurs saJuereurp puE 0r{l .>1ooqsrqt tno r{toq srseqrplnlolotu aqt uo snrot IIr^ e_ry\ Jo -q8norqr sploJunsllar drols aqr sy de.u atuesoqt dllecrseq to ur sassecordperetlldtuol dueur tno drrec pue sorntpal Iernl -rnrls urPlref,Orpqssllof, 'seruera;;rprJqto snorerunupue 11e asaqralrdsaq 'poo; rse8rpsn dyeqpue seurtsolurrno ur e^rl lerlt prretrpq eql ro rre eqt ruorJ uaSo.ltrutrerlxe ol srueld dlaq reqr Euatr€q oql op se 'sursrue8royo saddl reqto qlr.41r uorlerfosse asolf, ur aArTJo seruolof,tuJot sJar.{lo.uorlelosr ur elrl stusrue8rorelnllarrun oruosq8noqrly .sllel reqlo qtr^{ pa^lo^ur dyateurrturare srusrueS.ro relnllarrllnu ur sllar lsory 'sraqlo roJ luourarrnba.ralnlosqe ue sr lnq sllal atuos sllr>l ua8dxg 'elgers,{llernlcnrtspue dreuouersdla8rel arp srer{tO

'sJaJrloJpue seqeue 'so;n1lnl1s to sarloru ur eesuef a.rl sE Sur8ueqc-lseJe^eq pue dlprder e^ou aruos '(1-1 arn8r4) sadeqs pup sezrs lo f,lBrrcr, Surzeute ue ur otuoJ sllaJ

slla) Io f1r;euourruo)pue Alrsla^lqaql lU 's11arSurdpnts sdp.^a snorrel ar{l ruo{ urpel uef, to aA\ let{,ryrpup (suorlf,unJIeJrtrrr pup sluenlrlsuoJ Jrsgq Jroql 's11ec dlrs.rallp aqt Surcnporrurdq rerdeqr anSolord srql ;o ur truls elrN'slleJ rltpJp pue 'ayr1'qrrrg aqr 1o ,{lors petJceJ Jo -ulnru oqt 3ur,teo,ndgenper8 'splaryasegt to IIE r.uoryu,ry\pJp saqreo.rddelpluorurrodxapue slq8rsureqrrJsep11r,ue,tt 'sral -deqc SurrnolloJer{r uI 'uorletuour.radxa;o a1d1spue srseqd ',(8o1orq -rua u^\o slr spq splort eseql Jo qre1 leluarudolo,r -ep pue'eruerf,s relndruor tSolorsdqd'slrlaue8 1(docsonrur iiSoyorqrplnf,oloru'sorsdqdorq'dtlsruaqcorqreqtoSol sBur.rq (qcr.r sr lSolorq r lerll erualrs a,rrlBr8elut [e] JEInJOI6W 'puodsa; o1 sdem eleudordde tsotu oqt uo aprrep daqr moq pue sllor q8no.rqrs^{olJuorler.uro;ur^/rl,oq lnoqe dlrelnrrued 'peureal eg ol sureruoJlunotup asuerururue '11115 'Joqlo qJEe aJuenlturpu€ qrnot dagr ,vroq'urEluoJ daqt sernlcnrls tEr{na 's11ac sluouodruor ar{t tnoqp Etep.ry\au;ouorsoldxaue aJe! 1o o.tr 'suado d.rntuec tsrrJ-.{tue,v\teqr sV 'aJII Jo lrun Ietueruep 'aJIIyo sartradord>lreurller{ -unt oql sr IIar eqr tpr{t SuneJrpul aqt IIe trqrqxo susrueS.rorulnlloJrun aldurrsua,lg '1ac epurs e Jo lsrsuof, sulsrue8rodueru 1nq 'salnlf,n.rlsxalduror olur pezrve8rc sllel Jo suor1lrrtro suorllq ureluor srusrueSrore1 -NIIE]qFI.U

JOTIIO PUP EII

'OJII

OUIJEP SEIIITIqE OSAqI 'SUOIIJE

-eJ lef,rtuor1J lo AeJreSur.zetueue lno ,llrct pue'rlnurrls 1 ol puodsar 'uorleru.ro;urssecord 'aonpo.rder?rro-r8uer I sarpoq rno urot teql sllel lenpr^rpur eql 'sa,rlesrnoa>1r I 'sraLtr)easau oioq6l{poq ueurnqp }o sllo)uotllu}0L aq}astJe []ul utads pue 66a up jo uotuneql uJoJjs1leta16urs oslea.teLl)tqM 1;rnn 'uradsqlrnn'66a ueunq aq] 'llo)(urrl)Jaloulol)tLU 667- al6ursy

Sll:l) HIIM SNID] B ]J II

U] IdVH)

uEeJoeqt w deaPselru uoeq o^ErIsllel f,nodrElord / Puno} '3rl 'eggl X S' sr rltrea zr0l lnoqr to lelol e Surq8ra.n uo ErratJeq Jo regrunu pelerurlse eqJ 'srusrueS.rolenplrr 'lq8ram s(uprunq -lpul /r0I x t ueql ororu sluoserda.rsrql e8erat'eaqr 1o 3>1S'I-I pareurnseuE JoJ tunof,Je euetJpq led '3 or_0l x SZ rnoqe ;o rq8rerrtd;p e seq vJnr.nl)eq tpz olq)tnq?sg el8ursy 'sseruorqs.r{trpaaql ;o ued a8nq e dn a>1eru deqr tlenprzrrpur llptus erE salo,fue>1ord qSnoqlly 'uonezrueB 'losoldr lo 'lorrolur leuJalur 1o ecuese.rdaql Surlerrpur -Jo

s ' r ] l ) H r - r As N r 9 3 8l l l ' l

I

t urravul

ere suralo.rdduetu tsluatu snoenbBJreql ur pazllelol dyasrcerd -lredtuor papunog-euprgueu e^Eq tou oP sllal Ielrelleq q8noqrly 'sller Jo suleql snotueru€llJeq ro relnllorlun 0q ro'etrelcegouedo eql lsursrue8ropa11ac urc'ae31e uaarS-en1q -apurs are setodre{ord;o adrb snoJetunue'eualteg 'adfi sqr Jo slleJJolslsuof,salofrelord IV'FZ-I ern8rg) uooeztue8to Ieuralur aldulrs dlalueler e seq PUE'snalcnuPouIleP€ S>IJEI 'euelqtuatu euseld aqr dq Papunorrns sI letll luolulJedluol crtodre>1ord'EorqtrrePUEElrel pasolJa18urse Jo lslsuoJ s11ac -l€q apnllu satodru>1or4'ststlord pue'r8un;'sleuttue'slueld

'pa]rutlun nno11e{ q)ee'satuolo) talq6nepaleoplsulsasseu-r pleqlru(q)Uedaur)rpay\ slenst^,/qrqs {ueu ;o dn apeLu ) puelassa) [ ]ul ]o looqls 'sllo) 'slop 'nelg riuetu dn apeu.t alqtst^ pio]uets to anlq se {1rlenru61 uolourqseg'uoplog (6)Ued[]rstanrun uaar6 aql 1o n lenpt^tpur JJa[ xo^loA'e61e uaet6pa11el-e;6uts (+)]Jed)ul'pa]rulrlul-1 (a)uedlul 'pa]rurlun aresaraqds a6relaqt 'snarne ualaH s1ensrl7;e:r6o10rg eurlore) leluolo) 'slaq)reasau punoMe le ]ol) (p) paztltsso+ :s11ar a;6uts e6lel slensrlTueqburuunl o]oqd/HlN ()) tul Ued C uqo[(p)Uedrul V (a) s60arnesoutp 'pa]rullun olesllaluaal6eql eprnotd qdleu(q)Uedlul 'slaqlleasau poolqa)eu o] sa)uplsqns slensrn oloqd7ra16ne9 leq] slalaleld /uosurqou aq};o ped ale (sa}l{ro)nal) aunLuu.tl pue 'u..orpa+ur tueD(e)Uedlpoo] puetaleM+oUodsuet]lo] saqnlolur paurof lq6rl pueuuals{s ole slla) slla)poolqaltqMaql 'seyilolqyire0utleaq-uao^xo pr6ue Iq peyoddns oreslla)aql uoaMlaq sered5uo1ela)s asolnllel 's1ue;d 'dol poolq par ut uMoqs'slla)poolg()) ^ep6e6oueqlaul rolo) oslej oqf paxr} re;nrsen ur ,{1turr; (q) areld ur ore slle) oq} iueld ant6oltle)+ouaulnJaql ut antlleql solfads uror+por..ls oresllo)plopue'rllr^aLl]JosasPq aql reau,i;snonurluo: Ogt< o] asr.i ]o sJa]rl pueaptxotp uoqlel6utpenuol o1se6ue6orp{q aurosaueqlaLu r!ro] slla)nnel ,ipoqaq];o spedraqlool uodsue.rl ro} poolq euapeqaeq)le {q ,i6raualraq}a)npoldleq} (pul)/esoueqlanl) pailalsuer] aql ol ]aaqsletlaqltde eq1qonotqtpoolpa5e6tpuloJ+ }o 'sn;1n sseLu (q) uaquaure]pue'all8'po;enbogseq)nsesaaq> a>npold alesluaulnN]aaqssnonurluol e urslla)IueLusureluor v 's;;a> Outptntp q)el 'a.loquMoqsaurlsalur ol pasnereq)tqM 's1)elsrn)QoDe7alPasaqf q6norqlarr;s e 'sllo)+oremole1r1-ra6urJ snslan )tloqelaupue'(sllallr1ofue1na alou:euol)eqnl(e) satlt^t])e aql urse'leaqsler;eqlrda ue urol ue)slla)(6) uro[oqeql ]e qlnq 'o^oLll ltaqtul le]]lp o] ^lt1lqe rrlo,telord)uotleztue6lo {q a;qrsrn eq1sr{poq llo)oql lurolord e }o uorl)npo.r}ur lPulalul luerseronl; asaqlul pa}el}snlll u1'sqdelooloqd o} uol}lppe sllar,{6oloqdroLu apeurseMllo)aq1'salrrpuap aq1qbnorqls1lar ]o )roMlaupaq)uerq oq] jo auos 'sazlspue sadeqs srsllo)]o ,ileuen;e:roo;otldloul e6re1 raqloqllMsuot])auuo) ueqlarourulro]uel leql ooo'00 t ;1at y (+)slla) ,{;qrperrur ue 'urnllaqara) aLl}}o uornauelurlrn4el6urs lo luauruosse6ulpunolseue ul auo) slla) l-l lunglJ V

(b) Eukaryoticcell

( a ) P r o k a r y o t icce l l P e r i p l a s m iscp a c e a n d c e l lw a l l

Golgi vesicles

Lysosome

O u t e rm e m b r a n e

I n n e r( p l a s m a ) membrane

Nucleoid lu'btrm I

Nucleoid

N u c l e a rm e m b r a n e P l a s m am e m b r a n e Golgi vesicles Mitochondrion Peroxisome Lysosome

I n n e r( p l a s m a )m e m b r a n e

Periplasmicspace Outer membrane R o u g he n d o p l a s m i c reticulum

1-2 Prokaryotic cellshavea simplerinternal A FIGURE micrograph of a organizationthan eukaryoticcells.(a)Electron coli a commonintestinal bacteriumThe thin sectionof Escherichia withina of the bacterial DNA,is notenclosed nucleoid, consisting by two membraneE coli andsomeotherbacterra aresurrounded spaceThethincellwallis membranes separated bythe periplasmic (b)Electron mrcrograph of a plasma adjacent to the innermembrane antibodies Onlya single cell,a typeof whitebloodcellthatsecretes (theplasma membrane membrane) surrounds thecell,butthe manymembrane-limited compartments, or interior contains Thedefining of eukaryotic cellsis organelles. characteristic

whichis DNAwithina definednucleus, of thecellular segregation is membrane Theouternuclear by a doublemembrane bounded for factory a reticulum, withthe roughendoplasmic continuous process andmodifyproteins, proteinsGolgivesicles assembling to digestcellmaterials generate lysosomes energy, mitochondria and process usingoxygen, molecules them,peroxisomes recycle them to the surfaceto release carrycellmaterials vesicles secretory E M u r r a y . P a r t ( b ) fromPC G B u r d e t t a n d R D J lPart(a)courtesyofl lJltrastructure: A Functional 1993,CellandTissue Cross andK L Mercer, andCompanyl W H Freeman Perspective,

and 40 miles up in the atmosphere;they are quite adaptable! The carbon stored in bacteria is nearly as much as the carbon stored in plants. Eukaryotic cells, unlike prokaryotic cells, contain a defined membrane-bound nucleus and extensive internal membranes that enclose other compartments called organelles (Figure 1-2b). The region of the cell lying betweenthe plasma membrane and the nucleus is the cytoplasm, comprising the cytosol (aqueousphase)and the organelles.Eukaryotescompriseall membersof the plant and animal kingdoms,including

the fungi, which exist in both multicellular forms (molds) and unicellular forms (yeasts),and the protozoans (proto, primitive zoan, animal), which are exclusively unicellular. Eukaryotic cells are commonly about 10-100 pm across' generally much larger than bacteria. A typical human fibroblast, a connective tissuecell, might be about 15 p,m acrosswith a volume and dry weight some thousandsof times those of an E. coli bacterial cell. An ameba, a single-celledprotozoan, can be more than 0.5 mm long. An ostrich egg beginsas a singlecell that is evenlarger and is easilyvisible to the naked eye. THE DIVERSITA Y N D C O M M O N A L I T YO F C E L L S

All cells are thought to have evolved from a common progenitor becausethe structures and moleculesin all cells have so many similarities. In recent years, detailed analysis of the DNA sequencesfrom a variety of prokaryotic organisms has revealed two distinct types: the bacteria and the archaea. Working on rhe assumption that organisms with more similar genesevolvedfrom a common progenitor more recently than those with more dissimilar genes,researchers have developed the evolutionary lineage tree shown in Figure 1-3. According to this tree, the archaeaand the eukaryotes diverged from bacteria billions of years ago before they diverged from each other. In addition to DNA sequence distinctions that define the three groups of organisms,

Animals

Plants Fungi

Ciliates

Euglena

Microsporidia

EUKARYOTA S I i m em o l d s Diplomonads (Giardia lamblia)

EUBACTERIA E. coli

Sulfolobus ARCHAEA B. subtilus

Thermococcus

Thermotoga

Methanobacteriu m Halococcus

Flavobacteria G r e e ns u l f u r bacteria

Halobacterium Methanococcus jannaschii

Borrelia burgdorferi

P r e s u m e dc o m m o n p r o g e n i t o r of all extant organisms P r e s u m e dc o m m o n p r o g e n i t o r of archaebacteria and eukaryotes

A FIGURE 1-3 All organismsfrom simplebacteriato complex mammalsprobablyevolvedfrom a common,single-celled progenitor.Thisfamilytreedepicts theevolutionary relations among thethreemajorlineages of organisms. Thestructure of thetreewas initially ascertained frommorphological criteria: creatures that look alikewereput closetogetherMorerecently the sequences of DNA andproteins havebeenexamined asa moreinformation-rich criterion for assigning relationships Thegreater thesimilarities in thesemacromolecular sequences, the moreclosely related organisms arethoughtto be.Thetreesbasedon morphological comparisons andthefossilrecordgenerally agreewellwith thosebasedon molecular data.Althoughallorganisms in the eubacterial and archaean lineages areprokaryotes, archaea aremoresimilar to eukaryotes ("true"bacteria) thanto eubacteria in somerespects For instance, archaean andeukaryotic genomes encodehomologous histone proteins, whichassociate with DNA;in contrast, bacteria lack histonesLikewise, the RNAandproteincomponents of archaean ribosomes aremorelikethosein eukaryotes thanthosein bacteria. C H A P T E RI

I

L I F EB E G I N SW I T H C E L L S

archaeacell membraneshave chemical properties that differ dramatically from those of bacteria and eukaryotes. Many archaeansgrow in unusual,often extreme,environments that may resemblethe ancient conditions that existed when life first appeared on earth. For instance, halophiles ("salt loving") require high concentrationsof salt to survive, and thermoacidophiles("heat and acid loving") grow in hot (80' C) sulfur springs,where a pH of lessthan 2 is common. Still other archaeanslive in oxygen-free milieus and generate methane(CH+) by combining water with carbon dioxide.

U n i c e l l u l aO r r g a n i s m sH e l p a n d H u r t U s Bacteria and archaea, the most abundant single-celledorganisms,are commonly 1-2 pm in size. Despite their small size and simple architecture,they are remarkable biochemical factories,converting simple chemicalsinto complex biological molecules.Bacteria are critical to the earth's ecology, but some cause major diseases:bubonic plague (Black Death) from Yersiniapestis,strep throat from Streptomyces, tuberculosis from Mycobacterium tubercwlosis, anthrax from Bacillus anthracis, cholera from Vibrio cholerae, and food poisoning from certain types of E. coli and Salmonella. Humans are walking repositories of bacteria, as are all plants and animals.'We provide food and shelter for a staggering number of "bugs," with the greatestconcentration in our intestines.In return for the food and shelter that allow them to reproduce, bacteria help us digest our food. One common gut bacterium,E. coli, is also a favorite experimental organism. In responseto signalsfrom bacteria such as E. coli, the intestinal cells form appropriate shapesto provide a niche where bacteria can live, thus facilitating proper digestion by the combined efforts of the bacterial and the intestinal cells. Conversely,exposure to intestinal cells changes the properties of the bacteria so that they participare more effectivelyin human digestion. Such communication and responseis a common feature of cells. The normal, peacefulmutualism of humans and bacteria is sometimesviolated by one or both parties. When bacteria begin to grow where they are dangerousto us (e.g.,in the bloodstream or in a wound), the cells of our immune system fight back, neutralizingor devouring the intruders. Powerful antibiotic medicines,which selectivelypoison prokaryotic cells, provide rapid assistanceto our relatively slow-developingimmune response.Understanding the molecular biology of bacterial cells leads to an understanding of how bacteria are normally poisonedby antibiotics,how they becomeresistantto antibiotics, and what processesor structurespresent in bacterial but not human cells might be usefully targeted by new drugs. Like bacteria) protozoa are usually beneficial members of the food chain. They play key roles in the fertility of soil, controlling bacterial populations and excreting nitrogenous and phosphatecompounds,and are key playersin wastetreatment systems-both natural and man-made.These unicellular eukaryotesare also critical parts of marine ecosystems, consuming large quantities of phytoplankton and harboring photosynthetic algae, which use sunlight to produce biologically usefulenergyforms and small fuel molecules.

Enteringand Exitinga LiverCell Sporozoite S' vid"o: Plasmodium (b)

(a)

Redbloodcel ,I SPorulation

E *

,,

"F1 ,H;,",

\

Merozoites-

,11 )A

|,Ervuy rEo Gametocytes uo,

Huum maann F=>^

Mosquito

\ -\ / . / - \ - / /\ l,r'

+/L

I

+

( 0;r"""Y"!

FfGURE 1-4 Plasmodiumorganisms,the parasitesthat cause malaria,are single-celledprotozoanswith a remarkablelife cycle.ManyPlasmodium species areknown,andtheycaninfecta The hosts. varrety of animals, cycling betweeninsect andvertebrate fourspecies thatcausemalaria in humansundergo several dramatic (a)Diagram withintheirhumanandmosquito hosts. transformations of the lifecycleSporozoites entera humanhostwhenan infected Anopheles mosquitobitesa personfl Theymigrateto the liver, intothe wheretheydevelop intomerozoites, whicharereleased fromsporozoites, sothis bloodE. Merozortes differsubstantially "to transform" (Greek, isa metamorphosis or "many transformation merozoites invaderedbloodcells(RBCs) and shapes")Circulating producedby somePlasmodium reproduce withinthem B Proteins RBCs, causing the cellsto species moveto the surface of infected infected RBCs adhere to thewallsof bloodvessels. Thrsprevents fromcirculating to thespleen, wherecellsof the immunesystem theyharbor woulddestroy the RBCs andthe Plasmodium organisms in RBCs for a periodof time Aftergrowingandreproducing suddenly characteristic of eachPlasmodium species, the merozoites

from largenumbersof infectedcells4. lt burstforth in synchrony chillsthatare isthiseventthatbringson thefeversandshaking of malariaSomeof the released symptoms thewell-known a cycleof production creating RBCs, infectadditional merozoites intomaleand develop somemerozoites Eventually, andinfection. cells, These 5, anothermetamorphosis. femalegametocytes cannot whichcontainhalftheusualnumberof chromosomes, in bloodIo an Anopheles theyaretransferred for longunless survive gametocytes are the stomach, mosquito s In the mosquito. yetanother intospermor eggs(gametes), transformed flagellaon of longhairlike markedby development metamorphosis zygotesZ, of spermandeggsgenerates the sperm6 Fusion wallandgrowinto intothecellsof thestomach whichimplant of Rupture sporozoites for producing factories essentially oocysts, of sporozoites E; thesemigrateto the thousands an oocystreleases glands, settingthe stagefor infectionof anotherhuman salivary and of matureoocysts micrograph electron host.(b)Scanning stomach of sudace the external abut Oocysts sporozoites. emerging them that protects withina membrane wallcellsandareencased (b)courtesy of R E Sinden ] fromthe hostimmunesystem. lPart

However, some protozoa do give us grief: Entamoeba histolytica causesdysentery;Trichomonas uaginalis,vaginitis; and Trypanosoma brucei, sleeping sickness.Each year the deadliest of the protozoa, Plasmodium falciparum and related species,is the cause of more than 300 million new casesof malaria, a diseasethat kills 1.5 to 3 million people annually. These protozoans inhabit mammals and mosquitoes alternately,changing their morphology and behavior in responseto signalsin each of theseenvironments.They also recognize receptors on the surfacesof the cells they infect. The complex life cycle of Plasmodium dramatically illustrates how a singlecell can adapt to each new challenge it encounters(Figure 1-4). All of the transformations in cell type that occur during the Plasmodium Iife cycle are gov-

erned by instructions encodedin the geneticmaterial of this parasite and triggered by environmental inputs. The other group of single-celledeukaryotes, the yeasts, also have their good and bad points with respect to humans. as do their multicellular cousins, the molds. Yeasts and molds, which collectively constitute the fungi, have an important ecological role in breaking down plant and animal remains for reuse.They also make numerous antibiotics and are used in the manufacture of bread, beer,wine, and cheese.Not so pleasant are fungal diseases'which range from relatively innocuous skin infections such as jock itch and athlete's foot to life-threatening Pneumocystis carinii pneumonia, a common cause of death among AIDS patients. A N D C O M M O N A L I T YO F C E L L S THE DIVERSITY

VirusesAre the Ultimate Parasites

opportunity. Viral infections can be devastatingly destructive, causing cells to break open and tissuesto fall apart. However, many methods for manipulating cells depend on using virusesto convey geneticmaterial into cells.To do this, the portion of the viral genetic material that is potentially harmful is replaced with other genetic material, including human genes.The altered viruses, or vectors, still can enter cellstoting the introduced geneswith them (Chapter 9). One day, diseasescausedby defectivegenesmay be treated by using viral vectors to introduce a normal copy of a defective gene into patients. Current research is dedicated to overcoming the considerableobstaclesto this approach, such as getting the introduced genesto work at the right placesand trmes.

Not all microscopic pathogensare cells. The other most familiar disease-causingorganisms are the viruses, which make use of the machinery inside the cellsthey infect to copy themselves.Virus-causeddiseasesare numerous and all too familiar: chickenpox, influenza, some types of pneumonia, polio, measles,rabies,hepatitis,the common cold, and many others. Smallpox, once a worldwide scourge,was eradicated by a decade-longglobal immunization effort beginning in the mid-1960s. Mral infections in plants (e.g.,dwarf mosaic virus in corn) have a major economic impact on crop production. Planting of virus-resistantvarieties, developed by traditional breeding methods and more recently by geneticengineeringtechniques,can reduce crop lossessignificantly. Most viruses have a rather limited host range, infecting certain bacteria,plants, or animals(Figure1-5). Becausevirusescannot grow or reproduce on their own, they are in this sensenot consideredto be alive. To survive. a virus must infect a host cell and take over its internal machinery to synthesizeviral proteins and in some casesreplicate the viral geneticmaterial. When newly made virusesare releasedby budding from the cell membrane or when the infected cell bursts, the cycle starts anew. Viruses are much smaller than cells,on the order of 100 nanometer (nm) in diameter; in comparison, bacterial cells are usually >1000 nm (1 nm : 10-e meters).A virus is typically composedof a protein coat that enclosesa core containing the genetic material, which carries the information for producing more viruses (Chapter 4). The coat protects a virus from the environment and allows it to stick to, or enter,specifichost cells. In some viruses, the protein coat is surrounded by an outer membrane-likeenvelope. The ability of viruses to rransport genetic material into cells and tissuesrepresentsa medical menaceand a medical

The most remarkable feature of organismsis their ability to reproduce.Biological reproduction, combined with continuing evolutionary selectionfor a highly functional body plan, is why today's horseshoecrabs look much as they did 300 million years ago, a time span during which entire mountain ranges have risen or fallen. The Teton Mountains in S7yoming,now about 14,000 feet high and still growing, did not exist a mere 10 million years ago. Yet horseshoecrabs, with a life span of about 19 years,have faithfully reproduced their ancient selvesmore than half a million times during that period. The common impression that biological structure is transient and geologicalstructure is stableis the exact opposite of the truth. Despite the limited duration of our individual lives, reproduction gives us a potential for immortality that a mountain or a rock does not have. Whereas some species have changed little over great periods of time, other organismshave changeddramatically

(a)T4 bacteriophage

(b)Tobaccomosaicvirus

C h a n g e si n C e l l sU n d e r l i eE v o l u t i o n

,

50nm

,

(c) Adenovirus

A FIGURE 1-5 Virusesmust infect a host cell to grow and reproduce.Theseelectronmicrographs illustrate someof the structural variety (a)T4 bacteriophage exhibited byviruses. (bracket) attaches to a bacterial cellviaa tailstructureViruses that infect bacteria arecalledbacteriophages, (b)Tobacco or simplyphages. mosarc viruscauses a mottlingof the leaves of infected tobacco C H A P T E R1

I

L I F EB E G I N SW I T H C E L L S

plantsandstuntstherrgrowth.(c)Adenovirus causes eyeand respiratory tractrnfections in humans. Thisvirushasan outer membranous envelope fromwhichlongglycoprotein spikesprotrude [Part(a) from A Levine,1991, Viruses,ScientificAmericanLibrary,p 20 Part(b) courtesyof R C Valentine Part(c) courtesyof RobleyC Williams, Universityof Californial

during the same period. The changescame in responseto pressuresfrom the environment that causedincreasedsurvival of variant individuals. Both stasis and change are possible becausethe machinery of cells does an amazingly precisejob of copying geneticmaterial, yet its rare errors introduce some variation. If environmental conditions continue to select more or less the existing form, as in the caseof horseshoecrabs, the specieswill changelittle. If a new variant has a survival advantage, perhaps because conditions have changed, it may persist and replace the old form. Populations of bacteria exposedto antibiotics, for example, changetheir properties dramatically to escapeand live. They do this becauserare mutations, changesin the genetic material that allow antibiotic resistance,keep some cells alive while the cells without those mutations die. Most populations of any single specieshave a large repertoire of genetic alterations becausethere is a low but significant error rate in copying the genes.That error rate increasesin the presenceof radiation such as sunlight or certain chemical poisons. Current genomeproiects are exploring geneticvariation among humans. "The" human genome sequencethat has been determined already is just one version among billions. Understanding variation is essentialto learn how we respond differently to certain infections or drugs and to exploring how our geneticheritage combines with our experienceand learning to make each of us unique. Underlying the reproduction of organismsis the copying of cells, something that must be precise in order to control the size, shape, and organization of animals and to prevent unwanted growth, such as cancer.The cell is a machine that can copy itself, unlike viruses,which cannot do so on their own. As we will seein Chapters 20 and 21',the cell cyclefrom a single cell copying its own contents through division into two cells-is controlled by a seriesof elegant switches and cross-checking mechanisms. Reproducing cells accurately is a matter of life and death.

EvenSingleCellsCan Have Sex If genetic material was never shared or exchanged,each individual would be the beginning of a new clone of individuals, and the members of a clone would share most of the same genetic strengths and weaknesses.Sex is a processof mingling genetic variation from two individuals, creating new individuals with a combination of properties unlike either parent and that may be beneficial for survival and reproduction. Each chromosome except the sex chromosomes is representedtwice, one copy from the father and one from the mother. Since each pair of chromosomes trades piecesduring the formation of eggs and sperm, new combinations of genesare created and inherited together in the next generation-variation is accelerated. The other benefit of having two copiesof each chromosome is that a poorly functioning gene is backed up by the other copy. The common yeast used to make bread and beer, Saccharomycescereuisiae,appearsfairly frequently in this

Budding lS. cerevisi ael

1-6 The yeast Saccharomycescerevisraereproduces A FfGURE sexuallyand asexually'(a)Twocellsthat differin matingtype' calleda andcr,canmateto forman a/a cellIl. Thea anda cellsare theycontaina singlecopyof eachyeast meaning haploid, halfthe usualnumber'Matingyieldsa diploida/ctcell chromosome, Duringvegetative two containing copiesof eachchromosome. process an asexual by mitoticbudding, growth,diploidcellsmultiply a diploidcellsundergomeiosis, conditions, E Understarvation B. Rupture to formhaploidascospores typeof celldivision, special into whichcangerminate fourhaploidspores, releases of an ascus asexually E. (b)Scanning alsocanmultiply cells4. These haploid Aftereachbudbreaks of buddingyeastcells. micrograph electron buds free,a scaris left at the buddingsite,so the numberof previous (b) AbbeyA/isuals M bacteria are cells [Part canbe counted.Theorange lncl Unlimited, book becauseit has proven to be a great experimental organism. Like many other unicellular organisms' yeasts h"u. t*o mating types that are conceptually like the male and female gametes(eggsand sperm) of higher organisms'

ubiquitous. A N D C O M M O N A L I T YO F C E L L S THE DIVERSITY

.

7

We Developfrom a SingleCell In 1827, German physician Karl von Baer discovered that mammals grow from eggs that come from the mother's ovary. Fertilization of an egg by a sperm cell yields a zygote, a visually unimpressive cell 200 pm in diameter. Every human being begins as a zygote,which housesall the necessaryinstructions for building a human body containing about 100 trillion (1014)cells, an amazing feat. Development begins with the fertrlizedegg cell dividing into two, four, then eight cells, forming the very early embryo (Figure 1-7). Continued cell proliferation and then differentiation

Chapters 16 and 22. Making different kinds of cells-muscle, skin, bone, neuron, blood cells-is not enough to produce the human body. The cells must be properly arranged and organized into tissues,organs, and appendages.Our two hands have the same kinds of cells, yet their different arrangements-in a mirror image-are critical for function. In addition, many cells exhibit distinct functional and/or structural asymmetries, a property often called polarity. From such polarized cells arise asymmetric, polarized tissuessuch as the lining of the intestinesand structures such as hands and hearts. The features that make some cellspolarized and how they arise also are coveredin later chapters,including Chapter 21.

Video:EarlyEmbryonicDevelopment < FIGURE 1-7 The first few cell divisionsof a fertilized egg set the stagefor all subsequentdevelopment.A developing mouseembryois shownat (a)the two-cell,(b) four-cell, and(c)eight-cell stages. Theembryoissurrounded by supporting membranes. The corresponding stepsin human development occurduringthe firstfew daysafterfertilization. Researchers. IClaudeEdelmann/Photo I n cl

C H A P T E R1

I

L I F EB E G I N SW I T H C E L L S

Stem Cells,Fundamentalto FormingTissues and Organs,Offer MedicalOpportunities The biology of stem cells, cells that can give rise to specific cell types and tissues,has generated, great interest. 'We can 'Sfhen contrast stem cells to the simpler types of bacteria. a bacterial E. coli cell divides, both daughter cells are pretty much equivalent in content, size, and shape. In some other bacteria and in many casesof eukaryotic cell division, the two daughters differ in important ways. Although both will have the same genetic material, the cells may differ in size, shape, and contents. The cells may have different fates, that is, they may become different types of differentiated cell. A division that produces two different daughter cells is sometimes described as an asymmetric cell division. Stem-celldivisions are a specialcaseof asymmetric division. One of the two daughter cells is identical to the parent cell; the other follows a path of differentiation, such as becoming a blood cell. The parent cell, called a stem cell, can go on reproducing itself at every division, at each division also producing anorher blood cell. Mosr tissuesin our bodies form from stem cells. Blood, for example, is produced from stem cells that residein the bone marrow and continue to produce new blood cellsfor our entire lives. This is the basis of the often successfulbone marrow transplants that are used to treat cancer patients who have had their blood stem cells damaged by cancer treatments: what is being transplanted is stem cells.However, blood stem cells produce onlv more of themselvesand blood cells, not othir cell types. Thus eachtissuemust have its own stem cells,at leastduring the period of development when the tissue is formed. Stem cells for each tissue arise from even more capable stem cells that have the ability to form multiple stem cell types. The first stem cells are found in early embryos,where all the cells are capable of producing all cell types. In mammals the ultimate stem cell is the fertilized egg, which produces early embryo cells capable of forming all the tissuesof the body. This capability is illustrated by the formation of identical twins, which occur naturally when the mass of cells composing an early embryo divides into two parts, each of which develops and grows into an individual animal. This means that the cells cannor have divided up their embryo-forming duties prior to the time of embryo division. Each cell in an eight-cell-stagemouse embryo has the potential to give rise to any part of the entire animal. Cells with this capability are referred to as embryonic stem (ES)cells. As we will learn in Chapter 22, ES cells can be grown in the laboratory (cultured) and will develop into various types of differentiated cells under appropriate conditions. The ability to make and manipulate mammalian embryos in the laboratory has led to new medical opportunities as well as various social and ethical concerns.In vitro fertilization, for instance, has allowed many otherwise infertile couples to have children. One technique involves extractron of nuclei from defective sperm incapable of normally fertilizing an egg,injection of the nuclei into eggs,and implantation of the resulting fertilized eggsinto the mother.

In recent years, nuclei taken from cells of adult animals have been used to produce new animals. In this procedure' the nucleus is removed from a body cell (e.g., skin or blood cell) of a donor animal and introduced into an unfertilized mammalian egg that has beendeprived of its own nucleus.In a step that has now been done with mice, cows, sheep, mules, and some other animals, the egg with its donor nucleus is implanted into a foster mother. The ability of such a donor nucleusto direct the developmentof an entire animal shows that all the information required for life is retained in the nuclei of some adult cells. Sinceall the cells in an animal produced in this way have the genesof the single original donor cell, the new animal is a genetic clone of the donor (Figure 1-8), though the animals may differ anyway due to their distinct environments and experiences.Repeating the processcan give rise to many clones. Nuclei taken from ES cellswork especiallywell, whereasnuclei from other parts of the body at later times in life work far lesswell. The majority of embryos produced by this technique do not survive due to birth defects,so the donor nuclei may not have all the needed information or the nuclei may be damaged by the cloning process.Even those animals that are born alive have abnormalities,including acceleratedaging. The "rooting" of plants, in contrast, is a type of cloning that is readily accomplished by gardeners,farmers, and laboratory technicians. Scientific interest in the cloning of humans is very limited. Virtually all scientistsoppose it becauseof its high risk to the embryo (also, most people don't believe there is a

critical shortage of twins and triplets). Of much gteater scientific and medical interest is the ability to generatespecific cell types starting from embryonic or adult stem cells' This procedure, somatic cell nuclear transfer (SCNT)' produces cells that are grown in culture and never turned into

If the cells are produced using a donor nucleus from a patient, the properties of the cells may allow them to escaperejection by the patient's immune system,opening new possibilities for cell-transplanttherapies.

E

The Moleculesof a Cell

Molecular cell biologists explore how all the remarkable

ture and function.

Small MoleculesCarryEnergy,TransmitSignals, and Are Linkedinto Macromolecules Much of the cell's content is a watery soup flavored with small molecules (e.g., simple sugars' amino acids, vitamins) and ions (e.g.,sodium, chloride, calcium ions)' The locations conce.tirations of small molecules and ions within the "nd controlled by numerous proteins inserted in cellular are cell membranes. These pumps' transporters, and ion channels move nearly all small moleculesand ions into or out of the cell and its organelles(Chapter 11). One of the best-known small molecules is adenosine triphosphate (ATP), which storesreadily available chemical 'When ..r"rgy itt two of its chemical bonds (seeFigure 2-31)' cells"splitapart theseenergy-richbonds in AIP' the released ..r.rgy ."n b. harnessed to power an energy-requiring pro..tt such as muscle contraction or protein biosynthesis' 1-8 Fivegeneticallyidenticalclonedsheep.An early To obtain energy for making ATR cells break down food a FIGURE intofivegroupsof cellsandeachwas sheepembryowasdivided molecules.For instance, when sugar is degraded to carbon natural like the much mother, intoa surrogate implanted separately dioxide and water, the energy stored in the original chemical process of twinningAt an earlystagethecellsareableto adjustand bonds is releasedand much of it can be "captured" in ATP the cellsbecome laterin development forman entireanimal; (Chapter 72).Bacterial,plant, and animal cells can all make way andcanno longerdo so.An alternative progressively restricted ATP ty this process.In addition, plants and a few other orsingle-celled the nucleiof multiple isto replace to cloneanimals ganisms can harvest energy from sunlight to form ATP in with donornucleifromcellsof an adultsheep'Eachembryo embryos photosynthesis. ' was to the adultfromwhichthe nucleus identical will be genetically Other small moleculesact as signalsboth within and beto theseprocedures survive of embryos obtained.Lowpercentages tween cells; such signals direct numerous cellular activities on the givehealthy andthefull impactof the techniques animals, effect on our bodies of Library/Photo (Chapters iS uttd f e ;. fne powerful Photo Tompkinson/Science animalsis not yet known.lGeoff flooding of instantaneous the from comes a frightening event Incl Researchers, S F A CELL T H E M O L E C U L EO

O

9

the body with epinephrine, a small-moleculehormone that mobilizes the "fight-or-flight" response.The movements neededto fight or flee are triggered by nerve impulses that flow from the brain to our muscleswith the aid of neurotransmitters, another type of small-moleculesignal that we discussin Chapter23.

acids. Sugars,for example, are the monomers used to form polysaccharides. These macromolecules are critical structural components of plant cell walls and insect skeletons.A typical polysaccharideis a linear or branched chain of repeating identical sugar units. Such a chain carries information: the number of units. However, if the units arenot identical, then the order and type of units carry additional information. As we will seein Chapter 6, some polysaccharides exhibit the greaterinformational complexity associated with a linear code made up of different units assembledin a particular order. But this property is most typical of the two other types of biological macromolecules-proteins and nucleic acids.

ProteinsGive CellsStructureand perform Most CellularTasks The varied, intricate structures of proteins enable them to carry out numerous functions. Cells string together Z0 dif_ ferent amino acids in a linear chain to foim a protein (see Figure 2-14).Proteins commonly range in length from 100

to 1000 amino acids, but some are much shorter and others longer. We obtain amino acids either by synthesizingthem from other moleculesor by breaking down proteins that we eat. The "essential" amino acids, from a dietary standpoint, are the eight that we cannot synthesizeand must obtain from food. Beans and corn together have all eight, making their combination particularly nutritious. Once a chain of amino acids is formed, it folds into a complex shape,conferring a distinctive three-dimensionalstructure and function on each protein (Figure1-9). Some proteins are similar to one another and therefore can be consideredmembers of a protein family. A few hundred such families have been identified. Most proreins are designedto work in particular places within a cell or to be releasedinto the extracellular (extra, "outside") space.Elaborate cellular pathways ensurethat proteins are transported to their proper intracellular (intra, "within") locations or secreted (Chapters 13 and14). Proteins can serveas structural componentsof a cell. for example,by forming an internal skeleton(Chapters tO, tZ, and 18). They can be sensorsthat changeshapeas remperature, ion concentrations, or other properties of the cell change. They can import and export substancesacross the plasmamembrane(Chapter11). They can be enzymes,causing chemicalreactionsto occur much more rapidly than they would without the aid of theseprotein catalysts(Chapter 3). They can bind to a specificgene,turning it on or off (Chapter 7). They can be extracellular signals,releasedfrom one cell to communicatewith other cells, or intracellular signals, carrying information within the cell (Chapters 15 and 16). They can be motors that move other moleculesaround, burning chemicalenergy (ATP) to do so (Chapters17 and 1g).

Insulin

Glutaminesynthetase Lrturamtne synthetase

Hemoglobin

FIGURE 1-9 Proteinsvary greatly in size,shape,and function.Thesemodels of thewater-accessible surface of some representative proteins aredrawnto a commonscaleandreveal the numerous projections andcrevices on thesurface. Eachprotern hasa definedthree-dimensional shape(conformation) thatisstabilized by numerous chemrcal interactions discussed in Chapters 2 and3. The illustrated proteins include (glutamine enzymes synthetase and

10

C H A P T E R1

|

L | F EB E G T N W S |TH CELLS

DNA molecule

lmmunoglobulin

Adenylate K tn a s e

L i p i db i l a y e r

adenylatekinase),an antibody(immunoglobuiln), a hormone (insulin), and the bloods oxygencarrier(hemoglobin)Modelsof a segmentof the nucleicacid DNA and a smallregionof the lipid bilayerthat formscellularmembranes(seeSection1.3)demonstrate the relativewidth of thesestructures comparedwith that of tvpical proteins.[Courtesy of GarethWhite]

LI

'l'll)

v lo slln)r'lot^ tH_

puerls(^reluaLualduol) lolqOnep^^ououo 'xrlaqa;qnop pue spuerlsleur6uoor..l1 leurbrLo +o ouo 6urureluorqleo arnpold eq11o serdo>oMl sr aLr-ro)]no oLlf spuerlsAreluaueldLuor 'uorlerrldar ol saleldual se pesnpue punoMUnare spuerlsoM] aql

6utn6 Qq6ry)seseqg pue I aql uoaMlaqpuesaseqf pue slxtloqalqnop spuoqua6otp,iq V oql uaoMloq )eoM{q paztltqels slqnop e urol ol raqlo q)ea punole punoM aqlQlal,'xrlor.l spuerlsfuelueurelduo) orv\llo slslsuo)VNC 0t-l lunglJ V

spuerls ra1q6ne6

'g rardeq3 ur lretepur uortElsuertpuB uorldrrrsuPrl lno d.rrel leqt stuauodruor IIer eql euruexe al1 'opof, f,rteu -aE les.ra.trundlreeu aql ot Surprorre aruanbasVNUIU oqr dq parelrrp rap.ro asne;d eqt ur sprre ourrue raglaSol s>1ur1 (uorlelsuB-rl SurrnC 'uorlelsueJl pue selqtuesseatuosoqrrar{l pell€r 1na u1 vNd IBrlrur aqr vNC Sursnureqr VNU p otur saprloe]f,nuJo a8e>1ur1 aql sez.{1etec 'au.,(zua 'VNC 'aserorudlod y51g e8rel pepuens-alqnop V eql Jo uorsre^ (VNU) prJp Jrelf,nuoqrrpepuerts-a13urs e otur pardor sr aua8 e yo uor8er Surpor eqt 'uorldrrcsuprl pellel 'rs-rr; '(II-I aqt uI arn8lg) suretordorur VNC ur uorlerurot -ur pepol aqt ol sorrasur sessecordo.la.lesn slla] lJeluor 'opuru sr uratord Jr{t sllal qlrr{.a uI puE uel{,{\ slorluof, teqt uo8al Ktolap8at E pue urelord e ;o acuanb -es prf,p ounue aqt sarpads rcq7 uot8at Surpoc e :strud orrrl ureluoJ dluorutuoc suralord 3ur1eu Jot suorlfnJlsur d.r.rer teqr saue8eql'000'SZ-000'02 lnoqe'suerunq lsaue8pues -noqt .,taale e^eq errolf,pq tso14 '3uo1 seprloallnu 000'00I or 000S a.re dlyecrddrqlrq^\ 'souo8 eql (strun leuorlrunt elerrslP olul poPI^lPsl VNq Jo uorlrod Surreaq-uotlEturolul oql 'puerts e 3uo1esoprloalJnuJo rapro reaurl Jrll 'aluenb -esslr ur seprser VNC dq perrrpr uorteruroturlrleueg or{J. 'gfleru lou oP ]Pql sPuprls ror{rodueu sureluotroslEuorl vNC -nlos oqt ue^a 'Surraddrzot peal 'r llr.{\ puerts dretuauralduroc rel{lo eqt Surureluocuortnlos e ur raded aql Suopos taded 'alduruxerod ;o aoarde o] Paqleue pue par;rrndsI puerls auo;t reqlo aql Sursnpue.rtseuo Surlcalaprot Intesndlauarlxa sruorl -enpuq;1.i:rl prf,e f,rolf,nur.lrns 'suorlrpuoo arnle.radtuetpue tles drz dlsnoauetuods11,udaqt 'pale.r rq8rr eqr ur raqtaSor 4ceq -edes a.le spuprts .,(reluerualduol teqt Suols os sr spuerls Jr o.,rueqr;o Surqrreru,{-ruluaualduol srr{J '(91-1 arn8r4)3 e qtr.&\peqlteru sr J qrea pue 1 e ser1puerls reqlo eqt 'y ue seq pupJls ouo Jeleror{,la.:uouJnrlsuof aydrursp spr{ x[eq elqnop 'puens rqr VNC r{leg to auoqlleq lerqeq eqr tuo4 lno Sunoal 'puerts -ord stred eseq eqt qtrlr E ur puo ol pua paurol VNCI are '9 pue 'J t'V peter^argqe'seprtoalcnuluora11rp rnoC

'(y .rardeq3)saseqctue8ro rtlcdc ureluor sernlrnrts rrar.{lasnEreqsaspqse ol perraJererP uelto Oseql:sJPlloelJnu pellel sreuouoru Jo pasoduor are spupns VNC 'x1eq elqnop e Sururol 'srxe uoruruor e punore polrol ere lpqt spuerts IeJrlor{3uo1om.lJo stsrsuoJVNC Jo arnlfnrls IeuoIS -uaurp-oorr{l eql '(VNC) prf,p f,Ielf,nuoqrrfxooppaller retu -d1od 'lerroleru aqt uI peur€r sr utelord Jo pul>ltllee e crlaua8 acnpord ot aJor{1\l. pue 'uaqrrt hrroq rnoge uoIleIUJotuI oql

a)eld pue ourrl lq6tu aql le surelord6ur4ey1ro; uolleturo+ulpapo) f.r.re1sp!)v )rel)nN '(solnralou 80I x S) utlle utotord IErnltnDS lu€punqE eqr or (salncalotu000'02) utalo.rdroldoc 'dleprm -a.r sutetord alrnb eqt uo.r; sarrB,r Surpurq-urlnsur erpr 'e8e.ra,reuo urolord tuere;trp Jo eruepunqe aql 'lce1 u1 1o addr qree Jo selnrelouruorlpu e ot osolf,suleluol IIOJE snqr isurelord ruere;Jrp000'0I rnoqe suleluor IIat re^II p leq] raprsuoJ taqrrny dels auo uollelnf,lef, srqt drrec oI '(Ez0I x ZO'9) punoduor lerlueqr due 1o ayourrad salnrelotu Jo requnu eql laqunu s,orpeSorrypue lq8ra,t uratord Ielol eqt trrorl sp IIer re^II .radsalncalou utarord 60I x 6'L lnoqe 'suratord f,rlofre>lna to reqrunu letor oqt elelnllel uer e,l.r '(1ou73) 00L'TS yo rq8rorr ;o lerrddr sr enlE^ srql Surunssy relnrelorrr p seq uratord lseef e8erarreeql '3 or_0I x L er{r 'tq8ta,trs(ller e to tuer sr ureto.rdrelnller rq8rarvr ;o I€tol -nd 97,,(laleturxo.rddpro; slunoJJe uralord erur5 '3 r_0I x g'g q8ra.uplno.vi aql'1uF E0'I Jo &lsuep 11ec e Sururns IIer -sy '(s;arqqlur ro) etunlol e seg 'aprse e*l o_0I x V't p srql '(1ac re,rr1) uo (tuc rurl eqnr E ,{1q3nor'11ac SI SI00'0) 'req ardcoledeqe se r1rns'11accrlodre>1ne lerrd& e a4et s.ta1 -unu srqt eterurtseoJ 'lasrr urelureru pue alerado ol spJJu IIar e selnrelotu urarord dueur .uoq >1serq8nu a^.\txaN 'dtlulJul 3uo1e pre,&ol 1a,'nsr sutetord algrssodIo reqrunu .ro'alqetsun'luele.trnba llleuorr eqt'elqElunorsrpasr,&\rar.{lo 'seruanb -lunJ dueru aq asaql Surunsse ua,tg p1no.l.r leqt Jo '3uo1 sprre -as uralord luereJJrp alqrssod oov17ere araqt ounue 00t rnoqe sr ureto.rd..1errddl,,E Jr lng 'ecue13lsrr; re alqrssodrursrueestI is>lserperre^ eseqlurotred or papaeu surolord ruereJtrpoqt IIE ruroJ splre ouIIuE 0Z uel ,{\oH

ur pegrrtsap are aruosrldarer{r Jo sluauodruol raqto dueru aql lpue;rs VNC € otur seprtoepnu Surlury ro; alqrsuodsa_r sr eserau,(1odVNq 'leur8r.roeql ot Iefrluepr ql€e ,serrlaq elqnop 1o ;red e sr eruortno eqI .(0I-I a.rn8rgaas)pue_us dreruetualduoJ 1y\eue olur saprloopnu elquesse ol aleldual e se qrea sasnpup seuosoruorql eqr ul vNC Ielrleq PuErls -elqnop spuertso.,vrtrqt seteredas,aruosrlde.r eqt (eurqrpru Jo uorlerrlda.ruralordrllnru a8rel e ,saprlrp 11ace arurl d.ra,rg 'pec ol 'JlpLlreqlo eq.l 'asaql !tuoy41o1 IlEq peJen og UEJ'seue8eqt;o JIeq snLlrpue '(71-1 ern8r4)sauosoruorqr seq uerunq Jo 'lpH 9t IIal lpur -rou dre,te 'rulads pue s33a uondarxe egr qtrl1 .VNC 1o to luerualduror eJrluastr sasr.rduorrusrue8roue ;o auroua8eq1 '(e7-1 a-rn8r1 aes) aql yo uor8arI€rtueJaqt ur ,saurt duetu 11ac 'sat1alncalorusrqr lq13ua1ur ralaurllru Jlesrluo >lrEqPePIoJ B tnoqE alnrelotu VNC relnrrrr a13ursB ur sJprseruorterurot 's11arrrtodrelord u1 'suretord -ut cttaue83qt to IIe ro tsoru urEtJaJqtr.4apelerJosseelnfelou VNC Jeeurl a13urse surel -uor aruosoruonll qleg '(9 ;erdeq3) saruosoruorrlf,se.{\ou{ J^\ soJnlJnrls JprlrrueJor.[l olur peplot dle,rrsuelxa ,snap -nu agl ur petef,ol sr sllJJ lrodrelna ul VNC er.[]Jo rsory

u o t s r ^ t ol l o ) 6 u u n c p o l e ) r l d o up u e saurosotuotq)olur pa6e{)ed sl oruouagoql 'paroldxa Surag ere uorteln8e.r 11rrs ,saue8 1o ed& srql Jo &rnbrqn pue sursrupq)au eql qSnoql II€ ro tsoru alelnSer deu sygg llerus seteturlsaaruos dg 'sldrrcsuerlauaS;o drrpqerspue uortrnpord ,uors Surtuln8er -sardxa aue8 uo tleJJef,rt€uerp p e^eq uel selnrelour VNU 'serurtrq8u aqr sllet le rq8rr aqr ur saua8tq8u or1tsale^ IIpruS -ItrE legt ualsds IortuoJ alrsrnbxaup ruroJ ol padoldruaa.re srolreJ uotldtnsue;l lueretlrp Jo sperpunq 'susruefiro xald -ruoJ ul 'seua8pereln8er aqr Suqcalasol dlpr;rceds Surpurq -VNC u,4o str Surtnquluoc uralord auo ueql JJou qlr.^A 'saxaldruor uleloJdrtlnu sE lJo,ln uouo sJolfet uortdr.rrsuerl ']as eqt ur aueSqrea rEau lsrxo rotret teqr roJ satrsSurpurq ;r seua8Jo las E eteln8er dlateurproor uer rotf,€J uortdr.rcs 'uorssarda;pue uortelrl -uert Jo addl auo 1o serdocaldrrlnyq '11ar -re eua8 e Jo drlclJlradseqt Suunsue ;o VNC aql ur rnl -lo e dlug .seprtoaltnu IIr.^aacuanbesrJf,nsqrpe 1o sardor.ra.a1 rnoJ Jo due aq uec uortrsodr1f,Ee erurs (9tS'gV1't) saruanb -as alqrssod o^eq uec s.rred espq 0I Sururetuor ylrlq 0rt '3uo1srred aseq y51q ;o ruaru8asy ZI-9 $oqe seouanbes t.roqs azruSoJerllr,l.r'uralord Surpurg-y51q e d1lecrdd1 'VNC s,ller e ut luaserdspuesnoqlJrll Jo rno seue8,ua1e tsnl 1o suor8a.rdroleln8ar aqr o1 dlyerluare;ardpurq ot elqp ere .{eql reql dlasnard os pedeqs are srotreJ uortdrrrsue{ '(1 retdeq3) saue8 relncrtred ;o uortdursuerl Surssard 'saqrlr,rs sE tJE pue -ar ;o SurtB,r.rlJe JerJlre VNC ot purq (srolreJuorldrrrsuprl qcrq,rrr pallEt suralordSurpurq-ypq uo spuadapdtr,rrlceaua8yo lortuoJ r{tns 'speeuluorrnr }eetu ol 'go surato.rd;o arrolrada.r rragl Surldepe ,(qareqr ro uo saue8 rrPeds Suturnt dq suortrpuof, ur se8ueqc.ro sleu8rs leuJetxe 'esrol aJrApue IeuJetxeot puodsa;ue) sllJJlueru taaoerory s11ecdaupr>1,{q peenpord tou er€ teqt suralord oruos ernp -ord s1larra,tq dq,rrr. s(teqJ 'sureto-rdaleu ot pesn pup (uo paurnt lo 'a,ttlf,eare saua8esoqtJo eruosdluo ad.{rIIac r{rea

s r r r ) H r M s N r g r sl j r ' r I

t u:ravul

zl

ur tnq 'seua3ueunq to tes IInJ aql uretuor serpogrno ur sllar eL[] IIE dl.reau'aruetsur roC 'paquf,suurl aq UEJ seua8rraql eJeq.4 pue uoq,lt IoJluoc ol sde,,vreleq s{usrup8ro 11y ' u r a t o r do t u l s J l n f , 'salncalotuy51a re8rel -elou VNUIU to uouplsuerr eqt pue (seLuosoluorqr Jo drlllqers eql Jo uollrunJ Pue erntf,nrts '3uo1 sepnoepnu 'sVNU aqr aleln8a.rd11err;roads 002-02 'dr{lqers pue Surssecord VNU pue ornl Ilprus sas€f,dueru u1 -fnrts eruosoruoJqlSurpnycurtlrrrrlre eua8 slf,odseduetu 1o Suneln8e.rur alor tuet.rodurr flqelreua; e Aeld ol puno' ueaq osle ser{VNU 'flruareg razrsaqludsuratord pue repear VNUIU luarrr]'a pue asrcard dlqe>1reua.rp a{pru ol surel -ord 69 ueqt eroril qlrrr,rdn rueat leqt sureqf,VNU JnoJ seq euosoqrr agt (oldurexa roC 'aurLlleru rplnlelou e Surplrnq ro; {ro^\euer; E se enres uer y51g 'useldoldc ol snolf,nu ruoJJ uorleruro;ur Surr.ra;supJlur aloJ slr ol uortrppe uI

ureqlrpourle olurspr)eouru.re 6ur1ur1 {1;erruaqr {q ureloLd e puearuenbes slrpear]eql sourosoqu {q punoqsr}r oloqm alqrlosse 'useldoyb y11y (VNUul) eq] o1 sa^oLr; rebuesseu ernleur oql 'llo) p ul :E de15saruanbas 6urporuou oAoLUar o1pessa:ord rrloi{re>1ne sr aq1: E dals eleldua]e sespuer]s ldursuerl VNCaq],o auo pepuerls-a16urs 6ursn]drnsuert e olurseprloapnu 6ur>1ur1 VNUU-ard esereuri;od aq_La]rsuelsoq] 'uorle)ol>rloeds VNc oq] 6uo;esenou.r 'VNC ue,Louorldursuerl sur6aq asereu{1od e ]e auebpale^r])e VNU aq]o] punoqxelduoruorlpr]rur ure1o.rdr1lnu e 1o{lquasse6urnnollo3 : g da15uJeq]ole^r]lepuelorluo),{eq}seue6:r;r:edsaq11o ,lo1eln6er aql o1purqsrolreluorldursue{:It da15'ssarord suor6el delsrllnu e {q surelold;o saruenbaspr)eourue oq} o}ul pouo^uo)s! vNc u! uollewrolu!papo)aqM-! lun9lJ v ureq3prce ouil..uv I 1 I I

v l g 1 o u o r o e ro u r p o c u o N V r u U ; ou o t 6 a l6 u t P o c - u t a 1 o l 3 vNc Jo uorOorpaqrrcsuerluoN -n2q2q2qa V N C + o u o r 0 o rp a q u 3 s u e {

uollolJcsue{

d uorleAllcv

can be "painted" for easy 1-12 Chromosomes FIGURE A normalhumanhas23 pairsof morphologically identification. fromthe onememberof eachpairis inherited chromosomes; distinct motherandthe othermemberfromthefather(Left)A chromosome whenthe froma humanbodycellmidwaythroughmitosis, spread wastreatedwith Thispreparation arefullycondensed chromosomes reaqents thatalloweachof the 22 pairs staininq fluorescent-labeled

Chapter 4. The molecular design of DNA and the remarkable properties of the replisome ensure rapid, highly accurate copying. Many DNA polymerasemoleculeswork in concert, each one copying part of a chromosome.The entire genome of fruit flies, about 1.2 x 10o nucleotideslong, can be copied in three minutes! Becauseof the accuracyof DNA replication, nearly all the cells in our bodies carry the same genetic instructions, and we can inherit Mom's brown hair and Dad's blue eyes. A rather dramatic example of genecontrol involves inac'Women tivation of an entire chromosomein human females. have two X chromosomes,whereas men have one X chromosome and one Y chromosome, which has different genes than the X chromosome. Yet the genes on the X chromosome must, for the most part, be equally active in female cells(XX) and male cells(XY). To achievethis balance'one of the X chromosomesin female cells is chemically modified and condensedinto a very small mass called a Barr body' which is inactive and never transcribed. Surprisingly,we inherit a small amount of geneticmaterial entirely and uniquely from our mothers. This is the circular DNA present in mitochondria' the organelles in eukaryotic cells that synthesizeAIP using the energy released by the breakdown of nutrients. Mitochondria contain multiple copies of their own DNA genomes,which code for some of the mitochondrialproteins(Chapter6). Becauseeachhuman inherits mitochondrial DNA only from his or her mother (it comes with the egg but not the sperm), the

colorwhen to appearin a different andtheX andY chromosomes of multiplex Thistechnique microscope viewedin a fluorescence (M-FISH) iscalled sometimes in situhybridization fluorescence (RiSht) fromthe (Chapter Chromosomes 6) painting chromosome orderof size, in pairsrndescending preparation on the leftarranged of X andY chromosomes Thepresence an arraycalleda karyotype. of M R Speicher] asmale [Courtesy the sexof the individual identifies

distinctive features of a particular mitochondrial DNA can be used to trace maternal history. Chloroplasts, the organelles that carry out photosynthesisin plants' also have Ih.i, o*tt circular genomes'Both mitochondria and chloroolasts are believedto be derived from endosymbionts,bacteii" th"t took up residenceinside eukaryotic cells in a mutually beneficialpartnership.The mitochondrial and chloroplast circular DNAs appeatto have originated as bacterial genomes' which also are usually circular,though the organellegenomes have lost most of the bacterialgenes.

Mutations May Be Good, Bad,or Indifferent Mistakes occasionallydo occur spontaneouslyduring DNA replication, causing changesin the sequenceof nucleotides' Soch ch"ng.s, or mutations, also can arise from radiation that causesdamageto the nucleotidechain or from chemical poisons, such as those in cigarette smoke, that lead to errors iuring the DNA-copying process (Chapter 25)' Mutations .o-.1., various forms: a simple swap of one nucleotide for another; the deletion, insertion, or inversion of one to millions of nucleotides in the DNA of one chromosome; and translocation of a stretch of DNA from one chromosome to another. In sexually reproducing animals such as ourselves,mutations can be inherited only if they are presentin cellsthat potentially contribute to the formation of offspring' Such germJine cells include eggs'sperm' and their precursor cells' T H E M O L E C U L EOSF A C E L L

O

13

Body cells that do not contribute to offspring are called somatic cells. Mutations that occur in these cells never are inherited, although they may contribute to the onset of cancer. Plants have a less distinct division between somatic and germ-line cells, since many plant cells can function in both capacltres. Mutated genesthat encode altered proteins or that cannot be controlled properly ."u.. .rurn..ous inherited diseases.For example, sickle-celldiseaseis atributable to a single nucleotide substitution in the hemoglobin gene, which encodesthe protein that carries oxygen in red blood cells. The single amino acid changecausedby the sickle cell muta-

Sequencingof the human genome has shown that a

transcription factors typically are only 70-12 nucleotides long, a few single-nucleotidemutations might convert a nonfunctional bit of DNA into a functional protein-binding regulatory site. Much of the nonessentialDNA in both eukaryotesand prokaryotes consistsof highly repeatedsequencesthat can move from one place in the genome to another. These mobile DNA elementscan jump (transpose)inro genes,most commonly damaging but sometimes activating them. Jumping generallyoccursrarely enoughto avoid endangering the host organism. Mobile elements,which *... di.coveredfirst in plants, are responsiblefor leaf color variegation and the diverse beautiful color patterns of Indian corn kernels.By jumping in and out of ge.resthat control prgmentationas plant developmentprogresses,the mobile elemenrsgive rise to elaboratecolorid putt...rr. Mobile elements were later found in bacteria, in which they often carry and, unfortunatelS disseminategenesfor antibiotic resrstance. Now we understand that mobile elements have multi_ plied and slowly accumulatedin genomesover evolutionary time, becoming a universal property of genomesin preseni_ day_organisms. They account for an astounding45 percent of the human genome. Some of our own mobile DNA ele_ ments are copies-often highly mutated and damaged_of genomesfrom viruses that spend part of their life iycle as DNA segmentsinserted into host-cell DNA. Thus we carry in our chromosomes the genetic residues of infections ac_ quired by our ancestors.Once viewedonly as molecularpar_ asites,mobile DNA elementsare now thoueht to have ion_ tnbuted significantly to the evolution of higher organisms (Chapter6). '14

.

cHAprE1 R | L | F EB E G t Nwsl r H c E L L s

IE

TheWorkof Cetts

In essence,any cell is simply a compartment with a watery interior that is separatedfrom the external environment by a surfacemembrane (the plasma membrane) that preventsthe free flow of moleculesin and out. In addition, as we've noted, eukaryotic cells have extensive internal membranes that further subdivide the cell into various comparrmenrs, the organelles.Each compartment has contents and properties, such as specializedproteins or a certain pH, suited to its job. The plasma membrane and other cellular membranes are composedprimarily of two layers of phospholipid molecules. These bipartite moleculeshave a "water-loving" (hydrophilic) end and a "water-hating" (hydrophobic) end. The two phospholipid layersof a membrane are orienred with all the hydrophilic ends directed toward the inner and outer surfacesand the hydrophobic ends buried within the interior (Figure1-13). Smalleramounts of other lipids, such as cholesterol, and many kinds of proteins are inserted into the phospholipid framework. The lipid moleculesand someproteins can float sidewisein the plane of the membrane,giving membranes a fluid character. This fluidity allows cells to change shape and even move. However, the attachment of some membrane proteins to other molecules inside or outside the cell restricts their lateral movement. We will learn more about membranes and how molecules cross them in Chapters10 and 11. The cytosol and the internal spacesof organellesdiffer from each other and from the cell exterior in terms of aciditg ionic composition, and protein contents. For example, the composition of saltsinside the cell is often drastically different from what is outside. Becauseof these different ,,microclimates," each cell compartment has its own assigned

Cholesterol

Water-seeking h e a dg r o u p

Water

FIGURE 1-13Thewatery interiorof cellsis surroundedby the plasmamembrane,a two-layeredshell of phospholipids. Thephospholipid molecules areoriented with theirfattyacylchains (blacksquiggly lines) facinginwardandtheirwater-seeking head groups(whitespheres) facingoutward.Thusbothsidesof the membrane arelinedby headgroups, mainlycharged phosphates, adjacent to thewateryspaces tnside andoutside thecell.All biological membranes havethesamebasicphospholipid bilayer structureCholesterol (red)andvarious (notshown)are proteins embedded in the bilayer. Theinteriorspaceisactually muchlarger relative to thevolumeof the plasma membrane depicted here.

tasks in the overall work of the cell (Chapters 10, L2, and 13). The unique functions and microclimates of the various cell compartm€nts are due largely to the proteins that reside in their membranesor interior. 'We can think of the entire cell compartment as a factory dedicatedto sustainingthe well-being of the cell. Much cellular work is performed by molecular machines, some housed in the cytosol, some attached to the cytoskeleton' and some in various organelles.Here we quickly review the major tasks that cells carry out in their pursuit of the good life.

Cells needto break down worn-out or obsoleteparts into small molecules that can be discarded or recycled' This housekeepingtask is assignedlargely to lysosomes,organelles crammedwith degradativeenzymes.The interior of a lysosome has a pH of about 5.0' roughly 100 times more acidic than that of the surrounding cytosol. This aids in the breakdown of materials by lysosomal enzymes' which are specially

CellsBuild and DegradeNumerous Moleculesand Structures As chemical factories,cells produce an enormous number of complex molecules from simple chemical building blocks. All of this syntheticwork is powered by chemical energy extracted primarily from sugarsand fats or sunlight, in the case of plant cells, and stored primarily in ATP, the universal "currency" of chemical energy (Figure 1-14). In animal and plant cells, most ATP is produced by large molecular machines located in two organelles,mitochondria and chloroplasts. Similar machines for generating ATP are located in the plasma membrane of bacterial cells. Both mitochondria and chloroplasts are thought to have originated as bacteria that took up residenceinside eukaryotic cells and then became welcome collaborators (Chapter 12). Directly or indirectlS all of our food is created by plant cells using sunlight to build complex macromolecules during photosynthesis. Even underground oil suppliesare derived from the decay of plant material.

llll+ overviewAnimation:BiologicalE

Most of the structural and functional properties of cells de-

cell and most membrane proteins, however' are made on ribosomes associatedwith the endoplasmic reticulum (ER)' This organelleproduces,processes'and ships out both proteins and lipids. Prolein chains produced on the ER move to the Golgi comple*, where they are further modified before being for*ari.d to their final destinations. Proteins that travel in this way contain short sequencesof amino acids or attached sugar ch"itts (oligosaccharides)that serve as addressesfor directing them to their correct destinations. These addresseswork becausethey arerecognizedand bound by other proteins that do the sorting and shipping in various cell compartments'

lnterconversions or Light (photosynthesis) compoundswith high potentialenergY(resPiration )

Synthesisof cellularmacromolecules(DNA, RNA, proteins, polysaccharides)

Synthesisof other cellularconstituents (suchas membrane phospholipidsand certainrequired metabolites)

Cellularmovements, includingmusclecontraction,crawling movements of entire cells, and movement of chromosomesduring mitosis

A FIGURE1-14 ATP is the most common molecule used by cells to capture and transfer energy. ATPis formed from ADP and in plantsand by the inorganicphosphate(Pi)by photosynthesis

Transportof moleculesagainst a concentration

gradient

Generationof an electricpotential acrossa memDrane

Heat

for nerve 1fi..:.,;t;,",

by andfatsin mostcells.Theenergyreleased of sugars breakdown processes (hydrolysis) of PifromATPdrivesmanycellular thesplitting

THEWORK OF CELLS

15

lntermediate f ilaments

Microtubules

FIGURE 1-15 The three types of cytoskeletalfilamentshave characteristic distributionswithin cells.Threeviewsof the same cell.A cultured fibroblast wastreatedwith threedifferent antibodv preparations. Eachantibody bindsspecifically to the protein monomers formingonetypeof filamentandischemically linkedto a differently colored fluorescent dye(green, blue,or red).Visualization

A n i m a l C e l l sP r o d u c eT h e i r O w n E x t e r n a l E n v i r o n m e nat n d G l u e s The simplest multicellular animals are sinsle cells embedded in a jelly of proteins and polysaccharides."ll.d th. extracellular matrix. Cells themselvesproduce and secretethesematerials, thus creating their own immediate environment (Chapter 19). Collagen, the single most abundant protein in the animal kingdom, is a major component of the extracellular matrix in most tissues.In animals, the extracellularmatrix cushions and lubricates cells. A specialized,especially tough matrix, the basal lamina, forms a supporting layer un_ derlying sheetlikecell layers and helps pr.u"rrt the cells from rlppmg apart. The cells in animal tissuesare ..glued" togerher by cell_ adhesionmolecules(CAMs) embeddedin their surfacemem_

Microfilaments

of the stainedcellin a fluorescence microscope reveals the location of filaments boundto a particular preparation dye-antibody In this case,intermediate filaments green;microtubules, arestained blue; and microfilaments, red.All threefibersystems contributeto the shapeandmovements of cells.lcourtesy of V Small ]

animal cells (Figure 1-15). The cytoskeleton prevents the plasma membrane of animal cells from relaxing into a sphere(Chapter 10); it also functions in cell locomotion and the intracellular transport of vesicles,chromosomes, and macromolecules(Chapters 17 and 18). The cytoskeletoncan be linked through the cell surfaceto the extracellular matrix or to the cytoskeletonof other cells,thus helping to form tissues(Chapter 19). All cytoskeletal filaments are long polymers of protein subunits. Elaborate systemsregulatethe assembly dirursembly of the cytoskeleton,thereby controlling cell".rd shape.In some cells the cytoskeletonis relatively stable, but in others it changesshapecontinuously. Shrinkageof the cytoskeleton in some parts of the cell and its growrh in other parts can produce coordinated changesin shape that result in cell locomotion. For instance,a cell can send out an extensionthat attachesto a surfaceor to other cellsand then retract the cell body from the other end. As this processcontinues due to coordinated changesin the cytoskeleton,the cell moves forward. Cells can move at rates on the order of 20 pm./second.

C e l l sC h a n g eS h a p ea n d M o v e

largement but not movement of cells from one position to another.

Cells changeshapeand move becausetheir internal skeleton. the cytoskeleton,exerts forces on the rest of the cell and its

CellsSenseand SendInformation

attachments- Three types of protein filaments, organized into networks and bundles, form the cytoskeleton within

A living cell continuously monitors its surroundings and adjusts its own activities and composition accordingly. Cells also communicate by deliberatelysendingsignalsthat can be receivedand interpreted by other cells. Suchsignalsare com_ mon not only within an individual organism but also be_ tween organisms.For instance,the odor of a pear signals a food source to us and other animals; consumption of the

16

.

c H A p r E1R | L I F E B E G t Nwst r H c E L L s

pear by an animal aids in distributing the pear'sseeds.Everyone benefits! The signals employed by cells include simple small chemicals, gases, proteins, light, and mechanical movements. Cells possessnumerous receptor proteins for detecting signals and elaborate pathways for transmitting them within the cell to evoke a response.At any time, a cell may be able to senseonly some of the signalsaround it, and how a cell responds to a signal may change with time. In some cases,receivingone signal primes a cell to respond to a subsequentdifferent signal in a particular way. Both changesin the environment (e.g.,an increaseor decreasein a particular nutrient or the light level) and signals receivedfrom other cells representexternal information that cells must process.The most rapid responsesto such signals generally involve changesin the location or activity of preexisting proteins. For instance, soon after you eat a carbohydrate-rich meal, glucosepours into your bloodstream.The rise in blood glucose is sensedby B cells in the pancreas, which respond by releasingtheir stored supply of the protein hormone insulin. The circulating insulin signal causesglucose transporters in the cytoplasm of fat and muscle cells to move to the cell surface,where they begin importing glucose. Meanwhile, liver cellsalso are furiously taking in glucosevia a different glucosetransporter.In both liver and musclecells, an intracellular signalingpathway triggeredby binding of insulin to cell-surfacereceptorsactivatesa key enzymeneeded to make glycogen,a large glucosepolymer (Figure 1-16a). The net result of thesecell responsesis that your blood glucoselevel falls and extra glucoseis stored as glycogen,which your cells can use as a glucosesource when you skip a meal to cram for a test. The ability of cells to send and respond to signalsis crucial to development. Many developmentallyimportant signals are secretedproteins produced by specific cells at specific times and places in a developing organism. Often a receiving cell integratesmultiple signals in deciding how to behave,for example, to differentiate into a particular tissue type, to extend a process,to die, to send back a confirming s i g n a l( y e s ,I ' m h e r e ! ) ,o r t o m i g r a t e . The functions of about half the proteins in humans, roundworms, yeast, and severalother eukaryotic organisms have beenpredicted basedon analysesof genomic sequences (Chapter6). Suchanalyseshave revealedthat at least10-15 percent of the proteins in eukaryotesfunction as secretedextracellular signals, signal receptors, or intracellular signaltransduction proteins, which pass along a signal through a seriesof steps culminating in a particular cellular response (e.g., increased glycogen synthesis).Clearly, signaling and signal transduction are maior activities of cells.

CellsRegulateTheir Gene Expressionto Meet C h a n g i n gN e e d s In addition to modulating the activities of existing proteins, cells often respond to changing circumstancesand to signals from other cells by altering the amount or types of proteins they contain. Gene expression,the overall processof selectively reading and using genetic information, is commonly

(a)

B o u n ds i g n a l

Surfacereceptors

)?'.. OO o o

6

s

I

Active enzyme

enzyme (b) Cytosolic Receptor-hormone

tm

m R N A+ + j----\

o oo Protein

Oc

#

ot

^

I mRNA

Nucleus

lncreasedtranscription of specificgenes

1-16 Externalsignalscommonlycausea changein FIGURE the activity of preexistingproteinsor in the amountsand or of a hormone typesof proteinsthat cellsproduce.(a)Binding cantriggeran receptors to itsspecific molecule othersignaling of a the activity or decreases pathway that increases intracellular in to receptors bindingof insulin protein. Forexample, preexisting of cellsleadsto activation of liverandmuscle membrane the plasma from of glycogen in thesynthesis a keyenzyme glycogen synthase, within arelocated for steroidhormones glucose(b)Thereceptors complexes hormone-receptor The surface the cell cells,noton to increased tarqetgenes,leading of specific transcription activate that bindto proteins. Manysignals production of the encoded pathways, to alsoact,by morecomplex on the cellsurface receptors geneexPression modulate

controlled at the level of transcription, the first step in the production of proteins. In this way cells can produce a pariicular mRNA only when the encoded protein is needed' thus minimizing wasted energy. Producing an mRNA is, however,only the first in a chain of regulatedeventsthat together determine whether an active protein product is produced from a particular gene. Transcriptional control of geneexpressionwas first decisively demonstratedin the responseof the gut bacterium E. coli to different sugar sources.E. coli cells prefer glucose as a sugar source,but they can survive on lactosein a pinch' These bacteria use both a DNA-binding repressor protein and a DNA-binding actiuator protein to change the rate of transcription of three genesneededto metabolize lactosedepending on the relative amounts of glucoseand lactosepresint (Chapter 4). Such dual positiveinegativecontrol of gene exoression fine-tunes the bacterial cell's enzymatic equip-..rt fo. the job at hand. Like bacterial cells, unicellular eukaryotes may be subjected to widely varying environmental conditions that require extensivechangesin cellular structuresand function' T H EW O R K O F C E L L S

17

For instance,in starvation conditions yeastcellsstop growing and form dormant spores (seeFigure 1-6). In multicellular organisms, however, the environment around most cells is relatively constant. The major purpose of gene control in us and in other complex organismsis to tailor the properties of various cell types to the benefit of the entire animal or plant. Control of gene activity in eukaryotic cells usually involves a balance between the actions of transcriptional activators and repressors.Binding of activators to specificDNA regulatory sequencescalled enhancers turns on transcription, and binding of repressorsto other regulatory sequences called silencersturns off transcription. In Chapters 7 and 8, we take a closelook at transcriptional activators and repressors and how they operate, as well as other mechanismsfor controlling gene expression.In an extreme case,expression of a particular gene could occur only in part of the brain, only during eveninghours, only during a certain stageof development, only after a large meal, and so forth. Many external signals modify the activity of transcriptional activators and repressorsthat control specific genes. For example, lipid-soluble steroid hormones, such as estrogen and testosterone,can diffuse across the plasma membrane and bind to their specific receptors located in the cytoplasm or nucleus(Figure 1-16b).Hormone binding changes

Overview Animation: Life Cycle of a Cell {lltt Nondividing cells

o

Resting c el l s

R N Aa n d protein synthesis G2

A FIGURE 1-17 Duringgrowth, eukaryoticcellscontinually progressthrough the four stagesof the cell cycle, generatingnew daughtercells.In mostproliferating cells,the four phases of the cellcycleproceedsuccessively, takingfrom 10-20 hoursdepending on celltypeanddevelopmental state Duringinterphase, whichconsists of the G,,,S,andG2phases, the cellroughly doubles itsmassReplication of DNAdurinqthe S phaseleaves the cellwith four copiesof eachtypeof chromosome Inthe mitotic(M)phase, thechromosomes are evenlypartitioned to two daughter cells,andthecytoplasm divides roughlyin halfin mostcases. Undercertainconditions suchasstarvation or whena tissuehasreached itsfinalsize,cells willstopcycling andremainin a waitingstatecalledGs Mostcells in Gscanreenter thecycleif conditions chanqe.

18

C H A P T E R1

|

L t F EB E G T N W S |TH CELLS

the shape of the receptor so that it can bind to specific enhancer sequencesin the DNA, thus turning the receptor into a transcriptional activator. By this rather simple signaltransduction pathway, steroid hormones cause cells to change which genes they transcribe (Chapter 7). Since steroid hormones can circulate in the bloodstream, they can affect the properties of many or all cells in a temporally coordinated manner. Binding of many other hormones and of growth factors to receptors on the cell surface triggers different signal-transduction pathways that also lead to changesin the transcription of specific genes (Chapters 15 and 16). Although thesepathways involve multiple components and are more complicated than those transducing steroid hormone signals,the generalidea is the same.

CellsGrow and Divide As we have discussed,reproduction is at the heart of biology; rocks don't do it. The reproduction of organisms depends on the reproduction of cells. The simplest type of reproduction entails the division of a "parent" cell into two "daughter" cells.This occurs as part of the cell cycle,a series of eventsthat preparesa cell to divide followed by the actual division process, called mitosis. The eukaryotic cell cycle commonly is representedas four stages(Figure 1-17). The chromosomes and the DNA they carry are copied during the S (synthesis)phase.The replicatedchromosomesseparare during the M (mitotic) phase,with each daughter cell getting a copy of each chromosome during cell division. The M and S phasesare separatedby two gap stages,the G1 phase and G2 phase, during which mRNAs and proteins are made. In single-celledorganisms,both daughtercellsoften (though not always) resemblethe parent cell. In multicellular organisms, stem cells can give rise to two different cells, one that resembles the parent cell and one that does not. Such asymmetric cell division is critical to the generationof different cell types in the body (Chapter21). During growth the cell cycle operatescontinuously with newly formed daughter cells immediately embarking on their own path ro mitosis. Under optimal conditions bacteria can divide to form two daughter cells once every 30 minutes. At this rate, in an hour one cell becomesfour: in a day one cell becomesmore than 101a, which if dried would weigh about 25 grams. Under normal circumstances, however, growth cannot continue at this rate becausethe food supply becomeslimiting. Most eukaryotic cells take considerably longer than bacterial cells to grow and divide. Moreover, the cell cycle in adult plants and animalsnormally is highly regulated(Chapter20). This tight control prevents imbalanced, excessivegrowth of tissueswhile ensuring that worn-out or damaged cells are replaced and that additional cells are formed in responseto new circumstancesor developmental needs.For instance, the proliferation of red blood cellsincreasessubstantiallywhen a person ascendsto a higher altitude and needs more capacity to capture oxygen. Somehighly specializedcells in adult animals, such as nervecellsand striatedmusclecells,rarely divide, if at all. The fundamental defect in cancer is loss of the ability to

control the growth and division of cells.In Chapter 25, we examine the molecular and cellular eventsthat lead to inappropriate, uncontrolled proliferation of cells. Mitosis is an asexual process since the daughter cells carry the exact samegeneticinformation as the parental cell. ln sexwalreproduction, fusion of two cells produces a third cell that contains genetic information from each parental cell. Sincesuch fusions would causean ever-increasingnumber of chromosomes, sexual reproductive cycles employ a special type of cell division, called meiosis,that reducesthe number of chromosomesin preparation for fusion (seeFigure 5-3). Cells with a full set of chromosomes are called diploid cells. During meiosis, a diploid cell replicates its chromosomes as usual for mitosis but then divides twice without copying the chromosomesin between. Each of the resulting four daughter cells, which have only half the full number of chromosomes,is said to be haploid. Sexual reproduction occurs in animals and plants and even in unicellular organismssuch as yeasts(seeFigure 1-5). Animals spendconsiderabletime and energygeneratingeggs and sperm, the haploid cells, called gametes,which are used for sexualreproduction. A human femalewill produce about half a million eggsin a lifetime, all of thesecells forming before she is born; a young human male produces about 100 million sperm each day. Gametes are formed from diploid precursor germ-line cells,which in humans contain 46 chromosomes.In humans the X and Y chromosomesare called sex chromosomes becausethey determine whether an individual is male or female. In human diploid cells, the 44 remaining chromosomes,called autosomes,occur as pairs of 22 different kinds. Through meiosis,a man produces sperm that have 22 chromosomes plus either an X or a Y, and a woman produces ova (unfertilized eggs) with 22 chromosomesplus an X. Fusion of an egg and sperm (fertilization) yields a fertilized egg,the zygote,with46 chromosomes,one pair of each of the 22 kinds and a pair of Xs in femalesor an X and a Y in males(Figure1-18). Errors during meiosiscan lead to disorders resulting from an abnormal number of chromosomes.These include Down's syndrome, caused by an extra chromosome 21, and Klinefelter's syndrome, causedby an extra X chromosome.

Diploid (2n)

Haploid(1nl

(",,o )

One type of female gamete

Two types of male gamete

Diploid (2n) Female zygote

Male zygote

meiosis 1-18 Dad madeyou a boy or girl. In animals, FIGURE Themale cellsformseggsandsperm(gametes). of diploidprecursor the sexof the parentproduces two typesof spermanddetermines sex chromosomes; Y are the here, X and asshown zygoteIn humans, fromthe maleparentto a Y chromosome the zygotemustreceive (non-sex chromosomes). developintoa male A : autosomes bing" between the fingers; the cells in the webbing subsequently die in an orderly and precisepattern that leavesthe fingers and thumb free to play the piano. Nerve cells in the brain soon die if they do not make proper or useful electrical

CellsDie from AggravatedAssaultor an lnternal Program 'lfhen

cells in multicellular organismsare badly damagedor infectedwith a virus, they die. Cell death resulting from such a traumatic event is messy and often releasespotentially toxic cell constituents that can damage surrounding cells. Cells also may die when they fail to receivea life-maintaining signal or when they receive a death signal. In this type of programmed cell death, called apoptosis, a dying cell actually produces proteins necessaryfor self-destruction.Death by apoptosis avoids the releaseof potentially toxic cell constituents(Figure1-19). Programmed cell death is critical to the proper development and functioning of our bodies (Chapter 21). During fetal life, for instance,our hands initially developwith "web-

1-19ApoPtoticcellsbreakapartwithout spewing FIGURE forth cell constituentsthat might harm neighboringcells. looklikethe cellon the left Cells Whitebloodcellsnormally likethe cellon the programmed celldeath(apoptosis), undergoing The arereleased blebsthateventually surface right,formnumerous is growth Apoptosis signals. it lackscertain cellisdyingbecause cellswherethey cells,to remove virus-infected to eliminate important (likethewebbingthatdisappears asfingersdevelop), arenot needed cellsthatwouldreactwith ourown immunesystem andto destroy Inc] Unlimited, Murtil/isuals bodies[Gopal THE WORK OF CELLS

19

connectionswith other cells. Some developinglymphocytes, the immune-systemcells intended to recognizeforeign proteins and polysaccharides,have the ability to reac against our own tissues.Such self-reactivelymphocytes becomeprogrammed to die before they fully marure. If these cells are not weededout before reaching maturity, they can causeautoimmune diseases,in which our immune system destroys the very tissuesit is meant to protect.

IE

InvestigatingCellsand TheirParts

To build an integrared understanding of how the various molecular components that underlie cellular functions work together in a living cell, we must draw on various perspectives. Here, we look at how five disciplines-cell biology, biochemistry and biophysics,genetics,genomics,and developmental biology-can conrribure to our knowledge of cell structure and function. The experimental approachesof each field probe the cell's inner workings in different ways, allowing us to ask different types of questions about cells and what they do. Cell division provides a good example to illustrate the role of different perspectivesin analyzing a complex cellular process.Although we discussthe different disciplinesseparatelyfor clarity, in practice most biologists use multiple approachesin concert. This is part of the fun of

Nanometers

The goal of cell biologists is to understandhow a cell is able to control its own shape and surface properties, transport materials to the right locations, copy itself, and receiveand send signals.Cell biologists use severaltypes of microscopy to observecells, while at the same time labeling specificcell components and altering them to seewhat happens.Analysesare generally done at the micrometer scale. Actual observation of cells awaited development of the first, crude microscopes in the early 1600s. A compound

Meters

Assemblies Macromolecules

Glucose

C-C bond

Cell Biology Revealsthe Size,Shape,Location, and Movementsof Cell Components

Millimeters

Micrometers

Small molecules Atoms

cell biologg putting together genetics with microscopy or enzymology with development. The realm of biology rangesin scalemore than a billionfold (Figure 1-20). Beyond that, it's ecology and earth science at the "macro" end, chemistry and physics at the "micro" end. The visible plants and animals that surround us are measuredin meters (100-102 m). By looking closely,we can seea biologicalworld of millimeters(1 mm : 10-3 m) and even tenths of millimeters (10-a m). Setting aside oddities like chicken eggs, most cells are 1-100 micrometers (1 pm : 10-5 m) long and thus clearlyvisibleonly when magnified. To seethe structureswithin cells, we must go farther down the sizescaleto 10-100 nanometers(1 nm : 10 v m).

Hemoglobin

M u l t i c e l l u l aor r g a n i s m s

Cells

Ribosome

C. elegans

Bacterium

Mitochondrion

Newborn human

Bumblebee

I

J 1010m

10sm

1 0 ' 8m

'1 0-7m

0.1nm

1 nm

10nm

1 0 0n m

10'6m 1 pm

1 0 - 5m 10pm

FIGURE 1-20 Biologistsare interestedin objectsrangingin sizefrom smallmolecules to the tallesttrees.A sampling of biological objects aligned on a logarithmic scale(a)TheDNAdouble helixhasa diameter of about2 nm (b)Eight-cell-stage numan embryothreedaysafterfertilization, about200 rr"macross(c)A wolf

20

CHAPTER 1

I

L I F EB E G I N S WITHCELLS

1 0 - am 1 0 0u m

1 0 - 3m

1 0 2m

1 0 ' 1m

1 mm

1 0m m

100mm

1 0 0m 1m

spider, about15 mm across(d)Emperor penguins areabout1 m tall. [Part(a)Will andDeniMclntyrePart(b)YorgasNikas/photo Researchers, Inc Part(c)GaryGauglerl/isuals Unlimited, Inc Part(d)HughS Rosefuisuals Unlimited. lncl

microscope,the most useful type of light microscope,has two lenses.The total magnifying power is the product of the magnificationby each lens. As better lenseswere invented, the magnifying power and the ability to distinguish closely spacedobjects, the resolution, increasedgreatly. Modern cclmpoundmicroscopesmagnify the view about a thousandfold, so that a bacterium 1 micrometer (1 p-) long looks like it's a millimeterlong. Objectsabout 0.2 pm apart can be discernedin theseinstruments. Microscopy is most powerful when particular components of the cell are stained or labeled specifically,enabling them to be easilyseenand locatedwithin the cell. A simple exampleis stainingwith dyesthat bind specificallyto DNA to visualize the chromosomes. Specific proteins can be detected by harnessingthe binding specificityof antibodies,the proteins whose normal task is to help defend animals against infection and foreign substances.In general,eachtype of antibody binds to one protein or large polysaccharideand no other (Chapter 3). Purified antibodies can be chemically linked to a fluorescent molecule, which permits their detection in a specialfluorescencemicroscope(Chapter 3). lf a cell or tissueis treated with a detergentthat partially dissolvescell membranes,fluorescentantibodiescan drift in and bind to the specific protein they recognize. When the sample is viewed in the microscope,the bound fluorescent antibodies identify the location of the target protein (see F i g u r e1 - 1 5 ) . Betrer still is pinpointing proteins in living cells with intact membranes. One way of doing this is to introduce an engineeredgenethat codesfor a hybrid protein: part of the hybrid protein is the cellular protein of interest;the other part is a protein that fluoresceswhen struck by ultraviolet light. A common fluorescentprotein used for this purpose is green fluorescent protein (GFP), a natural protein that makes some iellyfish colorful and fluorescent. GFP "tagging" could reveal,for instance,that a particular protein is first made on the endoplasmic reticulum and then is moved by the cell into the lysosomes.In this case,first the endoplasmicreticulum and later the lysosomeswould glow in the dark. Chromosomesare visible in the light microscopeonly during mitosis,when they becomehighly condensed.The extraordinary behavior of chromosomesduring mitosis first was discoveredusing the improved compound microscopes of the late 1800s.About halfway through mitosis,the replicatedchromosomesbeginto move apart. Microtubules,one of the three types of cytoskeletalfilaments, participate in this movementof chromosomesduring mitosis.Fluorescenttagging of tubulin, the protein subunitthat polymerizesto form microtubules, reveals structural details of cell division that otherwisecould not be seenand allows observationof chromosomemovement(Figure1-21). Electron miqroscopesuse a focusedbeam of electronsinstead of a beam of light. In transmission electron microscopy, specimensare cut into very thin sections and placedunder a high vacuum,precludingexaminationof living cells. The resolution of transmission electron micro-

llll|

5e6nsAnimation:Mitosis

A FIGURE1-21 During the later stages of mitosis, microtubules (red) pull the replicated chromosomes(black) toward the ends of a dividing cell. Thisplantcell is stained and with a DNA-bindingdye (ethidium)to revealchromosomes antibodiesspecificfor tubulinto reveal with f luorescent-tagged microtubulesAt this stagein mitosis,the two copiesof each replicatedchromosome(calledchromatids)haveseparatedand are of AndrewBajer ] movinqawavf rom eachother [Courtesy

scopes,about 0.1 nm, permits fine structural details to be distinguished,and their powerful magnification would make a 1-pm-long bacterialcell look like a soccerball. Most of the organelles in eukaryotic cells and the double-layered structure of the plasma membrane were first observedwith electron microscopes(Chapter 9). \fith new specializedelectron microscopy techniques,three-dimensionalmodels of organellesand large protein complexes can be constructed from multiple images.But to obtain a more detailed look at the individual macromoleculeswithin cells, we must turn to techniqueswithin the purview of biochemistry and biophysics.

s e v e a tl h e B i o c h e m i s t r ay n d B i o p h y s i c R M o l e c u l a rS t r u c t u r ea n d C h e m i s t r yo f P u r i f i e d Cell Constituents Biochemistsextract the contentsof cellsand separatethe constituents based on differencesin their chemical or physical properties,a processcalledfractionation. The attention to individual moleculesmeans operating at the nanometer scale. Of particular interest are proteins, the workhorses of many A typical fractionation schemeinvolvesuse cellular processes. of various separationtechniquesin a sequentialfashion.These separationtechniquescommonly are basedon differencesin the size of moleculesor the electric charge on their surface (Chapter 3). To purify a particular protein of interest, a purification scheme is designed so that each step yields a

I N V E S T I G A T I NC GE L L SA N D T H E I RP A R T S

2'l

J

^c

*o

;s'-s'

4"8" 2

1

-

3

-

4

-

5

-

I

FIGURE 1-22 Biochemicalpurificationof a protein from a cell extract often requiresseveralseparationtechniques.The purificationcanbe followedby gelelectrophoresis of thestarting proteinmixture andthefractions obtained fromeachpurification step Inthisprocedure, a sample isapplied to wellsin thetop of a gelatin-like slabandan electric fieldisappliedInthe presence of appropriate saltanddetergent concentrations, the proteins move throughthefibersof the geltowardtheanode,with largerproteins movingmoreslowlythroughthe gelthansmaller ones(seeFigure 3-35)Whenthegelisstained, proteins separated arevisible as distinctbandswhoseintensities areroughlyproportional to the proteinconcentration Shownhereareschematic depictions of oels for thestarting (lane1)andsamples mixture of proteins takenaiter eachof several purification stepsIn the firststep,saltf ractionation, proteinsthat precipitated with a certainamountof saltwereredissolved; electrophoresis (lane2) showsthatit of thissample contains fewerproteins thantheoriginal mixtureThesample then wassubjected in succession to threetypesof column chromatography proteins thatseparate by electrical charge, size,or bindingaffinityfor a particular (seeFigure smallmolecule 3-37).The finalpreparation isquitepure,ascanbe seenfromtheappearance of justoneproteinbandin lane5 [AfterJBergetal,2o02,Biochemistry W H Freeman andCompany, p 87l preparation with fewer and fewer contaminating proteins, until finally only the protein of interestremains (Figure 1-22). The initial purification of a protein of interest from a cell extract often is a tedious, time-consumingtask. Once a small amount of purified protein is obtained, antibodies to it can be produced by methods discussedin Chapter 19. For a biochemist, antibodies are near-perfecttools for isolating larger amounts of a protein of interest for further analysis.In effect, antibodies can "pluck out" the protein they specifically recognizeand bind from a semipure sample containing numerous different proteins. An increasinglycommon alterna-

22

C H A P T E R1

I

L I F EB E G I N SW I T H C E L L S

tive is to engineera gene that encodesa protein of interest with a small attached protein "tag," which can be used to pull out the protein from whole cell extracts. Purification of a protein is a necessaryprelude to studies on how it catalyzesa chemical reaction or carries out other functions and how its activiry is regulated. Some enzymesare made of multiple protein chains (subunits) with one chain catalyzing a chemical reaction and other chains regulating when and where that reaction occurs. The molecular machines that perform many critical cell processesconstitute even larger assembliesof proteins. By separating the individual proteins composing such assemblies,their individual catalytic or other activitiescan be assessed. For example,purification and study of the activity of the individual proteins composing the DNA replication machine provided clues about how they work together to replicate DNA during cell division (Chapter 4). The folded, three-dimensionalstructure, or conformation, of a protein is vital to its function. To understand the relation between the function of a protein and its form, we need to know both what it does and its detailed structure. The most widely used method for determining the complex structures of proteins, DNA, and RNA is x-ray crystallography, one of the powerful tools of biophysics.Computer-assistedanalysisof the data often permits the location of every atom in a large, complex molecule to be determined. The double-helix structure of DNA, which is key to its role in herediry was first proposed basedon x-ray crystallographic studies.Throughout this book you will encounter numerous examplesof protein structuresas we zero in on how proteins work.

GeneticsRevealsthe Consequences of DamagedGenes Biochemical and crystallographic studies can tell us much about an individual protein, but they cannot prove that it is required for cell division or any other cell process.The importance of a protein is demonstratedmost firmly if a mutation that prevents its synthesis or makes it nonfunctional adverselyaffects the processunder study. !(/e define the genotype of an organism as its composition of genes;the term also is commonly used in referenceto different versionsof a singlegeneor a small number of genes of interest in an individual organism. A diploid organism generally carries two versions (alleles)of each gene, one derived from each parent. There are important exceptions, such as the geneson the X and Y chromosomesin males of some species,including our own. The phenotype is the visible outcome of a gene's action, such as blue eyes versus brown eyesor the shapesof peas.In the early days of genetics, the location and chemical identity of genes were unknown; only the observablecharacteristics,the phenotypes, could be followed. The concept that genesare like "beads" on a long "string," the chromosome,was p,roposedearly in the 1900s basedon geneticwork with the fruit fly Drosophila. In the classicalgeneticsapproach, mutants are isolated that lack the ability to do something a normal organism can do. Often large genetic "screens" are done to look for many different mutant individuals (e.g., fruit flies, yeast cells) that are

unable to complete a certain process,such as cell division or muscle formation. In experimental organismsor cultured cells, mutations usually are produced by treatment with a mutagen, a chemical or physical agent that promotes mutations in a largely random fashion.But how can we isolateand maintain mutant organismsor cellsthat are defectivein some process, such as cell division, that is necessaryfor survival?One way is to look for organisms with a temperature-sensitivemutation. Thesemutants are able to grow at one temperature,the permissiue temperature, but not at anothe5 usually higher temperature, the nonpermissiuetemperature.Normal cells can grow at either temperature. In most cases,a temperature-sensitivemutant produces an altered protein that works at the permissive temperaturebut unfolds and is nonfunctional at the nonpermissive temperature. Temperature-sensitive screensare readily done with viruses,bacteria, yeast,roundworms, and fruit flies. By analyzing the effectsof numerous different temperaturesensitivemutations that altered cell division, geneticistsdiscoveredall the genesnecessaryfor cell division without knowing anything, initially, about which proteins they encode or how theseproteinsparticipatein the process.The greatpower of geneticsis to reveal the existenceand relevanceof proteins without prior knowledge of their biochemicalidentity or molecular function. Eventually these "mutation-defined" genes were isolatedand replicated(cloned)with recombinantDNA techniquesdiscussedin Chapter 5. \fith the isolatedgenesin hand, the encodedproteins could be produced in the test tube or in engineeredbacteria or cultured cells. Then the biochemistscould investigatewhether the proteins associatewith other proteins or DNA or catalyze particular chemical reactions during cell division (Chapter20). The analysis of genome sequencesfrom various organisms during the past decadehas identified many previously unknown DNA regions that are likely to encode proteins (i.e., protein-coding genes).The generalfunction of the protein encoded by a sequence-identifiedgene may be deduced by analogy with known proteins of similar sequence.Rather than randomly isolating mutations in novel genes, several techniquesare now available for inactivating specific genes by engineering mutations into them or destroying their mRNA with interfering RNA molecules(Chapter 5). The effects of such deliberategene-specificinactivation procedures provide information about the role of the encoded proteins in living organisms. This application of genetic techniques starts with a gene/proteinsequenceand ends up with a mutant phenotype; traditional genetics starts with a mutant phenotype and ends up with a gene/proteinsequence.

GenomicsRevealsDifferencesin the Structure and Expressionof EntireGenomes Biochemistry and geneticsgenerally focus on one gene and '$flhile powerful, these tradiits encoded protein at a time. tional approachesdo not give a comprehensiveview of the structure and activity of an organism'sgenome,its entire set of genes.The field of genomicsdoes just that, encompassing the molecular characterizationof whole genomesand the determination of global patterns of geneexpression.The recent

completion of the genome sequencesfor more than 100 speciesof bacteria and severaleukaryotesnow permits comparisons of entire genomes from different species.The results provide overwhelming evidenceof the molecular unity of life and the evolutionary processesthat made us what we are (seeSection 1.5). Genomics-basedmethods for comparing thousands of piecesof DNA from different individuals all at the same time are proving useful in tracing the history and migrations of plants and animals and in following the inheritance of diseasesin human families. DNA microarrays can simultaneously detect all the mRNAs presentin a cell, thereby indicating which genesare being transcribed. Such global patterns of gene expression clearly show that liver cells transcribe a quite different set of genesthan do white blood cellsor skin cells. Changesin gene expressionalso can be monitored during a diseaseprocess' in responseto drugs or other external signals'and during development. For instance,the identification of all the mRNAs presentin cultured fibroblasts before, during' and after they divide has given us an overall view of transcriptional changesthat occur during cell division (Figure 1-23). Cancet diagnosis is being transformed becausepreviously indistinguishablecancer cells have distinct gene expressionpatterns and prognoses (Chapter 25). Similar studies with different organisms and cell types are revealing what is universal about the genesinvolved in cell division and what is specific to particular organisms.To find out which genesare directly regulatedby a transcription factor, chromatin containing the protein of interest can be purified with an antibody and the associated DNA analyzed on microarrays, a procedure called chromatin immunopreclpltatlon. The entire complement of proteins in a cell, its proteome' is controlled in part by changesin genetranscription.The regulated synthesis,processing,localization' and degradationof specific proteins also play roles in determining the proteome of a particular cell. Learning how proteins bind to other proteins, often in large, multiprotein complexes, is providing a comprehensiveview of the molecular machines important for cell functioning. The field of proteomics will advance dramatically once high-throughput x-ray crystallography, currently under development,permits researchersto rapidly determine the structuresof hundredsor thousandsof proteins.

DevelopmentalBiology RevealsChangesin the Propertiesof Cellsas They Specialize Another approach to viewing cells comes from studying how they changeduring development of a complex organism. Bacteria, algae, and unicellular eukaryotes (protozoans, yeasts) often, but by no means always, can work solo. The concerted actions of the trillions of cells that compose our bodies require an enormous amount of communication and division of labor. During the development of multicellular organisms, differentiation processesform hundreds of cell types, each specialized for a particular task: transmission of electric signals by neurons, transport of oxygen by red blood cells, destruction of infecting bacteria by macrophages' contraction by muscle cells, chemicalprocessingby liver cells,and so on. I N V E S T I G A T I NC GE L L SA N D T H E I RP A R T S

23

EXPERIMENTAL FIGURE 1-23 Microarrayanalysisof normal growing braincellsand braintumor cells.An experiment likethis isa starting pointfor learning howtumorcellsdifferfromnormal cellsRNAwasextracted fromnormalgrowingmousebraincells fromthecerebellum andfroma tumorof thecerebellum TheRNA fromthe tumorwaslabeled with a reddye,andRNAfromthe normal,non-tumorous cerebellum waslabeled with a greendye The two RNApreparations weremixedandhybridized to a microarray containing thousands of spotsof DNA Eachspotcontains the DNA sequence of onegene Unbound RNAwaswashedawayandthe microarray wasexposed to UVlight,whichcauses the dyesto fluoresce Spotsthataregreenhaveboundmostlynormalcerebellum RNA,spotsthatareredhaveboundmostlytumorRNA,andspots thatareyellowhaveboundroughly equalamounts of each.The faintlystained spotsrepresent genesfor whichthereislittleRNAin eithersampleThedataindicate whichgeneshavebeentranscribed in tumors,normalcerebellum, or both Onlypartof the datais shownhereTheentiredatasetrequires analyzing the colorsof more than25,000spots,allof whichcanbefittedontoonemicroscope slide.Precise measurements of colorintensity areactually madeby a spectrophotometer, but lookingby eyeshowsthat manygenesare morehighlyexpressed in normalor tumorcells.Someof these differences arethe consequence of the changeintotumorcells,but somemayreveal geneexpression changes thatcausethetumorsto form In addition, proteins madeexclusively in tumors,andperhaps necessary for uncontrolled growth,maybe candidate targets for discovering anti-cancer drugs [Courtesy of TalRaveh andl\y'atthew Scott, StanfordUniversitySchoolof Medicinel

Many of the differences among differentiated cells are due to production of specificsetsof proteins neededto carry out the unique functions of each cell type; that is, only a subsetof an organism'sgenesis transcribedat any given time or in any given cell. Such differential gene expressionat different times or in different cell types occurs in bacteria, fungi, plants, animals, and even viruses. Differential gene

24

CHAPTER 1

I

L I F EB E G I N S WITHCELLS

expression is readily apparent in an early fly embryo, in which all the cells look alike until they are stained to detect the proteins encoded by particular genes (Figure 1-24). Transcription can changewithin one cell type in responseto an external signal or in accordancewith a biological clock; some genes,for instance,undergo a dalIy cycle between low and high transcription rates. Producing different kinds of cells is not enough to make an organism, any more than collecting all the parts of a truck in one pile gives you a truck. The various cell types must be organized and assembled into all the tissues and organs. Even more remarkable, these body parts must work almost immediately after their formation and continue working during the growth process. For instance, the human heart begins to beat when it is lessthan 3 mm long, when we are mere 23-day-old embryos, and continues beating as it grows into a fist-sizemuscle. From a few hundred cells to billions, and still ticking. In the developing organism, cells grow and divide at some times and not others, they assembleand communicate, they prevent or repair errors in the developmentalprocess, and they coordinate each tissuewith others. In the adult organism,cell division largely stops in most organs.If part of an organ such as the liver is damaged or removed, cell division resumesuntil the organ is regenerated.The legend goes that Zets punished Prometheus for giving humans fire by

FIGURE 1-24 Differentialgene expressioncan be detectedin early fly embryosbefore cellsare morphologicallydifferent. An earlyDrosophila embryohasabout6000cellscoveringitssurface, mostof whichareindistinguishable by simplelightmicroscopy. lf the embryois madepermeable to antibodies with a detergent that partially dissolves membranes, theantibodies canfindandbindto the proteins theyrecognize Inthisembryowe seeantibodies tagged with a fluorescent labelboundto proteins thatarein the nuclei; each smallsphere corresponds to onenucleus. Threedifferent antibodies wereused,eachspecific proteinandeachgivinga for a different distinct green,or blue)in a fluorescence color(yellow, microscope. Theredcolorisaddedto highlight overlaps between theyellowand bluestainsThelocations proteins of thedifferent showthatthe cells arein factdifferent at thisearlystage,with particular genesturned on in specific stripes of cells. Thesegenescontrolthesubdivision of the bodyintorepeating segments, likethe blackandyellowstripes of a hornet.[Courtesy of Sean Carroll, University of Wisconsin ]

chaining him to a rock and having an eagleeat his liver. The punishment was eternal because,as the Greeks evidently knew, the liver regenerates. Developmental studies involve watching where, when, and how different kinds of cells form, discovering which signals trigger and coordinate developmentalevents,and understandingthe differential gene action that underliesdifferentiation (Chapters 16 and 21). During development we can see cells change in their normal context of other cells. Cell biology, biochemistry, cell biology, genetics, and genomics approachesare all employed in studying cells during development.

C h o o s i n gt h e R i g h t E x p e r i m e n t aOl r g a n i s m for the Job Our current understanding of the molecular functioning of cells rests on studieswith viruses,bacteria, yeast, protozoa, slime molds, plants, frogs, sea urchins, worms, insects,fish, chickens, mice, and humans. For various reasons, some organisms are more appropriate than others for answering particular questions.Becauseof the evolutionary conservation of genes,proteins, organelles,cell types, and so forth, discoveriesabout biological structuresand functions obtained with one experimental organism often apply to others. Thus researchersgenerallyconduct studieswith the organism that is most suitable for rapidly and completely answering the question being posed, knowing that the results obtained in one organismare likely to be broadly applicable.Figure1-25 summarizesthe typical experimental usesof various organisms whose genomeshave been sequencedcompletely or nearly so. The availability of the genomesequencesfor these organisms makes them particularly useful for geneticsand genomicsstudies. Bacteria have several advantagesas experimental organisms: they grow rapidlS possesselegant mechanisms for controlling gene activity, and have powerful genetics. This latter property relates to the small size of bacterial genomes,the easeof obtaining mutants, the availability of techniquesfor transferring genes into bacteria, an enormous wealth of knowledge about bacterial gene control and protein functions, and the relative simplicity of mapping genesrelative to one another in the genome. Singlecelledyeastsnot only have some of the sameadvantagesas bacteria but also possessthe cell organization,marked by the presenceof a nucleusand organelles,that is characteristic of all eukaryotes. Studiesof cellsin specializedtissuesmake use of animal and plant "models," that is, experimentalorganismswith attributes typical of many others. Nerve cells and muscle cells, for instance,traditionally were studied in mammals cells,such or in creatureswith especiallylarge or accessible as the giant neural cells of the squid and sea hare or the flight musclesof birds. More recently,muscle and nerve development have been extensively studied in fruit flies (Drosophila melanogaster),roundworms (Caenorhabditis elegans),and zebrafish(Danio rerio), in which mutants can be readily isolated. Organisms with large-celledembryos

that develop outside the mother (e.g.' frogs, sea urchins, fish, and chickens) are extremely useful for tracing the fates of cells as they form different tissues and for making extracts for biochemicalstudies.For instance,a key protein in regulating mitosis was first identified in studies with frog and sea urchin embryos and subsequentlypurified from extracts (Chapter 20lt. Using recombinant DNA techniques,researcherscan engineer specificgenesto contain mutations that inactivate or increaseproduction of their encodedproteins. Suchgenescan be introduced into the embryos of worms, flies, frogs, sea urchins, chickens,mice, a variety of plants, and other organisms,permitting the effectsof activating a geneabnormally or inhibiting a normal gene function to be assessed.This approach is being used extensivelyto produce mouse versions of human genetic diseases.Inactivating particular genes by introducing short piecesof interfering RNA is allowing quick tests of gene functions possiblein many organisms.The expansion of genomeproiectsto critically important diseaseorganisms,such as malaria, and to creaturesthat span the evolutionary tree is bringing new options for medicine and new insights into how living organisms have diversified to take advantageof every possibleecologicalniche. Mice have one enormous advantage over other experimental organisms:they are the closestto humans of any animal for which powerful geneticapproachesare feasible.Engineered mouse genes carrying mutations similar to those associatedwith a particular inherited diseasein humans can be introduced into mouse embryonic stem (ES) cells. These cells can be injected into an early embryo, which is then implanted into a pseudopregnantfemale mouse (a mouse treated with hormones to trigger physiological changes neededfor pregnancy) (Chapter 5). If the mice that develop from the injected ES cells exhibit diseasessimilar to the human disease,then the link between the diseaseand mutations in a particular geneor genesis supported. Once mouse models of a human diseaseare available, further studies on the molecular defectscausing the diseasecan be done and new treatmentscan be tested,thereby minimizing human exposure to untested treatments. Large-scalegenetic screens are being done that take advantageof newly designedmutagenic transposons.The transposons allow efficient generation of mouse mutants and rapid identification of the gene that has been hit in each one. A continuous unplanned genetic screen has been per\What we mean formed on human populations for millennia. is that all sorts of human variations have arisen and have been noticed, since they affect visible or noticeable human characteristics.Thousandsof inherited traits have beenidentified and, more recently,mapped to locations on the chromosomes.Some of these traits are inherited propensitiesto get a disease;others are eye color or other minor characteristics. Geneticvariations in virtually every aspectof cell biology can be found in human populations, allowing studiesof normal and diseasestatesand of variant cells in culture. Less-commonexperimental organisms offer possibilities for exploring unique or exotic properties of cells and for studying standard properties of cells that are exaggeratedin I N V E S T I G A T I NC GE L L SA N D T H E I RP A R T S

25

Podcast:Common ExperimentalOrganisms

Viruses

Bacteria

Proteinsinvolvedin DNA, RNA, protein synthesis Gene regulation Cancerand control of cell oroliferation Transportof proteinsand organellesinsidecells Infectionand immunity Possiblegene therapy approaches

Proteinsinvolvedin DNA, RNA, protein synthesis, metabolism Gene regulation Targetsfor new antibiotics Cell cycle Signaling

Yeast (Saccharo myce s cerev is i ael

Roundworm I Caenorh abd itis elegansl

Controlof cell cycle and cell division Proteinsecretionand membrane biogenesis Functionof the cytoskeleton Cell differentiation Aging Gene regulationand chromosome structure

26

C H A P T E R1

I

Developmentof the body plan C e l ll i n e a g e Formationand function of the nervous system Controlof programmedcell death Cell proliferationand cancergenes Aging Behavior Gene regulationand chromosome structure

Fruit ffy (Drosophi Ia mel anoga sterl

Zebrafish

Developmentof the body plan Generationof differentiatedcell lineages Formationof the nervoussystem, heart,and musculature Programmedcell death Geneticcontrol of behavior Cancergenesand control of cell proliferation Controlof cell polarization Effectsof drugs, alcohol,pesticides

Developmentof vertebratebody tissues Formationand function of brain and nervous syslem Birth defects Cancer

Mice, includingculturedcells

Plant (A ra b i d ops is th aIi anal

Developmentof body tissues F u n c t i o no f m a m m a l i a ni m m u n e system Formationand function of brain and nervoussystem Models of cancersand other human diseases Gene regulationand inheritance Infectiousdisease

Developmentand patterningof tissues Geneticsof cell biology Agricultural applications Physiology Gene regulation lmmunity Infectiousdisease

L I F EB E G I N SW I T H C E L L S

< FIGURE 1-25 Eachexperimentalorganismusedin cell (a) biology has advantagesfor certaintypes of studies.Viruses (b)havesmallgenomes andbacteria amenable to genetic dissection Manyinsights intogenecontrolinitially camefromstudies with these (c)hasthe cellular organismsTheyeastSaccharomyces cerevisiae organization of a eukaryote but isa relatively simplesingle-celled genetically. organism thatiseasyto growandto manipulate Inthe (d),whichhasa small nematode worm Caenorhabditis elegans numberof cellsarranged in a nearlyidentical wayin everyworm,the formation of eachindividual cellcanbe tracedThefruitfly (e),firstusedto discover Drosophila melanogaster the properties of genesthat chromosomes, hasbeenespecially valuable in identifying controlembryonic development Manyof thesegenesare evolutionarily conserved in humansThezebraf ishDaniorerio(f)is genesthatcontrol usedfor rapidgenetic screens to identify development andorganogenesis. Of theexperimental animal (g)areevolutionarily systems, mice(Musmusculus) the closestto humans andhaveprovided models for studying numerous human genetic andinfectious diseases. Themustard-family weed Arabidopsis thaliana,sometimes described asthe Drosophila of the plantkingdom, genes hasbeenusedfor genetic screens to identify involved in nearlyeveryaspect of plantlife Genome sequencing is completed for manyviruses andbacterial species, theyeast Saccharomyces cerevisiae, the roundwormC. elegans,the f ruit fly D. melanogaste4 humans,andthe plantArabidopsis thalianallis mostlycompleted for miceandin progress for zebrafish Other particularly organisms, frogs,seaurchins, chickens, andslimemolds, to be immensely continue valuable for cellbiologyresearch Increasingly, a widevariety of otherspecies for areused,especially (a)Visuals studies of evolution of cellsandmechanisms Unlimited, [Part Inc Part(b)KariLountmaa/Science Photo Library/Photo Researchers, Inc Part (c)ScimavPhoto Researchers, Inc Part(d)Photo Researchers, IncPart(e) Darwin Dale/Photo Researchers, Inc,Part(f)IngeSpencel'/isuals Inc Unlimited, Part(g)J M Labavjancanatuisuals Unlimited, Inc Part(h)Darwin Dale/Photo Researchers, Inc]

a useful fashion in a particular animal. For example, the ends of chromosomes,the telomeres,are extremely dilute in most cells.Human cells typically contain 92 telomeres(46 chromosomesX 2 endsper chromosome).In contrast,some protozoawith unusual "fragmented" chromosomescontain millions of telomeres per cell. Taking advantage of the unique properties of this well-chosen experimental organism has led to important recent discoveriesabout telomere structure.

The Most SuccessfulBiologicalStudiesUse M u l t i p l eA p p r o a c h e s We have discussedfive classesof approachesto biological problems: cell biology biochemistry and biophysics, genetics, genomics,and developmentalbiology. Each has its own types of experiments,and most biological problems require more than one approach in order to reach a satisfying understanding of mechanism. Now we will survey how these approacheshave been applied to the study of cell division to emphasizehow important it is to use multiple types of experlments.

Cell division was viewed, and indeed discovered,by some of the earliest usersof microscopes.More recently a variety of kinds of microscopy, including confocal and electron microscopy and time-lapseimaging (Chapter 9), have been used to characterizethe stepsof the cell cycle. Most biology begins with this sort of observation, defining the mysteries that must be tackled experimentally.Then manipulations begin. Antibodies were made againstproteins that play critical roles in cell division both to detect proteins and in some casesto interfere with the functions of those proteins. Key proteins were fused to fluorescentproteins, starting with the iellyfish greenfluorescentprotein (GFP),so that key proteins could be followed in living cells. Questions about when and where proteins work could be addressedand their functions defined to an extent. The apparatusof cell division, such as the mitotic spindle and other protein complexes,was purified and analyzed using the approaches of biochemistry and biophysics. Each protein had to be purified to find out whether it is part of a complex of proteins bound together as a machine, and the structuresof key proteins were determined using x-ray crystallography and other methods (Chapter 3). Previously unknown enzymatic activities were detected in extracts using assays such as measuring the attachment of phosphate groups to cell division regulatory proteins by kinases, and then the relevant kinasescould be purified. Finding a novel protein in a complex of proteins involved in cell division makes it a good bet that the protein does something important, a sort of "guilt by association," but it doesnot provide proof that the protein matters. For that one must turn to genetics. Genetics can be used to identify mutants in the newly found protein. If cell division fails in a living organism when the protein is not working, you know the protein matters. Geneticsis also a way to identify previously unknown genesand proteins sincescreenscan be done (especiallyin bacteria and yeast, but also in more complex Iab organisms)to look for all the genesthat are neededfor cell division. The newly discoveredproteins can be incorporated into a complete picture of the mechanicsof cell division machinery. Genomics provides another way to look for working parts of the cell-division machine. Since it is often true that mRNAs and proteins are produced only when they are needed, using microarrays to look for all geneswhose expressionvaries with the cell cycle is a powerful approach to identify candidatesfor cell division regulators. Having identified new genesthat are required for cell division, one must find out how thesegenes'protein products work. Simply knowing that a protein matters to cell division is not enough to understand the mechanism.Thus it is necessaryto return to biochemical and biophysical approaches to work out the molecular biology and to cell biology to monitor protein locations and movements. Finally, cell division does not happen in a vacuum; it happens in the context of the life cycle of the organism. To fully appreciatehow the regulation works and is used, it is important to use the approachesof developmental biology

I N V E S T I G A T I NC GE L L SA N D T H E I RP A R T s

27

to revealwhen and where cell division normally happensand why. In theseexperimentsthe times and placesof cell division during the developmentof the organism are monitored, and then the signals that stimulate or suppresscell division are identified and studied. Errors in developmental control of cell division, revealedby studying mutants, can causeorgans and tissuesto be the wrong sizeor cancer. The samekinds of approachesthat work for cell division can be applied to many other biological challenges,such as Iearning how muscles form or how they work or how the brain functions. Often it's good to use every tool in the toolkit.

tf,|

A GenomePerspective

on Evolution Comprehensivestudies of genesand proteins from many organismsare giving us an extraordinary documentationof the history of life. Nature is a laboratory that has been conducting experimentsfor billions of years, and some of the most successfulgenomesthat emergedare still with us. 'We share with other eukaryotes thousands of individual proteins, hundredsof macromolecularmachines,and most of our organelles,all as a result of our sharedevolutionary history. New insights into molecular cell biology arising from genomicsare leadingto a fuller appreciationof rhe elegant molecular machines that arose during billions of yearsof genetictinkering and evolutionaryselectionfor the most efficient, precise designs. Due ro alternative RNA splicing,the number of proteins vastly exceedsthe number of genes,and the functions of many variant proteins and assembliesof proteins remain to be discovered. Once a more complete description of cells is in hand, we will be ready to fully investigate the rippling, flowing dynamics of living systems.

MetabolicProteins,the GeneticCode, a n d O r g a n e l l eS t r u c t u r e sA r e N e a r l yU n i v e r s a l Even organisms that look incredibly different share many biochemical properties. For instance, the enzymesthat catalyze degradation of sugars and many other simple chemical reactions in cells have similar structures and mechanisms in most living things. The genetic code whereby the nucleotide sequencesof mRNA specifiesthe amino acid sequencesof proteins can be read equally well by a bacterial cell and a human cell. Becauseof the universalnature of the genetic code, bacterial "factories" can be designedto manufacture growth factors, insulin, clotting factors, and other human proteins with therapeutic uses. The biochemical similarities among organisms also extend to the organelles found in eukaryotic cells.The basic structuresand functions of these subcellular components are largely conservedin all eukaryotes.

28

Computer analysisof DNA sequencedata, now available for numerousbacterialspeciesand severaleukaryotes, can locate protein-coding geneswithin genomes.\fith the aid of the geneticcode, the amino acid sequencesof proteins can be deduced from the corresponding gene sequences.Although simple conceptually, "finding" genes and deducing the amino acid sequencesof their encoded proteins is complicated in practice becauseof the many noncodingregionsin eukaryoticDNA (Chapter5). Despite the difficulties and occasional ambiguities in analyzing DNA sequences, comparisonsof the genomesfrom a wide range of organisms provide stunning, compelling evidence for the conservation of the molecular mechanisms that build and change organisms and for the common evolut i o n a r y h i s t o r yo f a l l s p e c i e s .

CHAPTER 1

I

L I F EB E G I N S WITHCELLS

Darwin'sldeasAbout the Evolutionof Whole A n i m a l sA r e R e l e v a n t o G e n e s Darwin did not know that genesexist or how they change, but we do: the DNA replication machine makes an error, or a mutagen causesreplacement of one nucleotide with another or breakage of a chromosome. Some changesin the genomeare innocuous, some mildly harmful, some deadly; a very few are beneficial. Mutations can change the sequence of a gene in a way that modifies the activity of the encoded protein or alters when, where, and in what amounts the protein is produced in the body. Gene-sequencechangesthat are harmful will be lost from a population of organisms becausethe affected individuals cannot survive as well as their relatives. This selection process is exactly what Darwin described without knowing the underlying mechanismsthat cause organisms to vary. Thus the selectionof whole organisms for survival is really a selectionof genes,or more accurately sets of genes.A population of organismsoften contains many variants that are all roughly equally well-suited to the prevailing conditions. When conditions change-a fire, a flood, loss of preferred food supply, climate shift-variants that are better able to adapt will survive, and those less suited to the new conditions will begin to die out. In this way, rhe genetic composition of a population of organisms can change over tlme.

M a n y G e n e sC o n t r o l l i n gD e v e l o p m e n t A r e R e m a r k a b l yS i m i l a ri n H u m a n s a n d O t h e rA n i m a l s As humans, we probably have a biasedand somewhat exaggerated view of our status in the animal kingdom. Pride in our swollen forebrain and its associatedmental capabilities may blind us to the remarkably sophisticated abilities of other species:navigation by birds, the sonar systemof bats, homing by salmon, or the flight of a fIy. Despite all the evidencefor evolutionary unity at the cellular and physiological levels,everyoneexpectedthat genes

(a)

Genes

Flv

(d)

Mammal

(e)

< FIGURE 1-26 Similargenes,conservedduringevolution, processes in diverseanimals. regulatemanydevelopmental to havehada commonancestor areestimated Insects andmammals abouthalfa billionyearsago.Theysharegenesthatcontrolsimilar of the processes, suchasgrowthof heartandeyesandorganization times. conservation of functionfromancient bodyplan,indicating (a)Hoxgenesarefoundin clusters of mostor on thechromosomes proteins thatcontrolthe allanimalsHoxgenesencoderelated of activities of othergenesHoxgenesdirectthedevelopment as axisof manyanimals, alongthe head-to-tail different segments Eachgeneisactivated colors. indicated by corresponding (transcriptionally) axisand regionalongthe head-to-tail in a specific in micethe Hox there Forexample, controls the growthof tissues of vertebrae shapes genesareresponsible for thedistinctive Hoxgenesin fliescausebodypartsto formin affecting Mutations on the head. suchaslegsin lieuof antennae thewronglocations, genesprovide address andserveto direct a head-to-tail These in the rightplaces(b)Development of the rightstructures formation a genecalled eyesin fruitfliesrequires of the largecompound (c)Flieswith inactivated (namedfor the mutantphenotype). eyeless the human geneslackeyes(d)Normalhumaneyesrequire eyeless (e)Peoplelacking to eyeiess. gene,calledPax6,that corresponds anrrdia,a lackof adequatePax6functionhavethe geneticdisease encodehighlyrelatedproteins irisesin the eyesPax6andeyeless from of othergenesandaredescended theactivities that regulate (b)and(c)Andreas gene lParts Hefti, Interdepartmental the sameancestral (lEM) of BaselPart(d) of theUniversity Biocenter Microscopy Electron Unlimitedl Inc Part(e)Visuals Researchers. Fraser/Photo @Simon

that, as far as we can tell, are utterly absentfrom certain lineagesof animals. Plants, not surprisingly,exhibit many such differencesfrom animals after a billion-year separation in their evolution. Yet certain DNA-binding proteins differ between peasand cows at only two amino acids out of 1'021

regulating animal development would differ greatly from one phylum to the next. After all, insectsand seaurchins and mammals look so different. \(e must have many unique proteins to createa brain like ours . . . or must we? The fruits of research in developmental genetics during the past two decadesrevealthat insectsand mammals, which have a common ancestor about half a billion years ago, possessmany genes(Figure 1-26). Indeed, similar development-regulating a large number of these genes appear to be conserved in many and perhaps all animals. Remarkably, the developmental functions of the proteins encoded by thesegenesare also often preserved.For instance,certain proteins involved in eye development in insects are related to protein regulators of eye developmentin mammals. Samefor development of the heart, gut, lungs, and capillaries and for placementof body parts along the head-to-tail and back-to-front body axes (Chapter19). This is not to say that all genesor proteins are evolutionarily conserved. Many striking examples exist of proteins

H u m a nM e d i c i n el s I n f o r m e db y R e s e a r c h on OtherOrganisms Mutations that occur in certain genesduring the course of our lives contribute to formation of various human cancers. The normal, wild-type forms of such "cancer-causing"genes generallyencodeproteins that help regulatecell proliferation or death (Chapter 21').'Wealso can inherit from our parents mutant copies of genesthat causeall manner of genetic diseases,such as cystic fibrosis, muscular dystrophy' sickle cell anemia, and Huntington's disease.Happily we can also inherit genesthat make us robustly resist disease.A remarkable number of genesassociatedwith cancer and other human diseasesare present in evolutionarily distant animals. For example, a recent study shows that more than threequarters of the known human diseasegenes are related to genesfound in the fruit fIy Drosophila. Vith the identification of human diseasegenesin other organisms,experimental studies in experimentally tractable organisms should lead to rapid progress in understanding

OEN E V O L U T I O N A G E N O M EP E R S P E C T I V

29

the normal functions of the disease-relatedgenes and what occurs when things go awry. ConverselS the disease states themselvesconstitute a genetic analysis with well-studied phenotypes. All the genesthat can be altered to cause a certain diseasemay encode a group of functionally related proteins. Thus clues about the normal cellular functions of pro-

30

.

cHAPTERI I

L I F EB E G I N SW I T H C E L L S

teins come from human diseasesand can be used to guide initial research into mechanism. For instance, genesinitially identified becauseof their link to cancer in humans can be studied in the context of normal development in various model organisms, providing further insight about the functions of their protein products.

CHAPTER

CHEMICAL FOUNDATIONS Polarized light microscopic imageof crystalsof ATBwhose hydrolysis isa primarysourceof energythat drivesmanycellular chemical reactions[Dr.ArthurM SiegelmaMr'isuals Unlimited ]

he life of a cell dependson thousands of chemical interactions and reactions exquisitely coordinated with one another in time and sDaceand under the influence of the cell's genetic instructions and its environment. By understandingat a molecular level theseinteractions and reactions, we can begin to answer fundamental questionsabout cellular life: How doesa cell extract critical nutrients and information from its environment? How does a cell convert the energy stored in nutrients into work (movement,synthesis of critical components)?How does a cell transform nutrients into the fundamental structuresrequired for its survival (cell wall, nucleus, nucleic acids, proteins, cytoskeleton)? How does a cell link itself to other cells to form a tissue? How do cells communicate with one another so that a complex, efficiently functioning organism can develop and thrive? One of the goals of Molecular Cell Biology is to provide answers to these and other questions about the structure and function of cells and organisms in terms of the properties of individual moleculesand ions. For example, the properties of one such molecule,water, have controlled and continue to control the evolution, structure, and function of cells. You cannot understand biology without appreciating how the properties of water control the chemistry of life. Life first arose in a watery environment. Constituting 70-80 percent by weight of most cells, water is the most abundant molecule in biological systems. It is within this aqueous milieu that small molecules and ions, which make up about 7 percent of the weight of living matter, assembleinto the larger macromoleculesand macromolecular aggregatesthat make up a cell's machinery and architecture and so the remaining mass of organisms.

These small molecules include amino acids (the building blocks of proteins), nucleotides (the building blocks of DNA and RNA), lipids (the building blocks of biomembranes), and sugars (the building blocks of starchesand cellulose). Many biomolecules(e.g.,sugars)readily dissolvein water; these molecules are called hydrophilic (water liking). Others (e.g., cholesterol)are oilS fatlike substancesthat shun water; these are said to be hydrophobic (water fearing). Still other biomolecules(e.g.,phospholipids)are a bit schizophrenic, containing both hydrophilic and hydrophobic regions; these molecule are said to be amphipathic. Phospholipids are used to build the flexible membranes that form the wall-like boundaries of cells and their internal organelles.The smooth functioning of cells, tissues' and organisms depends on all these molecules, from the smallest to the largest. Indeed, the chemistry of the simple proton (H*) can be as important to the survival of a human cell as that of each gigantic, genetic-code-carrying DNA molecule (the mass of the DNA molecule in human

OUTLINE 2.1

CovalentBondsand NoncovalentInteractions 32

2.2

of Cells BuildingBlocks Chemical

40

2.3

Equilibrium Chemical

49

2.4

Energetics Biochemical

54

31

(a) Molecularcomplementarity

(bl Chemicalbuilding blocks

ProteinA

Polymerization p&. d'

",llrill t

1

ProteinB

S m a l lm o l e c u l e subunits (dl Chemicalbond energy

{c} Chemicalequilibrium

e#

Macromolecule

"High-energy" phosphoa n h y dr i d e bonds

kr Kl

K^^_

K1

Adenosine triphosphate

k,

A FIGURE2-1 Chemistry of life: four key concepts.(a) Molecular complementarity liesat the heartof all biomolecular interactions, as when two proteinswith complementary shapesand chemical propertiescometogetherto form a tightlybound complex (b) Small moleculesserveas buildingblocksfor IargerstructuresForexample, to generatethe information-carrying macromolecule DNA,four small nucleotidebuildingblocksare covalentlylinkedinto long strings (polymers), which then wrap aroundeachother to form the double helix (c) Chemicalreactionsare reversible, and the distributionof the chemicalsbetweenstartingreagents(/eft)and the productsof the

(nght)depends reactions on the rateconstants of the forward(k1, (k,,lowerarrow)reactions upperarrow)andreverse Theratioof these,K"o,provides an informative measure of the relative amounts (d)In of products andreactants thatwill be present at equilibrium manycases, the source of energyfor chemical reactions in cellsisthe hydrolysis of the molecule ATPThisenergyisreleased whena highenergyphosphoanhydride bondlinkingthe B andy phosphates in (red)isbrokenby the addition theATPmolecule of a watermolecule,

c h r o m o s o m e1 i s 8 . 6 x 1 0 r 0 t i m e s t h a t o f a p r o t o n ! ) . T h e chemical interactions of all of these molecules,large and small, with water and with one anothet define the nature of life. Luckily, although many types of biomolecules interacr and react in numerous and complex pathways to form functional cells and organisms, a relatively small number of chemical principles are necessaryto understand cellular processes at the molecularlevel (Figure 2-l).ln this chapter we review these key principles, some of which you already know well. Sfe begin with the covalent bonds that connect atoms into a molecule and the noncovalent forcesthat stabilize groups of atoms into functional structures within and between molecules. We then consider the key properties of the basic chemical building blocks of macromoleculesand macromolecular assemblies.After reviewing those aspectsof chemical equilibrium that are most relevant to biological systems,we end the chapter with basic principles of bio-

chemical energetics,including the central role of ATP (adenosinetriphosphate) in capturing and transferring energy in cellular metabolism.

32

cHAPTER2 |

CHEMICALFOUNDATTONS

TOrmlnOAUI'311O l',.

A

CovalentBondsand

NoncovalentInteractions Strong and weak attractive forces between atoms are the "glue" that holds them together in individual moleculesand permits interactions between different biomolecules.Strong forces form a covalent bond when two atoms share one pair of electrons("single" bond) or multiple pairs of electrons ("double" bond, "triple" bond, etc.). The weak attractive forces of noncovalent interactions are equally important in determining the properties and functions of biomolecules such as proteins, nucleic acids, carbohydrates,and lipids. .We will first review covalent bonds and then discussthe four

Electrons

Covalentbond H

H

H

H

A FIGURE 2-2 Covalentbondsform by the sharingof electrons. Covalent bonds,the strongforcesthat holdatomstogetherinto molecules, formwhenatomsshareelectrons fromtherroutermost electron orbitals. Eachatomformsa definednumberandqeometrv of covalent bonds

major types of noncovalent interactions:ionic bonds, hydrogen bonds, van der Waals interactions,and the hydrophobic effect.

The ElectronicStructureof an Atom D e t e r m i n e st h e N u m b e ra n d G e o m e t r y of CovalentBondslt Can Make Hydrogen, oxygen, carbon, nitrogen,phosphorus,and sulfur are the most abundant elementsin biological molecules. Theseatoms, which rarely exist as isolatedentities,readily form covalent bonds, using electronsin the outermost electron orbitals surrounding their nuclei (Figure 2-2\. As a rule, each type of atom forms a characteristicnumber of covalent bonds with other atoms, with a well-defined geometry determined by the atom's size and by both the distribution of electrons around the nucleus and the number of electronsthat it can share.In some cases(e.g.,carbon), the number of stable covalent bonds formed is fixed; in other cases (e.g., sulfur), different numbers of stable covalent bonds are possible. All the biological building blocks are organizedaround the carbon atom, which normally forms four covalent bonds with three or four other atoms. As illustrated in Figure 2-3a for formaldehyde, carbon can bond to three atoms, all in a common plane. The carbon atom forms two typical single bonds with two atoms and a double bond (two shared electron pairs) with the third atom. In the absenceof other constraints, atoms joined by a single bond generally can rotate freely about the bond axis, whereas those connected by a double bond cannot. The rigid planarity imposed by double bonds has enormous significancefor the shapesand flexibility of biomoleculessuch as phospholipids, proteins, and nucleic acids. Carbon can also bond to four rather than three atoms. As illustrated by the methane (CHa) molecule,when carbon is bonded to four other atoms, the angle between any two bonds is 109.5' and the positions of bonded atoms define the four points of a tetrahedron(Figure2-3b). This geome-

try defines the structures of many biomolecules.A carbon (or any other) atom bonded to four dissimilar atoms or groups in a nonplanar configuration is said to be asymmetric. The tetrahedral orientation of bonds formed by an asymmetric carbon atom can be arranged in three-dimensional space in two different ways, producing molecules that are mirror imagesof eachother, a property calledchirality (from the Greek word cheir,meaning "hand") (Figure2-4). Such moleculesare called optical isomers,or stereoisomers.Many molecules in cells contain at least one asymmetric carbon atom, often called a chiral carbon atom. The different stereoisomersof a molecule usually have completely different biological activities becausethe arrangement of atoms within their structures differs, yielding their unique abilities to interact and chemically react with other molecules. Some drugs are mixtures of the stereoisomersof small moleculesin which only one stereoisomerhas the biological activity of interest.The use of a pure single stereoisomer of the chemical in place of the mixture can result in a more potent drug with reduced sideeffects.For example,one stereoisomerof the antidepressantdrug citalopram (Celexa) is

(al Formaldehyde

H

c:o H

(b) Methane H

I

H-C-H

I

H Chemical structure

Ball-and-stick model

Space-filling model

2-3 Geometryof bondswhen carbonis covalently A FIGURE linked to three or four other atoms.(a)A carbonatomcanbe (CHzO). Inthiscase,the bondedto threeatoms,asin formaldehyde participate in two singlebondsandone electrons carbon-bonding etoms , h i c ha l ll i ei n t h es a m ep l a n eU. n l i k a d o u b l eb o n dw canrotatef reelyaboutthe by a singlebond,whichusually connected by a doublebondcannot(b)Whena bondaxis,thoseconnected (CH+), the carbonatomformsfoursinglebonds,asin methane (all in the formof in space oriented case) are H in this atoms bonded indicates on the leftclearly Theletterrepresentation a tetrahedron. andthe bondingpattern of the molecule theatomiccomposition the geometric modelin the centerillustrates Theball-and-stick of the balls the diameters bonds, but and of the atoms arrangement are electrons the atomsandtheirnonbonding representing with the bondlengthsThesizesof the smallcompared unrealistically modelon the rightmore cloudsin the space-filling electron in threedimensions thestructure represent accuratelv C O V A L E N TB O N D SA N D N O N C O V A L E N ITN T E R A C T I O N S

33

FIGURE 2-4 Stereoisomers. Manymolecules in cellscontain at leastoneasymmetric carbonatom Thetetrahedral orientation of bondsformedbyan asymmetric carbonatomcanbearranged in three-dimensional spacein two different ways,producing molecules that aremirrorimages, or stereoisomers, of eachother.Shownhereis thecommonstructure of an aminoacid,with itscentral asymmetric carbonandfourattached groups, including the Rgroup,discussed in Section 2 2. Aminoacidscanexistin two mirror-image forms, designated r ando. Although properties thechemical of such stereoisomers areidentical, theirbiological activities aredistinctOnly r aminoacidsarefoundin oroterns

that can participate in noncovalent interactions. Sulfur forms two covalent bonds in hydrogen sulfide (H2S)but also can accommodate six covalent bonds, as in sulfuric acid (H2SO4)and its sulfate derivatives.Nitrogen and phosphorus each have five electronsto share.In ammonia (NH3), the nitrogen atom forms three covalent bonds; the pair of electrons around the atom not involved in a covalent bond can take part in noncovalent interactions. In the ammonium ion (NH+*), nitrogen forms four covalent bonds, which have a tetrahedral geometry. Phosphoruscommonly forms five covalent bonds, as in phosphoric acid (H3POa) and its phosphate derivatives,which form the backbone of nucleic acids. Phosphategroups covalently attachedto proteins play a key role in regulating the activity of many proteins, and the central moleculein cellular energetics,ATP, contains three phosphate groups (seeSection 2.4). A summary of common covalent linkagesand functional groups (portions of molecules that confer distinctive chemical properties) is provided in Table 2-2.

ElectronsMay Be SharedEqually o r U n e q u a l l yi n C o v a l e n tB o n d s

The extent of an atom's ability to attract an electron is called its electronegatiuity. ln a bond between atoms with identical or similar electronegativities,the bonding electrons are es170 times more potent than the other. Somestereoisomershave sentially sharedequally betweenthe two atoms, as is the case very different activities. Darvon is a pain reliever,whereas its for most C-C and C-H bonds. Such bonds are called nonstereoisomer,Novrad (Daruon spelled backward), is a cough polar. In many molecules,the bonded atoms have different suppressant. One stereoisomer of ketamine is an anesthetic, electronegativities,resulting in unequal sharing of the elecwhereas the other causeshallucinations. I trons. The bond betweenthem is said to be polar. One end of a polar bond has a partial negativecharge The number of covalent bonds formed by other common (6-), and the other end has a partial positive charge ( 6+). atoms is shown in Table 2-1,.A hydrogen atom forms only In an O-H bond, for example, the greater electronegativone covalent bond. An atom of oxygen usually forms only ity of the oxygen atom relative to hydrogen results in the two covalent bonds but has two additional pairs of electrons electrons spending more time around the oxygen atom than the hydrogen. Thus the O-H bond possessesan electric dipole, a positive charge separated from an equal but opposite negative charge. The amount of 6- charge on the oxygen atom of a O-H dipole is approximately 25 percent of that of an electron, with an equivalent 6+ charge on the H atom. Becauseof its two O-H bonds that are nor AT()M AIIO USUAI. I,IUMBTB TYPICAL I)UTER TI.ICIROI'IS {]FCl)VATElrlT BI]NDS Bt]I'IIl GIOMETBY on exact opposite sides of the O atom, water molecules (HzO) are dipoles (Figure 2-5) that form electrostatic,noncovalent interactions with one another and with other molH I H ecules. These interactions play a critical role in almost o z every biochemical interaction and so are fundamental to ,ror cell biology. S 214,or5 St The polarity of the O:P double bond in H3PO4 results ,' in a resonancehybrid, a structure between the two forms N shown below in which nonbonding electrons are shown as 3or4 pairs of dots:

-T-

5

P

4

-'rP

I

-?-

H

CHAPTER2 I

CHEMICALFOUNDATIONS

I

:o

o I

H-O-P-O-H il"

o.

34

H

I

e

l*

H-O-P-O-H

I

o

FUNCTIONAL GROUPS

o -c-

o -c-o-

Carbonyl

Carboxyl

(ketone)

( c a r b o x y l i ca c i d )

o -o-P-oI

oPhosphate

oo

iltl -o-P-o-P-

o-

o-

Pyrophosphate (phosphorylated molecule)

(diphosphate)

LINKAGES

o til -c-o-cI

o -N-C-

ll

I Amide

In the resonancehybrid on the right, one of the electrons from the P:O double bond has accumulatedaround the O atom, giving it a negativecharge and leaving the P atom with a positive charge. These chargesare important in noncovalent interactions.

C o v a l e n tB o n d sA r e M u c h S t r o n g e r and More StableThan NoncovalentInteractions Covalentbonds are very stable(i.e.,consideredto be strong) becausethe energies required to break them are much greater than the thermal energy available at room temperature (25 "C) or body temperature(37'C). For example,the

ol

H

2-5 The dipolenatureof a water molecule.The A FIGURE a partialcharge(aweakerchargethantheone symbolE represents proton) in the a Because of thedifference on an electron or of H andO, eachof the polarH-O bondsin electronegativities of eachof anddirections of the dipoles waterisa dipoleThesizes the netdrstance andamountof charqe the bondsdetermine separation, or dipolemoment,of the molecule

thermal energy at25 "C is approximately 0.6 kilocalorie per mole (kcal/mol), whereas the energy required to break the carbon-carbonsingle bond (C-C) in ethane is about 140 times larger (Figure 2-6). Consequently' at room temperature (25 "C), fewer than f. in 1012ethanemoleculesis broken into a pair of 'CH3 molecules,each containing an unpaired, nonbondingelectron(calleda radical). Covalent single bonds in biological moleculeshave energies similar to the energy of the C-C bond in ethane. Because more electrons are shared between atoms in double bonds, they require more energy to break than single bonds. For instance, it takes 84 kcal/mol to break a single C-O bond but 170 kcal/mol to break a C:O double bond' The most common double bonds in biological molecules are C:O, C:N, C:C, and P:O. In contrast, the energy required to break noncovalent interactions is only 1-5 kcalimol, much less than the bond energiesof covalent bonds (seeFigure 2-5). Indeed' noncovalent interactions are weak enough that they are constantly being formed and broken at room temperature' Although these interactions are weak and have a transient existenceat physiologicaltemperatures(25-37 "C)' multiple noncovalent interactions can, as we will see' act together to produce highly stable and specific associations between different parts of alatge molecule or between different macromolecules. Below, we review the four main types of noncovalent interactions and then consider their roles in the binding of biomoleculesto one another and to other molecules. C O V A L E N TB O N D SA N D N O N C O V A L E N ITN T E R A C T I O N S

35

> FIGURE 2-6 Relativeenergiesof covalent Noncovalent interactions bondsand noncovalentinteractions. Bond lonic energies aredefinedastheenergyrequired to breaka particular typeof linkageCovalent Hydrogen b o n d si ,n c l u d i nt g bonds h o s ef o r s i n g l (eC - C ) a n d double(C:C) carbon-carbon bonds.areoneto Thermal two powersof 10stronger thannoncovalent energy interactions Thelatteraresomewhat greater thanthethermalenergyof theenvironment at (25"C) Many normalroomtemperature processes biological arecoupled to the energy 0.24 released duringhydrolysis of a phosphoanhydride bondin ATP

Covalentbonds

Hydrolysisof ATP p h o s p h o a n h y d r i dbeo n d

c-c

C=C

240 kcal/mol

Increasingbond strength

lonic InteractionsAre Attractions between OppositelyChargedlons Ionic interactions result from the attraction of a positively charged ion-a cation-for a negatively charged ion-an anion. In sodium chloride (NaCl), for example, the bonding electron contributed by the sodium atom is completely transferred to the chlorine arom. (Figure 2-7a). Unlike covalent bonds, ionic interactionsdo not have fixed or specificgeometric orientations becausethe electrostatic field around an ion-its attraction for an opposite charge-is uniform in all directions. In solid NaCl, many ions pack tightly together in an alternating pattern to permit opposite charges to align and thus form a highly orderedcrystallinearray (saltcrystals)(Figure2-7b). tVhen solid saltsdissolvein water, the ions separatefrom one another and are stabilized by their interactionswith water molecules.In aqueoussolutions,simpleions of biological

(al

significance,suchas Na*, K*, Ca2*,Mg2* rand Cl-, are hydrated, surrounded by a stable shell of water moleculesheld in place by ionic interactions betweenthe central ion and the oppositely charged end of the water dipole (Figure 2-7c). Most ionic compounds dissolvereadily in water becausethe energy of hydration, the energy releasedwhen ions tightly bind water molecules,is greater than the lattice energy that stabilizesthe crystal structure. Parts or all of the aqueousbydration shell must be removed from ions when they directly interact with proteins. For example, water of hydration is lost when ions pass through protein pores in the cell membrane during nerve conduction. The relative strength of the interaction betweentwo ions, A- and C-, dependson the concentration of other ions in a solution. The higher the concentration of other ions (e.g., Na* and Cl-), the more opportunities A and C* have to

(b)

1,' -> ---.+

cl Cl

Donationof electron

.-#

s

-d q{-

+ Hro dissolving +-Crystallizing

-d

U A FIGURE 2-7 Electrostaticinteractionsof oppositelycharged dissolved in water,the ionsseparate andtheircharges, no longer ionsof salt(NaCl)in crystalsand in aqueoussolution.(a)In balanced by immediately adjacent ionsof opposite charge, are crystalline tablesalt,sodiumatomsarepositively charged stabilized ions(Na+) by interactions with polarwaterWatermolecules andthe dueto the lossof oneelectron each,whereas chloride ionsareheldtogetherby electrostatic atomsare interactions between the correspondingly (Ct I 5Ugainingoneelectron negatively charged charges on the ionandthe partialcharges on thewater'soxygenand each(b)Insolidform,ioniccompounds formneatlyordered hydrogen atomsIn aqueous arrays, solutions, all ionsaresurrounded by a or crystals, of tightlypackedionsin whichthe positive andnegatively hydration shellof watermolecules charged ionscounterbalance eachother.(c)Whenthe crvstals are

36

CHAPTER2 I

CHEMICALFOUNDATIONS

(c)

(b)

(a)

:O-H

I

H H

iuH tll O-H

I o-H

H

I :O-H

:O-H

:O-H

H

ll

H-O:

I :O-H

HH H-O

Water-water

: O-H

H-O: I

I

H HH

:o -i-rtr-

:O- CHs

Alcohol-water

I

:N-CHs H

Amine-water

H

H

o -i - o-

.H-O: I H

Peptide group-water

Ester group-water

2-8 Hydrogenbondingof water with itself and with A FIGURE in an outerelectrons Eachpairof nonbonding other compounds. atomin a hydrogen atomcanaccepta hydrogen oxygen or a nitrogen andtheaminogroupscanalsoformhydrogen bond Thehydroxyl forms bondswithwater.(a)In liquidwater,eachwatermolecule others, creating a dynamic hydrogen bondswithseveral transient

(b)Wateralsocanform molecules networkof hydrogen-bonded for the high accounting andamines, bondswith alcohols hydrogen (c)Thepeptide groupandestergroup, of thesecompounds solubility participate in commonly in manybiomolecules, whicharepresent bondswithwateror polargroupsin othermolecules. hydrogen

interact ionically with these other ions and thus the lower the energyrequired to break the interaction betweenA- and C*. As a result, increasingthe concentrationsof saltssuch as NaCl in a solution of biological moleculescan weaken and even disrupt the ionic interactions holding the biomolecules together.

O-H bonds within a singlewater molecule (Figure2-8a). The strengthof a hydrogen bond betweenwater molecules (approximately 5 kcal/mol) is much weaker than a covalent O-H bond (roughly 110 kcal/mol), although it is greater than that for many other hydrogen bonds in biological molecules(t-2 kcall mol). The extensivehydrogen bonding between water molecules accounts for many of the key properties of this compound' including its unusually high melting and boiling points and its ability to interact with (e.g.,dissolve)many other molecules. The solubility of unchargedsubstancesin an aqueousenvironment dependslargely on their ability to form hydrogen bondswith water.For instance,the hydroxyl group (-OH) in an alcohol (XCH2OH) and the amino group (-NH2) in amines (XCH2NH2) can form severalhydrogen bonds with water, enabling these moleculesto dissolvein water to high concentrations(Figure2-8b). In general,moleculeswith polar bonds that easilyform hydrogen bonds with water' as well as charged moleculesand ions that interact with the dipole in water, can readily dissolve in water; that is' they are hydrophilic (water liking). Many biological moleculescontain, in addition to hydroxyl and amino groups' peptide and ester groups, which form hydrogen bonds with water via otherwisenonbondedelectronson their carbonyl oxygens(Figure 2-8c). X-ray crystallography combined with computational analysispermits an accuratedepiction of the distribution of the outermostunbondedelectronsof atoms as well as the electrons in covalent bonds, as illustrated in Figure 2-9.

HydrogenBondsDeterminethe Water S o l u b i l i t yo f U n c h a r g e dM o l e c u l e s A hydrogen bond is the interaction of a partially positively charged hydrogen atom in a molecular dipole (e.9., water) with unpaired electronsfrom another atom, either in the same (intramolecular\or different Untermolecular)molecule.Normall5 a hydrogen atom forms a covalent bond with only one other atom. However, a hydrogen atom covalentlybonded to an electronegativedonor atom D may form an additional weak association,the hydrogen bond, with an acceptoratom A, which must have a nonbonding pair of electronsavailable for the interaction: D6--H6+

+ : 46- i-

D6--H6*:.....:: 46-

uyarolln uona The length of the covalent D-H bond is a bit longer than it would be if there were no hydrogen bond becausethe acceptor "pulls" the hydrogen away from the donor. An important feature of all hydrogen bonds is directionality. In the strongest hydrogen bonds, the donor atom, the hydrogen atom, and the acceptor atom all lie in a straight line. Nonlinear hydrogen bonds are weaker than linear ones; still, multiple nonlinear hydrogen bonds help to stabilize the three-dimensionalstructuresof many proteins. Hydrogen bonds are both longer and weaker than covalent bonds betweenthe same atoms. In water, for example, the distance between the nuclei of the hydrogen and oxygen atoms of adjacent, hydrogen-bondedmoleculesis about 0.27 nm, about twice the length of the covalent

Van der WaalsInteractions Are Causedby TransientDiPoles When any two atoms approach each other closel5 they create a weak, nonspecific attractive force called a van der Waals interaction. Thesenonspecificinteractionsresult from the momentary random fluctuations in the distribution of the electrons of any atom' which give rise to a transtent C O V A L E N TB O N D SA N D N O N C O V A L E N ITN T E R A C T I O N S

37

clouds, the atoms are said to be in van der $7aalscontact. The strength of the van der rWaalsinteraction is about 1 kcal/mol. weaker than typical hydrogen bonds and only slightly higher than the averagethermal energy of moleculesat 25 "C. Thus multiple van der Waals interactions,a van der'Waalsinteraction in conjunction with other noncovalent interactions, or both are required to significantly influencethe stability of inter- and intramolecular conracrs.

The HydrophobicEffectCausesNonpolar Moleculesto Adhere to One Another Becausenonpolar molecules do not contain charged groups, possessa dipole moment, or becomehydrated,they are insoluble or almost insolublein water; that is, they are hydrophobic (water fearing).The covalentbonds betweentwo carbon atoms and between carbon and hydrogen atoms are the most common nonpolar bonds in biological systems.Hydrocarbons-molecules made up only of carbon and hydrogen-are virtually insoluble in water. Large triacylglycerols(or triglycerides),which make up A FIGURE 2-9 Distributionof bondingand outer nonbonding animal fats and vegetableoils, also are insolublein water. As we electronsin the peptidegroup.Shownhereisa peptidebond will see later, the major portion of these moleculesconsistsof linkingtwo aminoacidswithina proteincalledcrambinTheblack long hydrocarbon chains. After being shaken in water, triacyllinesrepresent thecovalent bondsbetween atomsThered(negative) glycerols form a separatephase.A familiar example is the sepaandblue(positive) linesrepresent contours of chargedetermined ration of oil from the water-basedvinegar in an oil-and-vinegar usingx-raycrystallography andcomputational methods. Thegreater salad dressing. the numberof contourlines,the higherthe charge. Thehighdensity Nonpolar moleculesor nonpolar portions of molecules of redcontourlinesbetweenatomsrepresents the covalent bonds (shared tend to aggregatein water owing to a phenomenoncalled pairs). electron Thetwo setsof redcontourlinesemanating fromtheoxygen(O)andnotfallingon a covalent the hydrophobic effect. Becausewater molecules cannot (black bond line) represent thetwo pairsof nonbonded form hydrogen bonds with nonpolar substances,they tend electrons on the oxygen that areavailable to participate in hydrogen bondingThehighdensity to form "cages" of relatiuely rigid hydrogen-bonded of bluecontourlinesnearthe hydrogen (H)bondedto nitrogen (N) pentagons and hexagons around nonpolar molecules represents a partialpositive charge, indicating thatthisH canactasa donorin hydrogen bonding. C Jelsch etal, 2000,procNat,t. [From Acad SciUSA97.3171 CourtesyofM M Teeterl

unequal distribution of electrons. If two noncovalently bonded atoms are close enough together, electrons of one atom will perturb the electronsof the other. This perturbation generatesa transient dipole in the secondatom, and the two dipoles will attract each other weakly (Figure 2-10). Similarly, a polar covalent bond in one molecule will attract an oppositely oriented dipole in another. Van der'Waals interactions, involving either transiently induced or permanent electric dipoles, occur in all types of molecules, both polar and nonpolar. In particular, van der \Waalsinteractions are responsible for the cohesion between nonpolar moleculessuch as heptane,CH3-(CH2)s-CH:, that cannot form hydrogen bonds or ionic interactionswith 'Waals other molecules.The strength of van der interactions decreasesrapidly with increasingdistance;thus thesenoncovalent bonds can form only when atoms are quite closeto one another. However, if atoms get too close together,they become repelled by the negative charges of their electrons. \fhen the van der Waals attraction between rwo aroms exactly balances the repulsion between their two electron

38

CHAPTER2 |

cHEM|CALFOUNDAT|ONS

ii

k----t

Covalent radius ( 0 . 0 6n 2m )

van derWaals radius ( 0 . 1 4n m )

A FIGURE 2-10 Two oxygenmoleculesin van der Waals contact.ln thismodel,redindicates negative chargeandblue positive indicates chargeTransient dipoles in theelectron clouds of all atomsgiveriseto weakattractive forces,calledvander Waals interactions. Eachtypeof atomhasa characteristic vanderWaals radius at whichvanderWaalsinteractions withotheratomsare optimal. Because atomsrepeloneanotherif theyarecloseenough together for theirouterelectrons to overlap withoutbeingshared in a covalent bond,thevanderWaalsradiusisa measure of thesizeof theelectron cloudsurrounding an atom Thecovalent radrus indicated hereisfor thedoublebondof O:O; thesinqle-bond covalent radius of oxygenisslightly longer.

Nonpolar substance

Watersreleasedinto bulk solution H i g h l yo r d e r e d w a t e rm o l e c u l e s

\\ o o'o \.t

o

o Hydrophobic aggregation

@o Lowerentropy

Higherentropy

2-11 Schematic depictionof the hydrophobiceffect' FIGURE in molecules thatformaroundnonpolar Cagesof watermolecules in thesurrounding thanwatermolecules aremoreordered solution r esd u c et h s en u m b e r b u l kl i q u i dA g g r e g a t i o nf n o n p o l amr o l e c u l e resulting in a in highlyordered cages, involved of watermolecules compared state(nErht) moreenergetical lyf avorable higher-entropy, state(/eft) with the unaggregated

(Figure 2-1I, Ieft). This state is energeticallyunfavorable becauseit decreasesthe randomness(entropy) of the population of water molecules.(The role of entropy in chemic a l s y s t e m si s d i s c u s s e di n a l a t e r s e c t i o n . )I f n o n p o l a r moleculesin an aqueousenvironment aggregatewith their hydrophobic surfacesfacing each other, the hydrophobic s u r f a c e a r e a e x p o s e dt o w a t e r i s r e d u c e d ( F i g u r e 2 - 1 1 , right). As a consequence,lesswater is neededto form the cages surrounding the nonpolar molecules, and entropy increases(an energeticallymore favorable state)relative to the unaggregatedstate. In a sense,then, water squeezes the nonpolar moleculesinto spontaneouslyforming aggregates.Rather than constituting an attractive force such as in hydrogen bonds, the hydrophobic effect resultsfrom an a v o i d a n c e o f a n u n s t a b l e s t a t e ( e x t e n s i v ew a t e r c a g e s a r o u n d i n d i v i d u a ln o n p o l a r m o l e c u l e s ) . Nonpolar moleculescan also associate,albeit weakly' through van der Vaals interactions.The net result of the hydrophobic and van der Waals interactionsis a very powerful tendencyfor hydrophobic moleculesto interact with one another,not with water. Simply put, like dissolueslike' Polar moleculesdissolve in polar solvents such as water; nonpolar moleculesdissolvein nonpolar solventssuch as hexane.

y ediated M o l e c u l a rC o m p l e m e n t a r i t M PermitsTight, Interactions Noncovalent via H i g h l yS p e c i f i cB i n d i n go f B i o m o l e c u l e s Both inside and outside cells, ions and molecuiesare constantly bumping into one another.The greaterthe number of copiesof any two types of moleculesper unit volume (i'e.,

the higher their concentration)' the more likely they are to encounter one another.Vhen two moleculesencounter each other, they most likely will simply bounce apart becausethe noncovalent interactions that would bind them together are weak and have a transient existenceat physiological temperatures. However, moleculesthat exhibit molecular complementarity, a lock-and-key kind of fit between their shapes, form multiple noncharges,or other physical properties,can '$7hen two such struccovalent interactions at close range. turally complementarymoleculesbump into each other' they can bind (stick) together. Figure 2-12 tllustrates how multiple, different weak bonds can bind two proteins together. Almost any other arrangement of the same groups on the two surfaceswould not allow the molecules to bind so tightly. Such multiple, specificinteractions betweencomplementary regions within a orotein molecule allow it to fold into a unique threedimensionalshape(Chapter 3) and hold the two chains of DNA togetherin a double helix (Chapter 4)' Similar interactionsunderliethe associationof groups of more than two molecules into multimolecular complexes, leading to formation of muscle fibers' to the gluelike associationsbetween cells in solid tissues,and to numerous other cellular structures. Depending on the number and strength of the noncovalent interactions betweenthe two moleculesand on their environment, their binding may be tight (strong) or loose (weak) and, as a consequence,either long lasting or transient.The higher the affinity of two moleculesfor each other, the better the molecular "fit" between them, the more noncovalent interactionscan form, and the tighter they can bind

-cH3 | -CH3 H3( ,

_cH3 H3C_

ProteinB ProteinA Stable complex

ProteinC ProteinA Less stable comPlex

andthe bindingof complementarity 2-12 Molecular FIGURE Thecomplementary proteinsvia multiplenoncovalentinteractions. of two proteinsurfaces polarity, andhydrophobicity charges, shapes, produce a whichin combination weakinteractions, permrt multiple from molecular deviations Because binding. tight and stronginteraction surface a parlicular binding, weaken substantially complementarity canbindtightlyto onlyoneor a usually of anygivenbiomolecule region of the Thecomplementarity of othermolecules verylimitednumber much more bind permits to them left on the two proteinmolecules proteins on therighi tightlythanthetwo noncomplementary INTERACTIONS T C O V A L E N TB O N D SA N D N O N C O V A L E N T

39

together.An important quantitative measureof affinity is the binding dissociationconstant K6, describedlater. As we discussin Chapter 3, nearly all the chemicalreactionsthat occur in cellsalso dependon the binding propertiesof enzymes.Theseproteins not only speedup, or cataIyze, reactions but also do so with a high degree of specificity, a reflection of their ability to bind tightly to only one or a few related molecules. The specificity of intermolecularinteractionsand reactions,which dependson molecular complementarity,is essentialfor many processes critical to life.

Covalent Bonds and Noncovalent Interactions Covalent bonds, which bind the atoms composing a olecule in a fixed orientation, consist of pairs of electrons shared by two atoms. They are stable in biological systems because the relatively high energies required to break them (50-200 kcal/mol) are much larger than the thermal kinetic energyavailableat room (25 .C) or body (37 "C) temperatures. r Many moleculesin cells contain at least one asymmetric carbon atom, which is bonded to four dissimilar atoms. Such moleculescan exist as optical isomers (mirror images),designatedn and r (seeFigure 2-4), which have different biological activities.In biological systems, nearly all sugarsare D isomers,whereasnearly all amino acids are L isomers. trons may be sharedequally or unequally in covalent Atoms that differ in electronegativityform polar cobonds in which the bonding electronsare distributed unequally. One end of a polar bond has a partial positive charge and the other end has a partial negativechaige (see Figure2-5). r Noncovalent interactions between atoms are considerably weaker than covalent bonds, with bond energlesranging from about 1-5 kcal/mol (seeFigure 2-6). r Four main types of noncovalent interactions occur in biological systems:ionic bonds, hydrogen bonds, van der \faals interactions, and interactions due to the hvdroohobic effect. r Ionic bonds result from the electrostatic attraction between the positive and negativechargesof ions. In aqueous solutions, all cations and anions are surrounded by a shell of bound water molecules(seeFigure Z-7c).Increasingthe salt (e.g.,NaCl) concentrarionof a solutioncan weakenthe relative strength of and even break the ionic bonds between biomolecules. hydrogen bond, a hydrogen atom covalently bonded electronegativeatom associateswith an accepror whose nonbonding electrons attract the hydrogen gure 2-8).

40

CHAPTER2 |

cHEMTCALFOUNDATTONS

r Weak and relatively nonspecificvan der'Sfaalsinteractions are createdwheneverany two atoms approach each other closely. They result from the attraction between transient dipoles associatedwith all molecules (seeFigure2-10). r In an aqueousenvironment, nonpolar moleculesor nonpolar portions of larger molecules are driven together by the hydrophobic effect, thereby reducing the exrent of their direct contactwith water molecules(seeFigure2-11). r Molecular complementarity is the lock-and-key fit between moleculeswhose shapes,charges,and other physical properties are complementary.Multiple noncovalent interactions can form betweencomplementary molecules,causing them to bind tightly (seeFigure2-12),but not between moleculesthat are not complementary. r The high degreeof binding specificity that results from molecular complementarity is one of the features that underlies intermolecular interactions and thus is essentialfor many processescritical to life.

E

Chemical BuildingBlocksof Cells

A common theme in biology is the construction of large molecules (macromolecules)and structures by the covalent or noncovalent associationof many similar or identical smaller molecules.The three most abundant classesof the critically important biological macromolecules-proteins, nucleic acids, and polysaccharides-are all polymers composed of multiple covalently linked building block small molecules,or monomers (Figure 2-13). Proteins are linear polymers containing 10 to severalthousand amino acids linked by peptide bonds. Nucleic acids are linear polymers containing hundreds to millions of nucleotides linked by phosphodiester bonds. Polysaccharidesare linear or branched polymers of monosaccharides(sugars)such as glucose linked by glycosidic bonds. Although the actual mechanismsby which covalent bonds betweenmonomers form are complex and will be discussedlater, the formation of a covalent bond between two monomer molecules usually involves the net loss of a hydrogen (H) from one monomer and a hydroxyl (OH) from the other monomer-or the net loss of one water-and can therefore be thought of as a debydration reaction. These bonds are stable under normal biological conditions (e.g., 37"C, neutral pH), and so thesebiopolymers are stable and can perform a wide variety of jobs in cells (store information, catalyze chemical reactions, serve as structural elements in defining cell shapeand movement, etc.). Macromolecular structures can also be assembledusing noncovalent interactions. The macromolecular two-layered (bilayer) structure of cellular membranesis built uo bv the noncovalent assemblyof many thousandsof small molecules called phospholipids (seeFigure 2-13).In this chapter, we will focus on the characteristicsof the monomeric chemical

POLYMERS

MONOMERS

ttl

H2N-C -C-OH I R

HHOHHOHHOHHO

HO

HO +

ttl

|

I R

I

l

ll,l

L ll

N-C-CrN-C-C-OH I I | R* R3 I

peptidebond

Amino acid

o tl

| ll I

| ll |

H-N-C-ciN-C-C | I lt R2 R, l"

oH

H-N-C-C-

PolYPePtide

B L

Base

?1,

HO-P-O

I

HO-P-OJs,

.OH

6Nucleic acid

Nucleotide

glYcosidicbond

Polysaccharide

Monosaccharide

I Hyoropr'irt. h e a dg r o u p J

Phospholipid

2-13 Overviewof the cell'sprincipalchemical FIGURE threemajortypesof biological buifdingblocks.(Top)The of bythe polymerization assembled are each macromolecules (monomers) type:proteins of a particular smallmolecules multiple acidsfromnucleotides 3),nucleic fromaminoacids(Chapter building blocks-amino acids,nucleotides,sugars'and phospholipids. The structure, function, and assemblyof proteins, nucleic acids, polysaccharides,and biomembranes are discussedin subsequentchapters.

A m i n o A c i d sD i f f e r i n gO n l y i n T h e i r SideChainsComposeProteins The monomeric building blocks of proteins ate 20 amino acids, which when incorporated into a protein polymer are sometimescalled residues.All amino acidshave a characteristic structureconsistingof a central alpha (cr)carbon atom (C') bonded to four different chemical groups: an amino (NHz)

(sugars)Each from monosaccharides (Chapter 4), andpolysaccharides whose reaction polymer by a linkedintothe iscovalently monomer (Boftom) In (dehydration) molecule net resultis lossof a water into a bilayer assemble noncovalently monomers phospholipid contrast, (chapter10) membranes of allcellular whichformsthebasis structure, group, a carboxylic acid or carboxyl (COOH) group (hence amino acid),a hydrogen (H) atom, and one variable Ih. *-. group, called a side chain or R group' Becausethe ct carbon i.-nali amino acids except glycine is asymmetric,thesemolecules can exist in two mirror-image forms called by convention the I (dextro) and the r- (levo) isomers (seeFigure 2-4)' The two isomerscannot be interconverted(one made identical with the other) without breaking and then re-forming a chemical bond in one of them. !7ith rare exceptions, only the I- forms of amino acids are found in proteins' To understand the three-dimensional structures and functions of proteins' discussedin detail in Chapter 3, you must be familiar with some of the distinctive properties of

B U I L D I N GB L O C K SO F C E L L S CHEMICAL

41

H Y D R O P H O BA I CM I N OA C I D S

cooI

*H3N-C-H I cHs

coo-

+ H . N - c I- H

"l

CH HsC

cooI

+H3N-c-H

CHs

cooI

cooI

+H3N-c-H

cooI

cooI

'H"N-C-H

-l

cooI

*H.N-C-H

-l

H-C - CH.

CH,

CH,

CH,

CH

C:CH

t"

lcHs

t-

HaC

t-

CHs

Lr*t OH

\/ Alanine ( A l ao r A l

Valine (Val orVl

lsoleucine ( l l eo r l l

Leucine (Leu or Ll

H Y D R O P H I LA I CM I N OA C I D S

Methionine (Met or M)

Acidic amino acids

cooI

coo-

I +H3N-c-H

I CHt

CH,

l-

NHs*

Lysine (Lys or Kl

CH,

t-

CH, lCH,

tCH, t-

Glycine (Gty or G)

.

H-C-OH

coo-

oH

cHs

Aspartate (Asp or Dl

Serine (Ser or Sl

Threonine (Thr orT)

I

'H"N-C-H

-l

CH,

IcH, )' cooGlutamate ( G l uo r E )

proline (pro or p)

amino acids, which are determined in part by their side chains. You need not memorize the detailed structure of each type of side chain to understandhow proteins work because amino acids can be classified into several broad categories basedon the size,shape,charge,hydrophobicity (a measure of water solubility), and chemical reactivity of the side chains (Figure 2-74). However, you should be familiar with the generalproperties of each category. Amino acids with nonpolar side chains are hydrophobic and so poorly soluble in water. The larger the nonpolar side chain, the more hydrophobic-less water soluble-the amino acid. The noncyclic side chains of alanine, ualine, leucine, and. isoleucine(calledaliphatic),as well as methionine,consisren_ tirely of hydrocarbons, except for the one sulfur arom in me_ thionine, and all are nonpolar. phenylalanine, tyrosine, and. 42

r"l t-i

coo+H3N-C-H

coo-

l-

NH i C: NHr+ lNHz Arginine (Argor Rl

SPECIALAMINO ACIDS

Cysteine (Cys or C)

cootl

CH,

CH,

Tryptophan (TrporW)

Polar amino acids with uncharged R groups

*H3N-C-H

I 'H"N-C-H -l

lCH,

Tyrosine (TyrorYl

+H.N-c-H

-l

coo-

Phenylalanine (Phe or Fl

c H A p r E R 2| c H E M t c A L F o u N D A T t o N s

FIGURE 2-14 The 20 commonaminoacidsusedto build proteins.Thesidechain(Rgroup;red)determines thecharacteristic properties of eachaminoacidandisthe basisfor grouping amino acidsintothreemaincategories: hydrophobic, hydrophilic, and special. Shownarethe ionized formsthatexistat the pH(=7)of the cytosolIn parentheses arethethree-letter andone-letter abbreviations for eachaminoacid.

tryptophan have large, bulky aromatic side chains. In later chapters, we will see in detail how these hydrophobic side chains under the influence of the hydrophobic effeci often pack in the interior of proteins or line the surfacesof proteins that are embeddedwithin hydrophobic regions of biomembranes. Amino acids with polar side chains are hydrophilic; the most hydrophilic of theseamino acids is the subsetwith side chains that are charged (ionized) at the pH typical of biological fluids (=7)-both inside and outside the cell (seeSectio-n 2.3). Arginine and lysine have positively charged side chains and are called basic amino acids;aspartic acid and glutamic acid have negatively charged side chains due to the carboxylic acid groups in their side chains (their charged forms are called aspartate and glutamate) and are called acidic. A fifth amino acid, histidine, has a side chain containing a ring

with two nitrogens, called imidazole, which can shift from being positively charged to uncharged depending on small changesin the acidity of its environment:

I

A c e t y ll y s i n e

C H 3 - C - N - C H 2 - C H 2 - C H 2 - C H " - C H - C-Ol O -

NH.-

o - o - Ptl o - c H 2 - c H - c o o -

ll Phosphoserine

ll O

NH"OH

pH 5.8

PH 7.8

The activities of many proteins are modulated by shifts in environmental acidity through protonation or deprotonation of histidine side chains. Asparagine and glutamine are uncharged but have polar side chains containing amide groups with extensivehydrogen-bondingcapacities'Similarl5 serine and threonine are unchargedbut have polar hydroxyl groups, which also participate in hydrogen bonds with other polar molecules. Lastl5 cysteine,glycine, and proline exhibit specialroles in proteins becauseof the unique properties of their side chains. The side chain of cysteine contains a reactive sulfhydryl group (-SH), which can oxidize to form a covato a secondcysteine: lent disulfide bond (-S-S-/

I I- H

I

I H,9-9H

3-Hydroxyproline

II H2C\ * N //CH-COOH, HC:C-CH2-CH-COOtrl NH.H3C-N-C-.N

3-Methylhistidine

H

-ooc y-Carboxyglutamate

-OOC

c H - c H' "l - c H - c o o ilH.*

of aminoacidside 2-15 €ommonmodifications A FIGURE others andnumerous residues chainsin proteins.Thesemodified groups(red)to theamino chemical of various areformedby addition chain of a polypeptide acidsidechainsduringor aftersynthesis

N-H

N-H

I

H-C-CH2-

SH+ HS-CH2q

ll

C:O

C:O

reveals that they contain upward of 100 different amino acids.Chemical modifications of the amino acids account for

ll

tl H-N

r''l ll

H-C-

ll O:C ll

C H 2- S - S -

N-H C H 2- c - H

C:O

Regionswithin a singleprotein chain (intramolecular) or in separatechains (intermolecular) sometimesare crosslinked through disulfide bonds. Disulfide bonds stabilizethe folded structure of some proteins. The smallestamino acid, glycine, has a singlehydrogen atom as its R group. Its small sizeallows it to fit into tight spaces.Unlike the other common amino acids, the side chain of proline bends around to form a ring by covalently bonding to the nitrogen atom (amino group) attached to the Co. As a result' proline is very rigid and createsa fixed kink in a protein chain, limiting how a protein can fold in the region of proline residues. Some amino acids are more abundant in proteins than others. Cysteine,tryptophan, and methionine are rare amino acids: together they constitute approximately 5 percent of the amino acids in a protein. Four amino acids-leucine, serine, lysine, and glutamic acid-are the most abundant amino acids, totaling 32 percent of all the amino acid residuesin a typical protein. However, the amino acid composition of proteins can vary widely from thesevalues. Although cellsusethe 20 amino acidsshown in Figure2-14 inthe initial synthesisof proteins' analysisof cellular proteins

and plants but less studied-perhaps becauseof the relative insta-bilityof phosphorylatedhistidine-and apparently rare in mammals.ltt. iia. chains of asparagine,serine,and threonine are sitesfor glycosylation,the attachmentof linear and branched carbohydrate chains. Many secretedproteins and membrane proteins contain glycosylated residues' Other amino acid modifications found in selectedproteins include the hydroxylation of proline and lysine residuesin collagen (Chapter 19), the methylation of histidine residuesin memb."ne rec.ptors' and the 7 carboxylation of glutamate in blood-clotting factors such as prothrombin' Acetylation, addition of an acetyl group' to the amino gro,rp oi the N-terminal residue, is the most common form acid chemical modification, affecting an estimated 6f "-ino 80 percentof all proteins:

o lllll

RO

cH3-c- r y- g- cll HH Acetylated N-terminus OF CELLS B U I L D I N GB L O C K S CHEMICAL

O

43

This modification may play an important role in controlling the life span of proteins within cells becausenonacetylateJ proteins are rapidly degraded.

PURINES NH,

O

ltl

Five Different Nucleotides A r e U s e dt o B u i l d N u c l e i cA c i d s Two types of chemically similar nucleic acids, DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). are the principal genetic-information-carryingmoleculesof the cell. The monomers from which DNA and RNA polymers are built, called nucleotides,all have a common structure: a phosphategroup linked by a phosphoesterbond to a pentose (a five-carbon sugar molecule) that in turn is linked io a nitrogen- and carbon-containing ring structure commonly referred to as a base (Figure 2-16a).In RNA, the pentoseis ribose; in DNA, it is deoxyribose that at posirion 2, has a proton rather than the hydroxyl group at that site in ribose

HH Adenine (A)

(Gl Guanine

PYRIMIDINES NH,

il

tru/?--cH

r"^tl

.r'"'ii" vl H Cytosine (C)

A FIGURE 2-17 Chemical structuresof the principalbasesin nucleicacids.ln nucleic acidsandnucleotides, nitrogen 9 of purines andnitrogen1 of pyrimidines (red)arebondedto the 1, carbonof riboseor deoxyribose U isonlyin RNA,andT isonlyin DNA Both R N Aa n dD N Ac o n t a iA n , G ,a n dC .

position 1 of a pyrimidine (N1). The acidic character of

which form ionic interactions with the negatively charged phosphates. Cells and extracellular fluids in organismscontain small concentrationsof nucleosides,combinations of a baseand a sugar without a phosphate.Nucleotides are nucleosidesthat have one, two, or three phosphate groups esterified at the 5' hydroxyl. Nucleoside monophosphateshave a single esterified phosphate (seeFigure 2-16a); nucleoside diphosphates contain a pyrophosphategroup:

oo

-o-l-o-A-o-

(a) Adenine

Nhz l

(b)

'-c'

5',

N ; , 6 ; -c

\

HOCH2

daH HC.1 : 1c s,/ -'N' N

o - o - P - O - c H5',

o-

5',

HOCH2

Phosphate 2'

OH

H

Ribose Adenosine 5'-monophosphate (AMP}

2-Deoxyribose

FIGURE 2-15 Commonstructureof nucleotides. (a)Adenosine 5' -monophosphate (AMp),a nucleotide present in RNAByconvention, thecarbonatomsof the pentose sugarin nucleotides arenumbered with primes. In naturalnucleotides, the 1, carbonisjoinedby a B linkage to the base(inthiscaseadenine); boththe base(blue)and the phosphate on the 5, hydroxyl (red)extendabovethe planeof the sugarring.(b)Ribose anddeoxyribose, the pentoses in RNAand DNA,respectively 44

.

c H A p r E R 2| c H E M t c A L F o u N D A T t o N S

o-

o-

Pyrophosphate

and nucleosidetriphosphateshave a third phosphate.Table 2-3 lists the names of the nucleosidesand nucleotidesin nucleic acids and the various forms of nucleosidephosphates.The nucleosidetriphosphatesare used in the synthesisof nucleic acids,which we cover in Chapter 4. Among their other functions in the cell, GTP participares in intracellular signaling a_ndacts as an energy reservoir,particularly in protein synthesis, and ATP, discussedlater in this chapter, is the most widely usedbiologicalenergycarrier.

M o n o s a c c h a r i d eJso i n e db y G l y c o s i d i B c onds Form Linearand Branchedpolysaccharides The building blocks of the polysaccharidesare rhe simple sugars, or monosaccharides.Monosaccharides are carbohy_ drates,which are literally covalently bonded combinationsof carbon and water in a one-to-one ratio (CH2O),, where n e q u a l s3 , 4 , 5 , 6 , o r 7 . H e x o s e s( n : 6 ) a n d p e n t o s e (sn : 5 ) are the most common monosaccharides. All monosaccharides

GUANINT(G}

ADENINE(A)

nNe Jin

t,,'o^o

innNe f Iino*e

uBACrr(lJ) THYMINE(I)

cYT0srNt(q

Adenosine

Guanosine

Cytidine

Uridine

Deoxyadenosine

Deoxyguanosine

Deoxycytidine

DeoxYthYmidine

Adenylate

Guanylate

Cytidylate

UridYlate

Deoxycytidylate

Deoxythymidylate

Deoxyadenylate

DeoxyguanYlate

Nucleoside monophosphates

AMP

GMP

CMP

UMP

Nucieosidediphosphates

ADP

GDP

CDP

UDP

Nucleoside triphosphates

ATP

GTP

CTP

UTP

Deoxynucleoside mono-, di-, and triphosphates

dAMP,etc.

dGMP,etc'

dCMP, etc

dTMP' etc.

contain hydroxyl (-OH) a keto group:

oo

- c t- icl - H lll

Aldehyde

groups and either an aldehyde or

Htt,

6

(-rQ

n-J'-oH

H

- c -Lcf - c - l

1

0) occurs spontaneously(AG < 0). An endothermic reaction (AH > 0) will occur spontaneouslyif AS increasesenough so that the T AS term can overcome the positive AH. Many biological reactions lead to an increase in order and thus a decreasein entropy (AS < 0). An obvious example is the reaction that links amino acids to form a protein. A solution of protein molecules has a lower entropy than does a solution of the same amino acids unlinked because the free movementof any amino acid in a protein is restricted when it is bound into a long chain. Often cells compensate for decreases in entropy by "coupling" suchsynthetic,entropylowering reactions with independent reactions that have a very highly negariveAG (seebelow). In this way cells can convert sources of energy in their environment into the building of highly organized structures and metabolic pathways that are essentialfor life. The actual changein free energy AG during a reacrion is influenced by temperature, pressure,and the initial concentrations of reactants and products and usually differs from AG''. Most biologicalreactions-like othersthat take place in aqueoussolutions-also are affected by the pH of the so'We lurion. can estimate free-energy changes for different temperaturesand initial concentrationsusing the equation AG:

AC.'-r RTln Q:

AC"'+ RTln

fproducts] Q-7) I reacrantsl

where R is the gas constanrof 1.987 call(degree.mol), T is the temperature (in degreesKelvin), and Q is the initial rctio of products to reactants. For a reaction A + B == C. in which two molecules combine to form a third, e in Equation2-7 equalstcl/lAltBl.In this case,an increasein the initial concentration of either [A] or [B] will result in a larger negative value for AG and thus drive the reaction toward more formation of C. Regardlessof the AG"' for a particular biochemicalreaction, it will proceed spontaneouslywithin cells only if AG is negative, given the intracellular concentrations of reactants and products. For example, the conversion of glyceraldehyde 3-phosphate (G3P) to dihydroxyacetonephosphate (DHAP), two inrermediatesin the breakdownof glucose, .^DHAP G3P . has a AGo' of -1840 caVmol.If the initial concentrationsof G3P and DHAP are equal, then AG : AGo' becauseRT ln 1 : 0; in this situation, the reversiblereaction G3P : DHAP will proceedspontaneouslyin the direction of DHAp formation until equilibrium is reached. However, if the initial 56

CHAPTER2 I

CHEMICALFOUNDATIONS

[DHAP] is 0.1 M and the initial [G3P] is 0.001 M, with other conditions standard,then Q in Equation 2-7 equals0.1/0.001 : 100, giving a AG of *887 caVmol.Under theseconditions, the reaction will proceed in the direction of formation of G3P. The AG for a reaction is independent of the reaction rare. Indeed, under usual physiological conditions, few if any of the biochemical reactions neededto sustain life would occur without some mechanism for increasing reaction rates. As we describe below and in more detail in Chapter 3, the rates of reactions in biological systemsare usually determinedby the activity of enzymes,the protein catalyststhat acceleratethe formation of products from reactantswithout altering the value of AG.

The Ad' of a ReactionCan Be Galculatedfrom lts K.o A chemical mixture at equilibrium is in a stable state of minimal free energy.For a system at equilibrium (AG : 0, Q : K"o), we can write AGo': -2.3RTlogK.o: -1362logK.o

Q-8)

under standard conditions (note the changeto base 10 logarithms). Thus if we determinethe concentrationsof reactants and products at equilibrium (i.e., the K.o), we can calculate the value of AGo'. For example,the K.o for the inrerconversion of glyceraldehyde 3-phosphate to dihydroxyacetone phosphate (G3P : DHAP) is 22.2 under standard conditions. Substitutingthis value into Equation 2-8, we can easily calculatethe AGo' for this reaction as - 1840 callmol. By rearranging Equation 2-8 and taking the antilogarithm, we obtain Keq :

10-(aG"'/2'3RT)

(2-e)

From this expression,it is clear that if AGo' is negative,the exponent will be positive and henceK.o will be greater than 1. Therefore at equilibrium rhere will be more products than reactants; in other words, the formation of products from reactants is favored. Conversely,if AG'' is positive, the exponent will be negativeand K.o will be lessthan 1.

The Rateof a ReactionDependson the Activation EnergyNecessary to Energize the Reactantsinto a TransitionState As a chemical reaction proceeds, reactants approach each otherl some bonds begin to form while others begin to break. One way to think of the state of the moleculesduring this transition is that there are strains in the electronic configurations of the atoms and their bonds. In order for the collection of atoms to move from the relatively stable state of the reactants to this intermediate state during the reaction, an introduction of energy is necessary.This is illustrated in the reaction energy diagram in Figure 2-30. Thus the collection of atoms is transiently in a higher-energysrare at some point during the course of the reaction. The state during a chemicalreaction at which the systemis at its highest energy level is called the transition state or transition-

+

II

Transitionstate (uncatalyzed)

Transitionstate (catalyzed) 6 0) 0) 0) LI

Products

Progressof reaction----> 2-30 Activationenergy of uncatalyzedand A FIGURE reactionpathway catalyzedchemicalreactions.Thishypothetical (blue)depicts proceeds A thechanges in freeenergyG asa reaction reaction willtakeplacespontaneously if thefreeenergy(G)of the (AG< 0). However, products all islessthanthatof the reactants proceed reactions throughone(shownhere)or morehighchemical isinversely states, andthe rateof a reaction energytransition proportional in to theactivation energy(AG*),whichisthe difference the reactants andthetransition stateIn a freeenergybetween (red),thefreeenergies of the reactants and reaction catalyzed products stateis areunchanged but thefreeenergyof thetransition lowered, thusincreasing thevelocity of the reaction

state intermediate.The energy neededto excite the reactants to this higher-energystate is called the activation energy of the reaction. The activation energy is usually representedby AGt, analogousto the representationof the changein Gibbs free energy (AG) already discussed.From the transition state, the collection of atoms can either releaseenergy as the reaction products are formed or releaseenergy as the atoms go "backward" and re-form the original reactants.The velocity (V) at which products are generated from reactants during the reaction under a given set of conditions (temperature, pressure,reactant concentrations)will depend on the concentration of material in the transition state, which in turn will depend on the activation energy and the characteristic rate constant (z) at which the transition state ls converted to products. The higher the activation energy, the lower the fraction of reactantsthat reach the transition state and the slower the overall rate of the reaction. The relationship between the concentration of reactants,z and V is (AG+/2 3RT) v : u lreactants]x 10 From this equation, we can seethat lowering the activation energy-that is, decreasingthe free energy of the transition stateAG+-leads to an accelerationof the overall reactionrate V. A reduction in AGt of 1.36 kcal/mol leads to a tenfold increasein the rate of the reaction, whereas a 2.72 kcal/mol reduction increasesthe rate 100-fold. Thus relatively small changesin AGt can lead to large changesin the overall rate of the reaction.

Catalystssuch as enzymes(Chapter 3) acceleratereaction rates by lowering the relative energy of the transition state and so the activation energy (seeFigure 2-30). The relative energiesof reactantsand products will determineif a reaction is thermodynamically favorable (negativeAG), whereas the activation energy will determine how rapidly products form (reaction kinetics). Thermodynamically favorable reactions will not occur if the activation energiesare too high.

L i f e D e p e n d so n t h e C o u p l i n go f U n f a v o r a b l e s ith Energetically C h e m i c aR l e a c t i o nw FavorableReactions unfavorable(AG > 0) Many processesin cellsareenergetically include the synExamples and will not proceed spontaneously. of a substance transport nucleotides and thesis of DNA from a higher concenlower to from a plasma membrane acrossthe or endergonic, energy-requiring, out an can carry tration. Cells reaction (AGr > 0) by coupling it to an energy-releasing,or exergonic, reaction (AGz < 0) if the sum of the two reactionshas an overall net negativeAG. Suppose,for example,that the reactionA = B + X has a AG of + 5 kcaUmoland that the reactionX = Y + Zhas a L,G of -10 kcal/mol:

(1) A

B+X

AG:+Skcal/mol

( 2\ x

Y+Z

AG:-10kcal/mol

Sum: A.

^B+Y+Z

AG'' :-5kcal/mol

In the absenceof the secondreaction' there would be much more A than B at equilibrium. However, becausethe conversion of X to Y + Z is such a favorable reaction, it will pull the first process toward the formation of B and the consumption of A. Energetically unfavorable reactions in cells often are coupled to the energy-releasinghydrolysis of ATP' as we discussnext.

Hydrolysisof ATPReleasesSubstantialFree E n e r g ya n d D r i v e sM a n y C e l l u l a rP r o c e s s e s In almost all organisms, adenosinetriphosphate, or AIP, is the most important molecule for capturing' transiently storing, and subsequentlytransferring energy to perform work (e.g.,biosynthesis,mechanicalmotion). The useful energyin an ATP molecule is contained in phosphoanhydride bonds, which are covalent bonds formed from the condensationof two moleculesof phosphateby the loss of water: OO

ti o- -i-on + Ho-P-o- . * ll

o-

o-

o

llll o--P-O-?-OI I o o-

+ H2O

B I O C H E M I C AELN E R G E T I C S

57

pH. During synthesis of ATP, a large input of energy is required to force the negative charges in ADP and P1 together.ConverselSmuch energy is releasedwhen ATP is hy*zc'-a-N rtl \u Phosphoanhydride bonds drolyzed to ADP and P;. In comparison, formation of the HC__*,rC_;1 phosphoester o bond between an unchargedhydroxyl in glycto to - o - P -i ol |- lL|Pl - O _ | . P - O erol and P1requires less energy, and less energy is released cH2-owhen this bond is hydrolyzed. tll oo-o H Cells have evolved protein-mediated mechanismsfor transferringthe free energyreleasedby hydrolysis of phosphoanhydride bonds to other molecules, thereby driving HO OH reactions that would otherwise be energeticallyunfavorAdenosine triphosphate able. For example, if the AG for the reaction B + C -+ D is positive but less than the AG for hydrolysis of ATP, the reA FIGURE 2-31 Adenosinetriphosphate(ATP).Thetwo phosphoanhydride bonds(red)in ATP, whichlinkthethreephosphate action can be driven to the right by coupling it to hydrolygroups, eachhasa AG'of about-7 3 kcal/mol for hydrolysis sis of the terminal phosphoanhydride bond in ATP. In one Hydrolysis of thesebonds,especially theterminal one,rsrnesource common mechanism of such energy coupling, some of the of energythatdrivesmanyenergy-requiring reactions in biological energy stored in this phosphoanhydride bond is transferred systems. to one of the reactants by breaking the bond in ATP and forming a covalent bond between the releasedphosphate group and one of the reactants.The phosphorylatedinterAn ATP molecule has two key phosphoanhydride (also mediate generatedin this way can then react with C to calledphosphodiester)bonds (Figure 2-31). Hydrolysis of a form D * P; in a reaction that has a negativeAG: phosphoanhydride bond (-) in each of the following reactions has a highly negativeAG'' of about -7.3 kcal/mol: NH"

B+ATPTB-p+ADP Ap-p-p + H2O ----+ Ap-p + Pi + H+ (ATP) Ap-p-p+H2O(ATP)

B-p+C-+D+P;

(ADP) Ap+PPi+H+ (AMP)

The overallreaction B+C+ATP:-D+ADP+P.

Ap-p + H2O ----+ Ap + P; * H+ (ADP)

(AMP)

In thesereactions,Pi standsfor inorganic phosphate(pO+, ) and PP;for inorganic pyrophosphate,two phosphategroups linked by a phosphoanhydride bond. As the top two reactions show, the removal of a phosphate or a pyrophosphate group from ATP leaves adenosinediphosphate (ADp) or adenosinemonophosphate (AMP), respecively. A phosphoanhydride bond or other high-energy bond (commonly denoted by -) is not intrinsically different from other covalent bonds. High-energy bonds simply releaseespecially large amounts of energywhen broken by addition of water (hydrolyzed). For instance,the AG"' for hydrolysis of a phosphoanhydride bond in ATP (-7.3 kcal/mol) is more than three times the AGo' for hydrolysis of the phosphoester bond (red) in glycerol3-phosphate(-Z.2kcallmol):

ooH Ho-p-o-cHr-lH - cH2oH I

U Glycerol3-phosphate

A principal reason for this differenceis that ATp and its hydrolysis products ADP and P1are highly charged at neutral

58

CHAPTER2 I

CHEMICALFOUNDATIONS

is energeticallyfavorable (AG < 0). An alternative mechanism of energy coupling is to use the energy releasedby ATP hydrolysis to changethe conformation of the molecule to an "energy-rich" stressedstate. In turn, the energy stored as conformational stresscan be released as the molecule "relaxes" back into its unstressed conformation. If this relaxation processcan be mechanistically coupled to another reaction, the releasedenergycan be harnessedto drive important cellular processes. As with many biosynthetic reactions,transport of molecules into or out of the cell often has a positive AG and thus requires an input of energy to proceed. Such simple transport reactions do not directly involve the making or breaking of covalent bonds; thus the AGo' is 0. In the case of a substancemoving into a cell, Equation 2-7 becomes

AG: Rrt"+."9*

(2-10)

where [C1"] is the initial concentration of the substanceinside the cell and [Co",] is its concentration outside the cell. 'We can see from Equation 2-10 that AG is positive for transport of a substanceinto a cell against its concentration gradient (when [Cr"] > [C"",]); the energy to drive such "uphill" transport often is supplied by the hydrolysis of

ATP. Conversely,when a substancemoves down its concentration gradient ([C",,] > [C,"] ), AG is negative. Such "downhill" transport releasesenergythat can be coupledto an energy-requiringreaction, say, the movement of another substanceuphill acrossa membrane or the synthesisof ATP itself (seeChapters 1I and 12).

ATPls GeneratedDuring Photosynthesis and Respiration Clearlg to continue functioning, cells must constantly replenish their ATP supply. In nearly all cells,the initial energysource whose energyis ultimately transformed into the phosphoanhydride bondsof ATP and bonds in other compoundsis sunlight. In photosynthesis,plants and certain microorganismscan trap the energy in light and use it to synthesizeAIP from ADP and P1.Much of the ATP produced in photosynthesisis hydrolyzed to provide energyfor the conversionof carbon dioxide to sixcarbon sugars,a processcalledcarbon fixation: ATP ADP + P. 6co2 + 6 Hro V c 6 H 1 2 o+6 o 0 2 In animals, the free energy in sugars and other molecules derived from food is releasedin the processof respiration. All synthesisof ATP in animal cells and in nonphotosynthetic microorganismsresultsfrom the chemicaltransformation of energy-richcompounds in the diet (e.g., glucose, starch). We discussthe mechanismsof photosynthesisand cellular respiration in Chapter 12. The completeoxidation of glucoseto yield carbon dioxide, c6Flpo6 + 6 02 --->6 co2 + 6 H2o has a AG'' of -686 kcal/mol and is the reverseof photosynthetic carbon fixation. Cells employ an elaborate set of protein-mediated reactions to couple the oxidation of 1 molecule of glucoseto the synthesisof as many as 30 moleculesof ATP from 30 molecules of ADP. This oxygen-dependent (aerobic) degradation (catabolism) of glucose is the major pathway for generating ATP in all animal cells, nonphotosyntheticplant cells, and many bacterial cells. Catabolism of fatty acids can also be an important source of ATP. Light energy captured in photosynthesisis not the only source of chemical energy for all cells. Certain microorganisms that live in or around deepoceanvents,where adequate sunlight is unavailable,derive the energyfor converting ADP and Pi into ATP from the oxidation of reduced inorganic compounds.Thesereducedcompounds originate deepin the earth and are releasedat the vents.

not accompanythe formation of new chemical bonds or the releaseof energythat can be coupled to other reactions.The loss of electronsfrom an atom or a molecule is called oxidation, and the gain of electrons by an atom or a molecule is called reduction. Becauseelectrons are neither created nor destroyedin a chemical reaction, if one atom or molecule is oxidized, another must be reduced. For example' oxygen draws electronsfrom ps2+ (ferrous) ions to form Fe3* (ferric) ions, a reaction that occurs as part of the process by which carbohydrates are degraded in mitochondria. Each oxygen atom receivestwo electrons, one from each of two Fe"- ions: 2 Fe2* + Yz oz -->2 Fe3* + 02Thus Fe2*is oxidized, and 02 is reduced.Suchreactionsin which one molecule is reduced and another oxidized often are referred to as redox reactions. Oxygen is an electron acceptor in many redox reactions in cells under aerobic conditions. Many biologically important oxidation and reduction reactions involve the removal or the addition of hydrogen atoms (protons plus electrons) rather than the transfer of isolated electronson their own. The oxidation of succinate to fumarate, which also occurs in mitochondria, is an example (Figure 2-32). Protons are soluble in aqueous solutions (as H3O+), but electrons are not and must be transferred directly from one atom or molecule to another without a water-dissolvedintermediate.In this rype of oxidation reaction' electrons often are transferred to small electron-carrying molecules, sometimes referred to as coenzymes.The most common of theseelectron carriers are NAD* (nicotinamide adeninedinucleotide),which is reducedto NADH' and FAD (flavin adenine dinucleotide), which is reduced to FADH2 (Figure 2-33). The reduced forms of these coenzymescan transfer protons and electrons to other molecules, thereby reducing them.

c-oI

H-C-H | H-C-H I

c- oo

Succinate

N A D * a n d F A DC o u p l eM a n y B i o l o g i c a l Oxidation and ReductionReactions In many chemical reactions, electrons are transferred from one atom or molecule to another; this transfer may or may

o c-o

o

---\----\---2 v v ze 2H*

I c-H

c-H I

c-o o

Fumarate

to fumarate.Inthis of succinate 2-32 Conversion A FIGURE aspartof the citric in mitochondria occurs which reaction, oxidation andtwo protonsTheseare losestwo electrons acidcycle,succinate it to FADH2. to FAD,reducing transferred

B I O C H E M I C AELN E R G E T I C S

59

(b) Reduced: FADH2 Reduced: NADH

o c-NH2

+ le

I

Hll

I

Ribose I 2P

I Ribitol I 2P

Ribose I 2P

I

..1

A O e n o sn re

Adenosine

NAD++H++2e-.-

NADH

Ribitol I 2P

I

I

Adenosine

Adenosine FAD+2H- +2e-

i-

FADH2

FIGURE 2-33 Theelectron-carrying coenzymesNAD+and FAD. (a)NAD*(nicotinamide adenine dinucleotide) isreduced to NADHby the addition of two electrons andoneprotonsimultaneously In manybiological redoxreactions, a pairof hydrogen atoms(two protons andtwo electrons) areremoved froma moleculeIn some cases, oneof the protons andbothelectrons aretransferred to NAD-;the otherprotonisreleased intosolution(b)FAD(flavin

adenine dinucleotide) isreduced to FADH2 bythe additionof two electrons andtwo protons, whensuccinate asoccurs isconverted to (seeFigure fumarate 2-32)ln thistwo-stepreaction, addition of one electron together with oneprotonfirstgenerates a short-lived (notshown), semiquinone intermediate whichthenaccepts a second electron andproton.

To describeredox reactions, such as the reaction of ferrous ion (Fe2+)and oxygen (O2), it is easiestto divide them into two half-reactions:

reduce)a compound with a more positivereduction potential. In this type of reaction, the changein electricpotential AE is the sum of the reduction and oxidation potentialsfor the two half-reactions.The AE for a redox reaction is related to the changein free energyAG by the following expression:

Oxidation of Fe2n: Reduction of 02:

2 Fez* --+ 2 Fe3* -t 2 e2 e * 1/z02 -- 02-

In this case,the reducedoxygen (O2-) readily reactswith two protons to form one water molecule(HzO). The readinesswith which an atom or a molecule gains an electron is its reduction potential E. The tendencyto lose electrons,the oxidation potential, has rhe same magnitude but opposite sign as the reduction potential for the reversereaction. Reduction porentials are measuredin volts (V) from an arbitrary zero point set ar the reduction potential of the following half-reactionunder standard conditions (25 "C. 1 atm, and reactantsat 1 M):

H+ + e- IY'Z

*t,

oxidation

The value of E for a molecule or an atom under standard conditions is its standardreduction potential, E'6 A molecule or an ion with a positive E'e has a higher affinity for electronsthan the H* ion does under standardconditions. Conversely,a molecule or ion with a negative E'6 has a lower affinity for electronsthan the H* ion does under standard conditions.Like the valuesof AGo', standardreduction potentials may differ somewhat from those found under the conditions in a cell becausethe concentrations of reactants in a cell are not 1 M. In a redox reaction,electronsmove spontaneouslytoward atoms or moleculeshaving more positiuereductionporentials. In other words, a compound having a more negativereduction potential can transfer electrons spontaneouslyto (i.e.,

60

CHAPTER2 I

CHEMICALFOUNDATIONS

AG (callmol) : -n (23,064)AE (volts)

(2-11)

wheren is the number of electronstransferred.Note that a redox reactionwith a positiveAE value will have a negativeAG and thus will tend to proceedspontaneouslyfrom left to right.

BiochemicalEnergetics r The changein free energy AG is the most useful measure for predicting the direction of chemicalreactionsin biological systems.Chemical reactions tend to proceed spontaneouslyin the direction for which AG is negative.The magnitude of AG is independentof the reaction rate. r The chemicalfree-energychangeAGo' equals -2.3 RT log K.o. Thus the value of AGo' can be calculatedfrom the experimentally determinedconcentrationsof reactantsand products at equilibrium. r The rate of a reaction dependson the activation energy neededto energizereactantsto a rransition state. Catalysts such as enzymesspeedup reactions by lowering the activation energyof the transitionstate. r A chemical reaction having a positive AG can proceed if it is coupled with a reaction having a negariveAG of larger magnitude. r Many otherwise energetically unfavorable cellular processesare driven by the hydrolysis of phosphoanhydride bonds in ATP (seeFigure2-31).

r Directly or indirectlS light energycaptured by photosynthesisin plants and photosynthetic bacteria is the ultimate source of chemical energy for almost all cells. r An oxidation reaction (loss of electrons)is always coupled with a reduction reaction (gain of electrons). r Biological oxidation and reduction reactions often are coupled by electron-carryingcoenzymessuch as NADand FAD (seeFigure2-33). r Oxidation-reduction reactionswith a positive AE have a negativeAG and thus tend to proceed spontaneously.

KeyTerms acid 52

hydrophobic 3 1

a carbon atom (C*) 41

hydrophobic effect 38

amino acids41

ionic interactions 36

amphipathic 31

molecular complementarity 39

base52 buffers 52 chemicalpotential energy54

monosaccharides44

covalentbond 32

nucleotides44

dehydration r eaction 4 0 AG (free-energy change)55

oxidation 59 pH 51

disulfide bond 43

p h o s p h o a n h y d r i dbeo n d s5 7

endergonic55

phospholipid btlayers41

endothermic 55

polar 34

energy coupling 58 enthalpy (H) 55

polymer 40 redox reaction 59

entropy (S)55

reduction 59

equilibrium constant49

saturated 47

exergonic 55

steadystate50

exothermic56

stereoisomers 33

fatty acids 47

unsaturated 47

hydrogen bond 37

van der $0aals interactions37

hydrophilic 31

44 nucleosides

Review the Concepts 1,. The gecko is a reptile with an amazing ability to climb smooth surfaces,including glass.Recentdiscoveriesindicate that geckosstick to smooth surfacesvia van der'lfaals interactions between septaeon their feet and the smooth surface. How is this method of stickinessadvantageousover covalent interactions?Given that van der Sfaalsforces are among the weakest molecular interactions, how can the gecko's feet stick so effectively? 2. The K* channel is an example of a transmembraneprotein (a protein that spans the phospholipid bilayer of the plasmamembrane).What typesof amino acidsare likely to be found (a) lining the channel through which K* passes,(b) in contact with the hydrophobic core of the phospholipid bilayer

containing fatty acylgroups, (c) in the cytosolic domain of the protein, and (d) in the extracellulardomain of the protein? 3. V-M-Y-F-E-N: This is the single-letteramino acid abbreviation for a peptide. What is the net charge of this peptide can at pH 7.0? An enzyme called a protein tyrosine kinase 'Sfhat attach phosphatesto the hydroxyl groups of tyrosine. is the net charge of the peptide at pH 7.0 after it has been phosphorylated by a tyrosine kinase? \What is the likely source of phosphateutilized by the kinase for this reaction? 4. Disulfide bonds help to stabilize the three-dimensional structure of proteins. What amino acids are involved in the formation of disulfide bonds?Does the formation of a disulfide bond increaseor decreaseentropy (AS)? 5. In the 1960s, the drug thalidomide was prescribed to pregnant women to treat morning sickness. However' thalidomide caused severe limb defects in the children of some women who took the drug, and its use for morning sicknesswas discontinued.It is now known that thalidomide was administered as a mixture of two stereoisomericcomthe pounds, one of which relieved morning sicknessand 'Sfhat defects' birth for the other of which was responsible Why might two such closely related comare stereoisomers? pounds have such different physiologic effects? 6. Name the compound shown below.

HrrriS)c-)x ll :,

se C i H

;; ll ll

Hrl',t-c\fi)c-i/ o -o- P-o-o-P-o-o-?-o-9Hz I o-

I

o-

I o

5',

-o 2',

OH OH Is this nucleotide a component of DNA, RNA, or both? Name one other function of this compound. 7. The chemical basis of blood-group specificity residesin the carbohydratesdisplayedon the surfaceof red blood cells. Carbohydrateshave the potential for great structural diversity. Indeed,the structural complexity of the oligosaccharides that can be formed from four sugarsis greater than that for oligopeptidesfrom four amino acids. Sfhat propertiesof carbohydratesmake this great structural diversity possible? 8. Ammonia (NH:) is a weak basethat under acidic conditions becomesprotonated to the ammonium ion in the following reaction: NH, + H- -+ NH+NH3 freely permeates biological membranes, including those of lysosomes.The lysosomeis a subcellular organelle with a pH of about 4.5-5.0; the pH of cytoplasmis -7'0. lWhat is the effect on the pH of the fluid content of lysosomes R E V I E WT H E C O N C E P T S

61

when cells are exposedto ammonia? No/e: Protonated ammonia does not diffuse freely acrossmembranes. 9. Consider the binding reaction L + R -+ LR, where L is 'S7hen a ligand and R is its receptor. 1 x 10 3 M L is added to a solution containing5 x 10-2 M R, 90% of the L binds to form LR. rVhat is the K.o of this reaction? How will the K.o be affected by the addition of a protein that catalyzes this binding reaction?V/hat is the K6? 10. Vhat is the ionization state of phosphoric acid in the cytoplasm? Vhy is phosphoric acid such a physiologically important compound? 1 1 . T h e A G o ' f o r t h e r e a c t i o nX + Y - + X Y i s - 1 0 0 0 callmol. What is the AG at 25 'C (298 Kelvin) starting with 0.01 M each X, I and XY? Suggesttwo ways one could make this reaction energeticallyfavorable. 12. According to health experts,saturatedfatty acids,which come from animal fats, are a major factor contributing to coronary heart disease.What distinguishesa saturated fatty acid from an unsaturated fatty acid, and to what does the term saturated refer?RecentlS trans unsaturatedfatty acids, or trans fats, which raise total cholesterollevelsin the bodv. have also been implicated in heart disease.How does the cis stereoisomerdiffer from the trans configuration, and what effect does the cis configuration have on the structure of the fatty acid chain? 13. Chemicalmodifications to amino acidscontribute to the diversity and function of proteins. For instance,7-carboxylation of specific amino acids is required to make some proteins biologically active. What particular amino acid undergoes this modification, and what is the biological relevance?Warfarin, a derivative of coumarin, which is present in many plants, inhibits 7-carboxylation of this amino acid and was used in the past as a rat poison. At present, it is also used clinically in humans. What patients might be prescribedwarfarin and whv?

62

CHAPTER2 I

CHEMICALFOUNDATIONS

References Albertg R. A., and R. J. Silbey.2005. PhysicalChemistry, 4th ed. Wiley. Atkins, P.,and J. de Paula. 2005. The Elementsof Physical Chemistry,4th ed. \7. H. Freemanand Company. Berg,J. M., J. L. Tymoczko, and L. Stryer.2007. Biochemistry, 5th ed. W. H. Freemanand Company. Cantor, P. R., and C. R. Schimmel.1980. BiophysicalChemistry.V. H. Freemanand Company. Davenport,H.W. 1974. ABC of Acid-BaseChemistry,6rh ed.. University of ChicagoPress. Eisenberg,D., and D. Crothers.1,979.PhysicalChemistryuith Applications to the Life Sciences.Benjamin-Cummings. Guyton, A. C., and J. E. Hall. 2000. Textbook of Medical Physiology, 10th ed. Saunders. Hill, T. J. 1977. FreeEnergy Transductionin Biology. Academic Press. Klotz, I. M. 1978. Energy Changesin BiochemicalReactions. AcademicPress. Murray, R. K., et al. 1999.Harper'sBiocbemistry,25thed. Lange. Nicholls, D. G., and S.J. Ferguson.1992. Bioenergetics2. Academic Press. Oxtoby, D., H. Gillis, and N. Nachtrieb. 2003. Principlesof Modern Chemistry,Sth ed. Saunders. Sharon,N. 1980. Carbohydrates. Sci.Am.243(5):90-116. Tanford, C. 1980. The Hydropl;obic Effect: Formation of Micellesand Biological Membranes,2d ed. \filey. Tinoco, I., K. Sauer,and J. Wang. 200L. PhysicalChemistryPrinciplesand Applications in Biological Sciences,4thed. Prentice Hall. Van Holde, K., W. Johnson,and P.Ho. 1998. Principlesof PhysicalBiochemistry.PrenticeHall. Voet, D., and J. Voet. 2004. Biochemistry,3d,ed. \7iley. Wood, !(. B., et al. 1981,.Biochemistry:A ProblemsApproach, 2d ed. Benjamin-Cummings.

CHAPTER

STRUCTURE PROTEIN AND FUNCTION

Ribbondiagramof a betapropeller domainfrom the humansignaling (spheres) proteinKeaplTenwatermolecules areboundto eachof lvlanyproteinsarebuiltfrom multiple, the sixbladesof the propeller. X Li,C A independently stableproteindomains[FromL J Beamet Bottoms, andM Hannink,2005,ActaCrystallogr D: Biol.Crystallogr of Robert Hube[Martinsried 51(10):1335-1342I Credit.Courtesy

roteins, which are polymers of amino acids, come in many sizesand shapes.Their three-dimensionaldiversity reflects underlying structural differences: principally variations in their lengths and amino acid sequences,and in some cases,differencesalso in the number of disulfide bonds or the attachment of small moleculesor ions to their amino acid side chains. In general,the linear, unbranched polymer of amino acidscomposing any protein will fold into only one or a few closely related three-dimensional shapes-called conformations. The conformation of a protein together with the distinctive chemical properties of its amino acid side chains determines its function. As a consequence,proteins can perform a dazzling array of distinct functions inside and outside of cells that either are essentialfor life or provide selective evolutionary advantageto the cell or organism that contains them. It is, therefore, not surprising that characterizing the structuresand activities of proteins is a fundamental prerequisitefor understanding how cells work. Much of this textbook is devoted to examining how proteins act together to enablecells to live and function properly. Many proteins can be grouped into just a few broad func. Structural proteins, for example,determinethe tional classes shapesof cellsand their extracellularenvironments,and serve as guide wires or rails to direct the intracellularmovement of moleculesand organelles.They usually are formed by the assemblyof multiple protein subunitsinto very large,long strucnres. Scaffold proteins bring other proteins together into

ordered arrays to perform specific functions more efficiently than if those proteins were not assembledtogether. Enzymes are proteins that catalyze chemical reactions. Membrane transport proteins permit the flow of ions and molecules acrosscellular membranes. Regulatoryproteins act as siSnals' sensors,and switches to control the activities of cells by altering the functions of other proteins and genes.These include signaling proteins, such as hormones and cell-surfacereceptors that transmit extracellular signals to the cell interior'

OUTLIN E 3.1

HierarchicalStructureof Proteins

64

3.2

P r o t e i nF o l d i n g

74

3.3

ProteinFunction

78

3.4

RegulatingProteinFunction ProteinDegradation

3.5

R e g u l a t i n gP r o t e i nF u n c t i o nl l : Noncovalentand CovalentModifications

3.6

Purifying,Detecting,and CharacterizingProteins

3.7

Proteomics

92 105

63

Motor proteins are responsiblefor moving other proteins, organelles,cells-even whole organisms.Any one protein can be a member of more than one protein class,as is the caseof some cell-surfacesignaling receptorsthat are both enzymes and regulator proteins becausethey transmit signals from outside to inside cells by catalyztngchemical reactions. To accomplishefficientlytheir diversemissionssomeproreinsassembleinto largecomplexes,often calledmolecularmachines. How do proteinsmediateso many diversefunctions?They do this by exploiting a few simple activiries.Most fundamentally, proteins bind-to one anorher,to other macromolecules, suchas DNA, and to smallmoleculesand ions.In many cases such binding can induce a conformational changein the protein and thus influenceits activity. Binding is basedon molecular complementaritybetweena protein and its binding partner, as describedin Chapter 2. A second key activity is enzymatic catalysis.Appropriate folding of a protein will place some amino acid side chainsand carboxyl and amino groups of the backboneinto positions that permit the catalysis of covalent bond rearrangements.A third activity involves folding into a channel or pore within a membrane through which moleculesand ions flow. Although theseare especially crucial protein activities,they are not the only ones. For example,fish that live in frigid waters-rhe Antarctic borchsand Arctic cods-have antifreezeproteins in their circulatory systems to preventwater crystallizationat subzerotemperatures. A completeunderstandingof how proteins permit cells to live and thrive requiresthe identificationand characterization of all the proteins used by a cell. In a sense,molecular cell biologistswant to compile a completeprotein 'parts list' and consrructan all-inclusive"users manual" that describeshow theseprclteinswork. Compiling a comprehensive protein parts list has become feasiblein recent years with the sequencingof entire genomes-complete sets of g e n e s - o f m o r e a n d m o r e o r g a n i s m s .F r o m a c o m p u r e r analysisof genome sequences,researcherscan deducethe number of amino acidsand their sequenceof most of the encoded proteins (Chapter5). The rerrn proreomewas coined to refer to the entire protein complementof an organism.The human genome conrains 20,000-25,000 genes(only four times that of the single-cellyeast Saccharomycescereuisiae). However, it encodesabout 33.000 different protein because of variation in mRNA producrion (e.g..alteinativesplicing (Chapter8)). Even more variation is generaredby 100 types of protein modification that can produce hundreds of thousandsof distinct human proteins.By comparingprotein sequencesand structures of proteins of unknown function to those of known function, scientistscan often deduce much about their functions. In the past, characterizationof protein function by genetic, biochemical, or physiological methods often precededthe identification of particular proteins. In the moderngenomicand proteomicera,a protein is usuallyidentified prior to determining its function. In this chapter,we begin our study of how the structureof a protein givesriseto its function, a themethat recursthroughout this book (Figure 3-1). The first secrion examineshow chains of amino acid building blocks are arrangedin a threedimensional structural hierarchy.The next section discusses 64

CHAPTER 3

|

PROTEIN S T R U C T U RAEN D F U N C T I O t T

MOLECULAR STRUCTURE Primary (sequence)

S e c o n d a r y( l o c a lf o l d i n g )

Tertiary ( l o n g - r a n gf e olding)

Supramolecular (large-scale assembly)

Ouaternary (multimericstructure)

(b)

Regulation

@ FUNCTION Transport i

C a t a l y s i s4

FIGURE 3-1 Overviewof proteinstructureand function. (a)Proteins areassembled according to a hierarchy of structures A polypeptide l i 'nse asr e q u e n coef a m i n oa c i d sl i n k e db y p e p t i d e bonds(primary structure) foldsinto localhelices or sheets (secondary structure) thatpackrntolarge(longer-range) complex (tertiary three-dimensional structures structu re) Someindividual polypeptides (quaternary associate intomultichain complexes structure), whichin somecases canbeverylarge,consisting of tensto (supramolecular (b)Protein hundreds of subunits assemblies) function includes organization of thegenome, otherproteins, lipidbilayer (structure); membranes, andcytoplasm controlof proteinactivity (regulation), monitoring of theenvironment andtransmitting resultant (signaling), information flowof smallmolecules andionsacross (transport); membranes (viaenzymes); catalysis of chemical reactions (viamotorproteins) andgeneration of forcefor movement These functions andothersarisefromspecifrc bindinginteractions and conformatronal changes in thestructure of a properly foldedprotein how proteins fold into thesestructures.\(e then rurn to protein function, focusingon enzymes,the specialclassof proteinsthat catalyzechemicalreactions.Variousmechanismsthat cellsuse to control the activitiesand life spansof proteinsare coveredin the next two sections.Next comesa sectionon commonly used techniquesin the biologist'stool kit for isolating proteins and characterizingtheir properties.The chapter concludeswith a discussionof the burgeoningfield of proteomics.

ff,t

Hierarchical Structureof Proteins

A protein chain folds into a distinct three-dimensionalshape that is stabilizedby noncovalent interacrionsberween regions in the linear sequenceof amino acids.A kcy concept rn

(a) Primarystructure -Ala -Glu -Val-Thr-Asp- Pro-Gly-

(b) Secondarystructure s heli

(c) Tertiarystructure

Domain

bond formation between the amino group of one amino acid and the carboxyl group of another results in the net releaseof a water molecule (dehydration) (Figure 3-3a). The repeated amide N, cr carbon (C*), carbonyl C and oxygen atoms of each amino acid residue form the backbone of a protein molecule from which the various side-chaingroups project (Figure 3-3b, c). As a consequenceof the peptide linkage, the backbone exhibits directionality becauseall the amino groups are located on the same side of the Co atoms. Thus one end of a protein has a free (unlinked) amino group (the N-terminus), and the other end has a free carboxyl group (the C-terminus). The sequenceof a protein chain is conventionally written with its

(d) Ouaternarystructure (a)

HO tll

HO

ttl

*HsN- Cd-CR1

O- + *H3N- Co-C-

3l

ll lN t,o \7

O-

n'

HOHO

riltll

(a)Thelinear FIGURE 3-2 Fourlevelsof proteinhierarchy. peptide bondsisthe acids linked together by of amino sequence (b)Folding primary chainintolocala structure. of the polypeptide (c)Secondary represents secondary structure. helices or B sheets loopsandturnsin a single together with various structural elements polypeptide stablestructure, chainpackintoa largerindependently distinct domains; thisistertiarystructure(d) whichmayinclude polypeptides can with theirown tertiary structures Someindividual complex. a multichain intoa quaternary structure defining associate understandinghow proteins work is that function is deriued from three-dimensional structure, and three-dimensional structure, which is determined primarily by noncoualent interactions betueen regions in the linear sequenceof amino acids, is specifiedby amino acid seqwence.Indeed,principles relating biologicalstructureand function initially were formulated by the biologistsJohannvon Goethe(1'749-1,832),Ernst Haeckel (1834-1.91.9),and D'Arcy Thompson \1'860-1'948). They greatly influencedthe school of "organic" architecture pioneeredin the early rwentieth century that is epitomizedby the dicta "form follows function" (Louis Sullivan)and "form is function" (Frank Lloyd'Wright). Here, we considerthe architectureof proteins at four levelsof organization: primar5 secondary,tertiary, and quaternary (Figure 3-2).

The PrimaryStructureof a Proteinls lts Linear Arrangemeno t f AminoAcids As discussedin Chapter 2, proteins are constructed by the polymerizationof 20 differenttypesof amino acids.Individual amino acids are linked together in linear, unbranched chains by covalent amide bonds, called peptide bonds, with occasional disulfide bonds covalently linking side chains together.Peptide

PePtide bond (b)

(C-terminus)

(N-terminus) (c)

amino 3-3 Structureof a polypeptide.(a)Individual A FIGURE via reactions form which peptide bonds, by together linked are acids the R1,R2,etc.,represent thatresultin a lossof water(dehydration). polymers of ("Rgroups")of aminoacids.(b)Linear sidechains whichhave aminoacidsarecalledpolypeptides, oeptidebond-linked (C-terminus) (N-terminus) end carboxyl free and a a freeaminoend linkingthe (c)A ball-and-stick modelshowspeptidebonds(yellow) atom(blue)of oneaminoacid(aa)with thecarbonyl aminonitrogen onein thechain.TheR groups of an adjacent carbonatom(gray) (black) of theaminoacids atoms (green) cr carbon extendfromthe properties of distinct the determine largely chains side These individual oroteins EF P R O T E I N S H I E R A R C H I C ASLT R U C T U RO

65

N-terminal amino acid on the left and its C-terminal amino acid on the right, and the amino acids are numbered sequentially starting from the amino terminus (number 1). The primary structure of a protein is simply the linear arrangement, or sequence,of the amino acid residuesthat compose it. Many terms are used to denote the chains formed by the polymerization of amino acids. A short chain of amino acids linked by peptide bonds and having a defined sequenceis called an oligopeptide, or just peptide; longer chains are referred to as polypeptides. peptides generally contain fewer than 20-30 amino acid residues, whereas polypeptides are often 200-500 residueslong. The longest protein described to date is the muscle protein titin with 25,926 residues.We generally reservethe term protein for a polypeptide (or complex of polypeptides) that has a welldefined three-dimensionalstructure. It is implied that proteins and peptides are the natural products of a cell. The size of a protein or a polypeptide is reported as its massin daltons (a dalton is 1 atomic massunit) or as its molecular weight (M\7), which is a dimensionlessnumber. For example,a 10,000-MI7 protein has a mass of 10,000 daltons (Da), or 10 kilodaltons (kDa). In the penultimatesection of this chapter, we will consider different methods for measuringthe sizesand other physical characteristicsof proteins. The known and predicted proteins encoded by the yeast genome have an averagemolecular weight of 52,728 and contain, on average,466 amino acid residues.The average molecular weight of amino acids in proteins is 113, taking into account their averagerelative abundances.This value can be used to estimate the number of residuesin a protein from its molecular weight or, conversely,its molecular weight from the number of residues.

SecondaryStructuresAre the Core Elements of ProteinArchitecture The secondlevel in the hierarchy of protein strucrure is secondary structure. Secondary structures are stable spatial arrangementsof segmentsof a polypeptide chain held together by hydrogen bonds between backbone amide and carbonyl groups and often involving repeatingstructural patterns. A singlepolypeptide may contain multiple types of secondary structure in various portions of the chain, depending on its sequence.The principal secondarystructures are the alpha (c) helix, the beta (p) sheet,and a short U-shapedbeta (F) turn. Portions of the polypeptide that don't form these structures,but neverthelesshave a well-defined,stableshape, are said to have anirregular structure.The term random ioil appliesto highly flexible portions of a polypeptide chain that have no fixed three-dimensionalstructure.In an averageprotein, 50 percent of the polypeptide chain exists as ct helices and B sheets;the remainder of the molecule is in coils and turns. Thus, ct helicesand B sheetsare the major internal supportive elementsin most proteins. In this section,we exploie the shapesof secondarystructuresand the forces that iavor their formation. In later sections,we examine how linear arrays of secondary structure fold together into larger, more complex arrangementscalled tertiary structure. 66

.

c H A p r E 3R |

pRorEtN s r R u c r u RA EN DF U N c l o N

A m i n ot e r m i n u s

Carboxylterminus

A FIGURE 3-4 The ct helix, a commonsecondarystructurein proteins.Thepolypeptide (seenasa ribbon)isfoldedinto backbone a spiralthat isheldin placeby hydrogen bondsbetweenbackbone oxygenandhydrogen atomsOnlyhydrogens involved in bondingare shown.Theoutersurface of the helixiscovered bv theside-chain R groups(green)

The a Helix In a polypeptide segmentfolded into an o helix, the backbone forms a spiral structure in which the carbonyl oxygen atom of eachpeptide bond is hydrogen-bonded to the amide hydrogen atom of the amino acid four residues farther along the chain (in the direction of the C-terminus) (Figure 3-4). Within an a helix, all the backbone amino and carboxyl groups are hydrogen-bondedto one another,exceptat the very beginning and end of the helix. This periodic arrangementof bonds confersan amino-to-carboxy-terminal directionality on the helix becauseall the hydrogen bond acceptors (e.g.,the carbonyl groups) have the same orientation (pointing in the downward direction in Figure 3-4) and results in a structure in which there is a complete turn of the spiral every 3.6 residues.An ct helix 36 amino acids long has 10 turns of the helix and is 5.4 nm long (0.54 nm/turn). The stable arrangement of hydrogen-bonded amino acids in the a helix holds the bar:kbone in a straight, rodlike cylinder from which the side chains point outward. The relative hydrophobic or hydrophilic quality of a particular helix within a protein is determined entirely by the

characteristicsof the side chains, becauseall the polar amino and carboxyl groups of the peptide backboneare engagedin hydrogen bonding with one another in the helix. In watersoluble proteins, the hydrophilic helicestend to be found on the outside surfaces,where they can interact with the aqueous environment, whereas hydrophobic helices tend to be buried within the core of the folded protein. The amino acid proline is usually not found in cr helices,becausethe covalent bonding of its amino group with a carbon in the side chain preventsits participation in stabilizingthe backbonethrough normal hydrogen bonding. While the classic ct helix is the most intrinsically stable, and most common helical form in proteins, there are variations, such as more tightly or loosely twisted helices.For example, in a specializedhelix called a coiled coil (describedseveralsectionsfarther on), the helix is more tightly wound (3.5 residuesand 0.51 nm per turn). The p Sheet Another type of secondarystructure, the B sheet,consistsof laterally packed B strands.Each B strand is a short (5- to 8-residue),nearly fully extended polypeptide segment. Unlike in the ct helix (where hydrogen bonding between the amino and carboxyl groups in the backbone occursbetlveen nearly adjacentresidues),hydrogenbonding in the B sheetoccurs between backbone atoms in separate,but adjacent, B strands (Figure 3-5a). Thesedistinct B strandsmay be either within a single polypeptide chain, with short or long loops be-

(a) Topview

'lo e

"{r ...)

Amino termrnus

Carboxyl termrnus

(b) Side

A FIGURE 3-5 The p sheet,anothercommonsecondary structurein proteins.(a)Topviewof a simplethree-stranded B p strandsThestabilizing rrydrogen bonds sheetwith antiparallel lines(b)Side by greendashed areindicated the B strands between (green) projection groups aboveand R of the viewof a B sheetThe in thisview Thefixedbond belowthe planeof thesheetisobvious produce contour a pleated backbone anglesin the polypeptide

of four residues, 3-6 Structureof a p turn' Composed A FIGURE chain(=180"U-turn)The of a polypeptide thedirection B turnsreverse 50 percent exact matches,or "identities") and related functions or structureswere defined as an evolutionarily related family, while a swperfamilyencompassedtwo or more families in which the interfamily sequencesmatched lesswell (=30-40 percent identities)than within one family. It is generally thought that proteins with 30 percent sequenceidentity are likely to have similar three-dimensionalstructures; however, proteins with far less sequencematching can have very similar structures.Recently,revised definitions of family and superfamily have been proposed, in which a family comprisesproteins with a clear evolutionary relationship (>30 percentidentity or additional structural and functional information showing common descent but FIGURE 3-25 Substratebindingin the activesite of typsin_ N like serineproteases. (a)Theactivesiteof trypsin(bluemolecule) H wrtha boundsubstrate (blackmolecule) Thesubstrate formsa two_ B i n d i n gs i t e stranded B sheetwith the bindingsite,andthe sidechainof an (Rr)in thesubstrate arginine is boundin the side-chain-specificitv binding p o c k e tl .t sp o s i t i v ecl h y a r g egdu a n i d i n i ugmr o u pi s stabilized by the negative chargeon the sidechainof the enzyme,s A s p - 1 8 9T h i sb i n d i n g a l i g n tsh ep e p t i d b e o n do f t h ea r g i n i n e appropriately (b) for hydrolysis catalyzed by theenzyme,s active_site c a t a l y tti rci a d( s i d ec h a i nos f S e r - 1 9 5H,i s - 5 a7 n dA s p - 1 0 2()b. )T h e a m i n oa c i d sl i n i n gt h es i d e - c h a i n - s p e c ibf i n c idt iyn g pocket d e t e r m i ni e t ss h a p ea n dc h a r g ea,n dt h u si t sb i n d i n g properties Trypsin accommodates the positively charged sidechainsof arginine and lysine; chymotrypsin, large,hydrophobic sidechainssuchas p h e n y l a l a n ianned; e l a s t a ssem , a lsl r d ec h a i nssu c ha sg l y c i naen d

alanine.[Part(a)modified from.J.J. perona andC. S. Craik,1991. J. Biol. Chen 272(48).29987-29990 I

Peptidebond to be cleaved

Side-chainspecificity binding pocket Asp-189

Chymotrypsin

Elastase

enzyme'sAsp-189. Trypsin has a marked preferencefor hydrolyzing proteins (black in Figure 3-25a) at the carboxyl side of a residue with a long positively charged side chain (arginine or lysine), becausethe side chain is stabilizedin the specificity binding pocket by the negativeAsp-189. Slight differencesin the structures of otherwise similar specificity pockets help explain the differing substratespecificities of the two related serine proteases:chymotrypsin prefers large aromatic groups (asin Phe,Tyr, Trp), and elastaseprefers the small side chains of Gly and Ala (Figure 3-25b1.The unchargedSer-189in chymotrypsinallows large, uncharged,hydrophobic side chains to bind stably in the pocket. The branchedaliphatic side chainsof valine and threoninein elastase replace glycines in the sides of the pocket in trypsin and thus prevent large side chains in substratesfrom binding, but allow stablebinding of the short alanineor glycinesidechain. In the catalytic site, all three enzymesuse the hydroxyl group on the side chain of a serine in position 195 to catalyzethe hydrolysis ofpeptide bonds in protein substrates.A catalytic triad formed by the three side chains of Ser-195, His-57, Asp-102 participates in what is essentiallya twostep reaction. Figure 3-26 shows how the catalytic triad co-

operates in breaking the peptide bond, with Asp-102 and His-57 supporting the attack of the hydroxyl oxygen of Ser-195 on the carbonyl carbon in the substrate.This attack initially forms an unstable transition state with four groups attached to this carbon (tetrahedral intermediate). Breaking of the C-N peptide bond then releasesone part of the protein (NH3-P2), while the other part remains covalently attached to the enzymevia an ester bond to the serine'soxygen, forming a relatively stable intermediate (the acyl enzyme). The subsequentreplacementof this oxygen by one from water, in a reaction involving another unstable tetrahedral intermediate, leadsto releaseof the final product (P1-COOH). The tetrahedral intermediates are partially stabilized by hydrogen bonding from the enzyme'sbackbone amino groups in what is called the oxyanion hole.The large family of serine proteasesand related enzymeswith an active-siteserine illustrates how an efficient reaction mechanism is used over and over by distinct enzymesto catalyzesimilar reactions. The serineproteasemechanismpoints out severalgeneral key featuresof enzymaticcatalysis:(1) enzymecatalytic sites are designedto stabilizethe binding of a transition state' thus lowering the activation energy and acceleratingthe overall

(c) Acyl enzyme (ES'complex)

(b) Tetrahedralintermediate (transitionstate)

( a ) E Sc o m p l e x

o H 'r'r.,..-N

D , rH; N

"c

/ Oxyanion hole

P.,/

P,,, H

T,o (f) EP complex

(d) Acyl enzyme (ES'complex)

(e) Tetrahedralintermediate (transitionstate)

(b)

pH 4.0

lsoelectric f o c u s i n g( l E F )

ET

.66

I

.2 o o, o

X

pH10.0 Apply first gel to top of second

34r

z

6 f OJU

pH 4.0

pH 10.0 16

0

I o o o q)

v

Separate

s lil,i??"?l" by size FIGURE3-36 Two-dimensionalgel A EXPERIMENTAL proteins on the basis of charge and separates electrophoresis mass.(a) In this technique,proteinsarefirst separatedinto bandson focusing(step[) The the basisof their chargesby isoelectric resultinggel strip is appliedto an SD5-polyacrylamide 9el (stepZ), (step B) (b) In this mass and the proteinsare separatedinto spotsby

cells,each fromcultured gelof a proteinextract two-dimensional by canbe detected Polypeptides a singlepolypeptide spotrepresents Each as autoradiography such dyes,ashere,or by othertechniques point(pl)andmolecular by itsisoelectric polypeptide ischaracterized (b)courtesy of J Celis ] weiqht IPart

PG ROTEINS AN , D CHARACTERIZIN P U R I F Y I N GD,E T E C T I N G

95

opposite end. A charged protein will migrate through the gradient until ir reachesits isoelectricpoint (pI), the pH at which the net charge of the protein is zero. This technique, called isoelectric focusing (IEF), can resolve proteins that differ by only one charge unit. Proteins that have been separated on an IEF gel can then be separatedin a second dimension on the basis of their molecular weights. To accomplish this separation,the IEF gel strip is placed lengthwiseon one outside edge of a sheetlike (two-dimensional, or slab) polyacrylamide gel, this time saturated with SDS. When an electric field is imposed, the proteins will migrate from the IEF gel into the SDS slab gel and then separateaccording to their masses. The sequential resolution of proteins by charge and mass can achieve excellent separation of cellular proteins (Figure 3-35b). For example, two-dimensional gels have been very useful in comparing the proteomes in undifferentiated and differentiated cells or in normal and cancer cells becauseas many as 1000 proteins can be resolvedas individual spots simultaneously.Sophisticatedmethods have been developed to permit the comparison of complex patterns of proteins in two-dimensional gels from related, but distinct,samples(e.g.,tissuefrom a normal versusa mutant individual) to permir identification of differencesin rhe types or amounts of proteins in the samples (seesection on proteomics,below).

Liquid ChromatographyResolvesproteins b y M a s s ,C h a r g e o , r B i n d i n gA f f i n i t y A third common technique for separating mixtures of proteins or fragments of proteins, as well as other molecules,is basedon the principle that moleculesdissolvedin a solution can differentially interact (bind and dissociate)with a particular solid surface, depending on the physical and chemical properties of the molecule and the surface.If the solution is allowed to flow across the surface, then molecules that interact frequently with the surface will spend more time bound to the surface and thus flow past the ,,rrfac. -or. slowly than molecules that interact infrequently with it. In this technique, called liquid chromatography (LC), the sample is placed on rop of a tightly packed column of spherical beadsheld within a glassor plastic cylinder.The samplethen flows down the column, usually driven by gravitational or hydrostatic forces alone or with the assistanceof a pump, and small aliquots of fluid flowing out of the column, called fractions, are collected sequentially for subsequentanalysis for the presenceof the proteins of interest.The nature of the beads in the column determineswhether the separation of proteins dependson differencesin mass, charge, or binding affinity. Gel Filtration Chromatography proteins that differ in masscan be separatedon a column composedof porous beads made from polyacrylamide, dextran (a bacterial polysaccharide), or agarose(a seaweedderivative)-a technique called gel filtration chromatography. Although proteins flow around the spherical beads in gel filtration chromatography they spend 96

o

c H A p r E 3R |

pRorEtN s r R u c r u RA EN DF U N c l o N

some time within the large depressionsthat cover a bead'ssurface. Becausesmaller proteins can penetrate into thesedepressions more readily than larger proteins can, they travel through a gel filtration column more slowly than larger proteins (Figure 3-37a). (In contrast, proteins migrate throwgh the pores in an electrophoreticgel; thus smaller proteins move faster than larger ones.) The total volume of liquid required to elute (or separateand remove) a protein from a gel filtration column depends on its mass: the smaller the mass, the more time it is trapped on the beads,the greater the elution volume. By use of proteins of known mass as standards to calibrate the column, the elution volume can be usedto estimatethe massof a protein in a mixture. A protein's shapeas well as its masscan influence the elution volume. lon-Exchange Chromatography In ion-exchangechromatographg a secondtype of liquid chromatography proteins are separatedon the basis of differencesin their charges.This techniquemakesuseof speciallymodified beadswhose surfaces are coveredby amino groups or carboxyl groups and thus carry either a positive charge (NHr*) or a negativecharge(COO ) at neutral pH. The proteins in a mixture carry various net charges at any given pH. When a solution of a protein mixture flows through a column of positively charged beads,only proteins with a net negative charge (acidic proteins) adhere to the beads; neutral and positively charged (basic) proteins flow unimpeded through the column (Figure 3-37b). The acidic proteins are then eluted selectivelyfrom the column by passing a solution of increasingconcentrationsof salt (a salt gradient) through the column. At low sah concentratrons, protein moleculesand beads are attracred by their opposite charges. At higher salt concentrations, negative salt ions bind to the positively charged beads, displacing the negatively charged proteins. In a gradient of increasing salt concentration, weakly bound proteins, those with relatively low charge, are eluted first and highly charged proteins are eluted last. Similarly, a negatively charged column can be used to retain and fractionate basic (positively charged) protelns. Affinity Chromatography The ability of proteins to bind specifically to other molecules is the basis of affinity chromatography. In this technique, ligand or orher molecules that bind to the protein of interest are covalently attached to the beads used to form the column. Ligands can be enzyme substrates,inhibitors or their analogues,or other small moleculesthat bind to specificproteins. In a widely usedform of this techniqu e-anti b o dy -aff in ity, or immu n oaffinity, ch r o matography-the attached molecule is an antibody specific for the desiredprotein (Figure 3-37c). (\7e discussantibodies as tools to study proteins next). An affinity column in principle will retain only those proteins that bind the molecule attached to the beads; the remaining proteins, regardlessof their charges or masses, will pass through the column because they do not bind. However, if a retained protein is in turn bound to other molecules, forming a complex, then the entire complex is

(c)Antibody-affi nity chromatography

(a) Gel filtrationchromatography

Load in pH 7 buffer

Largeprotein Small protein Layer sample on column

Add buffer to wash

O Protein recognized by antibody

proteins through column

o Proteinnot recognized by antibody

Polymergel bead

2

1

Elute with + pH3 buffer

EIuted fractions Antibody 1

2 Eluted f ractions

(b) lon-exchange chromatography Negativelycharged proteino Anions retained by beads

Positivelycharged proternO Layer sample on column

Elute negatively charged protein with salt solution

(Nacl)fl fl

Eluted fractions

Positively charged gel bead

3

2

1

fractions

FTGURE 3-37 Threecommonlyusedliquid EXPERIMENTAL techniquesseparateproteinson the basisof chromatographic mass,charge,or affinity for a specificbinding partner.(a)Gel proteins thatdifferin sizeA separates chromatography filtration layered on thetop of a cylinder iscarefully mixture of proteins proteins packed travelthroughthe with porousbeadsSmaller proteins columnmoreslowlythanlargerproteinsThusdifferent in theeluateflowingout of the bottomof thecolumnat emerging in canbe collected elutionvolumes) times(different different chromatography tubes,calledfractions(b)lon-exchange separate packed with proteins thatdifferin netchargein columns separates (shown positive or a here) charge carry either a beads that special havingthe samenetchargeasthe beads charge. Proteins negative proteins having whereas andflow throughthe column, arerepelled

chargebindto the beadsmoreor lesstightly, the opposite Boundproteins-inthiscase, on theirstructures. depending a salt elutedby passing subsequently charged-are negatively As the ions the column (usually of NaClor KCI)through gradient (more bound proteins tightly the displace they bindto the beads, in orderto be released). highersaltconcentration proteins require is of proteins a mixture (c)In antibody-affinity chromatography, with beadsto whicha specific passed througha columnpacked attachedOnlyproteinwith highaffinityfor the iscovalently antibody proteins flow by thecolumn;allthe nonbinding isretained antibody the boundproteiniseluted through.Afterthe columniswashed, the with an acidicsolutionor someothersolutionthat disrupts protein flows out of then released the complexes; antigen-antibody is collected and thecolumn

retained on the column. The proteins bound to the affinity column are then eluted by adding an excessof a soluble form of the ligand or by changing the salt concentration or pH such that the binding to the moleculeon the column is

disrupted. The ability of this technique to separatepartrcular proteins dependson the selectionof appropriate binding partners that bind more tightly to the protein of interest than to other proteins. . P U R I F Y I N GD, E T E C T I N GA,N D C H A R A C T E R I Z I NPGR O T E I N S

97

H i g h l y S p e c i f i cE n z y m ea n d A n t i b o d yA s s a y s Can DetectIndividualProteins The purification of a protein, or any other molecule, requires a specific assay that can detect the presenceof the molecule of interest as it is separatedfrom other molecules (e.g.,in column or density-gradientfractions or gel bands or spots).An assaycapitalizeson somehighly distinctivecharacteristicof a protein: the ability to bind a particular ligand, to catalyze a particular reaction, or to be recognized by a specific antibody. An assaymust also be simple and fast to minimize errors and the possibilitythat the protein of interest becomesdenaturedor degradedwhile the assayis performed. The goal of any purification scheme is to isolate sufficient amounts of a given protein for study; thus a useful assaymust also be sensitiveenough that only a small proportion of the available material is consumed by it. Many common protein assaysrequire just 10 e to 1.0 12g of material. Chromogenic and Light-Emitting Enzyme Reactions Many assaysare tailored to detect some functional aspectof a protein.For example,enzymaticactivity assaysare basedon the ability to detect the loss of substrateor the formation of product. Some enzymatic assaysutilize chromogenic substrates, which changecolor in the courseof the reaction. (Somesubstrates are naturally chromogenic; if they are not, they can be linked to a chromogenic molecule.)Becauseof the specificiryof an enzyme for its substrate,only samples that contain the enzyme will change color in the presenceof a chromogenic substrate; the rate of the reaction provides a measure of the quantity of enzymepresent.Enzymesthat catalyzechromogenic reactionscan also be fused or chemically linked to an antibody and used to "report" the presenceor location of an antigen to which the antibody binds (seebelow). Antibody Assays As noted earlier, antibodies have the distinctive characteristicof binding tightly and specificallyto antigens.As a consequence,preparations of antibodies that recognizea protein antigen of interest can be generatedand used to detect the presenceof the protein, either in a complex mixture of other proteins (finding a needle in a haystack, as it were) or in a partially purified preparation of a particular protein. The tight binding of the antibody to its antigen, and thus the presenceof the antigen, can be visualized by labeling the antibody with an enzyme)a fluorescent molecule, or radioactive isotopes. For example, luciferase, an enzyme present in fireflies and some bacteria, can be linked to an anribody. In the presenceof ATp and the substrate luciferin, luciferase catalyzesa light-emitting reaction. In either case,after the antibody binds to the protein of in-

98

C H A P T E R3

|

p R o T E t NS T R U C T U RAEN D F U N C T T O N

naturally fluorescent protein found in jellyfish (seeFigure 9-12). Alternatively after the first antibody binds to its target protein, a second, labeled antibody is used to bind to the complex of the first antibody and its target. This combination of two antibodiespermits very high sensitivity in the detection of a targetprotein. To generatethe antibodies, the intact protein or a fragment of the protein is injected into an animal (usually a rabbit, mouse, or goat). Sometimesa short synthetic peptide of 10-15 residuesbasedon the sequenceof the protein is used as the antigen to induce antibody formation. A synthetic peptide, when coupled to a large protein carrier, can induce an animal to produce antibodies that bind to that portion (the epitope) of the full-sized, natural protein. Biosynthetically or chemically attaching the epitope to an unrelatedprotein is called epitope tagging. As we'll see throughout this book, antibodies generatedusing either peptide epitopes or intact proteins are extremely versatilereagentsfor isolating, detecting,and characterizingprotelns. Detecting Proteins in Gels Proteins embedded within a one- or two-dimensionalgel usually are not visible. The two general approachesfor detecting proteins in gels are either to Iabel or stain the proteins while they are still within the gel or to electrophoreticallytransfer the proteins to a membrane made of nitrocellulose or polyvinylidene difluoride and then detect them. Proteinswithin gels are usually stainedwith an organic dye or a silver-basedstain, both detectedwith normal visible light, or with a fluorescent dye that requires specialized detection equipment. Coomassieblue is the most commonly usedorganic dye, typically usedto detect=1000 ng of protein, with a lower limit of detectionof =4-1,0 ng. Silver stainingor fluorescencestainingare more sensitive(lower limit of =1 ng). Coomassie and other stains can also be used to visualize proteins after transfer to membranes;however.the most common method to visualize proteins in these membranes is immunoblotting, commonly called'Westernblotting. Western blotting combines the resolving power of gel electrophoresisand the specificityof antibodies.This multistep procedure is commonly used to separateproteins and then identify a specificprotein of interest. As shown in Figure 3-38, two different antibodies are used in this method, one that is specific for the desiredprotein and a secondthat binds to the first and is linked to an enzymeor other molecule that permits detectionof the first antibody (and thus the protein of interesr to which it binds). Enzymesto which the secondantibody is attachedcan either generatea visible colored product or, by a processcalled chemiluminescence,produce light that can readily be recorded by film or a sensitive detector. The two different antibodies, sometimescalled a "sandwich," are used to amplify the signalsand improve sensitivity.If an antibody is not available,but the geneencodingthe protein is available and can be used to expressthe protein, recombinant DNA methods (Chapter 5) can irrcorporatea small peptide epitope (epitope tagging) into the normal sequenceof the protein that can be detected by a commercially available antibody to that epitope.

Illl+ Technique Animation:lmmunoblotting I

Antibody detection

Electrophoresisand transfer

!

Chromogenic detection

E

S D S - p o l y a c r y l a m i d e g e lM e m b r a n e

with lncubate A b ,( J ) ; washexcess

Incubatewith enzYmelinkedAb2 (Y); wash excess

Reactwith substrate for Ab2-linkedenzyme

FIGURE 3-38 Westernblotting A EXPERIMENTAL (immunoblotting) combinesseveraltechniquesto resolveand detect a specificprotein. StepE: Aftera proteinmixturehasbeen bands(orspots, throughan SDSgel,theseparated electrophoresed (blotted) fromthe gelonto gel)aretransferred for a two-dimensional removedStepZ: whichit isnot readily a porousmembraneJrom (Abr)specific of antibody isfloodedwith a solution Themembrane for a while.Onlythe protern andallowedto incubate for the desired thisproteinbindsthe antibody, bandcontaining membrane-bound (whoseposition cannotbe molecules forminga layerof antibody point) iswashedto remove Thenthe membrane seenat this

u n b o u nA d b ' . S t e pE : T h e m e m b r a ni sei n c u b a t ewdi t ha s e c o n d andbindsto thefirstAb1 (Ab2)thatspecifically recognizes antibody (e.9., to linked eitheran enzyme iscovalently antibody Thissecond reaction), a chromogenic can catalyze which phosphatase, alkaline can whosepresence or someothersubstance isotope, radioactive and the location Step4: Finally, with greatsensitivity be detected (e.g, by a deep-purple amountof boundAb2aredetected permitting the reaction), fromchromogenic precipitate (and the destred of the mass) therefore mobility electrophoretic (based on band aswellasitsquantity oroteinto be determined,

RadioisotopesAre lndispensableTools l olecules f o r D e t e c t i n gB i o l o g i c aM

Radioisotopes Useful in Biological Research Hundreds of biological compounds (e.g.,amino acids,nucleosides,and numerous metabolic intermediates)labeled with various radioisotopes are commercially available. These preparations vary considerably in their specific actiuity, which is the amount of radioactivity per unit of material, measured in

A sensitivemethod for tracking a protein or other biological molecule is by detecting the radioactivity emitted from radioisotopesintroduced into the molecule. At least one atom in a radiolabeled molecule is present in a radioactive form, called a radioisotope.

ISOTOPE

intensrtv).

}|ALF-tIIE

Phosphorus-32

1'4.3days

Iodine-125

60.4 days

Sulfur-35

87.5days

Tritium (hydrogen-3)

12.4 years

Carbon-14

5730.4years

dom/mmol) are available.Likewise' commercialpreparations tH-l"b.l.d nucleic acid precursorshave much ligher speoi 1aC-labeled cific activities than those of the corresponding preparations.In most experiments'the former are preferable t".uot. they allow RNA or DNA to be adequatelylabeled alter a shorter time of incorporation or require a smaller cell sample.Various phosphate-containingcompounds in which every phosphorus atom is the radioisotope phosphorus-32 P U R I F Y I N GD, E T E C T I N GA,N D C H A R A C T E R I Z I NPGR O T E I N S

99

a^rereadily available. Becauseof their high specific activity, 32P-labeled nucleotides are routinely ur.d to label nucleic acids in cell-freesystems. Labeled compounds in which a radioisotope replaces atoms normally present in the molecule have virtually the same chemical properties as the corresponding nonlabeled compounds. Enzymes,for instance,generally cannot distinguish betweensubstrateslabeledin this way and their nonlabeled substrates.The presenceof such radioactive atoms is indicatedwith the isotopein brackets(no hyphen) as a prefix (e.g., [3H]leucine).In .ontrurt, labeling almost all biomolecules (e.g., protein or nucleic acid) with the radioisotope iodine-125 (12sI)requires the covalent addition of 12sIto a molecule that normally does nor have iodine as part of its structure.Becausethis labelingproceduremodifies the chemical structure, the biological activity of the labeled molecule may differ somewhat from that of the nonlabeledform. The presenceof such radioactive atoms is indicated with the isotope as a prefix with a hyphen (no bracket) (e.g.,125l-trypsin). Standardmethods for labeling proteins with 12sIresult in covalent attachmentof the 125Iprimarily to the aromatic rings of tyrosine side chains (mono- and diiodotyrosine).

disintegrations per minute per small pixel of surface area. These instruments, which can be thought of as a kind of reusable electronic film, are commonly used to quantitate radioactive molecules separated by gel electrophoresisand are replacingphotographic emulsionsfor this purpose. A combination of labeling and biochemical techniques and of visual and quantitative detectionmethods is often employed in labeling experiments.For instance,to identify the major proteins synthesizedby a particular cell type, a sample of the cells is incubated with a radioactive amino acid (e.g., [35S]methionine)for a few minutes, during which time the Lbeled amino acid mixes with the cellular pool of unlabeled amino acids and some of the labeled amino acid is biosynthetically incorporated into newly synthesizedprotein. Subsequently unincorporatedradioactive amino acid is washed away from the cells. The cells are harvested,the mixture of cellular proteins is extractedfrom the cells (for example, by a detergentsolution), and then separatedby gel electrophoresis; and the gel is subjectedto autoradiography or phosphorimager analysis.The radioactive bands correspondto newly synthesizedproteins, which have incorporatei the radiolabeled amino acid. Alternatively, the proteins can be resolved by liquid chromatographS and the radioactivity in the eluted Labeling Experiments and Detection of Radiolabeled fractions can be determinedquantitatively with a counter.To Molecules Whether labeledcompoundsare detectedby audetect only one specificprotein, rather than all the proteins toradiography, a semiquantitativevisual assay or their radioacbiosyntheticallylabeled this way, a specific antibody to the tivity is measuredin an appropriate ',counter," a highly quantiprotein of interestcan be usedto precipitatethe protein away tative assaythat can determine the amount of a radiolabeled from the other proteins in the sample (immunoprecipitation). compound in a sample, depends on the nature of the experiThe precipitate is then solubilized in a detergenr,separating ment. In some experiments,both types of detection are used. the antibody from the protein, and the sampleis subjectedto In one use of autoradiographS a tissue,cell, or cell conSDS-PAGEfollowed by autoradiography.In this type of exstituent is labeledwith a radioactivecompound, unassociated periment, a fluorescent compound that is activated by the radioactivematerial is washed away, and the structure of the radiation is often infusedinto the gel so that the light emitted sample is stabilized either by chemically cross-linking the can be used to detect the presenceof the labeled protein, macromolecules('fixation') or by freezingit. The sample is either using film or a two-dimensional electronicdetector. then overlaid with a photographic emulsion sensitiveto radiPulse-chase experimentsare particularly usefulfor tracing ation. Developmentof the emulsion yields small silver grains changesin the intracellular location of proreins or the modiwhose distribution correspondsto that of the radioactivemafication of a protein or metabolit. ou.i time. In this experiterial and is usuallydetectedby microscopy.Autoradiographic mental protocol, a cell sample is exposed to a radiolabeled studiesof whole cellswere crucial in determiningthe intracelcompound that can be incorporated or otherwiseattachedto lular siteswhere various macromoleculesare synthesizedand a cellular molecule of interest-the "pulse"-for a brief pethe subsequentmovements of these macromoleculeswithin riod of time, then washedwith buffer to remove the unincorporated label, and finally incubated with an unlabeled form of the compound-the "chase" (Figure 3-39). Samplestaken periodically during the chaseperiod are assayedto determine the location or chemicalform of the radiolabel as a function of time. Often, pulse-chaseexperiments,in which the protein Quantitative measurementsof the amount of radioactivis detected by autoradiography after immunoprecipitation ity in a labeledmarerial are performed with severaldifferent and SDS-PAGE,are usedto follow the rate of synthesis,modification, and degradation of proteins by adding radioactive amino acid precursorsduring the pulse and then detectingthe amounts and characteristicsof the radioactiveprotein during the chase.One can thus observepostsyntheticmodifications of the protein that changeits electrophoreticmobility and the rate of degradation of a specificprotein. A classicuse of the pulse-chasetechniquewas in studiesto elucidatethe pathwav traversedby secretedproteins from their site of synihesisin the endoplasmicreticulum to the cell surface(Chapter 14). 100

.

c H A p r E3R | p R o r E t N s r R U c r u RAEN DF U N c l o N

Normal protein

p-e.

(b) Mutant 'Drotein

m '.,& o-

"'

key component, which provides a measure of the relative abundancesof each of the ions in the sample.The fourth essential component is a computerized data systemthat is used to calibrate the instrument; acquire,store, and processthe resulting data; and often direct the instrument automatically to collect additional specific types of data from the sample' based on the initial observations. This type of automated feedback is used for the tandem MS (MS/MS) peptidesequencingmethods describedbelow. The two most frequently usedmethods of generatingions of proteins and protein fragmentsare (1) matrix-assistedlaser desorption/ionization(MALDI) and (2) electrospray(ES)' In MALbI (Figure 3-40) the peptide or protein sampleis mixed with a low-molecular-weight,W-absorbing organic acid (the matrix) and then dried on a metal tatget. Energy from a laser ionizes and vaporizes the sample producing singly charged molecular ions from the constituentmolecules'In ES (Figure 3-41.a),the sample of peptidesor proteins in solution is converted into a fine mist of tiny droplets by spraying through a

l"j,\'J," ;:::,'J."'Ll3,' "".' il?HT":',i"H experimentscan FIGURE 3-39 Pulse-chase A EXPERTMENTAL track the pathway of protein modificationor movement newlysynthesized within cells.(a)Tofollowthefateof a specific proteinin a cell,cellswereincubated for 0 5 hr with [3sS]methionine proteins, (thepulse) andthe radioactive to labelallnewlysynthesized intothe cellswasthenwashedaway aminoacidnot incorporated (thechase) for varying timesup to Thecellswerefurtherrncubated to weresubjected from each timeof chase 24 hours,andsamples protein(here,the lowto isolate onespecific immunoprecipitation of the immunoprecipitates receptor) SDS-PAGE lipoprotein density permitted visualization of the one followedby autoradiography (p) protein, asa smallprecursor synthesized whichis initially specific (m) of addition form by larger mature modified to a rapidly andthen from proteinwasconverted Abouthalfof the labeled carbohydrates after0.5 hourof p to m duringthe pulse,the restwasconverted to stablefor 6-8 hoursbeforeit begins chaseTheproteinremains (b) (indicated The same intensity). band by reduced be degraded in cellsin whicha mutantformof the wasperformed experiment to converted proteinismadeThemutantp formcannotbe properly thanthe normalprotein the m form,andit is morequicklydegraded 1986, J CellEloi H A Brush, andM Krieger, fromK F Kozarsky, lAdapted 1567-1s7s 102(5) I Roshanl(eab 021-66950639

arated by the mass analyzeron the basis of their mlz. The two most frequently used mass analyzersare timeof-flight (TOF) instruments and ion traps. TOF instruments e*ploit the fact that the time it takes an ion to passthrough the length of the analyzer before reaching the detector is

Metal target

I

lonization +++ [email protected]

MassSpectrometryCan Determinethe Mass and Sequenceof Proteins Mass spectrometry (MS) is a powerful technique for characthe tertzingproteins.MS is particularly useful in determining 'With such inmass of a protein or fragments of a protein. formation in hand, it is also possibleto determinepart of or all the protein's sequence.This method permits the very highly accuratedirect determination of the ratio of the mass (m) of a charged molecule (ion) to its charge (z), ot mlz. Techniquesare then used to deducethe absolutemass of the ion. There are four key features of all mass spectrometers. The first is an ion source,from which charge, usually in the form of protons, is transferred to the peptide or protein molecules.The formation of these ions occurs in the presenceof a high electric field that then directs the chargedmolecular ions into the second key component' the mass analyzer. The mass analyzer,which is always in a high vacuum chamber, physically separatesthe ions on the basis of their differing mass-to-charge(mlz) ratios. The mass-separated ions are subsequentlydirected to strike a detector,the third

Sample

@

t

q)

c

Lightestions arrive at detector first

Time 3-40 Molecularmasscan be FIGURE a EXPERIMENTAL laserdesorption/ionization determinedby matrix-assisted massspectrometry'ln a MALDI-TOF time-of-flight (MALDI-TOF) pulses of lightfroma laserionizea proteinor massspectrometer, on a metaltarget(stepE) An that isabsorbed peptidemixture towardthe detector the ionsin the sample fieldaccelerates electric to the isproportional (steosEl andEl).Thetimeto the detector the having (mlz) ions For ratio. mass-to-charge the squarerootof timeto the ionsmovefaster(shorter the smaller samecharge, usingthetimeof flight weightiscalculated Themolecular detector). of a standard PG ROTEINS O AN , D CHARACTERIZIN P U R I F Y I N GD,E T E C T I N G

101

(a)

Electrospray needle

Atmosphere Vacuum

Mass Detector analyzer

----_Y--------Y-

Droplets containing solvatedions

rons

Mass spectrometer

Electrosprayionization (b)

568.65

100 3go ;80 o.^ /u o o

F60 Ebo €40 930 620 #10 0

MS/MS of mlz 836.47

o

0)

q) CC

100 90 FIIVGYVDDTOFVR 80 70 60 693.26 50 706.62 40 30 765.40 421.33 20 473.15 549.46 261.30 10 0 300 400 500 600 700 800

1142.53

1298.60 1497.46

1251 1124.44

1398.48 1536.14

900

1000

1100

1200

1300

14oO 15oO 1600

m/z EXPERIMENTAL FIGURE 3-41 Molecularmassof proteins and peptidescan be determinedby electrosprayionization ion-trap massspectrometry.(a)Electrospray (ES)ionization proteins converts andpeptides in a solution intohighlycharged gaseous ionsby passing the solution througha needle(forming the droplets) thathasa highvoltageacross it (charging the droplets). Evaporation of thesolvent produces gaseous ionstharenrera mass spectrometer. Theionsareanalyzed by an ion-trapmassanalyzer that thendirectsionsto the detector. (b) Toppanet:Massspectrumof a mixture of threemajorandseveral minorpeptides ispresented asthe relative abundance of the ionsstriking (y axis)asa the detector functionof the mass-to-charge (m/z)ralio(x axis).Bottornpanel:ln an MS/MSinstrument (suchasthe iontrapshownin part(a)),a

102

C H A P T E R3

|

p R o T E t NS T R U C T U RAEN D F U N C T T O N

peptideioncanbe selected specific for fragmentatron intosmaller ionsthatarethenanalyzed anddetected. (also TheMS/MS spectrum calledthe product-ion spectrum) provides detailed structural information aboutthe parention,including sequence information for peptidesHere,the ionwith a mlzof 836.47wasselected, fragmented andthe m/z massspectrumof the productionswas measured Notethereis'nolongeran ionwith an m/zoI g36.47 present because it wasfragmented. Fromthevarying sizes of the productions,the understanding that peptidebondsareoftenbroken in suchexperiments, the knownmlzvalues for individual aminoacid fragments, anddatabase information, the sequence of the peptide, FIIVGYVDDTQFVR, canbe deduced. ona fiourefrom [part(a)based part(b),unpublished 5 Carr; datafromS Carr I

proportional to the square root of mlz (smaller ions move fasterthan larger oneswith the samecharge,seeFigure 3-40). In ion-trap analyzers,tunable electric fields are used to cap'trap,' ions with a specific mlz and to sequentially ture, or pass the trapped ions out of the analyzer onto the detector (seeFigure 3-4ta). By varying the electric fields, ions with a wide range of mlz values can be examined one by one, producing a massspectrum,which is a graph of mlz (x axis) versus relative abundance(y axis) (Figure 3-41'b,top panel). In tandem, or MS/MS, instruments, any given parent ion in the original mass spectrum (Figure 3-41b, top panel) can be broken into smallerions by collisionwith an inmass-selected, ert gas, and then the mlz and relative abundancesof the resulting fragment ions measured (Figure 3-41b, bottom panel), all within the samemachinein about 0.1 s per selectedparent ion. This secondround of fragmentationand analysispermits the sequencesof short peptides ( FIGURE to each areaddedby a DNApolymerase Nucleotides synthesis. (indicated by growingdaughter strandin the 5'-+3' direction f roma continuously strandissynthesized Theleading arrowheads) (red) is strand lagging end. The primer at its 5' singleRNA thatare frommultipleRNAprimers discontinuously synthesized duplexis aseachnewregionof the parental formedperiodically produces Okazaki initially of theseprimers unwoundElongation prevtous the growing approaches fragment As each fragments, areligated andthefragments primer, the primerisremoved of the entire in synthesis results eventually of thisprocess Repetition l a g g i nsgt r a n d .

5', P o i n to f j o i n i n g L a g g i n gs t r a n d Okazakifragment P a r e n t aD l NAduPlex

S h o r tR N A p r i m e r

5', Leadingstrand

DNA REPLICATION

14'l

FocusAnimation:Coordinationof Leading- and

flltt strandsynthesis

(a) SV40DNA replicationfork

E::i1,""';

31

5',

Primase

L a g g i n gs t r a n d

E

pPol E Rfc PCNA

Primer

(b}PCNA RPA

a

Doublestranded DNA

Leadingstrand

(c)RPA

FIGURE 4-31 Model of an SV40DNA replicationfork. (a)A hexamer of largeT-antigen ([), a viralprotein. functions asa helicase to unwindthe parental DNAstrands. Single-strand regions of the parental template unwoundby largeT-antigen areboundby multiple copies of the heterotrimeric proteinRpA(Z). Theleading strandissynthesized by a complex of DNApolymerase S (polS),

(E). (b)Thethreesubunits fragment of pCNA,shownin different colors, forma circular structure with a centralholethroughwhich double-stranded DNApasses. A diagram of DNAisshownjn the centerof a ribbonmodelof the pCNAtrimer.Thediaqram at the

pCNAboundto DNAin upperleftshowsthe iconrepresenting parta. (c)Thelargesubunitof RPAcontains two domains thatbind single-stranded DNA.Onthe left,thestructure determined for the two DNA-binding domains of the largesubunitboundto single_ stranded DNAisshownwith the DNAbackbone (whitebackbone with bluebases) parallel to the planeof the page Notethatthe singleDNAstrandisextended withthe bases exposed, an optimal conformation for replication by a DNApolymerase Onthe right,the viewisdownthe lengthof thesingleDNAstrand,revealing how RpA wraparoundthe DNA.Thediagram B strands at bottomcenter showsthe iconrepresenting heterotrimeric RpAboundto singlestranded DNAin part(a).[part (a)adapted fromS J Flint etal, 2000, pathogenesis, Virology: Molecular Biology, andControl, ASMpress; part(b) afterJ M Gulbis et al, 1996,Cetl87:297; andpart(c)afterA Bochkarev etal, 1997, Nature 385:176 l

Figure 4-31 depicts the multiple proteins that coordinate copying of SV40 DNA at a replication fork. The assembled proteins at a replication fork further illustrate the concept of molecular machines introduced in Chapter 3. These multi_ component complexes permit the cell to carry out an ordered sequenceof eventsthat accomplishessentialcell functions. The molecular machine that replicatesSV40 DNA con_ tains only one viral protein. All other proteins involved in 142

o

c H A p r E R4

I

B A s t cM o L E c u L A R G E N E T tM c ECHANtsMs

llll+ FocusAnimation:Bidirectional of DNA Reptication EcoRl

SV40 DNA replication are provided by the host cell. This viral protein, large T-antigen, forms a hexamer that unwinds the parental strandsat a replication fork. Primers for leading and lagging daughter-strandDNA are synthesizedby a complex of primase, which synthesizesa short RNA primer, and DNA polymerased (Pol a), which extendsthe RNA primer with deoxynucleotides,forming a mixed RNA-DNA primer' The primer is extended into daughter-strand DNA by DNA polymerase6 (Pol 6), which is lesslikely to make errors during copying of the templatestrand than is Pol ct becauseof its proofreading mechanism (see Section 4.6 below). Pol E forms a complex with R/c (replication factor C) and PCNA (proliferating cell ntclear antigen), which displaces the primase-Pol crcomplex following primer synthesis.As illustrated in Figure 4-31,b,PCNA is a homotrimeric protein that has a central hole through which the daughterduplex DNA passes, thereby preventing the PCNA-Rfc-Pol 6 complex from dissociating from the template.Pol E is the main polymeraseused by eukaryotes for elongating DNA strands during replication. After parental DNA is separatedinto single-strandedtemplatesat the replication fork, it is bound by multiple copiesof RPA (replicationprotein A), a heterotrimericprotein (Figure 4-31,c).Binding of RPA maintains the template in a uniform conformation optimal for copying by DNA polymerases. Bound RPA proteins are dislodgedfrom the parental strands by Pol cr and Pol 6 as they synthesizethe complementary strandsbase-pairedwith the parental strands. Severaleukaryotic proteins that function in DNA replication are not depictedin Figure 4-31. DNA polymerasee also contributes to the synthesisof cellular chromosomal DNA, though its exact role is uncertain. Still other specializedDNA polymerasesare involved in repair of mismatchesand damagedlesionsin DNA (seeSection4.6). A topoisomeraseassociateswith the parental DNA aheadof the helicaseto remove torsional stressintroduced by the unwinding of the parental strands. Ribonuclease H and FEN I remove the ribonucleotidesat the 5' ends of Okazaki fragments;these are replacedby deoxynucleotidesadded by DNA polymerase6 as it Okazaki extendsthe upstream Okazaki fragment. Successive fragments are coupled by DNA ligase through standard 5'-+3' phosphoesterbonds.Replicationof a linear DNA molecule presentsa specialproblem at the ends of the molecule sincethe 5'-most RNA primers of the lagging strandscannot be replacedby DNA by this mechanism.In most eukaryotes' this problem is solved by the RNA-protein complex called telomerasethat carriesits own templateas discussedin Chapter 6, Genes,Genomics,and Chromosomes.

D N A R e p l i c a t i o nU s u a l l yO c c u r sB i d i r e c t i o n a l l y f r o m E a c hO r i g i n As indicatedin Figures4-30 and 4-31, both parental DNA strands that are exposedby local unwinding at a replication fork are copied into a daughter strand. In theory, DNA replication from a singleorigin could involve one replication fork

C i r c u l a vr i r a l cnromosome

o

q)

o)

E

.,*.,."0, o g;-ri.r-" o";"; r;,;*; a EXPERTME;I of microscopy bidirectionalreplicationof SV40DNA.Electron growthof DNAstrands bidirectional SV40DNAindicates replicating cells viralDNAfromSV4O-infected froman origin.Thereplicating one site recognizes which EcoRl, enzyme restriction wascut by the for a a landmark DNA.Thiswasdoneto provide in thecircular recognition the FcoRl in the 5V40genome: sequence specific asthe endsof linearDNA recognized isnoweasily sequence micrographs Electron microscopy. by electron vrsualized molecules a collection showed molecules DNA SV40 replicating of EcoRl-cut "bubbles," longerreplication with increasingly of cut molecules from eachendof the cut whosecentersarea constantdistance with Thisfindingisconsistent chaingrowthin two molecules at thecenterof a bubble, froma commonoriginlocated directions etal, G C Fareed diagrams' [See in thecorresponding asillustrated of N P Salzman l photographs courtesy J Virol10:484; 1972, that moves in one direction. Alternatively, two replication forks might assembleat a single origin and then move in opposite directions, leading to bidirectional growth of both i",rght., strands.Severaltypes of experiments,including the orr. sho*tt in Figure 4-32, provided early evidencein support of bidirectional strand growth. The general consensusis that all prokaryotic and eukaryoticlels employ a bidirectional mechanism of DNA DNA REpL1CAT;ON o

143

FocusAnimation:Coordination of Leading-and Lagging-strand flltt Synthesis Helicases

< FIGURE 4-33 Bidirectional mechanism of DNAreplication. Theleftreplication fork hereiscomparable to the replication fork diagrammed in Figure 4-31, whichalsoshowsproteins otherthan largeT-antigen lop:TwolargeT-antigen hexameric helicases first EJrn*'no'nn bindat the replication originin opposite orientations. Step[: Using energyprovided fromATPhydrolysis, the helicases movein opposite directions, unwinding the parental DNAandgenerating single-strand templates thatareboundby RPAproteinsStepE: primase_pol o complexes synthesize (red)base-paired shortprimers to eachof the parental primersynthesis separated strands. Stepg: pCNA-Rfc-pol 6 complexes E t".o,nn-.trand replace the primase-Pol crcomplexes J andextendtheshortprimers, generating (darkgreen)at eachreplication the leading strands fork [email protected]: Thehelicases furtherunwindthe parental strands, andRpA proteins bindto the newlyexposed single-strand regions. Stepg: I PCNA-Rfc-Pol 6 complexes extend the leading strands further Step6: extension ! | Leading-strand Primase-Pol ctcomplexes primers synthesize for lagging-strand t synthesis at eachreplication fork Stepfl: pCNA-Rfc-pol 6 complexes displace the primase-Pol o complexes andextendthe lagging-strand (lightgreen), Okazaki fragments whicheventually areligatedto the 5' endsof the leading strandsTheposition whereligation occursis represented by a circleReplication continues byfurtherunwinding of theparental strands andsynthesis of leading andlagging strands asin Steps4-Z Althoughdepicted asindividual stepsfor clarity, unwinding andsynthesis of leading andlaggingstrands occurconcunentlv I

Unlike SV40 DNA, eukaryotic chromosomal DNA moleculescontain multiple replication origins separatedby tens to hundreds of kilobases.A six-subunit protein called ORC, for origin recognition complex, binds to each origin and associateswith other proteins required to load cellular hexameric helicasescomposed of six homologous MCM proteins (for minichromosome maintenance. the genetic screen initially_used to identify the genes encoding them). Two opt.nn,"n-strand primersynrhesis posed MCM helicases separatethe parental strands at an

extension El I Leaoing-strand

+

E J

extension Z I a.nn,nn-strand

+

transcription of most genes,control of the initiation step is the primary mechanismfor regulatingcellular DNA replication. Ac_ S t r a n dl i g a t i o n

replication. In the caseof SV40 DNA, replication is initiated by binding of two large T-antigen hexamiric helicasesto the

into two daughtercells.We discussthe various regulatory mech_ anismsthat determinethe rate of cell division in Chapter 20.

DNA Replication Each strand in a parental duplex DNA acts as a template r synthesisof a daughter strand and remains base-paired the new strand, forming a daughter duplex (using a 144

C H A P T E R4

|

B A S T CM O L E C U L A RG E N E T T M C ECHANTSMS

semiconservativemechanism).New strands are formed the 5'--+3'direction. r Replication begins at a sequencecalled an origin. Each eukaryotic chromosomal DNA molecule contains multiple replication origins. r DNA polymerases,unlike RNA polymerases,cannot unwind the strandsof duplex DNA and cannot initiate synthesis of new strandscomplementaryto the templatestrands. r At a replication fork, one daughter strand (the leading strand) is elongated continuously. The other daughter strand (the lagging strand) is formed as a seriesof discontinuous Okazaki fragments from primers synthesizedevery few hundred nucleotides(Figure 4-30). r The ribonucleotidesat the 5' end of each Okazaki fragment are removed and replacedby elongation of the 3' end of the next Okazaki fragment. Finally adjacent Okazaki fragments are joined by DNA ligase. r Helicasesuse energyfrom ATP hydrolysis to separatethe parental (template)DNA strands. Primase synthesizesa short RNA primer, which remains base-pairedto the template DNA. This initially is extendedat the 3' end by DNA polymerase a (Pol c), resulting in a short (S')RNA(3' )DNA daughterstrand. r Most of the DNA in eukaryotic cells is synthesizedby Pol 6, which takes over from Pol ct and continues elongation of the daughterstrandin the 5'+3' direction.Pol 6 remains stably associatedwith the template by binding to Rfc protein, which in turn binds to PCNA, a trimeric protein that encirclesthe daughter duplex DNA (seeFigure 4-31). r DNA replication generally occurs by a bidirectional mechanism in which two replication forks form at an origin and move in opposite directions, with both template strandsbeing copied at eachfork (seeFigure4-33)' r Synthesisof eukaryotic DNA in vivo is regulatedby controlling the activity of the MCM helicasesthat initiate DNA replication at multiple origins spacedalong chromosomal DNA.

![

DNARepairand Recombination

Damage to DNA is unavoidable and arises in many ways. DNA damage can be caused by spontaneouscleavageof chemicalbonds in DNA, by environmental agentssuch as ultraviolet and ionizing radiation, and by reaction with genotoxic chemicalsthat are by-products of normal cellular metabolism or occur in the environment' A mutation in the normal DNA sequencecan occur during replication when a DNA polymerase inserts the wrong nucleotide as it reads a damagedtemplate. Mutations also occur at a low frequency as the result of copying errors introduced by DNA polymeraseswhen they replicate an undamagedtemplate. If such mutations were left uncorrected, cells might accumulate so many mutations that they could no longer function properly, In addition, the DNA in germ cells might incur too many

mutations for viable offspring to be formed' Thus the prevention of DNA sequenceerrors in all types of cellsis important for survival, and several cellular mechanismsfor repairing damagedDNA and correcting sequenceerrors have evolved' One mechanismfor repairing double-strandedDNA breaks' by a processcalled recombination, is also used by eukaryotic cells to generatenew combinations of maternal and paternal geneson each chromosome through the exchangeof segments of the chromosomesduring the production of germ cells (e'g', sperm and eggs). Significantln defects in DNA repair mechanisms and cancerare closelyrelated. !7hen repair mechanismsare compromised, mutations accumulate in the cell's DNA. If these mutations affect genes that are normally involved in the careful regulation of cell division, cells can begin to divide uncontrollably, leading to tumor formation, and cancer' Chapter 25 outlines in detail how cancer arisesfrom defects in DNA repair.We will encountera few examplesin this section, as well, as we first consider the ways in which DNA integrity can be compromised' and then discussthe repair mechanismsthat cells have evolved to ensurethe fidelity of this very important molecule'

IntroduceCopyingErrors DNA Polymerases and Also CorrectThem The first line of defensein preventingmutations is DNA polymerase itself. Occasionally, when replicative DNA polymerasesprogressalong the template DNA, an incorrect nuto the growing 3' end of the daughterstrand cleotideit for instance,in(seeFigure"da.a 4-31,).E. coll DNA polymerases., troduce about 1 incorrect nucleotideper 104 polymerizednucleotides.Yet the measuredmutation rate in bacterial cells is much lower: about 1 mistake in 10e nucleotidesincorporated into a growing strand. This remarkable accuracy is largely due to proofreading by E. coli DNA polymerases' Pro-ofreadingdependson a 3'-+5' exonucleaseactiuity of some DNA polymerases.Sfhen an incorrect baseis incorporated during DNA synthesis,base-pairingbetweenthe 3' nucleotideof the nascentstrand and the templatestrand doesnot occur.As a result,the polymerasepauses'then transfersthe 3' end of the growing chain to its exonucleasesite, where the incorrectmispairedbaseis removed (Figure4-34)' Then the 3' end is transferredback to the polymerasesite' where this region is copied correctly. Like the E. coli DNA polymerases' I*o enkaryotic DNA polymerases,6 and e, used for replication of most chromosomal DNA in animal cells' also have proofreading activity. It seemslikely that proofreading is indispensablefor all cellsto avoid excessivemutatlons'

C h e m i c aal n d R a d i a t i o nD a m a g et o D N A Can Leadto Mutations DNA is continually subiectedto a baffage of damaging chemical reactions; estimatesof the number of DNA damin a singlehuman cell range from 10a to 105 per "g..,r..t,, day! Even if DNA were not exposedto damaging chemicals, ..it"in aspectsof DNA structure are inherently unstable' D N A R E P A I RA N D R E C O M B I N A T I O N O

145

Frngers

Thumb

t^

Thumb

Fingers urowtng strand

Pol

Template strand

Exo

FIGURE 4-34 Proofreading by DNApolymerase. All DNA polymerases havea similar three-dimensional structure, which resembles a half-opened righthandThe,,fingers,, bindthesinglestranded segment of thetemplatestrand,andthe polymerase catalytic (Pol)liesin thejunctionbetween activity thefingers andpalm.As long asthecorrect nucleotides areaddedto the3, endof thegrowing strand,it remains in the polymerase site Incorporation of an incorrect

baseat the3' endcauses melting of thenewlyformedendof the duplexAsa result, pauses, thepolymerase andthe3,endof the growingstrandistransferred to the 3,-+5,exonuclease site(Exo) about3 nm away,wherethe mtspaired baseandprobably otherbases areremoved. Subsequently, the 3' endflipsbackintothe polymerase siteandelongation resumes. fromC M Joyce andT.T.Steltz, [Adapted 1995, 1 Bacteriol 177:6321,and S Bellandl Baker, 1998, Ceil92:2951

For example, the bond connecting a purine baseto deoxyribose is prone ro hydrolysis at low rate under physiological conditions, leaving a sugar without an attached base.Thus coding information is lost, and this can lead to a mutarion during DNA replication. Normal cellular reacrions,including the movement of electronsalong the electron-transportchain in mitochondria and lipid oxidation in peroxisomei, produce severalchemicalsthat react with and damage DNA, including hydroxyl radicals and superoxide (O2 ). These too can causemutations, including those that lead to cancers. Many spontaneous mutations are point mutations, which involve a changein a single basepair in the DNA se-

quence. One of the most frequent point mutations comes ftom deamination of a cytosine (C) base,which converts it into a uracil (U) base. In addition, the common modified baseS-methylcytosineforms thymine when it is deaminated. If thesealterationsare not correctedbefore the DNA is replicated,the cell will usethe strandcontainingU or T as template to form a U.A or T.A basepair, thus creating a permanent changeto the DNA sequence(Figure 4-35). Radiation from the environment can also have dramatic consequences for DNA. High-energy ionizing radiation such as x-rays and gamma rays causedouble-strandedbreaks in DNA. Uy radiation found in sunlight causesdistortions in

NH.

U

l' N'c-c-cr. ttl ozc'-r-cH I

Deamination

(.tl HNz"\c-cH"

trl

o-rctN.c

2-Deoxyribose

2-Deoxyribose

5-Methylcytosine

Thymine

5',

?21

Deamination

--+

5',

J

Replication

z

E .* Base-excision repatr 3',

3',

Witd-type DNA FIGURE 4-35 Deamination leadsto point mutations.A spontaneous pointmutation canformbydeamination of 5-methylcytosine (C)to formthymine(T).lf the resulting T.Gbasepair isnot restored to the normalC.Gbasepairby baseexcision_repair 146

.

Mutant DNA

5',

Wild-type DNA

(step[), it willleadto a permanent mechanisms changeIn sequence (r.e., a mutation) following (stepZ). Afteroneround DNAreplication of replication, onedaughter DNAmolecule willhavethe mutantT.A basepairandtheotherwillhavethewild-type C.Gbasepair.

c H A p r E4R | B A s t cM o L E c u L AGRE N E TM t cE c H A N t s M s

the DNA double helix that interfere with proper replication and transcription.

High-FidelitD y N A E x c i s i o n - R e p aSi ry s t e m s a n d R e p a i rD a m a g e Recognize In addition to proofreading,cellshaveother repair systemsfor preventingmutations due to copying errors, spontaneousmutation, and exposureto chemicalsand radiation. SeveralDNA excision-repair systemsthat normally operate with a high degree of accvracy have been well studied. These systemswere first elucidated through a combination of genetic and biochemicalstudiesin E. coli. Homologs of the key bacterialproteins exist in eukaryotes from yeast to humans, indicating that theseerror-freemechanismsaroseearly in evolution to protect DNA integrity. Each of these systems functions in a similar manner-a segmentof the damagedDNA strand is excised, and the gap is filled by DNA polymeraseand ligaseusing the complementary DNA strand as template. I7e will now turn to a closer look at some of the mechanisms of DNA repair, ranging from repair of single basemutations to repair of DNA broken acrossboth strands. Some of theseaccomplish their repairs with great accuracy;others are lessprecise.

BaseExcisionRepairsT.G Mismatchesand DamagedBases In humans, the most common type of point mutation is a C to T, which is causedby deamination of S-methyl C to T (see Figure 4-35). The conceptual problem with base excision repair in this case is determining which is the normal and which is the mutant DNA strand, and repairing the latter so that it is properly base-pairedwith the normal strand. Sincea G.T mismatch is almost invariably causedby chemical conversion of C to U or S-methyl C to T, the repair system evolvedto removethe T and replaceit with a C (Figure4-36). The G'T mismatch is recognized by a DNA glycosylase that flips the thymine base out of the helix and then hydrolyzes the bond that connects it to the sugar-phosphate DNA backbone. Following this initial incision, an apurinic (AP) endonucleasecuts the DNA strand near the abasicsite. The deoxyribose phosphate lacking the base is then removed and replaced with a C by a specializedrepair DNA polymerasethat reads the G in the template strand. As mentioned earlier, this repair must take place prior to DNA replication becausethe incorrect base in this pair, T, occurs naturally in normal DNA. Consequently,it would be able to engagein normal \Tatson-Crick basepairing during replication, generatinga stablepoint mutation that is now unable to be recognizedby repair mechanisms(seeFigure 4-35, s t e pZ ) . Human cells contain a battery of glycosylases'each of which is specific for a different set of chemically modified DNA bases.For example,one removesS-oxyguanine,an oxidized form of guanine, allowing its replacementby an undamagedG, and others remove basesmodified by alkylating agents.The resultingnucleotidelacking a baseis then replaced

3',

5' .*"'J.-r1.!!?sif..'-"1*.r

i{:iT,iil

-L*l-i-J_|j*l-_l-e 5' '' ,)a ' -lDNAglycosYlase

T*ril*rTl*r

-ji*j*|J*t-Li*L

ls A P EeI n d o n u c l e a s e

I t

* *T-r -i*rj""r I

!-r-.{e.+

liG:!"; fJ-

-^. )-

rr*

ls AP lyase I

(partof DNAPol0)

::*T-l- Tl*l]i-J-l-Lgl-l-i-J"-

PorF, DNA risase DNA

E

4-36 Baseexcisionrepair of a T'G mismatch.A DNA A FIGURE formedby usually for G'Tmismatches, glycosylase specific (see flipsthethymine 4-35), Figure residues of 5-mC deamination baseout of the helixandthencutsit awayfromthesugar-phosphate (blackdot).An justthe deoxyribose (stepn), leaving DNAbackbone site[apurinic baseless icfor the resultant specif endonuclease (stepE), and thencutsthe DNAbackbone | (APE1)l endonuclease apurinic endonuclease, by an phosphate is removed thedeoxyribose with DNApolymerase associated B, a specialized lyase(APlyase), usedin repair(stepB). Thegapisthenfilledin by DNApolymerase (stepZl),restoring theoriginal by DNAligase DNAPolB andsealed 42:2946] Chemie Angewandte pair 2003, O Schdrer, G.Cbase [After

by the repair mechanismjust discussed.A similar mechanism functions in the repair of lesions resulting from depwrination, the loss of a guanine or adenine base from DNA resulting from hydrolysis of the glycosylic bond between deoxyribose and the base.Depurination occursspontaneouslyand is fairly common in mammals. The resulting abasicsites,if left unrepaired, generatemutations during DNA replication because they cannot specifythe appropriatepaired base.

MismatchExcisionRepairsOther Mismatches a n d S m a l lI n s e r t i o n sa n d D e l e t i o n s Another process,also conservedfrom bacteria to man' principally eliminates base-pair mismatches and insertions or deletionsof one or a few nucleotidesthat are accidentallyintroduced by DNA polymerasesduring replication. As with base excision repair of a T in a T'G mismatch, the conceptual problem with mismatch excision repair is determining whic^his the normal and which is the mutant DNA strand, and repairing the latter. How this happensin human cellsis not known with certainty. It is thought that the proteins that bind to the mismatchedsegmentof DNA distinguishthe template AND RECOMBINATION . DNA REPAIR

147

z'lttsuz

Templatestrand

+ A

t:l 1ii

c

Newly synthesized d a u g h t e rs t r a n d

Cells use nucleotide excision repair to fix DNA regions containing chemically modified bases,often called chemical addwcts,that distort the normal shapeof DNA locally. A key to this type of repair is the ability of certain proteins to slide along the surfaceof a double-strandedDNA molecule looking for bulgesor other irregularities in the shapeof the double helix. For example, this mechanism repairs thyminethymine dimers, a common type of damage caused by UV light (Figure 4-38); thesedimers interfere with both replication and transcription of DNA.

lvtsxo\

-iil

!ll;l iilli

N u c l e o t i d eE x c i s i o nR e p a i r sC h e m i c aAl d d u c t s T h a t D i s t o r tN o r m a lD N A S h a p e

\

MLHl endonuclease, PMS2

a DNAhelicase DNAexonuclease

j

3' .-i- .,',,,"*.],--r,-'--;-"i,- 5,

3'd.

**5'

G a p r e p a i rb y D N A p o l y m e r a s ea n d l i g a s e

5',

l!. iri

3,h

3',

:liilai

ill||-fr

lllti:

Figure 4-39 illustrates how the nucleotide excisionrepair system repairs damaged DNA. Some 30 proteins are involved in this repair process,the first of which were identified through a study of the defectsin DNA repair in cultured cellsfrom individuals with xeroderma pigmentosum,a hereditarydiseaseassociatedwith a predisposition to cancer.Individuals with this diseasefrequently develop the skin cancers called melanomas and squdmous cell carcinomasif their skin is exposedto the UV rays in sunlight. Cells of affected patients lack a functional nucleotide excision-repair system. Mutations in any of at least seven different genes, called XP-A through Xp-G,

FIGURE 4-37 Mismatchexcisionrepairin humancells.The mismatch excision-repair pathway corrects errorsintroduced during replication A complex of the MSH2andMSH6proteins (bacterial MutShomologs 2 and6) bindsto a mispaired segment of DNAin sucha wayasto distinguish between thetemplate anonewty synthesized (steptr) Thistriggers daughter strands bindingof MLH.j andPMS2(bothhomologs of bacterial MutL)Theresulting DNAproteincomplex thenbindsan endonuclease thatcutsthe newly synthesized daughter strandNexta DNAhelicase unwinds the helix, andan exonuclease removes several nucleotides fromthecutendof the daughter strand,including the mismatched base(stepf,l) Finally, aswith baseexcision repair, thegapisthenfilledin by a DNA (Pol6, in thiscase) polymerase andsealed (stepS) by DNAligase

",x"

Deo

@ Oeo"yriU\e

Two thymine residues

and daughter strands; then the mispaired segmentof the daughter strand-the one with the replication error-is excisedand repaired to becomean exact;omplement of the templatestrand (Figure4-37).In contrastto baseexcisionrepair, mismatch excision repair occurs after DNA replication.

J,""Y,1,,"" o..

ouo*u.x"

Predispositionto a colon cancerknown as bereditary nonpolyposiscolorectalcancerresultsfrom an inherited loss-of-function mutation in one copy of either the MLHL or the MSH2 gene. The MSH2 and MLH1 proteins are essentialfor DNA mismatch repair (seeFigure 4-37). Cells with ar least one functional copy of each of these

H

@

o"o,.rx" 1..t

"

CH.

Thymine-thyminedimer residue

mon in noninherited forms of colon cancer.I 148

CHAPTER 4

|

FIGURE4-38 Formation of thymine-thymine dimers. The most commontype of DNA damagecausedby UV irradiation, thymine-thymine drmerscan be repairedby an excision-repair mechanism

BASTC M O L E C U L AG R E N E T TM CE C H A N T S M S

6VL

N O U _ V N l S n o f l uC N V U r v d l u V N C

'uorlJaslxeu (uoqrzutquo)at 'utsru oql snoSoloruoq tred sE possnJsrps Jo 'suorlElnrualnporlur uer rSELuEp -Eqreru yNC PuoreseqJ Io rreder ,\\oLIJo rldurexe euo sr uorto]oplrua8€tnru dlqrssod E r{f,nsJo uoueuroC '(69-g ernSrg)rurod SururoIeqr re srred eseq ]EJeAesJo ssol ur stlnser dlqerre,Lurssarord -rredaraql 'aruosouorqf, erues oql urory euoc stueru8eJ; VNC paurol eqt Jr ue^e fauord-rorre sr ssaco.rdsrql 'salnJaloruVNC o,ll.l 'Sururol-pua to spua snoSolotuoquou agl Sururoforso^lo^ur sno8o1outoquou'stJJsrLreS.ro relnllarrllnu ur s>leeJgpueJts -alqnop Sur.rrederroJ rusrueqreu tueurruope.rdoq1 'sIEOJq puErls-a]qnop rredar ot pe^lo^a aaeg suats.,(so,4AI 'passardxa sr eua8 reqt qrrq,^ ur addl 'oue8 reqtoue uor8a.rSurpooeql IIar ro le^el eqt Sur8ueqo 1o ot .{trurxord esolr otur aua8auo;o :atouo;d aqr Surrqplnoc luaua8ue.r.reeJ IeuosoruoJqf, € ro leruenbes pr)E ourrue luore;Jrp dlareldruoc e yo uorlrod lpurrural-J eqt ol pesnt ecuanbasprlp ourue auo ]o uoruod leuru.ret-51eqr ro; sepol legl aua8..ppqdq,,e elearf,plnoc Sururo[]cerrocur'aldruexa .rog 'saue8;o Suruorlcunt oqt tJeJJEuEtr terlt stuaua8uerre -er Ieruosoruorqcsso.r8ot peal uer VNC Jo spuerts elqnop dlJeln]rued ;o Sururo[a.rlJarrofur osnef,oqsuorsol aJOAas erp asaqJ 'VNC ul slearq puerts-elqnopesners8nrp raruer -rtue eurospue (uorterpe-r-l{" pue -x '3'e) uorlerpprSurzruol

v Nc u ! sle er gp ue rls- elqnoo redeu ol uorleurquo)auoz!lllnsuols^So^,\l '6g-7 ern8rg ur palcrdap g q8norqr sdalsJo suorrreer aqt pue 'HIIJJ ! 'turod xllaq VNC orlt Jo SuruodosreS teqt te Jo tueurlrnner -3rn srql iaserarudlod eqr 01 pelrufar sl 'gSJ 'uratord VNU '(raurp aunudql-eurudqlr ''3'a) vNC uo uorsele le ]lerusE pelletssauoreq aseraudlodVNU up;r 'uatsds srql u1 'suor8 -er leJrtrrf tsotu aql ot suoJto rreda.rstre.rrp.{1ruenr1;arred -a.rpaldnoc-uortdrrcsuert'selod.re>1ne raq8rq ur IIer auo due ur paqrrJsue.rlsr etuoua8 erlt Jo uortrer; Iletus e dluo acur5 ',updat palrlnot-uotlir.tcsua4 pollel-os-suorBa.r peqrrcs -uerluou ur uerll dle.trtoe Suraq euouaS eql ;o peqrrrsuert .raq8rq suor8a.rur el€J JetsEJqlnru e le parredarsr salodJ€>lne ur a8eruepVNC leql uortelrasqoeqt urpldxedleq deu rred

_er puB uorldr'su€' ur slrunqns vNC orr",Ir1:,ii; rrrH,,ru a;rnbar teqt sesserordreln1lecfuareJJrpoznl ul dlquresseural -ord e repurs seq ernleu pasn leql sreedde\'(I€-L a.rn8rg 'etrs aas)alertrurot ese;atu^,(1od VXU 8ur,rno11e trels aql te xllaq VNC eqt spur,\\unHII{J.;o dlrarrreaserrloqaqt 'uon -drrrsuul q'6€-V a;n8rg ur u.^oqs se'saserrlaqor ^(8o1our -orl aAEqslrunqns oser{r o./![ 'sllal crtodrelna ur .rredar Jo uorsrrxeeprtoepnu ro; parrnbaros]Eore'(19-1 ern8rl aas)

'nAZ lareqls awaq) alpueMabuV O lgV6ZtZn petdepVJ(tr do]s) pue'99t: ! l,t arnleN' IOOZ'sraleLrlreop 1u.ror1 u u t u t e u t aarq t p u e ' u o r l e l t ; d eVr N C u l s e e s e 6 ry1p 6 { q p a l e e s t > 1 t t 6 y56 {q petttJst de6 eq} ril;eut3saptloal)nuouoLx eseraur[1od l{1]>exe 'seseqpebeL-uep oq] qtlM luauOetl o1 peper6apsr q)rqM slqf (E dels)uorsalaq],to oplsqlee uo Uede VNC oq] sosealar puo)os oq] ]n) 'aseal)nuopuo saseqZ€-vZ slurod1epuetlspe6euLep ue se 6ut1leMou) D-dX uaql (E dols) e l-dx pue (aseol)nuopuo pue pulMUn potLlro+ sl soseqEZ=+o0lqqnqe lllun xll0qoqi 0z!llqelsap roqunj pue xelduor oql ol purq uaq] suralordVdUpue g-dx xllaq 'sltunqns 'srs{lorp{q olqnopaql putMUn,411eryed 61y Iq patannod 'HllJI lo1te1uotldtllsuei]s]lnllal ueqi xaldLlol ase)rloqosoqM slql (U dals)suralotdB€Zpue (urelord3 Lunsoluaubtderutepotax) eutulql I;1er1rur sl 'roLulp )-dX aql 1o xeldulote {q paztubo>er 'xrloqolqnopaq] uoruolslpsasne) e se q)ns leql uolsalvNC +o V'slle) ueunq ul ltedal uo!s!)xe ePlloal)nN 5€'t lun9lJ V yp6 edAl-p1t6

j,., j.,ILj-,11-LLL; ,,.-1,-.,

t

**t"-,n

VN8 ltr ".,,";1:3J I

.9

.€

VV

, .i'**.,n

,r"-;,-i'- ,s ln3 g-dx

lnc J-dx

9-dx

t

buruaoO x ! l o qatqnop VNo Jo lI

seua811e;o uorldrrcsueJtrot perrnberroloe; uortdrJ)suerl 'HIIJI, 'dlqelreruaA le.raue8e Jo strunqns aprrdeddlodaar; a ' G t - V e . r n 8 r ga e s )p o o l s -Jepun lle,t^.lAouare rreder uorsrJxeaprloelrnu ur surelord 'seruanbrsuoJaIUES eql o^Eq dX esoqrJo tsoru Jo solor aq1 pue edltouaqd erueseqt ernpo.rd11elunsoluau8rd erurep -oJax esnel pue ruelsls rredar srqt to uonplrtJeur ol peal

Double-strandbreak

vast majority of women with inherited susceptibility to breast cancer have a mutation in one allele of either the rttttttl BRCA-1 or the BRCA-2 genesrhat encodeproteins participating in this repair process.Loss or inactivation of the second allele inhibits the homologous recombination repair pathway and thus tends to induce cancerin mammary or ovarian epithelialcells,although at presentit is not clear why these estrogen-responsive tissuesare favored sites of carcinogenesis. Yeastscan repair double-strandbreaks induced by 1-irradiation. Isolation and analysisof radiationsensitive(RAD) mutants that are deficient in this reoair system facilitated study of the process. Virtually all the proteins a yeast Rad proteins have homologs in the human genome, Jo,n". and the human and yeastproteins function in an essentially identical fashion. A variety of DNA lesions not repaired by mechanisms discussedearlier can be repaired by mechanismsin which the damagedsequenceis replaced by a segmentcopied from the same or a highly homologous DNA sequenceon the homologous chromosome of diploid organisms,or the sister chromosome following DNA replication in all organisms.These mechanismsinvolve an exchange of strands between separate DNA moleculesand henceare collectivelyreferred to as FIGURE 4-40 Nonhomologous end-joining.Whensister D N A r ecombination mechanisms. chromatids arenot available to helprepairdouble-strand breaks, In addition to providing a mechanism for DNA repair, nucleotide sequences arebuttedtogetherthatwerenot apposed in similar recombination mechanismsgenerategeneticdiversity the unbroken DNA TheseDNAendsareusually fromthesame among the individuals of a speciesby causing the exchange chromosome locus,andwhenlinkedtogether, several basepairsare of large regions of chromosomesbetween the maternal and lost Occasionally, endsfromdifferent chromosomes areaccidentally paternal pair of homologous chromosomesduring the spejoinedtogetherA complex of two proteins, KuandDNA-dependent cial type of cellular division that generatesgerm cells (sperm protern kinase, bindsto theendsof a double-strand break(steptr) and eggs),meiosis (Figure 5-3). In fact the exchange of reAfterformation of a synapse, the endsarefurtherprocessed by gions of homologous chromosomes,called crossing over, is nucleases, resulting in removal (stepE), andthetwo of a few bases required for proper segregationof chromosomesduring the double-stranded molecules areligatedtogether(stepB) Asa result, first the double-strand meiotic cell division. Meiosis and the consequencesof breakis repaired, but several basepairsat thesite of the breakareremoved[Adapted generating new combinations of maternal and paternal fromG Chu,1997, J Biot Chem 272:24097; M Lieber et al, 1997,Curr. geneson one chromosome by recombination are discussed OpinGenet. Devel. T:99;andD van G a n t e t a l , 2 O O 1 ,N a t u r eR e v .G e n e t 2 : 1 9 6 I further in Chapter 5. The mechanismsleading to proper segregation of chromosomes during meiosis are discussedin Chapter 20. Here we will focus on the molecular mechanisms of DNA recombination, highlighting the exchangeof DNA strands betweentwo recombining DNA molecules.

TTTTTTTTTT

TTTTTTTTTT

chromosome to another. Such translocations may generare chimeric genesthat can have drastic effects on normal cell function, such as uncontrollable cell growth, which is the hallmark of cancer.The devastatingeffectsof double-strand breaks make this the "most unkindest cut of all," to borrow a phrase from Shakespeare's Julius Caesar.

H o m o l o g o u sR e c o m b i n a t i oC n a n R e p a i rD N A Damageand GenerateGeneticDiversity

150

.

cHAprER 4

|

Repair of a Collapsed Replication Fork An exampleof recombinationalDNA repair is the repair of a "collapsed,'replication fork. If a break in the phosphodiesterbackboneof one DNA strand is not repaired before a replication fork passes, the replicatedportions of the daughterchromosomesbecome separatedwhen the replication helicasereachesthe ,,nick,, in the parental DNA strand becausethere are no covalent bonds between the two fragments of the parental strand on either side of the nick. This processis called replication fork collapse (Figure4-41, stepn). If it is not repaired,it is generallylethal to at leastone daughtercell following cell division becauseof the loss of genetic information between the nick and the end of the chromosome.The recombination processthat repairs the resultingdouble-strandedbreak and regenerat.s r.pli."" tion fork involves multiple enzymesand other proteins, only some of which are mentionedhere.

B A s t cM o L E c u L A G R E N E T tMc E C H A N t s M s

DNAnick

5', 3',

I

I ll I Y

s'-e*onrcleaseacts on brokenend. Other daughter strand (pink)ligatedto repairedparentalstrand ( l i g h tb l u e )i n u n b r o k e n chromosome. 5', 3',

Jo

RecA-or Rad51-mediated strand invasion

Hollidaystructure

\--*

3' Ligateends

J

R e b u i l dr e p l i c a t i o fno r k a n d c o n t i n u er e p l i c a t i o n

(Figure 4-41.,steptr ). The lagging nascentstrand (pink) created on the unnicked, homologous' parent strand is ligated to the unreplicated portion of the parent chromosome, as shown in Figure 4-41, step Z). A critical protein required for the next step is RecA in bacteria, or the homologous Rad51 in S. cereuisiae and other eukaryotes. Multiple RecA/RadS1 molecules bind to the single-stranded DNA (now considered the invading strand) and catalyze its hybridization to a perfectly or nearly perfectly complementary sequencein another, homologous, double-strandedDNA molecule, either the ligated molecule created after fork collapse (as shown in the figure) or the other homologous chromosome in diploid organisms.The other strand (dark blue) of this target double-stranded DNA (the strand not basepairing with the invading strand) is displaced as a singlestranded loop of DNA along the region of hybridization between its complement and the invading strand (refer to Figure 4-4L, step B). The RecA/RadS1-catalyzedinvasion of a duplex DNA by a single-strandedcomplement of one of the strands is key to the recombination process. Since no basepairs are lost or gained in this process,calledstrand inuasion,it doesnot requirean input of energy. Next, the hybrid region between target DNA (pink) and the invading strand (dark red) is extended in the direction away from the break by proteins that use energy from ATP hydrolysis. This process is called branch migration (Ftgure 4-41,, step 4) becausethe point at which the target DNA strand (pink) crossesfrom one complementary strand (dark blue) to its complement in the broken DNA molecule (dark red), is called a branch in the DNA structure. In this diagram, the diagonal lines represent only one phosphodiesterbond. Molecular modeling and other studiesshow that the first baseon either side of the branch is base-pairedto a complementary nucleotide. As this branch miSrates to the Ieft, the number of base pairs remains constant; one new base pair formed with the (red) invading strand is matched by the loss of one base pair with the parental (dark blue)

strand. When the region of hybridization extends beyond the 5' 3', end of the broken strand (light blue), this broken parental DNA strand becomes increasingly single-stranded, as its repairof a collapsed A FIGURE 4-41 Recombinational complement, the invading (dark red) strand' base-pairsinfork. Parental strands arelightanddarkblueTheleading replication steadwith the target (pink) DNA strand. This single-stranded pink. red, lagging daughter strand is dark and the daughter strand (light blue) parcntal strand then base-pairswith the complephosphodiester mentary region of the other parental strand (dark blue) that represent a single linesin stepB andbeyond Diagonal colorSmallblack bondfromtheDNAstrandof theconesponding has likewise become single-strandedas the branch migrates of the phosphodiester cleavage [email protected] represent to the left (Figure 4-41., step 4). The resulting structure is See in the Holliday structure. of DNAstrands bondsat the crossover called a Hotliday strwcture, after the geneticist who first prornalVm bb/ruva. htmI f or an animationof sdscedu/jou http://www. posed it as an intermediatein Seneticrecombination. Again, RuvAandRuvB. See catalyzed by E coliproteins branchmigration the diagonal lines in the diagram following step 4 represent genetics.wisc.edu/Holliday/holliday3D htmlfor an http://engels single phosphodiesterbonds (not a stretch of DNA), and all Seethetextfor a of theHolliday structure anditsresolution animation basesin the Holliday structure are base-pairedto compleLehninger fromD L Nelson andM M Cox,2005, discussion. [Adapted mentary basesin the parental strands. Cleavageof the phos4thed, W H Freeman andCompany.l of Biochemistry Principles phodiesterbonds that crossover from one parental strand to ' the other and ligation of the 5' and 3 ends base-pairedto the The first step in the repair of the double-strand break is same parental strands (stepsE and 6) result in the generaexonucleolytic digestionof the strand (light blue) that has its (dark tion of a structure similar to a replication fork. Rebinding of red) 5' end at the break, leaving a portion of the other replication fork proteins results in extension of the leading (the single-stranded one with the 3' end at the break) strand D N A R E P A I RA N D R E C O M B I N A T I O N

151

Jn

Ends digestedby exonucleases,leaving 3 ' s i n g l e - s t r a n d eedn d s

RecA-or Rads1-mediated strand invasion

!

3 ' e n d o f i n v a d i n gs t r a n di s e x t e n d e db y D N A p o l y m e r a s eu n t i lt h e d i s p l a c e d single-strand(dark blue) base-pairswith the other 3' single strand generated i n i t i a l l y( p i n k )

A a e n di s e x t e n d ebdy D N Ap o l y m e r a s e J

Ends are ligated

l I

Jo

I

Cleavephosphodiesterbonds indicated with arrows and ligatealternativeends

A FIGURE 4-42 Double-strand DNAbreakrepairby homologousrecombination. Forsimplicity, eachDNAdoublehelix is represented by two parallel lineswith the polarities of the strands indicated by arrowheads at their3, endsTheuppermolecule hasa double-strand breakNotethat in the diagram of the upperDNA strand past the point of the original strand break and reinitiation of lagging-strandsynthesis(step Z), thus regenerating a replication fork. The overall processallows the undamagedupper strand in the lower molecule following step E (pink/light blue) to serveas template for extensionof the leading (dark red) strand in step Z. Double-Stranded DNA Break Repair by Homologous Recombination A similar mechanism called bomolopous 152

o

c H A p r E4R |

molecule the strandwith its3' endat the rightison thetop,whilein thediagram of the lowerDNAmolecule thisstrandisdrawnon the bottom Seethetextfordiscussion. L Orr-WeaverandJ W [AfterT. Szostak, 1985,MicrobiolRev. 49:33.1 recombination can repafua double-strand break in a chromosome and can also exchangelarge segmentsof two double-strandedDNA molecules (Figure 4-42). Homologous recombination is also dependenton strand invasion catalyzed principally by RecA in bacteriaand Rad51 in eukaryotes(steps Il and tr). The 3' end of the invading DNA strand is then extended by a DNA polymerase,displacingthe parental strand as an enlargingsingle-stranded loop of DNA (dark blue, step E). Vhen DNA synthesis extends sufficiently far, the displaced

B A s t cM o L E c u L AGRE N E TM t cE c H A N t s M s

parentalstrand (dark blue)that is complementaryto the 3' single-strandedregion generatedat the other broken end of DNA (the pink single-stranded region on the left following step n), base-pair(step B). This 3' end the complementarysequences (pink) is then extendedby a DNA polymerase,using the displaced single-strandedloop of parental DNA (dark blue) as template(step4). Next, the two 3' ends generatedby DNA synthesisare ligated(stepE)to the 5'ends generatedin step I by 5'-exonucleasedigestion of the broken ends. This generatestwo Holliday structuresin the paired molecules(stepE).Branch migration of theseHolliday structurescan occur in either direction (not diagrammed).Finally, cleavageof the strands at the positions shown by the arrows, and ligation of the alternative 5' and 3' ends at each cleavedHolliday structure generatestwo recombinant chromosomesthat each contain the DNA of one parental DNA molecule (pink and red strands) on one side of the break point and the DNA of the other parental DNA molecule (light and dark blue) on the other sideof the break point (step6). Eachchromosomecontains a third region, located in the immediate vicinity of the initial break point, that forms a heterodwplex;here one strand from one parent is base-pairedto the complementary strand of the other parent (pink or red base-pairedto dark or light blue). Base-pair mismatches between the two parental strandsare usually repairedby repair mechanismsdiscussed above to generatea complementary basepair. In the process, sequencedifferencesbetween the two parents are lost, a processreferredto as geneconuersion. Figure 4-43 diagrams how cleavageof one or the other pair of strandsat the four-way strand junction in the Holliday structure generatesparental or recombinant molecules.This process,calledresolution of the Holliday structure,separates DNA molecules initially joined by RecA/RadS1-catalyzed strand invasion. Each Holliday structure in the intermediate following step El of Figure 4-42 can be cleavedand religated in the two possibleways shown by the two setsof small black arrows. Consequently,there are four possibleproducts of the

recombination process.Two of theseregeneratethe parental chromosomes(with the exceptionof the heteroduplexregion at the break point that is repaired into the sequenceof one parent or the other (geneconversion),and t'wo generaterecombinant chromosomesas shown inFigure 4-42. Meiotic Recombination Meiosis is the specializedform of cell division in eukaryotesthat generateshaploid germ cells (e.g.,sperm and eggs)from a diploid cell (Figure 20-38). At least one recombination occurs between the paternal and maternal homologous chromosomesbefore the first meiotic cell division. Recombination is initiated by an enzyme that makes a double-strandedbreak in the DNA of one chromosome at any one of a very large number of sites.The process diagrammed in Figure 4-42 is then followed. The entire process from cleavageof the DNA of one chromosome through resolution of the Holliday structuresis repeateduntil at least one recombination, also called a crossouer'occurs between one pair of each of the homologous chromosomes. As mentioned earlier,the resulting link betweenhomologous chromosomesis required for their proper segregationduring the first meiotic cell division (seeChapter 20). As a consequence,every germ cell contains multiple recombinant chromosomes made of large segmentsof either the maternal or the oaternal chromosome.

DNA Repair and Recombination Changesin the DNA sequenceresult from copying errs and the effects of various physical and chemical agents. r Many copying errors that occur during DNA replication are corrected by the proofreading function of DNA polymerasesthat can recognize incorrect (mispaired) basesat the 3' end of the growing strand and then remove them by activity (seeFigure4-34). an inherent3'-+5' exonuclease

E

3'

5',

5',

--.: |

5',

3',

I

t AI 4-43 Alternativeresolutionof a Hollidaystru€ture. FIGURE bond.lt linesrepresent a singlephosphodiester Diagonal andvertical the diagram of the by rotating to diagram the process issimplest have 180'sothatthetop andbottommolecules bottommolecule Cuttinqthe bondsasshownin Il and the samestrandorientations

chromosomes theoriginal regenerates theendsasindicated ligating asshownat the asshownin E andreligating Cuttingthe strands Seehttp://engels chromosomes recombtnant bottomgenerates for a three-dimensional genetics.wisc.edu/Holliday/holliday3D.html anditsresolution structure of the Holliday animation AND RECOMBINATION O DNA REPAIR

153

r Eukaryotic cells have three excision-repair systemsfor correcting mispaired basesand for removing W-induced thymine-thymine dimers or large chemical adducts from DNA. Base excision repair, mismatch repair, and nucleotide excision repair operate with high accuracy and generally do not introduce errors. r Repair of double-strand breaks by the nonhomologous end-joining pathway can link segmentsof DNA from different chromosomes, possibly forming an oncogenic translocation. The repair mechanismalso producesa small deletion, even when segmentsfrom the same chromosome are joined. r Inherited defectsin the nucleotideexcision-repairpathway, as in individuals with xeroderma pigmentosum, predisposethem to skin cancer.Inherited colon cancer frequently is associatedwith mutant forms of proteins essentialfor the mismatch repair pathway. Defects in repair by homologous recombination are associatedwith inheritanceof one murant alleleof the BRCA-1 or BRCA2 gene and result in predispositionto breast and uterine cancer. r Error-free repair of double-strand breaks in DNA is accomplished by homologous recombination using the undamaged sister chromatid as a template. This processcan lead to recombination of parental chromosomesand is exploited by eukaryotes to generate genetic diversity by recombination of paternal and maternal chromosomes in developinggerm cells.

of the Cellutar Wl Viruses:Parasites GeneticSystem Virusesare obligate,intracellularparasites.They cannot reproduce by themselvesand must commandeera host cell's machineryto synthesizeviral proteins and in some casesto replicate the viral genome. RNA viruses, which usually replicate in the host-cell cytoplasm, have an RNA genome, and DNA viruses,which commonly replicate in the hostcell nucleus, have a DNA genome (seeFigure 4-1). Viral genomesmay be single-or double-stranded,dependingon the specific type of virus. The entire infectious virus particle, called a virion, consistsof the nucleicacid and an outer shell of protein that both protects the viral nucleic acid and functions in the processof host-cell infection. The simplest viruses contain only enough RNA or DNA to encode four proteins; the most complex can encode=200 proteins. In addition to their obvious importanceas causesof disease,viruses are extremely useful as researchtools in the study of basic biological processes,such as thosediscussedin this chaoter.

Most Viral Host RangesAre Narrow The surfaceof a virion contains many copies of one type of protein that binds specificallyto multiple copies of a receptor protein on a host cell. This interaction determines the

154

CHAPTER 4

|

host range-the group of cell types that a virus can infectand beginsthe infection process.Most viruses have a rather limited host range. A virus that infects only bacteria is called a bacteriophage, or simply a phage. Viruses that infect animal or plant cells are referred to generally as animal uiruses or plant uiruses.A few viruses can grow in both plants or animals and the insects that feed on rhem. The highly mobile insects serve as vectors for transferring such viruses between susceptibleplant or animal hosts. Wide host ranges are also characteristicof some strictly animal viruses,such as vesicularstomatitis virus, which grows in insect vectors and in many different types of mammals. Most animal viruses,however, do not cross phyla, and some (e.g.,poliovirus) infect only closely related speciessuch as primates. The host-cell range of some animal viruses is further restricted to a limited number of cell types because only these cells have appropriare surface receptors to which the virions can attach.

V i r a l C a p s i d sA r e R e g u l a rA r r a y so f O n e o r a Few Typesof Protein The nucleic acid of a virion is enclosedwithin a protein coat, or capsid, composed of multiple copies of one prorein or a few different proteins, each of which is encoded by a single viral gene.Becauseof this structure, a virus is able to encode all the information for making a relatively large capsid in a small number of genes.This efficient use of geneticinformation is important, since only a limited amount of DNA or RNA, and therefore a limited number of genes,can fit into a virion capsid. A capsid plus the enclosednucleic acid is called a nucleocapsid. Nature has found two basic ways of arranging the multiple capsid protein subunits and the viral genome into a nucleocapsid.In some viruses,multiple copies of a single coat protein form a helical structure that enclosesand protects the viral RNA or DNA, which runs in a helical groove within the protein tube. Viruses with such a helical nucleocapsid, such as tobacco mosaic virus, have a rodlike shape (Figure 4-44a). The other major structural type is based on the icosahedron, a solid, approximately spherical object built of 20 identical faces,each of which is an equilateral triangle (Figure 4-44b). During infection, some icosahedral viruses interact with host cell-surfacereceptors via clefts in between the capsid subunits; others interact via long fiberlike proteins extending from the nucleocapsid. In many DNA bacteriophages,the viral DNA is located within an icosahedral "head" that is attached to a rodlike "tail." During infection, viral proteins at the tip of the tail bind to host-cellreceptors,and then the viral DNA passesdown the tail into the cytoplasm of the host cell (Figure 4-44c). In someviruses,the symmetricallyarrangednucleocapsid is coveredby an external membrane,or envelope,which consistsmainly of a phospholipid bilayer but also conrains one or two types of virus-encodedglycoproteins (Figure 4-44d).

BASTC M O L E C U L AG R E N E T TM CE C H A N T S M S

Poliovirus

Tobaccomosaicvirus (c)

(d)

50 nm

50 nm

A v i a n i n f l u e n z av i r u s

(a)Helical vlrus tobaccomosaic 4-44 Virionstructures. < FIGURE ( b )S m a li lc o s a h e dvr a i rlu sT h ee x a m p lseh o w ni sp o l i o v i r u s . of an enveloped virus,an example (c)Bacteriophage Ta (d)Influenza part(b) Library; Photo (a)O Bradfute, Arnold/Science Peter virus[Part Biozentrum/ (c) of Microbiology, part Department of T S Baker; courtesy t oe s e a r c h e rl sn,c l S c l e n c eP h o t oL i b r a r yp; a r t ( d ) J a m e sC a v a l l i n i / P h o R

T4 Bacteriophage

The phospholipidsin the viral envelopeare similar to thosein the plasmamembraneof an infectedhost cell.The virai envelope is, in fact, derivedby budding from that membrane,but contains mainly viral glycoproteins,as we discussshortly.

V i r u s e sC a n B e C l o n e da n d C o u n t e d i n P l a q u eA s s a y s The number of infectiousviral particlesin a samplecan be quantifiedby a plaque assay.This assayis performedby culturing a dilute sample of viral particleson a plate covered with host cells and then counting the number of local Iesions,called plaques,that develop (Figure 4-45). A plaque developson the plate wherevera singlevirion initially infects

a singlecell. The virus replicatesin this initial host cell and then lyses(ruptures)the cell, releasingmany progenyvirions that infect the neighboring cells on the plate. After a few such cyclesof infection, enough cells are lysed to produce a visibleclear area,the plaque,in the layer of remaininguninfectedcells. Sinceall the progeny virions in a plaque are derived from a single parental virus, they constitute a virus clone. This type of plaque assayis in standardusefor bacterialand animal viruses.Plant virusescan be assayedsimilarly by counting local lesions on plant leavesinoculated with viruses. Analysis of viral mutants' which are commonly isolated by plaque assays,has contributedextensivelyto current understandingof molecularcellularprocesses.

SYSTEM RENETIC V I R U 5 E SP: A R A S I T EOSF T H E C E L L U L A G

155

(a)

Confluentlayer of susceptiblehost cells growing on surfaceof a plate

A d d d i l u t es u s p e n s i o nc o n t a i n i n gv i r u s ; after infection,cover layer of cells with agar; incubate Plaoue

3. Replication-Yiral mRNAs are produced with the aid of the host-cell transcription machinery (DNA viruses)or by viral enzymes(RNA viruses).For both types of viruses, viral mRNAs are translated by the host-cell translation machinery. Production of multiple copies of the viral genome is carried out either by viral proteins alone or with the help of host-cell proteins. 4. Assembly-Yiral proteins and replicated genomesassociate to form progeny virions. 5. Release-Infected cell either ruptures suddenly (lysis), releasingall the newly formed virions at once, or disintegratesgraduallS with slow releaseof virions. Both cases lead to the death of the infected cell.

Eachplaque representscell lysis initiatedby one viral particle(agar restrictsmovement so that virus can infectonly contiguouscells)

Figure 4-46 rllustratesthe lytic cycle forT4 bacteriophage,a nonenveloped DNA virus that infects E. coli. Viral capsid proteins generally are made in large amounts becausemany

Freevirion

E. coli

chromosome

Xffi;ffi["-E a nn d d iinn i aj ne f ic n nt i o n a

EsE *?

,

/

/.. ,, 'll

l

l.: .T4DNA

Plaque

A EXPERIMENTAL FTGURE 4-45 The plaqueassaydetermines the numberof infectiousparticlesin a viral suspension. (a)Each lesion, or plaque, whichdevelops wherea singlevirioninitially infected a singlecell,constitutes a pureviralclone.(b)plaques on a lawnof Pseudomonasfluorescens bacteriamadeby bacteriophage polytechnique of Dr Pierre Rossi, $S1 [Part(b)Courtesy Ecole F6d€rale de (LBE-EPFL) Lausanne l Replication of viralDNA Expression of virallateproteins

LyticViral Growth CyclesLeadto the Death of Host Cells Although details vary among different types of viruses,those that exhibit a lytic cycle of growth proceed through the following general stages: l, Adsorption-Virion interacts with a host cell by binding of multiple copies of capsid protein to specificreceptors on the cell surface. 2. Penetration-Yiral genome crossesthe plasma membrane. For some viruses,viral proteins packagedinside the capsid also enter the host cell.

155

C H A P T E R4

|

A FIGURE 4-46 tytic replicationcycleof a nonenveloped, bacterialvirus.E.colibacteriophage T4 hasa double-stranded DNA genomeandlacksa membrane envelope Afterviralcoatproteins at thetip of thetailin T4 interact with specific receptor proteins on the exterior of the hostcell,theviralgenomeisinjected intothe host (stepIl). Host-cell enzymes thentranscribe viral"early"genesinto mRNAs andsubsequently translate theseintoviral"early"proteins (stepZ) Theearlyproteins replicate theviralDNAandinduce expression of viral"late"proteins (stepS) The by host-cell enzymes virallateproteins include capsid andassembly proteins andenzymes thatdegrade the host-cell DNA,supplying nucleotides for synthesis of moreviralDNA Progeny virions areassembled in thecell(stepZl) (step5) whenviralproteins andreleased lysethecell.Newly liberated viruses initiateanothercycleof infection in otherhost ceils

B A S t CM O L E C U L A RG E N E T T M C ECHANTSMS

Rabiesvirus *

N u c l e o c a p s i dp r o t e i n Matrixprotein

't

R e c e p t o r - b i n d i nggl y c o p r o t e i n

o V i r a lR N A p o l y m e r a s e

arOOinS $ V i r u s r e c e p t o r C e l lm e m b r a n e

;{b :'

I'

i

':

..,/ Cytosol

\enoo"vtori.

I Transnort fl

M a t r i xa n d n u c l e o c pa s i d synthesrs

A { Replication h' l.

t ER

.{

Transcription Nucleus

E# Release

FIGURE4-47 Lytic replication cycle of an enveloped, animal e dN A v i r u s . R a b i evsi r u si s a n e n v e l o p evdi r u sw i t h a s i n g l e - s t r a n d R genome The structuralcomponentsof this virusare depictedat the top After a virionadsorbsto multiplecopiesof a specifichost membraneprotein(steptr), the cellengulfsit in an endosome ( s t e pE ) A c e l l u l apr r o t e i ni n t h e e n d o s o m em e m b r a n ep u m p s H* ionsfrom the cytosolinto the endosomeinterior.The resulting s c o n f o r m a t i o n cahl a n g ei n t h e d e c r e a sien e n d o s o m apl H i n d u c e a leadingto fusionof the viralenvelopewith the viralglycoprotein, r e m b r a n ea n d r e l e a soef t h e n u c l e o c a p s i d e n d o s o m al il p i db i l a y em uses into the cytosol(stepsB and 4) ViralRNApolymerase in the cytosolto replicatethe viralRNA ribonucleoside triphosphates genome(stepE) and to synthesize viralmRNAs(step6) One of the glycoprotein, which is viralmRNAsencodesthe viraltransmembrane ( E R a) s i t i s r n s e r t e idn t o t h e m e m b r a n eo f t h e e n d o p l a s m ri ce t i c u l u m

(stepZ). Carbohydrate isadded ribosomes on ER-bound synthesized t h e i n s i d e E Rl u m e na n di sm o d i f i eads t o t h el a r g ef o l d e dd o m a i n passthroughthe glycoprotein andtheassociated the membrane fuse (stepE) Vesicles with matureglycoprotern Golgiapparatus on the viralglycoprotein depositing membrane, with the hostplasma the cell domainoutside withthe largereceptor-binding cellsurface on host-cell aretranslated (step9) Meanwhile, otherviralmRNAs andviralRNA protein, matrixprotein, intonucleocapsid ribosomes with replicated areassembled polymerase GtepIE). Theseproteins nucleocapsids GtepI[), RNA(brightred)intoprogeny viralgenomic domainof viraltransmembrane withthecytosolic whichthenassociate (stepIE) Theplasma membrane in the plasma glycoproteins t h en u c l e o c a p sf oi dr ,m i n ga " b u d "t h a t m e m b r a ni sef o l d e da r o u n d (stePIE) isreleased eventually

copiesof them are requiredfor the assemblyof eachprogeny virion. In eachinfectedcell, about 100-200 T4 progenyvirions are producedand releasedby lysis. The lytic cycle is somewhatmore complicatedfor DNA virusesthat infect eukaryoticcells.In most suchviruses,the DNA genome is transported (with some associated proteins)into the cell nucleus.Once inside the nucleus,the viral DNA is transcribedinto RNA by the host'stranscription machinery.Processingof the viral RNA primary transcript by host-cell enzymesyields viral mRNA, which is transportedto the cytoplasmand translatedinto viral pro-

teins by host-cellribosomes,tRNA, and translationfactors. The viral proteins are then transported back into the nucleus,where some of them either replicate the viral DNA directly or direct cellular proteinsto replicatethe viral DNA' as in the case of SV40 discussedearlier.Assembly of the capsid proteins with the newly replicated viral DNA occurs in the nucleus,yieldingthousandsto hundredsof thousands of progenyvirions. Most plant and animal viruseswith an RNA genome do not require nuclear functions for lytic replication. In some of these viruses, a virus-encoded enzyme that enters the host

G E N E T I CS Y S T E M SF T H E C E L L U L A R V I R U S E SP: A R A S I T EO

157

d u r i n g p e n e t r a t i o n t r a n s c r i b e st h e g e n o m i c R N A i n t o mRNAs in the cell cytoplasm. The mRNA is directly translated into viral proteins by the host-cell translation machinery. One or more of theseproteins then produces additional copies of the viral RNA genome. Finally, progeny genomes are assembledwith newly synthesizedcapsid proteins into p r o g e n yv i r i o n si n t h e c y t o p l a s m . After the synthesisof hundreds to hundreds of thousandsof new virions has beencompleted,dependingon the type of virus and host cell, most infecredbacterialcellsand some infectedplant and animal cellsare lysed,releasingall the virions at once. In many plant and animal viral infections, however, no discretelytic event occurs; rather, the dead host cell releasesthe virions as it gradually disintegrates. As noted previously,envelopedanimal virusesare surrounded by an outer phospholipid layer derived from the plasma membrane of host cells and containing abundant viral glycoproteins. The processesof adsorption and release of envelopedviruses differ substantially from these p r o c e s s e sf o r n o n e n v e l o p e dv i r u s e s . T o i l l u s t r a t e l y t i c replication of enveloped viruses, we consider the rabies v i r u s , w h o s e n u c l e o c a p s i dc o n s i s t so f a s i n g l e - s t r a n d e d RNA genome surrounded by multiple copies of nucleocapsid protein. Like most other lytic RNA viruses,rabies virions are replicated in the cytoplasm and do not require host-cell nuclear enzymes.As shown in Figure 4-47, a rabies virion is adsorbedto a host cell by binding to a specific cell-surfacereceptor moleculeand then entersthe cell by endocytosis.Progeny virions are releasedfrom a host cell by budding from the host-cellplasma membrane.Budding virions are clearly visible in electron micrographs of infected cells, as illustrated in Figure 4-48. Many tens of thousands of progeny virions bud from an infected host cell before it dies.

V i r a l D N A l s I n t e g r a t e di n t o t h e H o s t - C e l l G e n o m ei n S o m eN o n l y t i cV i r a l G r o w t h C y c l e s Some bacterial viruses, called temperate phages,can establish a nonlytic associationwith their host cellsthat doesnot kill the cell. For example,when bacteriophageinfectsE. coli, the viral DNA may be integrated into the host-cell chromosome rather than being replicated. The integrated viral DNA, called a prophage, is replicated as part of the cell's DNA from one host-cell generation to the next. This phenomenon is referred to as lysogeny. Under certain conditions, the prophage DNA is activated,leading to its excision from the host-cell chromosome and entrance into the lytic cycle, with subsequentproduction and releaseof progeny vlrtons. The genomesof a number of animal viruses also can rntegrateinto the host-cell genome. One of the most important are the retroviruses,which are envelopedviruses with a genomeconsistingof two identical srrandsof RNA. These viruses are known as retrouiruses because their RNA genome acts as a template for formation of a DNA

158

CHAPTER 4

I

A EXPERIMENTAL FIGURE 4-48 Progenyvirionsare released by budding.Progeny virions of enveloped viruses arereleased by buddingfrominfected cellsIn thistransmission electron micrograph of a cellinfected with measles virus,virionbudsareclearly visible protruding fromthe cellsurfaceMeasles virusisan enveloped RNA viruswith a helical nucleocapsid, likerabies virus,andreplicates as illustrated in Figure4-47 [From A Levine. 1991 Scientific , Viruses, p 221 American tibrary,

molecule-the opposite flow of geneticinformation compared with the more common transcription of DNA into RNA. In the retroviral life cycle (Figure 4-49), a viral enzyme called reversetranscriptaseinitially copies the viral RNA genome into single-strandedDNA complementary to the virion RNA; the same enzyme then catalyzessynthesisof a complementaryDNA strand. (This complex reaction is detailed in Chapter 6 when we consider closely r e l a t e d i n t r a c e l l u l a r p a r a s i t e sc a l l e d r e t r o t r a n s p o s o n s . ) The resulting double-strandedDNA is integrated into the chromosomal DNA of the infected cell. Finally, the integrated DNA, called a provirus, is transcribed by the cell's own machinery into RNA, which either is translated into viral proteins or is packagedwithin virion coat proteins to form progeny virions that are releasedby budding from the host-cell membrane. Becausemost retrovirusesdo not kill their host cells, infected cells can replicate,producing daughter cells with integrated proviral DNA. These daughter cells continue to rranscribe the proviral DNA and bud progeny virions. Some retrovirusescontain cancer-causing genes (oncogenes),and cellsinfectedby suchretrovirusesare oncogenically transformedinto tumor cells.Studiesof oncogenicretroviruses (mostly virusesof birds and mice) have revealeda great deal about the processes that leadto transformationof a normal cell into a cancercell (Chapter25).

BASTC MOLECULAG R E N E T TM CE C H A N T S M S

llll|

overview Animation: Life Cycle of a Retrovirus Genomic ssRNA Retrovirus Host-cell

Reverse transcription

Transportto n u c l e u sa n d integration

I \

*Y

havea genome FIGURE 4-49 Retrovirallife cycle.Retroviruses RNA and an outer copies of single-stranded of two identical interact in the envelope envelopeStep[: Afterviralglycoproteins protein, envelope host-cell membrane the retroviral with a specific membrane, allowing entryof the with the plasma fusesdirectly intothe cytoplasm of the cell StepE: Viralreverse nucleocapsid genomeintoa andotherproteins copytheviralssRNA transcriptase intothe DNA StepB: TheviraldsDNAis imported double-stranded

Among the known human retrovirusesare human Tc e l l l y m p h o t r o p h i c v i r u s ( H T L V ) , w h i c h c a u s e sa form of leukemia, and human immunodeficiency virus ( H I V ) , w h i c h c a u s e sa c q u i r e d i m m u n e d e f i c i e n c y s y n drome (AIDS). Both of these viruses can infect only specific cell types, primarily certain cells of the immune system and, in the caseof HIV, some central nervous system neurons and glial cells. Only these cells have cell-surface receptors that interact with viral envelope proteins, accounting for the host-cell specificity of these viruses.Unlike most other retroviruses,HIV eventually kills its host cells. The eventual death of large numbers of immunesystem cells results in the defectiveimmune response characteristicof AIDS. Some DNA viruses also can integrate into a host-cell chromosome. One example is the human papillomaviruses (HPVs), which most commonly cause warts and other benign skin lesions. The genomes of certain HPV serotypes, however,occasionallyintegrate into the chromosomal DNA of infected cervical epithelial cells, initiating developmentof cervical cancer. Routine Pap smears can detect cells in the early stagesof the transformation processinitiated by HPV integration, permitting effectivetreatment. I

sitesin the hostintooneof manypossible andintegrated nucleus chromosome onlyonehost-cell DNA.Forsimplicity, cellchromosomal istranscribed viralDNA(provirus) isdepictedStepZl: Theintegrated (darkred)and generating mRNAs RNApolymerase, bythe host-cell (brightred).Thehost-cell machinery genomicRNAmolecules andnucleocapsid intoglycoproteins theviralmRNAs translates by andarereleased virions thenassemble proteins. StepEt: Progeny 4-47. in Figure buddingasillustrated

Viruses: Parasitesof the Cellular Genetic System r Viruses are small parasitesthat can replicate only in host cells. Viral genomes may be either DNA (DNA viruses)or RNA (RNA viruses)and either single-or doublestranded. r The capsid, which surrounds the viral genome, is composed of multiple copiesof one or a small number of virusencodedproteins. Somevirusesalso have an outer envelope' which is similar to the plasma membrane but contains viral transmembraneproteins. r Most animal and plant DNA viruses require host-cell nuclear enzymesto carry out transcription of the viral genome into mRNA and production of progeny genomes' In contrast, most RNA viruses encode enzymesthat can transcribe the RNA genomeinto viral mRNA and produce new copies of the RNA genome. r Host-cell ribosomes, tRNAs, and translation factors are used in the synthesisof all viral proteins in infected cells.

G E N E T I CS Y S T E M SF T H E C E L L U L A R V I R U S E SP: A R A S I T EO

159

r Lytic viral infection entails adsorption, penetration, synthesisof viral proteins and progeny genomes(replication), assemblyof progeny virions, and releaseof hundreds to thousandsof virions, leadingto death of the host cell (seeFigure 4-46).Releaseofenveloped vrrusesoccurs by budding through the host-cell plasma membrane (see Figure 4-471. r Nonlytic infection occurs when the viral genome is integrated into the host-cell DNA and generally does not lead to cell death. r Retroviruses are enveloped animal viruses containing a single-stranded RNA genome. After a host cell is penetrated, reversetranscriptase,a viral enzymecarried in the virion, converts the viral RNA genome into doublestranded DNA, which integratesinto chromosomal DNA (seeFigure4-49). r Unlike infection by other retroviruses,HIV infection eventually kills host cells, causing the defects in the immune responsecharacteristicof AIDS. r Tumor viruses, which contain oncogenes,may have an RNA genome (e.g.,human T:cell lymphotrophic virus) or a DNA genome (e.g., human papillomaviruses).In the case of theseviruses,integration of the viral genomeinto a hostcell chromosome can causetransformation of the cell into a tumor cell.

In this chapter we first reviewed the basic structure of DNA and RNA and then describedfundamental aspectsof the transcription of DNA by RNA polym.rur.t. RNA polymerases are discussed in greater detail in Chapter 7, along with additional factors required for transcriotion i n i t i a t i o n i n e u k a r y o t i cc e l l sa n d i n t e r a c t i o n sw i t h . e g u l a tory transcription factors that control transcription initiation in both bacterial and eukaryotic cells. Next, we discussedthe geneticcode and the participation of IRNA and the protein-synthesizingmachine, the ribosome, in decoding the information in mRNA to allow accurateassembly of protein chains. Mechanisms that regulate protein synthesis are consideredfurther in Chapter 8. Then, we consideredthe molecular detailsunderlying the accuratereplication of DNA required for cell division. Chapter 20 coversthe mechanismsthat regulatewhen a cell replicates its DNA and that coordinate DNA replication with the complex process of mitosis that distributes the daughter DNA molecules equally to each daughter cell. The next section addressedmechanisms for repairing damage to DNA, including recombination mechanismsthat also lead to the generationof geneticdiversity among individuals of a species.This genetic recombination contributes to the diversity of traits subjectedro natural selectionduring the evolution of contemporary species.In Chapter 20, we discuss the mechanisms that segregatechromosomes into haploid germ cells, a processthat requires recombination 160

.

c H A p r E4R |

between maternal and paternal chromosomes.Finally, we discussed viruses, parasites of the cellular molecular genetic system and important model systemsand useful tools for studying multiple aspects of molecular cell biology. The basicmolecular geneticprocessesdiscussedin this chapter form the foundation of contemporary molecular cell biology. Our current understandingof theseprocesses is grounded in a wealth of experimentalresults and is not likely to change.However, the depth of our understanding will continue to increaseas additional details of the structures and interactionsof the macromolecularmachinesinvolved are uncovered. The determination in recent years of the three-dimensionalstructures of RNA polymerases, ribosomal subunits, and DNA replication proteins has allowed researchersto design ever more penerraung experimental approachesfor revealinghow thesemacromoleculesoperate at the molecular level. The detailed level of understanding currently being developed may allow the design of new and more effective drugs for treating illnessesof humans, crops, and livestock.For example,the recent high-resolutionstructuresof ribosomesare providing insights into the mechanism by which antibiotics inhibit bacterial protein synthesiswithout affecting the function of mammalian ribosomes. This new knowledge may allow the design of even more effective antibiotics. Similarln detailed understanding of the mechanisms regulating transcription of specifichuman genesmay lead to therapeutic strategies that can reduce or prevent inappropriate immune responsesthat lead to multiple sclerosisand arthritis, the inappropriate cell division that is the hallmark of cancer, and other pathological processes. Much of current biological researchis focusedon discovering how molecular interactions endow cells with decision-making capacity and their special properties. For this reason severalof the following chapters describecurrent knowledge about how such interactions regulate transcription and protein synthesisin multicellular organisms and how such regulation endows cells with the capacity to become specializedand grow into complicated organs. Other chapters deal with how protein-protein interactions underlie the construction of specialized organellesin cells, and how they determine cell shapeand movement. The rapid advancesin molecular cell biology in recent years hold promise that in the not too distant future we will understand how the regulation of specialized cell function, shape,and mobility coupled wirh regulared c e l l r e p l i c a t i o n a n d c e l l d e a t h ( a p o p t o s i s )l e a d t o t h e growth of complex organisms like flowering plants and human beings.

KeyTerms anticodon127 codons127 complementary L14

B A S tM c o L E c u L AGRE N E TM t cE c H A N t s M s

crossingover 150 deamination 146 depurination 147

DNA end-joining 149

polyribosomes138

DNA polymerases141

primary transcript 121

double helix 114 envelope(viral) 154

primer 141

excision-repair systems147

reading frame 1.28

exons 123 geneconversion153

recombination112

genetic code 127

retroviruses152

Holliday structure154

reversetranscriptase152

homologousrecombination repair L50

ribosomal RNA (rRNA) 112

introns 123

ribosomes127

lagging strand 141

RNA polymerase120

leading strand 141

thymine-thymine dimers 148

messengerRNA (mRNA) 112

promoter 1-21-

replicationfork 141

mutation 138

transcription1 12 transferRNA (IRNA) 112

Okazaki fragments 141 phosphodiesterbond 1 14

translation 112 'Watson-Crick basepairs 114

Review the Concepts l. \fhat are'Watson-Crickbasepairs? lWhy are they important? 2, TAIA box-binding protein binds to the minor groove of DNA, resulting in the bending of the DNA helix (seeFigure 4-5). Vhat property of DNA allows the TAIA box-binding protein to recognizethe DNA helix? 3. Preparing plasmid (double-stranded,circular) DNA for sequencinginvolves annealing a complementary,short, single-strandedoligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplishedby heating the plasmid DNA and primer to 90 "C and then 'C. \ilhy does slowly bringing the temperature down to 25 this protocol work? 4. \fhat difference between RNA and DNA helps to explain the greater stability of DNA? What implications does this have for the function of DNA? 5. What are the major differencesin the synthesisand structure of prokaryotic and eukaryotic mRNAs? 6, 'While investigatingthe function of a specificgrowth factor receptor gene from humans, researchersfound that two types of proteins are synthesizedfrom this gene. A larger protein containing a membrane-spanningdomain functions to recognizegrowth factors at the cell surface,stimulating a specific downstream signaling pathway. In contrast, a related, smaller protein is secretedfrom the cell and functions to bind availablegrowth factor circulating in the blood, thus inhibiting the downstream signaling pathway. Speculateon how the cell synthesizesthesedisparateproteins. 7. The transcription of many bacterial genesrelieson functional groups called operons,such as the tryptophan operon

'$7hat advantagesare (Figure 4-1.3a).'What is an operon? there to having genesarrangedin an operon' compared with the arrangementin eukaryotes? 8. Contrast how selectionof the translational start site occurs on bacterial,eukaryotic, and poliovirus mRNAs. 9. \fhat is the evidence that the 23S rRNA in the large rRNA subunit has a peptidyltransferaseactivity? 10. How would a mutation in the poly(A)-binding protein I gene affect translation? How would an electron micrograph of polyribosomesfrom such a mutant differ from the normal pattern? L1. What characteristic of DNA results in the requirement that some DNA synthesis is discontinuous? How are Okazaki fragments and DNA ligase utilized by the cell? L2. Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to mutagens. 'What are the three excision-repair systemsfound in eukaryotes, and which one is responsible for correcting thymine-thymine dimers that form as a result of UV light damageto DNA? 13. DNA-repair systemsare responsiblefor maintaining genomic fidelity in normal cellsdespitethe high frequencywith which mutational eventsoccur.'Sfhattype of DNA mutation is generatedby (a) UV irradiation and (b) ionizing radiation? Describe the system responsiblefor repairing each of these types of mutations in mammalian cells. Postulatewhy a loss of function in one or more DNA-repair systems typifies many cancers. 14. lVhat is the name given to the processthat can repair DNA damage and generate genetic diversity? Briefly describe the similarities and differences of the two processes. 15. The genome of a retrovirus can integrate into the host-cellgenome.What geneis unique to retroviruses,and why is the protein encoded by this gene absolutely necessary for maintaining the retroviral life cycle?A number of retroviruses can infect certain human cells. List two of them, briefly describe the medical implications resulting from these infections, and describewhy only certain cells are infected.

Analyze the Data Protein synthesisin eukaryotes normally begins at the first AUG codon in the mRNA. Sometimes,however' the ribosomes do not begin protein synthesisat this first AUG but scan past it (leaky scanning),and protein synthesisbegins instead at an internal AUG. In order to understandwhat features of an mRNA affect efficiency of initiation at the first AUG, studies have been undertaken in which the synwas examined. thesisof chloramphenicolacetyltransferase protein referred a give rise to Translation of its messagecan protein, CAT smaller a slightly give rise to to as preCM or (see M. Kozak. 2005. Gene 367:1'3). The two proteins differ in that CAT lacks several amino acids found at the A N A L Y Z ET H E D A T A

T

161

N-terminus of preCAT. CAT is not derived by cleavageof preCAT but, instead, by initiation of translation of the mRNA at an internal AUG:

precAT Start

CAT Start

Stop

I

ll

vt m 7 c p p p " , ' ' , ", A U G 12

,:r [J[[*;,[[[[n

AUG

a. Resultsfrom a number of studieshave given rise to the hypothesisthat the sequence(-3)ACCAUGG(+4), in which the start codon AUG is shown in boldface,provides an optimal context for initiation of protein synthesisand ensures that ribosomesdo not scanpast this first AUG to begin initiation insteadat a downstreamAUG. In the numbering scheme used here, the A of the AUG initiation is designated(*1); bases5' of this are given negarivenumbers [so that the first b a s eo f t h i s s e q u e n cies ( - 3 ) ] , a n d b a s e s3 ' t o t h e ( + 1 ) A a r e given positive numbers [so that the last baseof this sequence is (+4)]. To test the hypothesisthat the start sire sequence (-3)ACCAUGG(+4) preventsleaky scanning,the chloramphenicol acetyltransferase mRNA sequencewas modified and the resulting effectson translation assessed. In the following figure, the sequence(red) surrounding the first AUG codon (black) of the mRNA that gives rise to the synthesisof preCAT is shown above lane 3. Modification of this messageis shown above the other gel lanes (altered nucleotides are in blue), and the completedproteins generatedfrom eachmodified messageappear as bands on the SDS-polyacrylamide gel below. The intensity of each band is an indication of the amount of that protein synthesized.Analyzethe alterations to the wild-type sequence,and describe how they affect translation. Are the positions of some nucleotidesmore important than others? Do the data shown in this figure provide support for the hypothesisthat the context in which the first AUG is presentaffectsefficiencyof translation from this site? Is ACCAUGG an optimal contexr for initiation from the first AUG?

CCCCA -3UUAAC UUCCC UUCCA (t

AUG1 I A A A A A U U U U ^-^^"-1U

PrtrLAr

G G IC +4UGGAA

preCAT+ * CAT+*

***{} s

G

G

b. What are some additional alterations to this message, other than those shown in the figure, that would further elucidate the importance of the ACCAUGG .

c H A p r E R4

|

c. A mutation causing a severe blood diseasehas been found in a single family (seeT. Matthes et a1.,2004, Blood 104:2181). The mutation, shown in red in the fig, ure below, has been mapped to the 5' untranslatedregion of the gene encoding hepcidin and has been found to alter the gene'smRNA. The shadedregions indicate the coding sequenceof the normal and mutant genes.No hepcidin is produced from the altered mRNA, and lack of hepcidin resultsin the disease.Can you provide a reasonableexplanation for the lack of synthesisof hepcidin in the family memberswho have inherited this mutation? $fhat can you deduce about the importance of the context in which the start site for initiation of protein synthesisoccurs in this c a s e?

Starthepcidin .....cCAGUGGGACAGCCAGACAGACGGcncCnricccncUG..... Norma

I

Y .....GCAAUGGGACAGCCAGACAGACGGCACGAUGGCACU........ Mutant

References Structure of Nucleic Acids Arnott, S. 2006. Historical article: DNA polymorphism and the earfy history of the double helix. TrendsBiochem. Sci.3l:349-354. Berger,J. M., and J. C. Wang. 1996. Recentdevelopmentsin DNA topoisomeraseII structureand mechanism.Curr. Opin. Struc. Biol. 6:84-90. Dickerson,R. E. 1983. The DNA helix and how it is read. Sci. Am. 249:94-1.'1.1.. Dickerson,R. E., and H. L. Ng. 2001. DNA srructurefrom A to B. Proc. Nat'l Acad. Sci.USA.98:6986-69888. Doudna, J. A., and T. R. Cech.2002.The chemicalrepertoireof natural ribozymes.N ature 418:222-228. Kornberg, A., and T. A. Baker.2005. DNA Replication.University Science,chap. 1. A good summary of the principlesof DNA structure. Lilley, D. M. 2005. Structure,folding and mechanismsof ribozymes.Curr. Opin. Struc.Biol. t5:313-323. Vicens,Q., and T. R. Cech.2005. Atomic level architectureof group I introns revealed.TrendsBiochem. Sci.3l:41-51. 'Wang, J. C. 1980. SuperhelicalDNA. TrendsBiochem. Sci. 5:279-221. Wigley,D.B. 1995. Srructureand mechanismof DNA topoisomerases.Ann. Reu.Biophys. Biomol. Struc.24:L85-208.

+

Lane12345

'162

sequence as an optimal context for synthesis of preCAT rather than CAT? How would you further examine w h e t h e rA a t t h e ( - 3 ) p o s i t i o n a n d G a t t h e ( + 4 ) p o s i t i o n are the most important nucleotidesto provide context for the AUG start?

Transcription of Protein-Coding Genes and Formation of Functional mRNA Brenner,S., F. Jacob,and M. Meselson.1,96L.An unstableintermediatecarrying information from genesto ribosomesfor protein synthesis.Natur e 190:576- 5 8'1,. Murakami, K. S., and S. A. Darst. 2003. BacterialRNA polvmerases:the whole story.Curr. Opin. Strwc.Biol. t3:31-39.

B A S t cM o L E c u L A R G E N E I cM E c H A N t s M s

Okamoto K., Y. Sugino,and M. Nomura. 1962. Synthesisand turnover of phagemessengerRNA in E. coli infectedwith bacteriophageT4 in the presenceof chloromycetin.J. Mol. Biol. 5:527-534. Steitz,T. A. 2006. Visualizingpolynucleotidepolymerase machinesat work. EMBO J.25:3458-3468. The Decoding of mRNA by tRNAs Alexander,R. !(., and P. Schimmel.2001. Domain-domain comProg. Nucl. Acid Res. munication in aminoacyl-tRNA synthetases. Mol. Biol. 69:31,7-349. Hatfield, D. L., and V. N. Gladyshev.2002.How seleniumhas altered our understanding of the genetic code.Mol. Cell Biol. 22:3565-3576. Hoagland, M. B., et al. 1958. A solubleribonucleicacid intermediatein protein synthesis./. Biol. Chem.23l:241-257. Ibba, M., and D. Soll. 2004. Aminoacyl-tRNAs: settingthe limits of the geneticcode.GenesDeu. 18:731-738. Khorana, G. H., et al. 1966. Polynucleotidesynthesisand the geneticcode. Cold Spring Harbor Symp. Quant. Biol.3l:3949. Nakanishi, K., and O. Nureki. 2005. Recentprogressof structural biology of IRNA processingand modification. MoL Cells l91.57-166. Nirenberg, M., et al. 1966.The RNA code in protein synthesis. Cold Spring Harbor Symp. Quant. Biol. 3t:ll-24. Rich. A.. and S.-H. Kim. 1978. The three-dimensionalstructure of transfer RNA. Scl.Am.240(1,1:52-62(offprint 1.377). Stepwise Synthesis of Proteins on Ribosomes Abbott, C. M., and C. G. Proud. 2004. Translationfactors:in sicknessand in health. TrendsBiocbem.Sci.2925-131. Auerbach,T., A. Bashan,and A. Yonath. 2004. Ribosomal antibiotics:structural basisfor resistance,synergismand selectivity. TrendsB iotech nol. 22:570- 576. Frank, J., et al. 2005. The role of IRNA as a molecularspring in decoding,accommodation,and peptidyl transfer.FEBSLett. 579:959-962. Ganoza,M. C., M. C. Kiel, and H. Aoki. 2002. Evolutionary conservationof reactionsin translation.Microbiol. Mol. Biol. Reu. 66:460485. Gualerzi,C. O., et al. 2001. Initiation factorsin the early events of mRNA translation in bacteria.Cold Spring Harbor Symp. Quant. Biol. 66:363-376. Hellen, C. U., and P. Sarnow.2001. Internal ribosomeentry sitesin eukaryotic mRNA molecules.Genet.Deuel. 15:1593-161'2. Kahveiian,A., G. Roy, and N. Sonenbery.200l. The mRNA closed-loopmodel: the function of PABPand PABP-interactingproteins in mRNA translation.Cold Spring Harbor Symp. Quant. Biol. 66:293-300. Kapp, L. D., and J. R. Lorsch. 2004. The molecularmechanics of eukaryotictranslation.Ann. Reu.Biochem. 73:657-704. Mitra, K., and J. Frank. 2006. Ribosomedynamics:insights from atomic structuremodeling into cryo-electronmicroscopy maps.Ann. Reu.Biophys.Biomol. Struc.35:299-3t7. Noller, H. F. 2005. RNA structure:readingthe ribosome. Science309:1508-15 14. Noller, H. F., et al. 2002. Translocationof IRNA during protein synthesis.FEBSLett. 514i1.1.-16. Polacek,N., and A. S. Mankin. 2005. The ribosomal peptidyl transferasecenter:structure,function, evolution, inhibition' Cdr. Reu.Biocbem.Mol. Biol. 4O:285-31.1. Preiss,T., and M. W. Hentze.2003. Startingthe protein synthesis machine:eukaryotic translation initiation. BioEssays 25:1201-1.211'. Richter,J. D., and N. Sonenberg.2005. Regulationof capdependenttranslation by eIF4E inhibitory proteins.Nature 433:477480.

Scheper,G. C., C. G. Proud, and M. S' van der Knaap. 2005' Defectivetranslation initiation causesvanishingof cerebralwhite matter.TrendsMol. Med. t2:1'59-1'66. Sonenberg,N. 2006. TranslationalControl in Biology and Medicine (CSH monograph).Cold SpringHarbor Press. Sonenberg,N., and T. E. Dever.2003. Eukaryotic translation initiation factors and regulators.Curr. Opin. Struc.Biol' 13:56-63' Steitz,T. A. 2005. On the structural basisof peptide-bondformation and antibiotic resistancefrom atomic structuresof the large ribosomal subunit. FEBSLett. 579:955-958' Taylor, S. S., N. M. Haste' and G. Ghosh. 2005. PKR and eIF2ct:integration of kinasedimerization,activation' and substrate docking. Cell 122:823-82 5. DNA Replication Brautigam, C. A, and T. A. Steitz. 1998' Structural and functional insights provided by crystal structures of DNA polymerases and their snbtti"t. complexes.Curr. Opin. Struc. Biol. 8:54-63. Bullock, P.A. 1997. The initiation of simian virus 40 DNA replication in vitro. Crit. Reu.Biochem.Mol. Biol' 32:503'568. DePamphilis,M. L., ed. 2006 DNA Replicationand Human Disease.Cold SpringHarbor Laboratory Press. Kornberg. A., and T. A. Baker.2005. DNA Replication' University Science. Langston,L. D., and M. O'Donnell. 2005. DNA replication: keep moving and don't mind the gap.Mol. Cells23:155-160' Mendez,J., and B. Stillman.2003. Perpetuatingthe double helix: molecularmachinesat eukaryotic DNA replication origins' 25:11'58-I1'67. BioEssays O'Donnell, M.2006. Replisomearchitectureand dynamicsin Eschericbia coli. l. B iol. Cbem. 281:106 5 3-106 56. Sclafani,R. A., R. J. Fletcher,and X. S' Chen' 2004' Two heads are better than one: regulation of DNA replication by hexameric helicases.GenesDeu. 18:2039-2045. DNA Repair and Recombination Andressoo,J. O., and J. H. Hoeijmakers'2005. Transcriptioncoupled repair and premature aging.Mutat. Res.577:179-1'94' Barnes,D. 8., and T. Lindahl. 2004. Repair and geneticconsequencesof endogenousDNA basedamagein mammalian cells'Ann' Reu.Genet.38:445476. Bell, C. E. 2005. Structureand mechanismoI Escherichiacoli RecA ATPase.Mol. Microbiol. 58:358-366. Friedberg,E. C., et al' 2006. DNA repair: from molecularmechanism to human disease.DNA Repair 5:986-996. Haber,J. E. 2000. Partnersand pathwaysrepairing a doublestrand break. Trends Genet. 16:259-264. system'Na/' Jiricny,1.2006. The multifacetedmismatch-repair Reu.Mol. Cell Biol.7:335-346. Khuu. P.A.. et al. 2005. The stacked-XDNA Holliday iunction and protein recognition.l. Mol. Recog.192234-242. Lilley, D. M., and R. M. Clegg' t993-The structureof the four--ay jonction in DNA. Ann. Reu-Biophys. Biomol' Struc' 22:299-328. Mirchandani, K. D., and A. D. D'Andrea- 2006. The Fanconi anemia/BRCAp"lh*"yt a coordinator of cross-link repail Exp' Cell Res.372:2647-2653' Mitchell, J. R., J. H. Hoeijmakers,and L. J. Niedernhofer'2003' Divide and.*qu.t, nucleotideexcisionrepair battlescancerand aging.Curr. Opin. Cell Biol.l5:232-240. Orr-Weaver,T. L., and J. I7. Szostak.1985. Fungal recombination. Microbiol. Reu. 49:33-58. Shin, D. S., et al. 2004. Structureand function of the double strand break repair machinery.DNA Repair 32863-873' '!food, R. D., M. Mitchell, and T. Lindahl. Human DNA repair Res.577:275-283. Mutat. senes. R E F E R E N C E 5o

16 3

Yoshida,K., and Y. Miki. 2004. Role of BRCA1 and BRCA2 as re-gulatorsof DNA repair, transcription, and cell cycle in responseto DNA damage.CancerSci. 95,:865-87t.

Viruses:Parasites of the CellularGeneticSystem Flint,S.J.,et al. 2000.Principles of Virology: Molecular Biology, Pathogenesis,and Control. ASM press. Hull, R. 2002. Matheuts' Plant Virology. Academic press.

164

C H A P T E R4

I

B A S T CM O L E C U L A RG E N E T T M C ECHANTSMS

Klug, A. 1999.The tobacco mosaic virus particle: structure and assembly.Phil. Trans, R. Soc.Lond. B Biol. SZi.354:531-535. Knipe, D. M., and P. M. Howley eds. 2001. Fields Virology. Lippincott Villiams & Ifilkins. Kornberg, A., and T. A. Baker. 1992. DNA Replication,2d, ed,. W. H. Freeman and Company. Good summary of bacteriophagemolecular biology.

CHAPTER

GENETIC MOLECULAR TECHNIQUES (RNA|) mostgenesin the canbe usedto silence RNAinterference worm on the right (markedby C. elegansgenome Thetransgenic expresses dsRNAto the muscle a GFPreporterin headneurons) geneunc-\5, resultingin the potentdegradationof the unc-/5 of the worm ln contrast, mRNAand leadingto completeparalysis body the typicalsinusoidal the wild-typeworm on the leftexhibits of JohnKim] movement[Courtesy

I n previous chapters, we were introduced to the variety of I tasks that proteins perform in biological systems.Indeed' I the very field of molecular cell biology seeksto understand the molecular mechanismsof individual proteins and how groups of proteins work together to perform their biological functions. In studying a newly discoveredprotein' cell biologistsusually begin by asking three questionsabout it: what is its function, where is it located, and what is its structure?To answer thesequestions,investigatorsemploy three tools: the genethat encodesthe protein, a mutant cell line or organism that lacks the function of the protein, and a sourceof the purified protein for biochemicalstudies.In this chapter we consider various aspectsof two basic experimentalstrategiesfor obtaining all three tools (Figure5-1). The first strategy,often referred to as classicalgenetics, beginswith isolation of a mutant that appearsto be defective in some process of interest. Genetic methods then are used to identify and isolate the affected gene. The isolated genecan be manipulatedto produce large quantitiesof the protein for biochemical experiments and to design probes for studies of where and when the encoded protein is expressedin an organism.The secondstrategyfollows essentially the same stepsas the classicalapproach but in reverse order, beginning with isolation of an interesting protein or its identification based on analysis of an organism's genomic sequence.Once the corresponding gene has been isolated, the gene can be altered and then reinsertedinto an organism. In both strategies,by examining the phenoof mutations that inactivate a particutypic consequences lar gene, geneticistsare able to connect knowledge about the sequence,structure, and biochemical activity of the

encoded protein to its function in the context of a living cell or multicellular organism. An important component in both strategiesfor studying a protein and its biological function is isolation of the corresponding gene. Thus we discussvarious techniques by which res.archits can isolate, sequence'and manipulate specific re-

we discusstechniquesthat abolish normal protein function in order to analyzethe role of the protein in the cell.

OUTLIN 5.1

GeneticAnalysisof Mutationsto ldentify and StudYGenes

166

5.2

DNA Cloningand Characterization

176

5,3

UsingClonedDNA Fragmentsto StudyGene ExPression

5.4

ldentifying and LocatingHuman DiseaseGenes

5.5

Inactivatingthe Functionof Specific Genesin EukarYotes

165

> FIGURE 5-1 Overviewof two strategies for relatingthe function,location,and structureof gene products,A mutant organism isthestarting pointfor the classical geneticstrategy(greenarrows)Thereverse (orange strategy arrows) usually beginswith identification of a protein-codrng sequence by analysis of genomesequence databases In bothstrategies, the actualgeneisisolated eitherfroma DNAlibrary or by specific amplification of the genesequence from genomicDNA Oncea clonedgeneis isolated, it canbe usedto produce theencoded protein in bacterial or eukaryotic expression systems Alternatively, a clonedgenecanbe rnactivated by oneof various techniques andusedto generate mutantcellsor orqanisms

Mutant organism/cell Comparisonof mutant and wild-type function G e n e t i ca n a l y s i s Screeningof DNA library

Clonedgene DNA sequencing

to ldentifyand StudyGenes As describedin Chapter 4, the information encoded in the DNA sequenceof genesspecifiesthe sequence-and therefore the structure and function-of every protein moleculein a cell. The power of geneticsas a tool foi studying cells and organismslies in the ability of researchersto selectivelyalter every copy of just one type of protein in a cell by making a change in the gene for that protein. Genetic analysesof mutants defectivein a particular processcan reveal (a) new genes required for the process to occur, (b) the order in which gene products act in the process,and (c) whether the proteins encoded by different genes interact with one another. Before seeinghow geneticstudiesof this rype can provide insights into the mechanism of complicated cellular or developmental process,we first explain some basic genetic terms used throughout our discussion. The different forms, or variants, of a geneare referred to as alleles.Geneticistscommonly refer to the numerous naturally occurring genetic variants that exist in populations, particularly human populations, as alleles.The term mutation usually is reserved for instances in which an allele is known to have been newly formed, such as after treatment of an experimental organism with a muragen, an agent that causesa heritable changein the DNA sequence. Stricdyspeaking,the particular serof alielesfor all the genes carried by an individual is its genotype.However, this term also is usedin a more restrictedsenseto denoteiust the allelesof the

type usually denoresan allele that is present at a much higher frequency than any of the other possible alternatives. 166

.

cHAprER 5

|

Databasesearchto identify protein-codingsequence PCRisolationof corresponding gene

Expression in cultured cells

Genetic Analysis of Mutations

ff,t

Gene inactivation

M o L E c u L AG R E N E T tr cE c H N t e u E s

Protein Localization Biochemical studies Determ i nati o n of structu re

Geneticistsdraw an important distinction between the genotype and the phenotype of an organism. The phenotype refers to all the physical attributes or traits of an individual that are the consequenceof a given genotype. In practice, however, the term phenotype often is used to denote the physical consequencesthat result from just the alleles that are under experimental study. Readily observable phenotypic characteristicsare critical in the geneticanalysisof mutations.

R e c e s s i vaen d D o m i n a n tM u t a n t A l l e l e s GenerallyHave OppositeEffectson G e n eF u n c t i o n A fundamental genetic difference between experimental organismsis whether their cells ca:i::ya single set of chromosomes or two copies of each chromosome. The former are referred to as haploid; the latter, as diploid. Complex multicellular organisms (e.g., fruit flies, mice, humans) are diploid, whereasmany simple unicellular organismsare haploid. Someorganisms,notably the yeastSaccharomycescereuisiae, can exist in either haploid or diploid states. Many cancer cells and rhe normal cells of some organisms, both plants and animals) caffy more than two copies of each chromosome.However, our discussionof genetictechniques and analysis relates to diploid organisms, including dipioid yeasts. Although many different allelesof a gene might occur in different organisms in a population, any individual diploid organism will carry two copiesof eachgeneand thus at most can have two different alleles.An individual with two different allelesis heterozygousfor a gene, whereas an individual that carriestwo identical allelesis homozygousfor a gene.A recessivemutant allele is defined as one in which both alleles must be mutant in order for the mutant phenotype to be observed;that is, the individual must be homozygous for the mutant allele to show the mutant phenotype.In contrast, the phenotypic consequences of a dominant mutant allelecan be

;;-;-'*i

=

GENOTYPE I l-----t DIPLOID PHENOTYPE

Wild type

Dominant =

i M uta nt

mutant alleles 5-2 Effectsof dominantand recessive FIGURE on phenotypein diploidorganisms.A singlecopyof a dominant bothcopies whereas a mutantphenotype, to produce alleleissufficient observedin a heterozygousindividual carrying one mutant and one wild-type allele(Figure5-2). 'Whether a mutant allele is recessiveor dominant provides valuable information about the function of the affectedgene and the nature of the causativemutation' Recessivealleles usually result from a mutation that inactivates the affected gene,leadingto a partial or completelossof fwnctioz. Suchrecessivemutations may remove part of the gene or the entire genefrom the chromosome,disrupt expressionof the gene,or alter the structure of the encoded protein, thereby altering its function. Conversely,dominant alleles are often the consequenceof a mutation that causessome kind of gain of function. Such dominant mutations may increase the activity of the encodedprotein, confer a new function on it, or lead to its inappropriate spatial or temporal pattern of expression. Dominant mutations in certain genes,however,are associated with a lossof function. For instance,somegenesatehaploinswfficient, meaning that both allelesare required for normal function. Removing or inactivating a singleallele in such a gene leadsto a mutant phenotype.In other rare instancesa dominant mutation in one allelemay lead to a structuralchangein the protein that interferes with the function of the wild-rype protein encoded by the other allele. This type of mutation, referred to as a dominant-negatiue,producesa phenotype similar to that obtainedfrom a loss-of-functionmutation. Someallelescan exhibit both recessiveand dominant properties.In such cases,statementsabout whether is dominant or recessivemust specify the phenoallele an type. For example, the allele of the hemoglobin gene in humans designatedHb'has more than one phenotypicconsequence.Individuals who are homozygousfor this allele (Hb'/Hb') have the debilitating diseasesickle-cellanemia, but heterozygousindividuals (Hb'/Hb") do not have the disease.Therefore, Hb' is recessiuefor the trait of sicklecell disease.On the other hand, heterozygous(Hb'/Hb') individuals are more resistantto malaria than homozygous (Hb"/Hb") individuals, revealing that Hb' is dominant for the trait of malaria resistance.I

to causea mutantphenotype allelemustbe present of a recessive causea lossof function;dominant usually mutations Recessive causea gainof functionor an alteredfunction usually mutations

mutationsthan dominant mutations.

Segregationof Mutations in Breeding ExperimentsRevealsTheir Dominance or RecessivitY Geneticistsexploit the normal life cycle of an organism to test for the dominance or recessivityof alleles' To see how this is done, we need first to review the type of cell division that gives rise to gametes (sperm and egg cells in higher plants and animals). l7hereas the body (somatic)cells of -ort *.tl,i.ellular organisms divide by mitosis, the germ

their genesmay exist in different allelic forms' Figure 5-3 depicts the major eventsin mitotic and meiotic cell division' InLitosis DNA replication is always followed by cell division, yielding two diploid daughter cells' In meiosis oze round'of DNe replication is followed by two separatecell divisions, yieldingfour haploid (12) cells that contain only one chromosome of each homologous pair' The apportion-

A commonly used agent for inducing mutations (mutagenesis) in experimental organisms is ethylmethane sulfonate (EMS). Although this mutagen can alter DNA sequencesin severalways, one of its most common effectsis to chemically modify guanine basesin DNA, ultimately leading to the conversionof a G'C basepair into an A T basepair. Such an alteration in the sequenceof a gene,which involves only a singlebasepair, is known as a point mutation. A silent A N D s T U D YG E N E S TO IDENTIFY OF MUTATIONS ANALYSIS GENETIC

167

Focus Animation: Mitosisftttt Focus

Meiosis

MEIOTIC CELL DIVISION

Paternal homolog Maternal homolog

S o m a t i cc e l l( 2 n )

Premeioticcell l2nl

I DNA reptication

vI

v

Replicated cnromosomes (4nl

DNA reptication

Replicated cnromosomes

I

I Homologous chromosomes + align; synapsisand crossing over

v

Mitotic apparatus

Mitotic appara

;

MetaphaseI

o o o

I

I

v

v

/\

/ Ceil division \

++

D a u g h t e cr e l l s( 2 n )

o o o o

E

FIGURE 5-3 Comparison of mitosisand meiosis.Both somatrc cellsandpremeiotic germcellshavetwo copies of each (2n),onematernal chromosome andonepaternal. In mitosis, the replicated chromosomes, eachcomposed of two sister chromatids, alignat the cellcenterin sucha waythatboth daughter cellsreceive a maternal andpaternal fromolog of each morphological typeof chromosome. Durinqthefirstmerctrc division, however, eachreplicated chromosome pairswith its nomotogous partnerat the cellcenter; thispairingoff isreferred Io assynapsis, andcrossing overbetweenhomoloqous

168

CHAPTER 5

|

M O L E C U L AG R E N E T TTCE C H N T O U E S

chromosomes is evidentat this stage One replicatedchromosomeof eachmorphological type then goesinto eachdaughtercell The resultingcellsundergoa seconddivisionwithout interveningDNA replication, with the srsterchromatidsof eachmorphological type beingapportionedto the daughtercells.In the secondmeiotic divisionthe alignmentof chromatidsand their equalsegregation into daughtercellsis the sameas in mttoticdivision.The alignmentof pairsof homologouschromosomein metaphaseI is randomwith respectto other chromosomepairs,resultingln a mix of paternally and maternallyderivedchromosomes in eachdaughtercell.

(a) Segregationof dominant mutation Mutant

Wild-tYPe

Gametes

F i r s tf i l i a l g e n e r a t i o nF, . : all offspringhave mutant phenotype

Gametes S e c o n df i l i a l g e n e r a t i o nF, r : 3/aof offspringhave mutant phenotype Normal

(b) Segregationof recessivemutation Mutanl

(Figure 5-4). If the F1 progeny exhibit the mutant trait' then ih."r.r.rr"n, allele is dominant; if the F1 progeny exhibit the wild-type trait, then the mutant is recessive'Further crossing b"t*.Ln F1 individualswill also revealdifferent patternsof inheritanceaccording to whether the mutation is dominant or recessive.When F1 individuals that are heterozygousfor a dominant allele are crossedamong themselves,three-fourths of the resulting F2 progeny will exhibit the mutant trait' In contrast, when F1 individuals that are heterozygous for a recessiveallele are crossedamong themselves,only one-fourth of the resultingF2 progeny will exhibit the mutant tratt' As noted earlier,the yeast S. cereuisiae,an lmportant experimental organism' can exist in either a haploid or a iiotoid state.1n these unicellular eukaryotes' crossesbetween haploid cells can determinewhether a mutant allele is dominani or recessive.Haploid yeast cells' which carry one copy of each chromosome' can be of two different mating types k.town as a and ct. Haploid cells of opposite mating type can mate to produce a/ct diploids, which carry two of each chromosome. If a new mutation with an ob.*i., servablephenotypeis isolatedin a haploid strain, the mutant strain can be mated to a wild-type strain of the opposite mating type to produce a/o diploids that are heterozygousfor thl mutant ull.t.. ff these diploids exhibit the mutant trait, then the mutant allele is dominant, but if the diploids appear as wild-type, then the mutant allele is recessive'I7hen a/ct diploids aie placed under starvation conditions, the cells undergo -eiosfu, giving rise to a tetrad of four haploid spores' t*Jof type a and two of type ct. Sporulation of a heterozygo.rsdipiiid cell yields two sporescalryils the mutant allele ina t*o carrying the wild-type allele (Figure 5-5)' Under Wild type (type a)

Gametes

Mutant (type o)

F i r s tf i l i a l g e n e r a t i o nF, r . no offspringhave mutant phenotype Diploid cells: w i l l n o t e x h i b i tm u t a n t phenotypeif mutation is recessive

Gametes S e c o n df i l i a l g e n e r a t i o nF, r : 1/+of offspringhave mutant phenotype

Haploid spores in tetrad: 2 will be mutant 2 will be wild tYPe

5-4 Segregationpatternsof dominantand A FIGURE recessivemutationsin crossesbetweentrue-breedingstrains o f d i p l o i do r g a n i s m sA. l l t h e o f f s p r i nign t h e f i r s t( F r ) the F1 lf the mutantalleleisdominant, generation areheterozygous. ( a ) p a r t l f t he i n p h e n o t y p a e s , m u t a n t t h e e x h i b i t o f f s p r i nw g ill g i l le x h i b itth e ee , F 1o f f s p r i nw m u t a na t l l e l ei s r e c e s s i vt h a ,si n p a r t( b ) C r o s s i nogf t h e F 1 w i l d - t y pp eh e n o t y p e different alsoproduces amongthemselves heterozygotes m u t a na t lleles r e c e s s i v e a n d f d o m i n a n t s e g r e g a t i or ant i o so r intheF,qeneration

of allelesin yeast'Haploid 5-5 Segregation FIGURE cellsof oppositematingtype(i e , oneof matingtype Saccharomyces an a/ctdiploidlf ctandoneof matingtypea) canmateto produce theothercarries and allele wild-type a dominant carries onehaploid gene, resulting the same of the allele mutant a recessive trait Undercertaln the dominant diploidwillexpress heterozygous haploidspores' four of tetrad a diploidcellwillforma conditions, trait and recessive the express will tetrad the Twoof the sporesin tratt dominant the express two will

A N D S T U D YG E N E S G E N E T I CA N A L Y S I SO F M U T A T I O N ST O I D E N T I F Y

169

appropriate conditions, yeastsporeswill germinate,produc_ rng vegetativehaploid srrains of both mating rypes.

(a)

p Incubate at 23 .C for 5 n

-+

C o n d i t i o n aM l u t a t i o n sC a n B e U s e dt o S t u d y E s s e n t i aGl e n e si n y e a s t

E

Add mutagen; distributeinto s m a l l e ra l i q u o t s

00001000 [000t[00

VVVV

The proceduresusedto identify and isolate mutants, referred to as genettc screens,depend on whether the experimental organism is haploid or diploid and, if the latter, whether the mutation is recessiveor dominant. Genes that encode proteins essentialfor life are among the most interestingand important ones ro study. Since phenotypic expressionof mutationsin essentialgenesleadsto death of the individual, ingeniousgeneticscreensare neededto isolateand maintain organismswith a lethal mutation.

rI V V V

Colonies

Incubate at23'C

ff5fi:JJ:ru

Temperature-sensitive for growth; growth at 23., no growth at 36.

(b) Wild type

cdc28 mutants

t

t

tagenizedyeastcellsthat could grow normally at23 "C but that could not form a colony when placedat 36;C (Figure5_6a). Once temperature-sensitive murants were isolated,fu.th., analysisrevealedthat some indeed were defectivein cell divi-

l

o cdcZmutants

Cg

6 ,G

l{ t.. v

o' t-

170

o

c H A p r E5R |

MoLEcuLA GRE N E TrtEcc H N t e u E S

ao

FIGURE 5-6 Haploidyeastscarrying < EXPERIMENTAL lethalmutationsare maintainedat temperature-sensitive permissive temperatureand analyzedat nonpermissive cellfor temperature-sensttive screen temperature.(a)Genetic grow form (cdc) and yeast that in Yeasts mutants divisioncycle but not at 36 "C temperature) at 23 'C (permissive colonres thatblocks (nonpermissive maycarrya lethalmutation temperature) for blocksat (b)Assay colonies of temperature-sensitive celldivision. of wildin thecellcycle.Shownherearemicrographs stages specific after mutants different temperature-sensitive yeast two and type cells, for 6 h Wild-type temperature at the nonpermissive incubation sizes of buds, to grow,canbe seenwith alldifferent whichcontinue cellsin the of the cellcycleIn contrast, stages different reflecting in thecell stage at a specific a block exhibit lowertwo micrographs of a cycleThecdc28mutantsarrestat a pointbeforeemergence cellsThecdcZmutants, appearasunbudded newbudandtherefore justbeforeseparation of the mothercellandbud whicharrest (a)see (emerging cell),appearascellswith largebudslPart daughter L H H a r t w e l l ,1 9 6 -,l J B a c t e r i o9l 3 j 6 6 2 ; p a r t ( b ) f r o m L M H e r e f o r d a n d L H Hartwell.1914,J Mol Biol 84.4451

ComplementationTestsDetermineWhether Mutations Are in the Different Recessive S a m eG e n e In the genetic approach to studying a particular cellular process, researchersoften isolate multiple recessivemutaiion, that produce the same phenotype. A common test for

ganism heterozygousfor both mutations (i'e', carrying one a one b allele)will exhibit the mutant phenotype beIll.le "nd causeneither allele provides a functional copy of the gene' In contrast, if mutation a and b arein separategenes,then heterozygotescarrying a single copy of each mutant allele will not;;hibit the mutant phenotype becausea wild-type allele

theseyeastmutants did not simply fail to grow, as they might if they carried a mutation affecting generalcellular metabolism. Rather,at the nonpermissivetemperature,the mutants of interest grew normally for part of the cell cycle but then arrestedat a particular stageof the cell cycle,so that many cells at this stagewere seen(Figure 5-6b). Most cdc mutations in that is, when haploid cdc strainsare mated yeastare recessive; to wild-type haploids,the resulting heterozygousdiploids are nor defectivein cell division. neither temperature-sensitive

R e c e s s i vLee t h a lM u t a t i o n si n D i p l o i d sC a n B e l d e n t i f i e db y I n b r e e d i n ga n d M a i n t a i n e d in Heterozygotes In diploid organisms,phenotypesresulting from recessive mutations can be observedonly in individuals homozygous for the mutant alleles.Sincemutagenesisin a diploid organism typically changesonly one allele of a gene' yielding heterozygousmutants, geneticscreensmust include inbreeding stepsto generateprogeny that are homozygous for the mutanl alleles. The geneticist H. Muller developed a general and efficient procedure for carrying out such inbreeding experiments in the fruit fly Drosophila. Recessivelethal mutaiions in Drosophila and other diploid organisms can be maintained in heterozygousindividuals and their phenotypic consequencesanalyzedin homozygotes. The Muller approach was used to great effect by C' Niisslein-Volhard and E. \Tieschaus, who systematically lethal mutations affectingembryogenesis screenedfor recessive in Drosophila. Dead homozygousembryos carrying recessive lethal mutations identifiedby this screenwere examinedunder the microscope for specific morphological defects in the embryos.Current understandingof the molecularmechanisms underlyingdevelopmentof multicellularorganismsis based,in large part, on the detailedpicture of embryonic development rWe revealedby characterizationof theseDrosoprila mutants. will discusssome of the fundamental discoveriesbased on thesegeneticstudies\n Chapter 22.

lar characterization of the CDC genes and their encoded proteins, as describedin detail in Chapter 20, has provided a ?r"-.*ork for understanding how cell division is regulated in organismsranging from yeast to humans'

Double Mutants Are Useful in Assessing t h e O r d e ri n W h i c h P r o t e i n sF u n c t i o n Based on careful analysis of mutant phenotypes associated with a particular cellular process' researchersoften can deduce the order in which a set of genesand their protein products function. Two general types of processesare amenable to such analysis: (a) biosynthetic pathways in which a precursor material is convertedvia one or more intermediatesto a final product and (b) signaling pathways that regulate other processesand involve the flow of information rather than chemical intermediates.

A N D S T U D YG E N E S TO IDENTIFY OF MUTATIONS ANALYSIS GENETIC

171

> EXPERIMENTA FLI G U R E5 - 7 Complementation analysisdetermines whether recessivemutations are in the same or different genes. Complementation testsin yeastare performedby matinghaploida and o cellscarryingdifferentrecessrve mutations to producediploidcells In the analysis of cdc mutations,pairsof differenthaploid temperature-sensitive cdc strainswere systematically matedand the resultingdiploids testedfor growth at the permissive and nonpermrsstve temperaturesIn this hypothetical example,the cdcX and cdcy mutants c o m p l e m e net a c ho t h e ra n d t h u s h a v e mutationstn differentgenes,whereasthe cdcX and cdcZmutantshavemutationsin the s a m eg e n e

M a t e h a p l o i d so f oppositemating types and carryingdifferent recessivetemperaturesensitivecdc mutations

Mutant (type a)

Mutant (type cr)

(cdcX)

(cdcY\

\_./

\_-/ \/

Mutant (typea)

Mutant (typeo)

\cdcx)

(cdcz)

\_-./

\_-,i

\/

\r'

cdcXlcdcY (type a/o)

\r'

cdcXlcdcZ (type a/o) P l a t ea n d i n c u b a t e at permissive temperature

T e s tr e s u l t i n gd i p l o i d s for a temperaturesensitivecdc phenotype

2C

aa

Growth

No growth

6A

PHENOTYPE: Wild type INTERPRETATION:

36'C

Growth indicatesthat mutations cdcX and cdcY are in differentgenes

Y9

M utant Absenceof growth indicatesthat mutations c d c Xa n d c d c Z a r e i n t h e s a m eg e n e -Ir-V----l...t-^_ia"'-l___LF

Respectivewild-typealleles p r o v i d en o r m a lf u n c t i o n

next. In E. coLi,the genesencodingtheseenzymeslie adja_ cent to one another in the genome, constituting the trp operon (seeFigure 4-73a). The order of action of the differ_ ent genesfor theseenzymes,hencethe order of the biochemi_ cal reactions in the pathway, initially was deducedfrom the types of intermediatecompoundsthat accumulatedin each

In Chapter 14 we discussthe classicuse of the double_ mutant.strategyto help elucidatethe secretorypathway. In this pathway proteins to be secreredfrom the cell rnou. i.otheir site of synthesison the rough endoplasmicreticulum (ER) to the Golgi complex. then to ,..r.toiy vesicles, and fi_ n a l l y t o r h ec e l l s u r f a c e . Ordering of Signaling pathways As we learn in later chapters,expressionof many eukaryoticgenesis regulated by signaling pathways that are initiateJ by extracellular 172

.

c H A p r E5R | M o L E c u L AGRE N E Tr tEcc H N t o u E S

B o t h a l l e l e sn o n f u n c t i o n a l

hormones, growth factors, or other signals. Such signaling pathways may include numerouscomponents,and doublemutant analysisofren can provide insight into the functions and interactionsof thesecompon.nrr.th. only prerequisite for obtaining useful information from this type of analysisis that the two mutations must have opposite effects on the output of the sameregulatedpathway. Most commonl5 one mutatio_nrepressesexpressionof a particular reporrer gene even when the signal is present, while another mutation resultsin reporter geneexpressionevenwhen the signalis absent(i.e.,constirutiveexpression).As illustratedin Figure5_gb, two simple regulatory mechanismsare consistentwith such

Note that this technique differs from complementation analysisjust describedin that when testingtwo recessive mu_ tations, the double mutant created is homozygolzsfor both mutations.Furthermore,dominant mutantscan be subiected t o d o u b l e - m u t a natn a l v s i s .

(a)Analysisof a biosyntheticpathway 1. A m u t a t i o ni n A a c c u m u l a t e isn t e r m e d i a t e e. A m u t a t i o ni n B a c c u m u l a t e isn t e r m e d i a t 2 OF PHENOTYPE D O U B L EM U T A N T

A d o u b l em u t a t i o ni n A a n d B a c c u m u l a t e s 1. intermediate INTERPRETATION: The reaction catalYzedby A precedes the reaction catalYzedbY B. I

: '

Eo'Et'E (b)Analysisof a signalingpathway

mutant allelewould have a mutant phenotype(Figure5-9a)' The observation of genetic suppressionin yeast strains carrying a mutant actin allele (act1-1) and a secondmutation (sic5) in another gene provided early evidence for a

A mutation in A gives repressedreporterexpresslon. A mutation in B gives constitutivereporterexpression. PHENOTYPE OF : D O U B L EM U T A N T : A d o u b l em u t a t i o ni n A a n d B g i v e s repressedreporterexPression. I , INTERPRETATION: A positively regulates repofter expression and is negativelYregulated bY B' .

(a)Suppression GenotyPe AB Phenotype Wildtype

aB Mutant

ab Ab Mutant SuPPressed

rNrERPRErAloP H E N O T Y PO EF D O U B L EM U T A N T

INr ERPRErArIoN:

/ed\

t I i/t l

A d o u b l em u t a t i o ni n A a n d B g i v e s constitutivereporterexpression.

\UU,/

pression i7 f .x 7:; i:';:;':, t""1 i' fJ3i,,1,133 A--€--l

B

(b) Synthetic lethality 1 Genotype

AB Phenotype Wild type

5-8 Analysisof doublemutantsoften canorderthe FIGURE in stepsin biosyntheticor signalingpathways'Whenmutations process but have genesaffectthe samecellular two different of the doublemutant phenotypes, the phenotype different distinctly genes mustfunction(a) which the two in the order canoftenreveal pathway, a thataffectthe samebiosynthetic Inthe caseof mutations t em e d t a t e l y t i l la c c u m u l attheei n t e r m e d i ai m d o u b l em u t a nw in the by the proteinthatactsearlier preceding the stepcatalyzed of a signaling analysis organism(b)Double-mutant wild-type on effects haveopposite if two mutations pathwayispossible phenotype gene In thiscase,the observed of a reporter expression aboutthe orderin which information of the doublemutantprovides regulators or negative actandwhethertheyarepositive the proteins

G e n e t i cS u p p r e s s i o an n d S y n t h e t i cL e t h a l i t y t roteins C a n R e v e a Il n t e r a c t i n go r R e d u n d a n P Two other types of genetic analysis can provide additional clues about how proteinsthat function in the samecellular processmay interactwith one anotherin the living cell. Both of thesemethods,which are applicablein many experimental organisms,involve the use of double mutants in which the phenotypic effects of one mutation are changed by the presenceof a secondmutation. Suppressor Mutations The first type of analysisis basedon geneticsuppression.To understandthis phenomenon,suppose

aB Partial defect

ab

Ab

Severe defect

Partial defect

rNrERPRErArto-

,fii\

( | 11I ) U,/

\U

i

(cl Synthetic lethality 2 Genotype

AB

Phenotype Wildtype

aB Wild type

ab

Ab Wild tYPe

or 5-9 Mutationsthat resultin geneticsuppression A FIGURE proteins' redundant or interacting reveal syntheticlethality proteins with two defective (a)Observation thatdoublemutants phenotype butthatsinglemutantsgive (A andB)havea wild-type thatthefunctionof eachprotein indicates a mutantphenotype thatdouble other.(b)Observation the with on interaction depends mutants single than defect phenotypic severe more a have mutants (e g , subunits of a heterodimer) thattwo proteins alsoisevidence (c)Observation thata double to functionnormally. mustinteract mUtantisnonviab|ebutthatthecorrespondingsing|emutants f unctionin thattwo proteins indicates phenotype thewild-type product an essential to produce pathways redundant

A N D S T U D YG E N E S O F M U T A T I O N sT O I D E N T I F Y ANALYSIS GENETIC

.

173

direct interaction in vivo between the proteins encoded by the two genes.Later biochemical studies showed that these two proteins-Act1 and Sac6-do indeed inreract in the construction of functional actin structureswithin the cell. Synthetic Lethal Mutations Another phenomenon,called synthetic lethality, produces a phenotypic effect opposrte to that of suppression.In this case,the deleteriouseffectof one mutation is greatly exacerbated(rather than suppressed)by a secondmutation in a relatedgene.One situation in which such synthetic lethal mutations can occur is illustrated in Figure 5-9b. In this example,a heterodimericprotein is partiall5 but not completely,inactivatedby mutations in eiiher one of the nonidentical subunits.However, in double mutants carrying specificmurationsin the genesencodingboth subunits,little interaction betweensubunits occurs,iesulting in severephenotypic effects. Synthetic lethal mutations

product cannor be synthesizedand the double mutanrs will be nonviable.

(a)

G e n e sC a nB e l d e n t i f i e db y T h e i r M a p p o s i t i o n on the Chromosome The preceding discussionof genetic analysisillustrates how a geneticistcan gain insight into gene function by observing the phenotypic effectsproduced by joining together different combinations of mutant allelesin the samecell or organism. For example, combinations of different alleles of the same gene in a diploid can be used to determine whether a mutation is dominant or recessiveor whether two different recessive mutations are in the same gene.Furthermore, combinations of mutations in different genes can be used to determine the order of gene function in a pathway or to identify functional relationships between genessuch as suppressionand synthetic enhancement.Generally speaking,all these methods can be viewed as analytical tests baseJ on gene functioz. \7e will now consider a fundamentally different type of genetic analysis based on gene positioz. Studies designedto determine the position of a gene on a chromosome, often referred to as genetic mapping studies, can be usedto identify the geneaffected by a particular mutation or to determine whether two mutations are in the samegene. In many organisms generic mapping studies rely on exchangesof genetic information that occur during meiosis. As discussedin Chapter 4 and as shown in Figure 5-10a,

(b)Consider two linkedgenesA and Bwith recessive allelesa and b.

-'-lf m2

Replicated chromosomes (4nl

Crossof two mutantsto construct a doublyheterozygous strain:

and over

AlAblb

x alaBlB

I

MetaphaseI

A i

A n a p h a s eI

Crossof double heterozygoteto test strain: A b aBab

..

a

b

I

*\ /

";

I

I

A n a p h a s el l

v

I

v AbaBABab abuA"brb \___________-Y_

Parentaltypes

_________YJ

Recombinanttypes

m1 1n

1n

Parental gamete

tn

Recombinantgametes

tn

parental gamete

A FIGURE5-10 Recombinationduring meiosis can be used to map the position of genes. (a)Shown is an individualthat carries two mutations,designatedm/ (yellow)andm2 (green),that are on the maternaland paternalversionsof the samechromosomelf crosslngoveroccursat an intervalbetweenml andm2 beforethe first meloticdivision,then two recombinantgametesare produced; one carriesboth m / and m2, whereasthe other carriesneither mutation The longerthe distancebetweentwo mutationson a 174

.

cHAprER s

I

M o l E c u L A RG E N E T tTcE C H N t o u E S

GeneticdistancebetweenA and B can be determinedfrom frequencyof parentaland recombinantgametes: gametes Geneticdistancein cM = 100, Itotbi.nant total gametes chromatid,the more likelythey are to be separatedby recombination and the greaterthe proportionof recombinantgametesproduced (b) In a typicalmappingexperiment,a strainthat is heterozygous for two differentgenesis constructedThe frequencyof parentalor recombinantgametesproducedby thls straincan be determjned from the phenotypesof the progenyin a testcross to a homozygous recessive strain The geneticmap distancein centimorgans (cM) is givenas the percentof the gametesthat are recombinant

genetic recombination takes place before the first meiotic cell division in germ cells,when the replicatedchromosomes of each homologous pair align with each other. At this time, homologous DNA sequenceson maternally and paternally derived chromatids can exchangewith each other, a process 'We now know that the resulting known as crossing over. crossovers between homologous chromosomes provide structural links that are important for the proper segregation of pairs of homologous chromatids to opposite poles during the first meiotic cell division (for discussionseeChapter 20). Considertwo different mutations,one inheritedfrom each parent, that arc located close to one another on the same chromosome.Two different typesof gametescan be produced according to whether a crossoveroccurs betweenthe mutations during meiosis. If no crossoveroccurs between them, gametesknown as parental types,which contain either one or the other mutation, will be produced. In contrast' if a crossoveroccurs betweenthe two mutations' gametesknown as recombinant types will be produced. In this example recombinant chromosomeswould contain either both mutations, or neither of them. The sites of recombination occur more or lessat random along the length of chromosomes;thus the closertogethertwo genesare, the lesslikely that recombination will occur between them during meiosis. In other words, the lessfrequently recombination occursbetweentwo genes on the same chromosome, the more tightly they are Iinked and tbe closer together they are. Two genesthat are sufficiently close together such that there are significantly fewer recombinant gametes produced than parental gametes are consideredto be geneticallylinked. The technique of recombinational mapping was devised in 1911 by A. Sturtevantwhile he was an undergraduate working in the laboratory of T. H. Morgan at Columbia University. Originally used in studies on Drosophila, this technique is still used today to assessthe distance between two genetic loci on the same chromosome in many experlmental organisms. A typical experiment designedto determine the map distancebetweentwo geneticpositions would involve two steps. In the first step' a strain is constructed that carriesa different mutation at eachposition, or locus. In to dethe secondstep, the progeny of this strain are assessed termine the relative frequency of inheritance of parental or recombinant types.A typical way to determinethe frequency of recombination between two genesis to cross one diploid parent heterozygousat each of the genetic loci to another parent homozygousfor each gene.For such a cross,the proportion of recombinant progeny is readily determined becauserecombinant phenotypeswill differ from the parental phenotypes.By convention, one genetic map unit is defined as the distance between two positions along a chromosome that results in one recombinant individual in 100 total progeny. The distance corresponding to this 1 percent recombination frequency is called a centimorgan (cM) in honor of Sturtevant'smentor,Morgan (seeFigure 5-10b). A complete discussion of the methods of genetic mapping experiments is beyond the scope of this introductory discussion;however,two featuresof measuringdistancesby recombination mapping need particular emphasis.First, the

frequency of genetic exchange between two loci is strictly proportional to the physical distancein basepairs separating ih.- o.tly for loci that are relatively close together (sa5 less than about 10 cM). For loci that are farther apart than this' a distance measured by the frequency of genetic exchange tends to underestimatethe physical distance becauseof the possibility of two or more crossoversoccurring within an inie.ual. In the limiting casein which the number of recombinant types will equal the number of parental types, the two loci under considerationcould be far apart on the same chromosome or they could be on different chromosomes, and in such casesthe loci are consideredto be unlinked' A secondimportant concept neededfor interpretation of

recombination frequency (i.e.' a genetic distance of 1 cM) representsa physical distanceof about 2.8 kilobasesin yeast distance of about 400 kilobases in compared *lth " Drosophila and about 780 kilobasesin humans' One of the chief uses of genetic mapping studies is to

human diseasescan be identified using such methods' A second general use of mapping experiments is to determine *hethe. two different mutations are in the samegene' If two mutations are in the same gene, they will exhibit tight linkage in mapping experiments,but if they are in different g..r.{ they will usually be unlinked or exhibit weak linkage'

Genetic Analysis of Mutations to ldentify and Study Genes r Diploid organisms carry two copies (alleles)of each gene,whereashaploid organismscarry only one copy' r Recessivemutations lead to a loss of function, which is masked if a normal allele of the gene is present' For the mutant phenotype to occur' both alleles must carry the mutatl0n. r Dominant mutations lead to a mutant phenotype in the presenceof a normal allele of the gene.The phenotypesassociatedwith dominant mutations often representa gain of function but in the caseof some genesresult from a loss of function. r In meiosis,a diploid cell undergoesone DNA replication and two cell divisions, yielding four haploid cells in which maternal and paternal alleles are randomly assorted (see Figure5-3).

GENES G E N E T I CA N A L Y S I SO F M U T A T I O N ST O I D E N T I F YA N D S T U D Y

175

r Dominant and recessivemutations exhibit characteristic segregatlonpatternsin geneticcrosses(seeFigure5_4). r I n h a p l o i d y e a s t .t e m p e r a t u r e - s e n s i t i vmeu t a t i o n s a r e particularly useful for identifying and studying genesessential to survival. r The number of functionally related genesinvolved in a process can be defined by complemenration analysis (see Figure-5-7). r The order in which genesfunction in a signaling pathway can be deducedfrom the phenotype of double mutants defectivein two stepsin the affectedprocess. r Functionally significant interactions between Drorelns can be deduced from the phenotypic effects o? allelespecificsuppressormutations or syntheticlethal mutations. r Genetic mapping experimentsmake use of crossingover between homologous chromosomes during meiosis to measurethe genetic distance between two different muta_ tions on the samechromosome.

DNACloningand Characterization

f[

is simply any DNA molecule composed of sequencesde_ rived from different sources. The key to cloning a DNA fragment of interest is to link it to a vector DNA molecule that can replicate within a host cell. After a singlerecombinant DNA molecule,composedof a vector plus an insertedDNA fragmenr, is introdu.id irrto " host cell, the inserted DNA is replicated along with the vec_ tor, generating a large number of identical DNA molecules. The basic schemecan be summarizedas follows:

vectorsexist, our discussionwill mainly focus on plasmid vectors in E. coli host cells,which are commonly used. Various techniquescan then be employed to identify the sequenceo{ interest from this collection of DNA fragments,known as a DNA library. Once a specificDNA fragment is isolated,it is typically characterizedby determining the exact sequenceof nucleotidesin the molecule. We end with a discussionof the polymerasechain reaction (PCR).This powerful and versatile techniquecan be usedin many ways to generatelarge quantities of a specificsequenceand otherwisemanipulate ONR m the laboratory.The various usesof cloned DNA frasmentsare discussed in subsequent sections.

RestrictionEnzymesand DNA Ligases A l l o w I n s e r t i o no f D N A F r a g m e n t si n t o CloningVectors A major objective of DNA cloning is to obtain discrete, small regions of an organism'sDNA that constitute specific genes.In addition, only relatively small DNA moleculescan be cloned in any of the availablevectors.For thesereasons, the very long DNA molecules that compose an organism's genome must be cleavedinto fragments that can be inserted into the vector DNA. Two types of enzymes-restriction enzymes and DNA ligases-facilitate production of such recombinantDNA molecules. Cutting DNA Molecules into Small Fragments Restric_ tion enzymesare endonucleasesproduced by bacteria that typically recognizespecific 4- to 8-bp sequences,calledrestrictin sites, and then cleaveboth DNA strandsat this site. Restriction sites commonly are short palindromic sequences;that is, the restriction-sitesequenceis the sameon each DNA strand when read in the 5'-+3' direction (Figure5-11). For each restriction enzyme) bacteria also produce a modification enzyme, which protects a bacterium's own DNA from cleavageby modifying it at or near eachpotenrial cleavagesite. The modification enzymeadds a methyl group to one or two bases,usually within the restriction site. When

Vector + DNA fragment EcoRl

J

+

RecombinantDNA

J

J'

r(-

|

J

Cleavage EcoRl I

Isolation, sequencing,and manipulation of purified DNA fragment Although investigatorshave devisednumerous experimental variations, this flow diagram indicatesthe essentialsteDsin DNA cloning. In this section,we first describemethods for isolating a specificsequenceof DNA from a seaof other DNA sequences. This processoften involvescutting the genomernto fragmentsand then placing each fragment ii a vector so that the entire collection can be propagatedas recombinantmole_ cules in separatehost cells. While many different types of '176 .

c H A p r E5R I M o L E c u L AGRE N E Tr tEcc H N t e u E s

|

ti +

Replication of recombinant DNA within host cells

Stickyends

s',.),

-------r

G . TTAA

c ----r

3'

\l

5

FIGURE 5-11 Cleavage of DNAby the restrictionenzyme EcoRf.Thisrestriction enzymefromE colimakesstaqqered cutsat the specific 6-bppalindromic sequence shown,yielding fragments withsingle-stranded, "sticky,, complementary ends.Manyother restriction enzymes alsoproduce fragments with stickyends

a methyl group is presentthere, the restriction endonuclease is prevented from cutting the DNA. Together with the restriction endonuclease,the methylating enzyme forms a restriction-modification system that protects the host DNA while it destroysincomingforeign DNA (e.g.,bacteriophage DNA or DNA taken up during transformation) by cleaving it at all the restriction sitesin the DNA. Many restriction enzymesmake staggeredcuts in the two DNA strands at their recognition site, generatingfragments that have a single-stranded"tail" at both ends,sticky ends (seeFigure 5-11). The tails on the fragmentsgeneratedat a given restriction site are complementaryto those on all other fragments generated by the same restriction enzyme. At room temperature, these single-strandedregions can transiently base-pairwith thoseon other DNA fragmentsgenerated with the same restriction enzyme. A few restriction enzymes,such as Alul and SmaI, cleaveboth DNA strandsat the same point within the restriction site, generating fragmentswith "blunt" (flush)endsin which all the nucleotides at the fragment ends are base-pairedto nucleotides in the complementarystrand.

The DNA isolated from an individual organism has a specificsequence,which purely by chancewill contain a specific set of restriction sites' Thus a given restriction enzyme will cut the DNA from a particular source into a reproducible set of fragmentscalled restriction fragments.The frequency with which a restriction enzymecuts DNA, and thus the average size of the resulting restriction fragments, depends largely on the length of the recognition site. For example, a restriction enzyme that recognizesa 4-bp site will cleaveDNA an averageof once every4", or 256, basepairs, whereas an enzyme that recognizesan 8-bp sequencewill cleaveDNA an averageof onceevery4E basepairs (=65 kb)' Restriction enzymes have been purified from several hundred different speciesof bacteria, allowing DNA molecules to be cut at a large number of different sequencescorresponding to the recognitionsitesof theseenzymes(seeTable5-1)' Inserting DNA Fragments into Vectors DNA fragments with either sticky endsor blunt endscan be insertedinto vector DNA with the aid of DNA ligases.During normal DNA replication, DNA ligase catalyzestheend-to-endioining (ligation) of

ENZYME

MICRO()RGANISM SOURCE

SITERECOGNITION

BamHl

B a cillu s amy lo liq u efaciens

-G-G-A-T-C.C. -C-C-T-A-G-G.

PBODUCED ENOS

J Sticky

1 J Sau3A

aureus Staphylococcus

-G-A-T-C.C-T-A-G-

Sticky

t EcoRl

Escherichia coli

Hindlll

Haemophilus influenzae

J -G-A-A-T-T-C-C.T-T-A-A-G t J -A,A-G.C-T-T.

Sticky

Sticky

-T-T-C-G-A-4.

T Smal

Serratia mdrcescens

J -C-C-C-G-G-G-G-G-G-C-C-C-

Blunt

1

Notl

No cardia otiti di s-cauiarum

-G-C_G-G.C-C-G-C-C-G-C-C-G-G-C-G-

Sticky

t Many of these recognition sequencesare included in a common polylinker sequence(seeFigure 5-13). D N A C L O N I N GA N D C H A R A C T E R I Z A T I O N

177

short fragments of DNA called Okazaki fragments. For purposesof DNA cloning, purified DNA ligaseis usedto covalently join the ends of a restriction fragment and vector DNA that have complementaryends (Figure5-12). The vector DNA and restriction fragment are covalently ligated rogetherthrough the standard3'-+5' phosphodiesterbonds of DNA. In addition to Iigating complementary sticky ends, the DNA ligasefrom bacteriophage T4 can ligate any two blunt DNA ends. However, blunt-end ligation is inherently inefficient and requires a higher concentration of both DNA and DNA ligasethan doesligation of sticky ends.

E. coliPlasmidVectorsAre Suitablefor Cloning lsolatedDNA Fragments Plasmidsare circular, double-strandedDNA (dsDNA) molecules that are separatefrom a cell's chromosomal DNA. These extrachromosomal DNAs, which occur naturally in bacteria and in lower eukaryotic cells (e.g.,yeast),exist in a

Genomic DNA fragments (a)

3' P-AATT oH__r-----::-.---r 5,

VectorDNA (a')

(b)

s', oH 3'r---------r-TTAA-p

+

P-C GHO-:5'

3' (c)

P-A G CT HOj-:-:r

3' 5,

I

I Complementary I endsbase-pair I

v

OHP

lltr 3'r------]-TTAA

/\ PHO 2 ATP T4 DNA ligase 2AMP+2PPi (a')

5'I-AATT

(a)

3',---------F++ii

3'

s,

FIGURE 5-12 Ligationof restrictionfragmentswith complementary stickyends.In thisexample, vectorDNAcutwith EcoRl ismixedwith a sample containing restriction fragments produced by cleaving genomicDNAwith several different restriction enzymes Theshortbasesequences composing the stickyendsof eachfragment typeareshownThestickyendon the cutvectorDNA (a')base-pairs onlywith thecomplementary stickyendson theEcoR/ fragment(a)in the genomic sample. Theadjacent 3, hydroxyl and5, phosphate groups(red)on the base-paired fragments thenare joined(ligated) covalently byT4 DNAligase. 178

.

c H A p r E R5

|

MoLEcuLAR G E N E T trcE c H N t o u E s

Polylinker

Plasmid cloning vector

FIGURE 5-13 Basiccomponentsof a plasmidcloningvector that can replicatewithin an E. coli cell. plasmid vectorscontaina genesuchasamp',whichencodes selectable the enzyme andconfers resistance to ampicillin. Exogenous P-lactamase DNAcan be inserted intothe bracketed regionwithoutdisturbing theabilityof the plasmidto replicate or express theamp,gene plasmid vectors alsocontaina replication origin(ORl) sequence whereDNA replication isinitiated by host-cell enzymes. Inclusion of a synthetic polylinker containing the recognition sequences for several different restriction enzymes increases the versatility of a plasmidvectorThe vectorisdesigned sothateachsitein the polvlinker is unioueon t h ep l a s m i d .

parasitic or symbiotic relationship with their host cell. Like the host-cell chromosomal DNA, plasmid DNA is duplicated before every cell division. During cell division, copies of the plasmid DNA segregateto each daughtercell, assuring continued propagation of the plasmid through successive generationsof the host cell. The plasmidsmost commonly usedin recombinant DNA technology are those that replicate in E. col/. Investigators have engineeredtheseplasmids to optimize their use as vectors in DNA cloning. For instance, removal of unneeded portions from naturally occurring E. coli plasmids yields plasmid vectors, (=1.2-3 kb in circumferential length, that contain three regions essentialfor DNA cloning: a replication origin; a marker that permits selection,usually a drugresistancegene;and a region in which exogenousDNA fragments can be inserted (Figure 5-13). Host-cell enzymes replicate a plasmid beginning at the replication origin (ORI), a specific DNA sequenceof 50-100 basepairs. Once DNA replication is initiated at the ORI, it continues around the circular plasmid regardlessof its nucleotide sequence.Thus any DNA sequenceinsertedinto such a plasmid is replicated along with the rest of the plasmid DNA. Figure 5-14 outlines the general procedure for cloning a DNA fragment using E. coli plasmid vectors. \lhen E. coli cells are mixed with recombinant vector DNA under certain conditions, a small fraction of the cells will take up the plasmid DNA, a process known as transformation. Typically, 1, cell in about 10,000 incorporates a single plasmld DNA molecule and thus becomes transformed. After plasmid vectors are incubated with E. coli, those cells that take up the plasmid can be easily selectedfrom the much larger number of cells. For instance,if the plasmid carries a gene that confers resistance to the antibiotic ampicillin,

> EXPERIMENTAL FIGURE 5-14 DNAcloningin a plasmid vector permitsamplificationof a DNAfragment.A fragmentof an intoa plasmid vectorcontaining DNAto be clonedisfirstinserted gene(amp'),suchasthatshownin Figure 5-13 ampicillin-resistance molecule by incorporation of a plasmid Onlythefew cellstransformed cells, the mediumIntransformed willsurvive on ampicillin-containing plasmid in intodaughter cells,resulting DNAreplicates andsegregates formation of an ampicillin-resistant colonv

transformed cells can be selected by growing them in an ampicillin-containing medium. DNA fragments from a few base pairs up to =10 kb commonly are insertedinto plasmid vectors. When a recombinant plasmid with an inserted DNA fragment transforms an E. coli cell, all the antibiotic-resistantprogeny cells that arise from the initial transformed cell will contain plasmids with the sameinsertedDNA. The insertedDNA is replicated along with the rest of the plasmid DNA and segregatesto daughter cells as the colony grows. In this way, the initial fragment of DNA is replicated in the colony of cells into a large number of identical copies. Since all the cells in a colony arise from a single transformed parental cell, they constitute a clone of cells, and the initial fragment of DNA inserted into the parental plasmid is referred to as cloned DNA or a DNA clone. The versatility of an E. coli plasmid vector is increased by the addition of a polylinker, a synthetically generated sequencecontaining one copy of severaldifferent restriction sitesthat are not presentelsewherein the plasmid sequence (seeFigure 5-13). \fhen such a vector is treated with a restriction enzyme that recognizesa restriction site in the polylinker, the vector is cut only once within the polylinker. Subsequentlyany DNA fragment of appropriate length produced with the same restriction enzymecan be insertedinto the cut plasmid with DNA ligase.Plasmids containing a polylinker permit a researcher to use the same plasmid vector when cloning DNA fragmentsgenerated with different restriction enzymes,which simplifies experimentalprocedures. For some purposes,such as the isolation and manipulation of large segmentsof the human genome, it is desirable to clone DNA segments as large as several megabases [L megabase(Mb) : 1 million nucleotides).For this purpose specializedplasmid vectors known as BACs (bacterialartificial chromosomes)have been developed.One type of BAC uses a replication origin derived from an endogenousplasmid of E. coli known as the F factor. The F factor and cloning vectors derived from it can be stably maintained at a single copy per E. coli cell even when they contain inserted sequencesof up to about 2 Mb. Production of BAC libraries requires special methods for the isolation, ligation, and transformation of large segmentsof DNA becausesegments of DNA larger than about 20 kb are highly vulnerable to mechanical breakage by even standard manipulations such as prpetung.

DNA fragment to be cloned Enzymaticallyinsert DNA into plasmid vector

Recombinant plasmid

Mix E. coliwith olasmids in presenceol CaCl2;heat-pulse C u l t u r eo n n u t r i e n ta g a r p l a t e sc o n t a i n i n ga m p i c i l l i n

E. coli cnromosome

Transformedcell SUTVIVES

Cellsthat do not t a k e u p p l a s m i dd i e o n a m p i c i l l i np l a t e s

I P l a s m i replication d I

+

certmurtiotication I

g Colony of cells,each containingcopies of the same recombinantPlasmid

GDNALibrariesRepresentthe Sequences of Protein-CodingGenes A collection of DNA molecules each cloned into a vector molecule is known as a DNA library. !7hen genomic DNA from a particular organism is the source of the starting DNA, the set of clones that collectively represent all the DNA sequencesin the genome is known as a genomic D N A C L O N I N GA N D C H A R A C T E R I Z A T I O N .

179

I lJ

+F*ry65' TranscriUe RNAintocDNA

< FIGURE 5-15 A cDNAlibrary containsrepresentative copiesof cellularmRNAsequences. A mixtureof mRNAsis pointfor preparing thestarting plasmid recombinant clones eachcontaining a cDNA.Transforming E coliwith the plasmids recombinant generates a setof cDNAclones representing allthecellular mRNAs. Seethetextfor a step-bysteodiscussion.

g I n " . o u " R N Aw i t ha t k a t i E J A d dp o t y ( d c ) t a i l Single-stranded 3' G GGGT-___--I cDNA

T T T T 5' t,,,.,.

EI lil$:fl6"#lli",

Y 5'I 3'GGGGI_---__--lTTTT5' -

complementary | Synttresize

sJ strand Double-stranded cDNA r (Jbbb a

-

i ^ F

3', - - r

I fTT5

oRl sites 5', 3'GGGG

E

I

C T T A A G E G G G G I _ _ _ _ _ _ - _ _T_ IT T T E C

lf Gf]GGGGI-.-_lT Stickyend

.

.,*"" withEcoRl T T TECTTAA

I Individual clones

180

T TAAGE

c H A p r E Rs

I

rJl:ru:HT:;,0?,,

MoLEcuLAR G E N E I Cr E c H N t e u E s

nJ.,,with EcoRl

library. Such genomic libraries are ideal for representingthe geneticcontent of relatively simple organismssuch as bacteria or yeast, but presentcertain experimental difficulties for higher eukaryotes.First, the genesfrom such organismsusually contain extensiveintron sequencesand therefore can be too large to be inserted intact into plasmid vectors. As a result, the sequencesof individual genesare broken apart and carried in more than one clone. Moreover, the presenceof introns and long intergenic regions in genomic DNA often makes it difficult to identify the important parts of a gene that actually encode protein sequences.For example, only about 1.5 percentof the hunran genomeactually represents protein-coding genesequences. Thus for many studies,cellular mRNAs, which lack the noncoding regionspresentin genomic DNA, are a more useful starting material for generating a DNA library. In this approach, DNA copies of mRNAs, called complementaryDNAs (cDNAs), are synthesized and cloned into plasmid vectors. A large collection of the resulting cDNA clones, representingall the mRNAs expressedin a cell type, is called a cDNA library.

cDNAsPreparedby ReverseTranscription o f C e l l u l a rm R N A sC a n B e C l o n e dt o G e n e r a t ec D N AL i b r a r i e s The first stepin preparing a cDNA library is to isolatethe total mRNA from the cell type or tissueof interest.Becauseof their poly(A) tails, mRNAs are easily separated from the much more prevalent rRNAs and tRNAs presentin a cell extract by use of a column to which short strings of thymidylate (oligo-dTs) are linked to the matrix. The generalprocedure for preparing a cDNA library from a mixture of cellular mRNAs is outlined in Figure 5-15. The enzymereversetranscriptase,which is found in retroviruses,is usedto synthesize a strand of DNA complementary to each mRNA molecule, starting from an oligo-dT primer (steps1 and2). The resulting cDNA-mRNA hybrid moleculesare converted in several stepsto double-strandedcDNA moleculescorrespondingto all the mRNA molecules in the original preparation (steps 3-5). Each double-stranded cDNA contains an oligodC.oligo-dG double-strandedregion at one end and an oligo-dT.oligo-dA double-strandedregion at the other end. Methylation of the cDNA protects it from subsequent restrictionenzymecleavage(step6). To prepare double-stranded cDNAs for cloning, short double-strandedDNA moleculescontaining the recognition site for a particular restriction enzymeare ligatedto both ends of the cDNAs using DNA ligasefrom bacteriophageT4 (Figure 5-15, step 7). As noted earlier,this ligasecan join "bluntended" double-strandedDNA moleculeslacking sticky ends. The resulting moleculesare then treated with the restriction enzymespecificfor the attachedlinker, generatingcDNA moleculeswith sticky endsat eachend (step8a). In a separateprocedure,plasmid DNA first is treatedwith the samerestriction enzymeto produce the appropriate sticky ends (step8b). The vector and the collection of cDNAs, all containing complementary sticky ends, then are mixed and joined covalently by DNA ligase(Figure 5-15, step 9). The resulting

DNA moleculesare transformed into E. coli cellsto generate individual clones;each clone carrying a cDNA derived from a singlemRNA. Becausedifferent genesare transcribed at very different rates,cDNA clonescorrespondingto abundantly transcribed genes will be representedmany times in a cDNA library, whereas cDNAs corresponding to infrequently transcribed geneswill be extremely rare or not presentat all. This property is advantageousif an investigatoris interestedin a gene that is transcribedat a high rate in a particular cell type' In this case,a cDNA library preparedfrom mRNAs expressedin that cell type will be enriched in the cDNA of interest, facilitating isolation of clonescarrying that cDNA from the library. Howeve! to have a reasonablechance of including clones corresponding to slowly transcribedgenes'mammalian cDNA libiaries must contain 1.06-107individual recombinantclones.

D N A L i b r a r i e sC a n B e S c r e e n e db y H y b r i d i z a t i o n e robe to an OligonucleotidP Both genomic and cDNA libraries of various organisms contain hundredsof thousandsto upwards of a million individual clones in the case of higher eukaryotes. Two general approaches are available for screening libraries to identify clonescarrying a geneor other DNA region of interest: (1) detectionwith oligonucleotideprobes that bind to the clone of interest and (2) detection basedon expression of the encoded protein. Here we describe the first method; an example of the secondmethod is presentedin the next section. The basis for screeningwith oligonucleotideprobes is hybridization, the ability of complementary singlestrandedDNA or RNA moleculesto associate(hybridize) specificallywith each other via basepairing. As discussed in Chapter 4, double-stranded(duplex) DNA can be denatured (melted) into single strands by heating in a dilute salt solution. If the temperature then is lowered and the ion concentration raised, complementary single strands will reassociate(hybridize) into duplexes.In a mixture of nucleic acids, only complementary single strands (or strands containing complementary regions) will reassociate; moreover,the extent of their reassociationis virtually unaffectedby the presenceof noncomplementarystrands. As we will seelater in this chapter,the ability to identify a particular DNA or RNA sequencewithin a highly complex mixture of moleculesthrough nucleic acid hybridization is the basis for many techniquesemployed to study gene expresslon. The stepsinvolved in screeningan E. coli plasmid cDNA library are depicted in Figure 5-16. First' the DNA to be screenedmust be attachedto a solid support. A replica of the petri dish containing a large number of individual E. coli clones is reproduced on the surfaceof a nitrocellulose membrane. The DNA on the membrane is denatured, and the membrane is then incubated in a solution containing a radioactively labeled probe specificfor the recombinant DNA containing the fragment of interest. Under hybridization conditions (near neutral pH, 40-65 "C' 0.3-0'6 M NaCl), D N A C L O N I N GA N D C H A R A C T E R I Z A T I O N .

181

*'**

5eu

I n d i v i d u acl o l o n i e s

B o u n ds i n g l e - s t r a n d eDdN A

Master plate of E. coli colonies

Filter

P l a c en i t r o c e l l u l o sfei l t e ro n D l a t e t o p i c ku p c e l l sf r o m e a c hc o l o n y Hvbridized c o m p l e m e n t a rD y NAs

N i t r o c e l l u l o sfei l t e r

Wash away labeledDNA that does not hybridizeto DNA bound to filter

r"uorr autoradiography f

I

Performaut o r a d i o g r a p h y

o)

S i g n a la p p e a r so v e r p l a s m i dD N A t h a t i s complementary to probe

A EXPERIMENTAL FIGURE 5-16 cDNAlibrariescan be screened with a radiolabeledprobeto identifya cloneof interest.The a p p e a r a noc fea s p o to n t h ea u t o r a d i o g r ai nmd i c a t et hs ep r e s e n c e o f a r e c o m b i n acnl to n ec o n t a i n i nDgN Ac o m p l e m e n t a t or yt h e probeTheposition of the spoton the autoradioqram isthe mirror

i m a g eo f t h ep o s i t i oonf t h a tp a r t i c u l a c lro n eo n t h eo r i g i n aple t r i dish(although for easeof comparison, it isnot shownreversed h e r e )A. l i g n i ntgh ea u t o r a d i o g r awm i i s hw i l l i t ht h eo r i g i n aple t r d locatethe corresponding clonefromwhichE colicellscanbe recovered

this labeledprobe hybridizesro any complemenrarynucleic acid strandsbound to the membrane.Any excessprobe that doesnot hybridize is washedaway, and the labeledhybrids are detectedby autoradiography of the filter. This technique can be usedto screenboth genomicand cDNA libraries,but is most commonly usedto isolatespecificcDNAs. ClearlS identification of specific clones by the membrane-hybridizationtechnique depends on the availa b i l i t y o f c o m p l e m e n r a r yr a d i o l a b e l e d p r o b e s . F o r a n oligonucleotideto be useful as a probe, ir must be long enough for its sequenceto occur uniquely in the clone of interest and not in any other clones. For most purposes, this condition is satisfied by oligonucleotidescontaining a b o u t 2 0 n u c l e o t i d e s .T h i s i s b e c a u s ea s p e c i f i c2 0 - n u c l e o t i d e s e q u e n c eo c c u r s o n c e i n e v e r y 4 2 0 ( = 1 0 1 2 )n u cleotides.Since all genomesare much smaller (=3 x t0e nucleotidesfor humans),a specific20-nucleotidesequence in a genomeusually occurs only once. With automated ins t r u m e n t s n o w a v a i l a b l e , r e s e a r c h e r sc a n p r o g r a m t h e chemicalsynthesisof oligonucleotidesof specificsequence up to about 100 nucleotideslong. Longer probes can be preparedby the polymerasechain reaction (pCR), a widely

usedtechniquefor amplifying specificDNA sequences rhat is describedlater. How might an investigator design an oligonucleotide probe to identify a clone encoding a particular protein? It helps if all or a portion of the amino acid sequenceof the protein is known. Thanks to the availability of the complete genomic sequencesfor humans and some important model organisms such as the mouse, Drosophila, and the roundworm Caenorbabditis elegans,a researchercan use an appropriate computer program to searchthe genomic sequence database for the coding sequencethat corresponds to the amino acid sequenceof the protein under study. If a match is found, then a single, unique DNA probe based on this known genomic sequencewill hybridize perfectly with the clone encoding the protein of interest.

182

.

cHAprER s

I

M o l E c u L A RG E N E T rI cE c H N t e u E S

YeastGenomicLibrariesCan Be Constructed with Shuttle Vectorsand Screenedby F u n c t i o n aC l omplementation In somecasesa DNA library can be screenedfor the ability to express a functional protein that complements a recessive

Polylinker

(a)

Shuttlevector

CEN (b)

l^

dNos mil$

mmrs

Yeastgenomic DNA

Transform E. coli Screenfor amoicillinresistance 'as\ +

*

***

I lsolateandpoolrecombinant from 105transformed I plasmids { F. colicolonies complementation Assayyeastgenomiclibraryby functional

5-17 A yeastgenomiclibrarycan be < EXPERIMENTAL FIGURE plasmid vector that can replicatein shuttle in a constructed shuttlevector of a typicalplasmid yeastand E.coli.(a)Components genesThepresence of a yeastoriginof for cloningSaccharomyces (CEN) (ARS) allowsstable anda yeastcentromere DNAreplication isa yeast yeast included Also in andsegregation replication markersuchasURA3,whichallowsa ura3 mutantto selectable sequences thevectorcontains growon mediumlackinguracilFinally, in E.coli(ORlandamp')anda polylinker andselection for replication (b)Typical protocol for of yeastDNAfragments. for easyinsertion yeast of total digestion genomic Partial yeast library a constructing with an fragments to generate genomic DNAwith5au3Aisadjusted to acceptthe sizeof about10 kb Thevectorisprepared average the whichproduces with BamHl, genomic by digestion fragments E. coli that clone of transformed samestickyendsas5au3A.Each a singletype contains resistance for ampicillin growsafterselection of yeastDNAfragment in a genomic DNA fragment inserted into a plasmid vector. To construct a plasmid genomic library that is to be screenedby functional complementationin yeast cells,the plasmid vector must be capable of replication in both E. coli cells and yeast cells. This type of vector' capable of propagation in two different hosts, is called a shuttle vector. The structure of a typical yeast shuttle vector is shown in Figure 5-L7a. This vector contains the basic elements that permit cloning of DNA fragmentsin E- coli.In addition, the shuttle vector contains an autonomouslyreplicating sequence(ARS), which functions as an origin for DNA replication in yeast; a yeast centromere (called CEN), which allows faithful segregationof the plasmid during yeastcell division; and a yeastgeneencodingan enzymefor uracil synthesis (URA3), which serves as a selectable marker in an approprlate yeastmutant. To increasethe probability that all regions of the yeast genome are successfullycloned and represented in the plasmid library, the genomic DNA usually is only partially digest.d to yield overlapping restriction fragments of =tb t U. These fragments are then ligated into the shuttle vector in which the polylinker has been cleavedwith a restriction enzymethat produces sticky ends complementary to those on the yeast DNA fragments (Figure 5-17b). Becausethe 10-kb restriction fragmentsof yeastDNA are incorporated into the shuttle u.ito., randomly, at least 10s E. coli colonies,each containing a particular recombinant shuttle vector, are necessaryto assurethat each region of yeast DNA has a high probability of being representedin

the library at least once. mutation. Sucha screeningstrategywould be an efficientway Figure 5-18 outlines how such a yeast genomic library to isolate a cloned genethat correspondsto an interestingrecan be screenedto isolate the wild-type gene corresponding cessivemutation identified in an experimental organism. To one of the temperature-sensitivecdc mutations mentioned to illustrate this method, referredto as functional complementain this chapter. The starting yeast strain is a double earlier E. coli tion, we describehow yeast genescloned in special that requires uracil for growth due to a ura3 mttamutant identify yeast cells to plasmidscan be introduced into mutant is temperature-sensitivedue to a cdc28 mutation and tion strain. in the mutant the wild-type genethat is defective by its phenotype (see Figure 5-6). Recombinant identified purpose of screening for the Libraries constructed from the yeast genomic library are mixed isolated plasmids from constructed are among yeast gene sequencesusually genomic DNA rather than cDNA. BecauseSaccharomyces with yeast cells under conditions that promote transformation of the cells with foreign DNA. Sincetransformed yeast genesdo not contain multiple introns, they are sufficiently cells carry a plasmid-borne copy of the wild-type URA3 compact that the entire sequenceof a genecan be included D N A C L O N I N GA N D C H A R A C T E R I Z A T I O N

183

Libraryof yeast genomic DNA carrying URA3selectivemarker

Temperature-sensitive cdc-mutant yeast; ura3 (requiresuracil)

Transformyeast by treatmentwith LiOAC,PEG.and heat shocr Plateand incubateat permissivetemperature o n m e d i u m l a c k i n gu r a c i l

Only colonies carrYtng a URA3 marker are able to grow

23'C

R e p l i c a - p l a taen d incubateat nonpermissive te m perature

Only colonies carrying a wild-type CDC gene are able to grow

36'C

EXPERIMENTAL FIGURE 5-18 Screening of a yeastgenomic libraryby functionalcomplementation can identifyclones carryingthe normalform of a mutantyeastgene.Inthis example, a wild-type CDCgeneis isolated by complementation of a cdcyeastmutant TheSaccharomyces strainusedfor screentng rne yeastlibrary carries ura3 anda temperature-sensitive cdcmutation Thismutantstrainisgrownandmaintained at a permisstve (23"C) Pooled temperature plasmids prepared recombinant as

shownin Figure 5-17arerncubated with the mutantyeastcellsunder conditions thatpromotetransformation Therelatively few transformed yeastcells, plasmid whichcontainrecombinant DNA. cangrowin theabsence of uracilat 23 'C Whentransformed yeast colonies arereplica-plated andplacedat 36'C (a nonpermissrve temperature), onlyclones carrying a libraryplasmid thatcontains the wild-type copyof the CDCgenewillsurviveL|OAC= lithiumacetate; PEG= polyethylene glycol

gene,they can be selectedby their ability to grow in the absenceof uracil. Typically, about 20 petri dishes, each containing about 500 yeast transformants, are sufficient to represent the entire yeast genome. This collection of yeast transformants can be maintained at 23"C, a temperature permissivefor growth of the cdc28 mutant. The entire colIection on 20 plates is then transferredto replica plates, which are placed at 36 "C, a nonpermissivetemperature for cdc mutants. Yeastcoloniesthat carry recombinant plasmids expressinga wild-type copy of the CDC28 genewill be able to grow at 36'C. Once temperature-resistant yeastcolonies have been identified, plasmid DNA can be extracted from the cultured yeast cells and analyzed by subcloning and DNA sequencing,topics we take up next.

the well into which the original DNA mixture was placed at the start of the electrophoreticrun. Smaller moleculesmove through the gel matrix more readily than larger molecules, so that molecules of different length migrate as distinct bands. Smaller DNA moleculesfrom about 10 to 2000 nucleotides can be separatedelectrophoretically on polyacrylamide gels, and larger molecules from about 200 nucleotidesto more than 20 kb on agarose gels. A common method for visualizingseparatedDNA bands on a gel is to incubatethe gel in a solution containing the fluorescentdye ethidium bromide. This planar moleculebinds to DNA by intercalating berweenthe base pairs. Binding concentratesethidium in the DNA and also increasesits intrinsic fluorescence.As a result, when the gel is illuminated with ultraviolet light, the regions of the gel containing DNA fluoresce much more brightly than the regionsof the gel without DNA. Once a cloned DNA fragment, especiallya long one, has beenseparatedfrom vector DNA, it often is treated with various restriction enzymesto yield smallerfragments.After separation by gel electrophoresis,all or some of these smaller fragments can be ligated individually into a plasmid vector and cloned in E. coli by the usual procedure. This process, known as subcloning,is an important step in rearranging parts of genesinto useful new configurations. For instance, an investigator who wants to change the conditions under which a geneis expressedmight usesubcloningto replacethe normal promoter associatedwith a cloned genewith a DNA segmentcontaining a different promoter. Subcloningalso can be used to obtain cloned DNA fragments that are of an appropriate length for determining the nucleotidesequence.

Gel Electrophoresis Allows Separationof Vector DNA from ClonedFragments In order to manipulate or sequencea cloned DNA fragment, it sometimesmust first be separatedfrom the vector DNA. This can be accomplished by cutting the recombinant DNA clone with the samerestriction enzymeusedto produce the recombinant vectors originally. The cloned DNA and vector DNA then are subjected to gel electrophoresis, a powerful method for separatingDNA moleculesof different size(Figure5-19). Near neutral pH, DNA molecules carry a large negative charge and therefore move toward the positive electrode during gel electrophoresis.Becausethe gel marrix restricrs random diffusion of the molecules, molecules of the same length migrate together as a band whose width equalsthat of '184 .

c H A p r E5 R | M o L E c u L AGRE N E TrtEc c H N t e u E s

(a)

DNA restrictionfragments

dKs

I n , u . " m i x t u r ei n t h ew e l lo f I a n a g a r o soer p o l y a c r y l a m i d e A n n l ve l e c t r ifci e l d I sel.

v Well

__l

- (Negativeelectrode)

Gelparticle

Pores

+ (Positive lectrode) M o l e c u l e sm o v e t h r o u g hp o r e s in gel at a rate inversely p r o p o r t i o n atlo t h e i r c h a i nl e n g t h

separates 5-19 Gel electrophoresis FIGURE < EXPERIMENTAL by DNA moleculesof different lengths.(a)A gel is prepared p o u r i n ga l i q u i dc o n t a i n i negi t h e rm e l t e da g a r o soer t w o g l a s sp l a t e sa f e w u n p o l y m e r i zaecdr y l a m i dbee t w e e n m i l l i m e t ear sp a r t A s t h e a g a r o sseo l i d i f i eosr t h e a c r y l a m i d e e v a l sf)o r m s p o l y m e r i z ienst op o l y a c r y l a m i ad eg ,e lm a t r i x( o r a n g o p o l y m e r s T h e d i m e n s i o nosf o f c h a i n s c o n s i s t i nogf l o n g ,t a n g l e d s ,r p o r e sd, e p e n do n t h e t h e i n t e r c o n n e c t icnhga n n e l o f t h e a g a r o soer a c r y l a m i dues e dt o f o r mt h e g e l concentration T h es e p a r a t ebda n d sc a nb e v i s u a l i z ebdy a u t o r a d i o g r a p(hi fyt h e n yt e f r a g m e n tasr er a d i o l a b e l eodr)b y a d d i t i o no f a f l u o r e s c e d ( e g , e t h i d i u mb r o m i d et )h a t b i n d st o D N A ( b )A p h o t o g r a pohf a ( E t B r )E t B rb i n d st o D N Aa n d g e ls t a i n e w d i t h e t h i d i u mb r o m i d e f l u o r e s c eusn d e rU Vl i g h t ,T h eb a n d si n t h ef a r l e f ta n df a r r i g h t f r a g m e n tosf k n o w ns i z e l a n e sa r ek n o w na s D N Al a d d e r s - D N A h e l e n g t ho f t h e D N A f o r d e t e r m i n i nt g t h a ts e r v ea sa r e f e r e n c e f r a g m e n tisn t h e e x p e r i m e n tsaal m p l eI P a r(tb )S c i e n cPeh o t o L i b r alr y

o- o - PI : o

-O-P:O

I o

I

o

- O - P I: O

- O - P I: O

I o Subjectto autoradiography or incubatewith fluorescentdye

I

-O-P:O

l o

ase

- O - PI : O I O

I

CH,

QH,

HH Signals corresponding to DNA bands

Deoxyribonucleoside triphosPhate (dNTP)

Dideoxyribonucleoside triphosPhate (ddNTP)

of deoxyribonucleoside 5-20 Structures FIGURE triphosphate (dNTP) dideoxyribonucleoside and triphosphate intoa growingDNA residue (ddNTP). of a ddNTP Incorporation at thatpoint elongation strandterminates D N A C L O N I N GA N D C H A R A C T E R I Z A T I O N

185

Technique Animation:DideoxySequencing of DNA{tttt (b)

P r i m e r5 ' T e m p l a t e3 ' -

5'

(a) 5'TAGCTGACTC3' 3' A T C G A C T G A G T C A A G A A C T A T T G G G C T T A A

I DNApolymerase

+ ddGTP

I | + dATB dGTB dCTB dTTp | + ddGTPin low concentration I

v 5'TAGCTGACTCAG3' 3' ATCGACTGAGTCAAGAACTATTGGGCTTAA

-A

-G

5 ' T A G C T G A CT C A GT T C + T T G 3 ' 3' ATCGACTGAGTCAAGAACTATTGGGCTTAA

_A

EG

-G

5' TAGCTGACTCAGTTJTTCNTNACCCG3' 3' ATCGACTGAGTCAAGAACTATTGGGCTTAA

-T

T

etc.

I

I

etc.

I

Denatureand separatedaughterstrandsby electrophoresis I N N N N A A T G A A TA G A T A T A T A G G G G A A T T G A G T 20 30 40

AAATAG 110

TTGG GTAA 120

ATGGT 130

GGTA

ATAG

GGGGAT

TGTTT 140

a EXPERIMENTAL FTGURE 5-21 ClonedDNAscan be sequencedby the Sangermethod, usingfluorescent-tagged dideoxyribonucleoside (ddNTps). triphosphates (a)A single (template) strandof the DNAto be sequenced (blueletters) is hybridized to a synthetic primer(blackletters) deoxyribonucleotide Theprimeriselongated in a reaction mixture containing thefour normaldeoxyribonucleoside triphosphates plusa relatively small amountof oneof thefourdideoxyribonucleoside triphosphates. ln thisexample, (yellow) ddGTP ispresentBecause of the relatively low concentration of ddGTP, incorporation of a ddGTBandthus chaintermination, occurs at a givenposition in the sequence only about1 percent of thetime Eventually the reaction mixture will containa mixture of prematurely (truncated) terminated dauqhter

186

CHAPTER 5

I

MOLECULAG RENETIC TECHNIQUES

T

TAGAGT

GA

TG

AGG

GTGAAATTGTTATGTAAA 150 160

AIG 80

AAG TTGAGTATT 90-

170

A

A

AA '180

I

AT

fragments endingat everyoccurrence of ddGTp(b)Toobtainthe complete sequence of a templateDNA,four separate reactions are performed, eachwith a different dideoxyribonucleoside triphosphate (ddNTP) TheddNTP thatterminates eachtruncated fragment canbe identified by useof ddNTPs taggedwith four differentfluorescent dyes(indicated (c)In an automated bycolored highlights). sequencing machine, thefourreaction mixtures aresubjected to gel electrophoresis, andtheorderof appearance of eachof thefour drfferent fluorescent dyesat the endof the gelis recordedShown hereisa sample printoutfroman automated sequencer fromwhich thesequence of theoriginal template DNAcanbe deduced fromthe sequence of thesynthesized strandN = nucleotide thatcannotbe (c)fromGriffiths assigned[Part et al, Figure 14-27 I

lsolation of a genomic library spanning the genome of interest A l i g n i n gl i b r a r yc l o n e s by hybridizationor restriction-site mapping

Ordered set of clones spanningthe genome

Sequencing of orderedclones

Genomicsequence > FIGURE 5-22 Two Strategies for Assembling WholeGenome Sequences. Onemethoddepends on isolating andassembling a set thatspanthe genomeThiscanbe doneby of clonedDNAsegments or by alignment of matching clonedsegments by hybridization restriction sitemapsTheDNAsequence of the ordered clones can genomic intoa complete The thenbe assembled sequence

of Sequencing r a n d o ml i b r a r yc l o n e s

Sequenceof unordered fragments, for about lO-fold coverageof eachgenomic segment

Aligning sequenced clonesby comPuter Assembled genomlcsequence DNA easeof automated on the relative methoddepends alternative the library stepof ordering the laborrous andbypasses sequencing sothateachsegment clones enoughrandomlibrary Bysequencing to it ispossible to 10 times genome from 3 is represented of the of the alignment by computer sequence thegenomrc reconstruct fragments verylargenumberof sequence

guished by their corresponding fluorescent label (Figure 521b). For example,all truncated fragmentsthat end with a G would fluoresce one color (e.g., yellow), and those ending with an A would fluoresceanother color (e.g',red), regardless The complete characterizationof any cloned DNA fragment requires determination of its nucleotide sequence.F. Sanger of their lengths. The mixtures of truncated daughter fragments from each of the four reactionsare subjectedto elecand his colleaguesdeveloped the method now most comtrophoresison specialpolyacrylamidegels that can separate monly used to determine the exact nucleotide sequenceof single-strandedDNA moleculesdiffering in length by only 1 DNA fragmentsup to =500 nucleotideslong. The basic idea nucleotide.A fluorescencedetector that can distinguish the behindthis method is to synthesizefromthe DNA fragmentto four fluorescenttags is located at the end of the gel. The sebe sequenceda set of daughterstrandsthat are labeledat one quence of the original DNA template strand can be deterend and differ in length by one nucleotide.Separationof the mined from the order in which different labeledfragmentsmitruncated daughterstrandsby gel electrophoresiscan then esgrate past the fluorescencedetector (Figure 5-21'c). tablish the nucleotidesequenceof the original DNA fragment. In order to sequencea long continuousregion of genomic Synthesisof truncated daughterstandsis accomplishedby triphosphates(ddNTPs). DNA or even the entire genomeof an organism, researchers use of 2',3'-dideoxyribonucleoside These molecules,in contrast to normal deoxyribonucleotides usually employ one of the strategiesoutlined in Figure 5-22. (dNTPs), lack a 3' hydroxyl group (Figure 5-20). Although The first method requiresthe isolation of a collection of cloned overlap. Once the sequence DNA fragmentswhose sequences ddNTPs can be incorporated into a growing DNA chain by oligonucleotidesbased is determined, fragments of these of one DNA polymerase,once incorporated they cannot form a for use as synthesized can be chemically sequence on that phosphodiesterbond with the next incoming nucleotide In fragments. overlapping the adjacent in sequencing primers triphosphate.Thus incorporation of a ddNTP terminates is determined DNA of long stretch of a sequence way, the this resulting at in a daughterstrand truncated chain synthesis, incrementally by sequencingof the overlapping cloned DNA specific positions correspondingto the basecomplementary fragments that compose it. A second method, which is called added ddNTP on the template strand. to the the time-consumbypasses whole genomeshotgunseqwencing, Sequencingusing the Sangerdideoxy chain-termination ing step of isolating an ordered collection of DNA segments method is usually carried out using an automated DNA sethat span the genome.This method involves simply sequencing quencing machine. The reaction begins by denaturing a random clones from a genomic library. A total number of double-strandedDNA fragment to generatetemplate strands for in vitro DNA synthesis.A syntheticoligodeoxynucleotide clonesare chosenfor sequencingso that on averageeach segabout 10 times.This degreeof ment of the genomeis sequenced is usedas the primer for the polymerizationreactionthat concoverageensuresthat eachsegmentof the genomeis sequenced tains a low concentrationof eachof the four ddNTPs in addimore than once.The entiregenomicsequenceis then assembled tion to higher concentrationsof the normal dNTPs. The using using a computeralgorithm that alignsall the sequences, ddNTPs are randomly incorporated at the positions of the their regionsof overlap.\7hole genomeshotgunsequencingis correspondingdNTP, causingtermination of polymerization of the fastestand most cost-effectivemethod for sequencinglong at thosepositionsin the sequence(Figure5-21,a).Inclusion stretchesof DNA, and most genomes'including the human fluorescenttagsof different colors on eachof the four ddNTPs genome,have beensequencedby this method. allows each set of truncated daughterfragmentsto be distin-

Rapidly C l o n e dD N A M o l e c u l e sA r e S e q u e n c e d b y t h e D i d e o x yC h a i n - T e r m i n a t i oMne t h o d

D N A C L O N I N GA N D C H A R A C T E R I Z A T I O N

187

TechniqueAnimation: PolymeraseChain Reaction{tttt

c Y c l e1

, Denaturationof DNA I A n n e a l i n go f p r i m e r s

E l o n g a t i o no f p r i m e r s

I

c Y c l e2

, Denaturationof DNA I A n n e a l i n go f p r i m e r s

Elongationof primers

{

G Y c l e3

< EXPERIMENTAL FIGURE 5-23 The polymerase chainreaction(PCR) is widely used to amplifyDNAregionsof known sequences. Toamplifya specific regionof DNA,an investigator willchemically primers synthesize two different oligonucleotrde complementary to (designated sequences of approximately 18 bases flankingtheregionof interest aslightblue anddarkbluebars)Thecomplete reaction iscomposed of a complex mixture of doublegenomic stranded DNA(usually DNAcontaining thetargetsequence of interest), a stoichiometric excess of bothprimers, thefourdeoxynucleoside triphosphates, anda heatstableDNApolymerase knownasTaqpolymerase. DuringeachPCRcycle, the reaction mixture isfirstheatedto separate thestrands andthencooledto allowtheprimers to bindto complementary sequences flanking the regionto beamplified. Iaq polymerase thenextends eachprimerfromits3' end,generating newlysynthesized strands thatextendin the3' direction to the 5' endof thetemplate strand.Duringthethirdcycle, two double-stranded DNAmolecules aregenerated equalin lengthto thesequence of theregionto beamplified Ineachsuccessive cyclethetargetsegment, whichwillannealto theprimers, isduplicated, andwilleventually vastlyoutnumber allotherDNAsegments in thereaction mixture Successive PCRcycles canbeautomated bycycling the reaction for timedintervals at high temperature for DNAmeltingandat a definedlowertemperature for theannealing and portions elongation of thecycleA reaction thatcycles 20 timeswillamplifythespecific target sequence 1-million-fold

, Denaturationof DNA I n n n e a t i n so f p r i m e r s

E l o n g a t i o no f p r i m e r s

I

L

Cycles4, 5, 6, etc.

T h e P o l y m e r a sC e h a i nR e a c t i o nA m p l i f i e sa SpecificDNA Sequencefrom a ComplexMixture If the nucleotide sequencesat the ends of a parricular DNA region are known, the intervening fragment can be amplified directly by the polymerase chain reaction (PCR). Here we describethe basic PCR technique and three situations in which it is used. 188

.

cHAprER s

I

M o L E c u L AG R E N E I cr E c H N t e u E s

The PCR dependson the ability to alternately denature (melt) double-strandedDNA moleculesand hybridizecomplementary singlestrandsin a controlled fashion. As outlined in Figure5-23, a typical PCR procedurebeginsby heat-denaturation of a DNA sampleinto singlestrands.Next, two synthetic oligonucleotidescomplementaryto the 3' ends of the target DNA segmentof interestare addedin greatexcessto the denatured DNA, and the temperarure is lowered to 50-60 'C. Thesespecificoligonucleotides,which are at a very high concentration,will hybridizewith their complementarysequences in the DNA sample, whereas the long strands of the sample DNA remain apart becauseof their low concentration.The hybridized oligonucleotidesthen serveas primers for DNA chain synthesisin the presenceof deoxynucleotides(dNTPs) and a temperature-resistantDNA polymerase such as that from Thermusaquaticus(a bacteriumthat livesin hot springs).This enzymq called Taq polymerase, can remain active even after being heatedto 95 oC and can extend the primers at temperaturesup to72"C. When synthesisis complete,the whole mixture is then heatedto 95 "C to denaturethe newly formed DNA duplexes.After the temperatureis lowered again, another cycle of synthesistakes place becauseexcessprimer is still present. Repeated cycles of denaturation (heating) followed by hybridization and synthesis(cooling) quickly amplify the sequence of interest. At each cycle, the number of copies of the sequencebetweenthe primer sitesis doubled; therefore, the desired sequenceincreasesexponentially-about a million-fold after 20 cycles-whereas all other sequencesin the original DNA sampleremain unamplified. Direct lsolation of a Specific Segment of Genomic DNA For organismsin which all or most of the genome has been sequenced,PCR amplification starting with the total genomic DNA often is the easiestway to obtain a specificDNA region of interest for cloning. In this application, the two oligonucleotideprimers are designedto hybridize to sequences flanking the genomic region of interest and to include sequences

Regionto be amplified 5'

3'

P r i m e r1

D N As y n t h e s i s

s'

5'

P r i m e r2

5-24 A specifictarget region in total FIGURE < EXPERIMENTAL genomicDNAcan be amplifiedby PCRfor usein cloning.Each to oneendof thetargetsequence primerfor PCRiscomplementary that enzyme for a restriction sequence the recognition andincludes primer doesnot havea sitewithinthetargetregion.In thisexample, primer2 contains a Hindlll whereas a BamHl sequence, 1 contains (Notethatfor clarity, icationof only in anyround,amplif sequence isshown,the onein brackets oneof thetwo strands ) After aretreatedwith appropriate thetargetsegments amplification, generating with stickyendsThese fragments restriction enzymes, plasmid vectors andcloned into complementary canbe incorporated (seeFigure 5-13). in E colibythe usualprocedure

c

Prime1 r

C o n t i n u ef o r = 2 0 PCRcycles Cut with restriction enzymes

Stickyend

-Stickyend Ligatewith plasmidvector with stickyends

that are recognizedby specificrestriction enzymes(Figure 524). After amplification of the desired target sequencefor about 20 PCR cycles,cleavagewith the appropriate restriction enzymesproduces sticky ends that allow efficient ligation of the fragment into a plasmid vector cleaved by the same restriction enzymesin the polylinker. The resulting recombinant plasmids,all carrying the identical genomic DNA segment,can then be cloned in E. coli cells.\fith certain refinements of the PCR, even DNA segmentsgreater than 10 kb in length can be amplified and cloned in this way. Note that this method does not involve cloning of large numbers of restriction fragments derived from genomic DNA and their subsequentscreeningto identify the specificfragment of interest. In effect, the PCR method inverts this traditional approach and thus avoids its most tedious aspects.The PCR method is useful for isolating genesequencesto be manipulated in a variety of useful ways describedlater. In addition the PCR method can be used to isolate gene sequencesfrom mutant organismsto determinehow they differ from the wild type. A variation on the PCR method allows PCR amplification of a specificcDNA sequencefrom cellular mRNAs. This

method, known as reuersetranscriptase-PcR /R?PCR/, begins with the same procedure describedpreviously for isolation of cDNA from a collection of cellular mRNAs' Typically' an oligo-dT primer, which will hybridize to the 3' poly(A) tail of the mRNA, is used as the primer for the first strand of cDNA synthesisby reversetranscriptase.A specific cDNA can then be isolatedfrom this complex mixture of cDNAs by PCR amplification using two oligonucleotide primers designedto match sequencesat the 5' and 3' ends of the corresponding mRNA. As described previously, these primers could be designedto include restriction sitesto facilitate the insertion of amplified cDNA into a suitableplasmid vector. Preparation of Probes Earlier we discussedhow oligonucleotide probes for hybridization assayscan be chemically synthesized.Preparation of such probes by PCR amplification requires chemical synthesisof only two relatively short primers corresponding to the two ends of the target sequence. The starting sample for PCR amplification of the target sequencecan be a preparation of genomic DNA, or a preparation of cDNA synthesizedfrom the total cellular 32PmRNA. To generatea radiolabeled product from PCR, labeled dNTPs are included during the last several amplification cycles.Becauseprobes prepared by PCR are relatively 3'P atoms incorporated into long and have many radioactive them, theseprobes usually give a stronger and more specific signal than chemically synthesizedprobes. Tagging of Genes by Insertion Mutations Another useful application of the PCR is to amplify a "tagged" gene from the genomic DNA of a mutant strain. This approach is a simpler method for identifying genesassociatedwith a particular mutant phenotype than screening of a library by functionalcomplementation(seeFigure5-18). The key to this use of the PCR is the ability to produce mutations by insertion of a known DNA sequenceinto the genome of an experimental organism. Such insertion mutations can be generated by use of mobile DNA elements, which can move (or transpose)from one chromosomal site to another. As discussedin more detail in Chapter 5, these DNA sequencesoccur naturally in the genomesof most organisms and may give rise to loss-of-function mutations if they transposeinto a protein-coding region. For example, researchershave modified a Drosophila mobile DNA element, known as the P element, to optimize D N A C L O N I N GA N D C H A R A C T E R I Z A T I O N

r89

> EXPERIMENTAL FIGURE 5-25 The genomic sequenceat the insertionsite of a transposon is revealedby PCRamplificationand Restriction sites:t sequencing. Toobtainthe DNAsequence of the insertion siteof a P-element transooson it is necessary to PCR-amplify thejunctionbetween knowntransposon sequences andunknown flankingchromosomal sequences Onemethodto achieve thisisto cleave genomic DNAwith a restriction enzyme thatcleaves oncewithinthe transposon sequence Ligation of the resulting restriction fragments willgenerate circular DNA molecules. Byusingappropriately designed DNA primers thatmatchtransposon sequences it is possible junction to PCR-amplify the desired fragmentFinally, (see a DNAsequencing reaction Figure 5-21)is performed usrngthe PCR-amplified fragmentasa template andan oligonucleotide primerthat matches sequences neartheendof the transposon, to obtainthesequence of thejunction between thetransposon andchromosome

I ransDoson

I cr, *it, I

restriction enzyme

Ligate to circularize

PCRprimers

Sequencing pflmer

I PCRamplification with Orimers to transposon I

-+

its use in the experimental generation of insertron mutations. Once it has been demonstratedthat insertion of a P element causesa mutation with an interestingphenotype, the genomic sequencesadjacentto the insertion site can be amplified by a variation of the standardPCR protocol that usessyntheticprimers complementaryto the known P-element sequencebut that allows unknown neighboring sequencesto be amplified. One such method, depicted in Figure 5-25, beginsby cleavingDrosophila genomic DNA containing a P-elementinsertion with a restriction enzyme that cleavesonce within the P-elementDNA. The collection of cleaved DNA fragmenrs treated with DNA ligase yields circular molecules,some of which will contain P-element DNA. The chromosomal region flanking the P element can then be amplified by PCR using primers that match P-elementsequencesand are elongatedin opposite directions. The sequenceof the resulting amplified fragment can then be determined using a third DNA primer. The crucial sequencefor identifying the site of P-element insertion is the junction between the end of the P-element and genomic sequences.Overall, this approach avoids the cloning of large numbers of DNA fragments and their screeningto detect a cloned DNA correspondingto a mutated geneof interest. Similar methods have been applied to other organrsms for which insertion mutations can be generatedusing either mobile DNA elements or viruses with sequencedgenomes that can insertrandomly into the genome. 190

CHAPTER 5

|

MOLECULAG R E N E T TTCE C H N T Q U E S

DNA Cloning and Characterization r In DNA cloning, recombinant DNA molecules are formed in vitro by inserting DNA fragments into vecror DNA molecules.The recombinant DNA molecules are then introduced into host cells, where they replicate, producing large numbers of recombinant DNA molecules. r Restriction enzymes (endonucleases)typically cut DNA at specific4- to 8-bp palindromic sequences,producing defined fragments that often have self-complementarysinglestrandedtails (stickyends). I Two restriction fragments with complementary ends can be joined with DNA ligase to form a recombinant DNA molecule(seeFigure 5-12). t E. coli cloning vectors are small circular DNA molecules (plasmids)that include three functional regions:an origin of replication, a drug-resistancegene, and a site where a DNA fragmentcan be inserted.Transformedcellscarrying a vector grow into colonieson the selectionmedium (seeFigure5-13). r A cDNA library is a set of cDNA clones prepared from the mRNAs isolated from a particular type of tissue. A genomic library is a set of clones carrying restriction fragments produced by cleavageof the entire genome. r In cDNA cloning, expressed mRNAs are reversetranscribedinto complementaryDNAs, or cDNAs. By a series of reactions,single-strandedcDNAs are converted into

double-strandedDNAs, which can then be ligated into a plasmidvector (seeFigure5-15). r A particular cloned DNA fragment within a library can be detected by hybridization to a radiolabeledoligonucleotidewhose sequenceis complementaryto a portion of the fragment(seeFigure5-16). r Shuttle vectors that replicate in both yeast and E. coli can be used to construct a yeastgenomic library. Specificgenes can be isolated by their ability to complementthe correspondingmutant genesin yeastcells(seeFigure5-17). r Long cloned DNA fragments often are cleavedwith restriction enzymes,producing smallerfragmentsthat are then separatedby gel electrophoresisand subclonedin plasmid vectorsprior to sequencingor experimentalmanipulation. r DNA fragmentsup to about 500 nucleotideslong are sequenced in automated instruments based on the Sanger (dideoxychain-termination)method (seeFigure5-21). r lil/hole genome sequencescan be assembledfrom the sequencesof a large number of overlappingclones from a genomiclibrary (seeFigure 5-22). r The polymerasechain reaction(PCR)permitsexponential amplification of a specificsegmentof DNA from just a single initial template DNA molecule if the sequenceflanking the DNA regionto be amplifiedis known (seeFigure5-23). r PCR is a highly versatilemethod that can be programmed to amplify a specificgenomicDNA sequence,a cDNA, or a sequenceat the junction betweena transposableelement and flanking chromosomalsequences.

EE UsingClonedDNAFragments to StudyGeneExpression In the last sectionwe describedthe basictechniquesfor using recombinantDNA technologyto isolatespecificDNA clones, and ways in which the clones can be further characterized.

Now we considerhow an isolatedDNA clone can be usedto study geneexpression.We discussseveralwidely usedgeneral techniquesthat rely on nucleic acid hybridization to elucidate when and where genesare expressed,as well as methods for generatinglarge quantitiesof protein and otherwisemaniputo determinetheir expressionpatlating amino acid sequences terns,structure,and function. More specificapplicationsof all thesebasictechniquesare examinedin the following sections.

s e r m i tD e t e c t i o no f H y b r i d i z a t i o nT e c h n i q u eP F r a g m e n t s a n d mRNAs S p e c i f i cD N A Two very sensitivemethodsfor detectinga particular DNA or RNA sequencewithin a complex mixture combine separation and hybridizationwith a complementary by gel electrophoresis probe. A third method involveshybridizing DNA radiolabeled labeledprobesdirectly onto a preparedtissuesample.\Wewill encounter referencesto all three of these techniques,which have numerousapplications,in other chapters. Southern Blotting The first hybridizationtechniqueto detect DNA fragments of a specific sequenceis known as Southern blotting after its originator E. M. Southern.This techniqueis capable of detecting a single specific restriction fragment in the highly complex mixture of fragments produced by cleavageof the entire human genomewith a restrictionenzyme.When sucha complex mixture is subjectedto gel electrophoresis,so many different fragmentsof nearly the same length are presentit is not possibleto resolveany particular DNA fragmentsas a discrete band on the gel. Neverthelessit is possibleto identify a particular fragmentmigrating as a band on the gel by its ability to hybridize to a specificDNA probe. To accomplish this, the restriction fragments present in the gel are denatured with alkali and transferredonto a nitrocellulosefilter or nylon membraneby blotting (Figure 5-26). This procedurepreservesthe distribution of the fragmentsin the gel, creatinga replica of the gel on the filter. (The blot is usedbecauseprobesdo not readily diffuseinto the original gel.)The filter then is incubatedunder hybridization conditions with a specificradiolabeledDNA probe, which usually is

DNA I I Cleavewith restriction enzymes I Gel V

Autoradiogram

Ni t r o c e l l luo s e Ni t r o c e l l luo s e Gel ----.f----

Hybridizewith l a b e l e dD N A o r R N Ap r o b e

---r---T---T

A l k a l i n es o l u t i o n C a p i l l a r ya c t i o nt r a n s f e r s DNAfrom gelto nitrocellulose

FIGURE A EXPERIMENTAL 5-25 Southernblot techniquecan detecta specificDNAfragmentin a complexmixtureof threedifferent restrictionfragments.Thediagram depicts to fragments in the gel,butthe procedure canbe applied restriction

that of DNAfragmentsOnlyfragments of millions a mixture probewillgivea signalon an autoradiogram to a labeled hybridize mRNAs specifrc blottingdetects calledtVorthern technique A similar J Mol Blol98:508 1975, l withina mixturelseeE M Southern,

U S I N GC L O N E DD N A F R A G M E N TTSO S T U D YG E N EE X P R E S S I O N

191

generatedfrom a cloned restriction fragment. The DNA restriction fragmentthat is complementaryto the probe hybridizes,and its location on the filter can be revealedby autoradiography. Northern Blotting One of the most basicways to characterize a cloned geneis to determinewhen and where rn an organism the geneis expressed.Expressionof a particular genecan be followed by assayingfor the corresponding mRNA by Northern blotting, named, in a play on words, after the related method of Southern blotting. An RNA sample, often the total cellular RNA, is denatured by treatment with an agent such as formaldehyde that disrupts the hydrogen bonds between base pairs, ensuring that all the RNA moleculeshave an unfolded, linear conformation. The individual RNAs are separated according to size by gel electrophoresisand transferred to a nitrocellulose filter to which the extendeddenatured RNAs adhere.As in Southernbloning, the filter then is exposedto a labeled DNA probe that is complementaryto the geneof interest; finally, the labeled filter is subjected to autoradiography. Becausethe amount of a specificRNA in a samplecan be estimated from a Norrhern blot, the procedureis widely used ro compare the amounts of a particular mRNA in cells under differentconditions(Figure5-27). In Situ Hybridization Northern blotting requiresextracring the mRNA from a cell or mixture of cells,which meansthat the cellsare removedfrom their normal location within an orsan-

UN

{k

5kb-

2kb-

ism or tissue.As a result, the location of a cell and its relation to its neighbors is lost. To retain such positional information in precisestudiesof geneexpression,a whole or sectionedtissueor evena whole permeabilizedembryo may be subjectedto in situ hybridization to detect the mRNA encoded by a particular gene.This technique allows genetranscription to be monitored in both time and space(Figure5-28).

D N A M i c r o a r r a y sC a nB e U s e dt o E v a l u a t et h e E x p r e s s i o on f M a n y G e n e sa t O n e T i m e Monitoring the expressionof thousandsof genessimultaneously is possiblewith DNA microarray analysis,another technique based on the concept of nucleic acid hybridization. A DNA microarray consists of an organized array of thousands of individual, closely packed gene-specific sequencesattached to the surfaceof a glassmicroscopeslide. By coupling microarray analysis with the results from genome sequencing projects, researchers can analyze the global patterns of gene expression of an organism during specificphysiological responsesor developmentalprocesses. Preparation of DNA Microarrays In one methodfor preparing microarrays,an =1-kb portion of the coding region of each gene analyzedis individually amplified by the PCR. A robotic deviceis used to apply each amplified DNA sample to the surface of a glass microscope slide, which then is chemically processedto permanently attach the DNA sequencesto the glasssurfaceand to denature them. A typical array might contain =6000 spotsof DNA in a2 x 2- cm grid. In an alternative merhod, multiple DNA oligonucleotides, usually at least 20 nucleotides in length, are synthesizedfrom an initial nucleotide that is covalently bound to the surface of a glass slide. The synthesisof an oligonucleotide of specific sequencecan be programmed in a small region on the surfaceof the slide. Severaloligonucleotidesequencesfrom a singlegeneare thus synthesizedin neighboring regions of the slide to analyzeexpressionof that gene. Vith this method, oligonucleotidesrepresentingthousands of genescan be produced on a singleglassslide. Becausethe methods for constructing these arrays of synthetic oligonucleotideswere adapted from methods for manufacturing microscopic integrated circuits used in computers, these types of oligonucleotidemicroarrays are often called DNA chips.

1kb-0.6s kb -

w

t-flHl,.'l'"

A EXPERIMENTAL FIcURE5-27 Northernblot analysisreveals increased expression of p-globinmRNAin differentiated erythroleukemia cells.ThetotalmRNAin extracts of erythroleukemia cellsthatweregrowingbut uninduced andin cells induced to stopgrowingandallowedto differentiate for 4g hoursor 96 hourswasanalyzed by Northern blottingfor B-globin mRNAThe density of a bandisproportional to theamountof mRNApresent TheB-globin mRNAisbarelydetectable in uninduced cells(UNlane) but increases morethan1000-fold by 96 hoursafterdifferentiation is induced[Courtesy of L Kole] 192

.

cHAprER 5

|

M o L E c u L AG R E N E T tr cE c H N t e u E s

Using Microarrays to Compare Gene Expression under Different Conditions The initial stepin a microarrayexpression study is to preparefluorescentlylabeledcDNAs corresponding to the mRNAs expressedby the cellsunder study.When the cDNA preparation is applied to a microarray,sporsrepresenting genesthat are expressedwill hybridize under appropriate conditions to their complementarycDNAs in the labeledprobe mix, and can subsequentlybe detectedin a scanninglasermicroscope. Figure 5-29 depicts how this method can be applied to examine the changes in gene expression observed after starved human fibroblasts are transferred to a rich, serumcontaining, growth medium. In this type of experiment, the separatecDNA preparations from starvedand serum-grown

(c)

DorsaI Head

NT

Notochord

A EXPERIMENTAL FIGURE 5-28 In situ hybridizationcandetect activityof specificgenesin whole and sectionedembryos.The s p e c i m ei n s p e r m e a b i l i zbeydt r e a t m e nwt i t h d e t e r g e natn da protease to expose the mRNAto the probeA DNAor RNAprobe, s p e c i f ifco r t h e m R N Ao f i n t e r e sits, m a d ew i t h n u c l e o t i daen a l o g s c o n t a i n i ncgh e m i c aglr o u p tsh a tc a nb e r e c o g n i z ebdy a n t i b o d i e s A f t e rt h e p e r m e a b i l i zsepde c i m ehna sb e e ni n c u b a t ewdi t ht h e p r o b eu n d e cr o n d i t i o nt h s a tp r o m o t e hybrid z a t i o nt,h ee x c e s s p r o b ei s r e m o v ew d i t ha s e r i eosf w a s h e sT h es p e c i m ei n st h e n i n c u b a t ei d n a s o l u t i ocno n t a i n i nagn a n t i b o dtyh a tb i n d st o t h e p r o b eT hs a n t i b o diysc o v a i e n tl loyi n e dt o a r e p o r t eern z y m (ee g , se h o r s e r asdh p e r o x i d a o r a l k a l i npeh o s p h a t a st hea) tp r o d u c eas productAfterexcess coloredreaction antibodyhasbeenremoved,

drecipitate o r t h e r e p o r t eern z y m iesa d d e dA c o l o r e p s u b s t r a tf e f o r m sw h e r et h e p r o b eh a sh y b r i d i z et od t h e m R N Ab e i n g d e t e c t e d( a )A w h o l em o u s e m b r y oa t a b o u t1 0 d a y so f probedfor Sonichedgehog mRNAThestainmarks development ( r e d a l o n gt h e m e s o d e r rmu n n i n g a r o d o f a r r o w ) , t h en o t o c h o r d f u t u r es p i n acl o r d ( b )A s e c t i oonf a m o u s e m b r y os i m i l atro t h a t i n o a r t( a ) T h ed o r s a l / v e n tar xailso f t h e n e u r atlu b e( N T c) a nb e (redarrow) notochord seen,with the Sonichedgehog-expressing ( b l u e v e n t r a (l c )A s t i l f l a r t h e r a r r o w ) e n d o d e r m b e l o wi t a n dt h e during embryoprobedfor an mRNAproduced wholeDrosophila is patternof bodysegments Therepeating tracheadevelopment of L visibleAnterior(head)is up,ventralisto the left Icourtesy andN/ P Scott Milenkovic l

fibroblastsare labeledwith differently colored fluorescent dyes.A DNA array comprising8600 mammaliangenesthen is incubatedwith a mixture containingequal amountsof the t w o c D N A p r e p a r a t i o n su n d e r h y b r i d i z a t i o nc o n d i t i o n s . After unhybridizedcDNA is washed away, the intensity of green and red fluorescenceat each DNA spot is measured microscopeand storedin computerfiles using a fluorescence under the name of eachgeneaccordingto its known position on the slide.The relativeintensitiesof red and greenfluorescencesignalsat eachspot are a ffreasureof the relativelevel of expressionof that genein resp()nseto serum.Genesthat are not transcribedunder thesegrowth conditions give no detectablesignal. Genesthat are transcribed at the same level under both conditions will hybridize equally to both r e d a n d g r e e n - l a b e l e dc D N A p r e p a r a t i o n s .M i c r o a r r a y analysisof geneexpressionin fibroblastsshowedthat transcriptionof about 500 of the 8600 genesexaminedchanged substantiallyafter addition of serum.

the many different changesin cell physiology that occur when cells are transferred from one medium to another. I n o t h e r w o r d s , g e n e st h a t a p p e a rt o b e c o - r e g u l a t e di n a s i n g l e m i c r o a r r a y e x p r e s s i o ne x p e r i m e n t m a y u n d e r g o changesin expressionfor very different reasonsand may a c t u a l l y h a v e v e r y d i f f e r e n t b i o l o g i c a l f u n c t i o n s .A s o l u t i o n t o t h i s p r o b l e m i s t o c o m b i n et h e i n f o r m a t i o n f r o m a set of expressionarray experimentsto find genesthat are similarly regulated under a variety of conditions or over a oeriod of time. This more informative use of multiple expressionarray experiments is illustrated by examining the relative expression of the 8600 genesat different times after serum addition, generatingmore than 104 individual piecesof data. A computer program, relatedto the one usedto determinethe can organizethese of differentprotein sequences' relatedness over the expression genes show similar that data and cluster cluster such Remarkably, serum addition. after time course particproteins genes whose encoded groups sets of analysis ipate in a common cellular process, such as cholesterol biosynthesisor the cell cycle (Figure5-30).

C l u s t e rA n a l y s i so f M u l t i p l e E x p r e s s i o n E x p e r i m e n t sl d e n t i f i e sC o - r e g u l a t e G d enes F i r m c o n c l u s i c l n sr a r e l y c a n b e d r a w n f r o m a s i n g l e m i c r o a r r a y e x p e r i m e n t a b o u t w h e t h e r g e n e st h a t e x h i b i t s i m i l a r c h a n g e si n e x p r e s s i o na r e c o - r e g u l a t e da n d h e n c e likely to be closely related functionally. For example, m a n y o f t h e o b s e r v e dd i f f e r e n c e si n g e n e e x p r e s s i o nj u s t e fs d e s c r i b e di n f i b r o b l a s t sc o u l d b e i n d i r e c t c o n s e < r u e n c o

analysiswill be a powerful F.i In the future, microarray di"enustic tool in medicine. For instance,particular fiil setsof .RXRt have beenfound to distinguishtumors with a poor prognosisfrom those with a good prognosis.Previously indistinguishablediseasevariations are now detectable' Analysisof tumor biopsiesfor thesedistinguishingmRNAs

U S I N GC L O N E DD N A F R A G M E N TTSO S T U D YG E N EE X P R E S S I O N .

193

Technique Animation:Synthesizing an Oligonucleotide Array flllt TechniqueAnimation: Screeningfor Patternsof Gene Expression Fibroblasts w i t h o u ts e r u m

I

t s o t a tteo t a tm R N A I

+

Reverse-transcribe I to cDNA labeledwith lr/ a fluorescentdye {

Green dye--J

cDNAs hvbridized to DNAs for a single gene

J I I

Hybridizeto DNA mrcroarray

< EXPERIMENTAL FIGURE 5-29 DNAmicroarrayanalysiscan revealdifferencesin gene expressionin fibroblastsunder differentexperimentalconditions.(a)In thisexample, cDNA prepared frommRNAisolated fromfibroblasts eitherstarved for serumor afterserumadditionislabeled with different fluorescent dyesA microarray composed of DNAspotsrepresenting 8600 genesisexposed mammalian to an equalmixture of thetwo cDNA preparations underhybridization conditions Theratioof the intensities of redandgreenfluorescence overeachspot,detected with a scanning confocal lasermicroscope, indicates the relative expression of eachgenein response to serum.(b)A micrograph of a smallsegment of an actualDNAmicroarray. Eachspotin this 16 x genehybridized 16arraycontains DNAfroma different to control andexperimental cDNAsamples labeled with redandgreen fluorescent dyes(A yellowspotindicates equalhybridization of greenandredfluorescence, indicating no changein gene (b)Alfred expression) Pasieka/Photo Researchers, Inc] [Part

Wash Measuregreen and red fluorescenceover eachspot

will help physiciansto selectthe most appropriate treatment. As more patternsof geneexpressioncharacteristicof various diseasedtissuesare recognized,the diagnostic use of DNA microarrays will be extendedto other conditions.I

E. coliExpressionSystemsCan ProduceLarge Quantitiesof Proteinsfrom ClonedGenes

A lf a spot is green,expressionof that gene decreasesin cells after serum addition

.E l f a s p o t i s r e d ,e x p r e s s i o no f t h a t g e n e i n c r e a s e isn c e l l s after,seru m,addition

Many protein hormones and other signalingor regulatory proteins are normally expressedat very low concentrations,precluding their isolation and purification in large quantities by standard biochemical techniques. Widespread therapeutic use of such proteins, as well as basicresearchon their structureand functions, dependson efficient proceduresfor producing them in large amounts at reasonablecost. RecombinantDNA techniquesthat turn E. coli cells into factories for synthesizinglow-abundance proteins now are used to commercially produce granulocyte colony-stimulating factor (G-CSF), insulin, growth hormone, and other human proteins with therapeuticuses. For example, G-CSF stimulatesthe production of granulocytes, the phagocytic white blood cells critical to defense against bacterial infections. Administration of G-CSF to cancer patients helps offset the reduction in granulocyte production caused by chemotherapeuticagents, thereby protecting patients againstseriousinfection while they are receiving chemotherapy.I The first step in producing large amounts of a lowabundanceprotein is to obtain a cDNA clone encoding the full-length protein by methods discussedpreviously.The second step is to engineerplasmid vectorsthat will expresslarge amounts of the encoded protein when it is inserted into E. coli cells.The key to designingsuch expressionvectors is inclusion of a promoter, a DNA sequencefrom which transcription of the cDNA can begin. Consider,for example, the

194

c H A P T E R5

|

M O L E C U L AG R E N E T TTCE C H N T Q U E S

Eachcolumn representsa differentgene at times after addition of serum

0)

E -

-r-

BCD

A A EXPERIMENTAL FIGURE 5-30 Clusteranalysisof data from multiple microarrayexpressionexperimentscan identify cogeneswas of 8600mammalian regulatedgenes.Theexpression at timeintervals overa 24-hour detected by microarray analysis periodafterserum-starved wereprovided with serum.The fibroblasts that algorithm diagram shownhereisbasedon a computer cluster groupsgenesshowingsimilar with a compared changes in expression overtime.Eachcolumnof colored serum-starved controlsample a time boxesrepresents a singlegene,andeachrow represents point.A redboxindicates relative to the in expression an increase in expression; anda blackbox,no control;a greenbox,a decrease

relatively simple system for expressing G-CSF shown in Figure 5-31. In this case,G-CSF is expressedin E. coli transformed with plasmid vectors that contain the lac promoter adjacentto the cloned cDNA encoding G-CSF.Transcription from the lac promoter occurs at high rates only when lactose, or a lactose analog such as isopropylthiogalactoside (IPTG), is added to the culture medium. Even larger quantities of a desired protein can be produced in more complicated E. coli expressionsystems. To aid in purification of a eukaryotic protein produced in an E. coli expression system, researchersoften modify the cDNA encodingthe recombinant protein to facilitate its separation from endogenousE. coli proteins. A commonly used modification of this type is to add a short nucleotide sequenceto the end of the cDNA, so that the expressedprotein will have six histidine residuesat the C-terminus. Proteins modified in this way bind tightly to an affinity matrix > EXPERIMENTAL FIGURE 5-31 Someeukaryoticproteinscan be producedin E coli cellsfrom plasmidvectorscontainingthe vectorcontainsa fragment lac promoter.(a)Theplasmidexpression the /acpromoterandthe containing of the E colichromosome analogIPTG, of the lactose lacZgene.Inthe presence neighboring /acZ normallytranscribes the iacZgene,producing RNApolymerase protein, intotheencoded mRNA,whichistranslated B-galactosidase (b)The/acZgenecanbe cut out of the expression vectorwith andreplaced by a clonedcDNA,in thiscaseone restriction enzymes granulocyte Whenthe factor(G-CSF). colony-stimulating encoding plasmid intoE.collcells,additionof IPTG istransformed resulting produce G-CSF fromthe/acpromoter transcription andsubsequent protein intoG-CSF mRNA.whichistranslated

at thetop The"tree"diagram icantchangein expression. signif genescanbe patterns for individual showshowthe expression to grouptogetherthe geneswith fashion in a hierarchical organized overtime'Five of expression in theirpatterns similarity the greatest geneswereidentified in this regulated of coordinately clusters by the barsat the bottom.Eachcluster asindicated experiment, proteins functionin a geneswhoseencoded multiple contains (A),thecellcycle process: biosynthesis cholesterol particular cellular (C),signaling andangiogenesis (B),the immediate-early response (E).[Courtesy of Michael (D),andwoundhealing andtissueremodeling Laboratoryl National Berkeley Lawrence B Eisen,

(- -*R^*fu \/

,

p-galactosidase.

- IPTG (b)

Transform E. coli

- IPTG

+ IPTG

G E N EE X P R E S S I O N TO STUDY U S I N GC L O N E DD N A F R A G M E N T S

195

that contains chelated nickel atoms, whereas most E. coli proteins will not bind to such a matrix. The bound proteins can be releasedfrom the nickel atoms by decreasingthe pH of the surrounding medium. In most cases,this procedure yields a pure recombinant protein that is functional, since addition of short amino acid sequencesto either the Cterminusor the N-terminus of a protein usually doesnot interfere with the protein's biochemicalactivity.

{a) Transient transfection cDNA

I transtectcultured I c e l l sb y l i p i dt r e a t m e n t or electroporation J

PlasmidExpressionVectorsCan Be Designedfor U s ei n A n i m a lC e l l s \Vhile bacterial expressionsystemscan be used successfully to createlarge quantitiesof someproteins, bacteriacannot be used in all cases.Many experimenrsto examine the function of a protein in an appropriate cellular context requlre expression of a geneticallymodified protein in cultured animal cells. Genesare cloned into specializedeukaryotic expressionvec, tors and are introduced into cultured animal cells by a processcalled transfection.Two common methods for transfecting animal cells differ in whether the recombinant vecor DNA is or is not integratedinto the host-cellgenomic DNA. In both methods,culturedanimal cellsmust be treatedto facilitatetheir initial uptake of the recombinantplasmidvector. This can be done by exposingcells to a preparationof lipids that penetrarethe plasma membrane, increasingits permeability to DNA. Alternatively, subjecting cells to a brief electric shock of severalthousand volts, a technique known as electroporation, makes them transiently permeableto DNA. Usuallythe plasmidDNA is addedin sufficient concentrationto ensurethat a large proportion of the cultured cellswill receiveat leastone copy of the plasmidDNA. Researchers have also harnessedvirusesfor their use in the laboratory; virusescan be modified ro contain DNA of interest, which is then introduced into host cells by simply infecting them with the recombinant virus. Transient Transfection The simplestof the two expression methods, calledtransient transfectioz, employs a vector similar to the yeast shuttle vectors describedpreviously. For use in mammalian cells,plasmid vectorsare engineeredalso to carry an origin of replicationderivedfrom a virus that infecrsmammalian cells, a strong promoter recognized by mammalian RNA polymerase,and the cloned cDNA encodingthe protein to be expressedadjacentto the promoter (Figure5-32a). Once such a plasmid vector entersa mammalian cell, the viral origin of replication allows it to replicate efficientl5 generating numerousplasmidsfrom which the protein is expressed.However,duringcell divisionsuchplasmidsare nor faithfullysegregatedinto both daughtercellsand in time a substantialfraction of the cells in a culture will not contain a plasmid, hencethe name t ransi ent t ransfecti on. Stable Transfection (Transformation) If an introduced vector integratesinto the genomeof the host cell, the genomeis permanentlyalteredand the cell is said to be transformed.lntegration most likely is accomplishedby mammalian enzymes that normally function in DNA repair and recombination. 196

c H A P T E R5

|

MOLECULAG R E N E T TTCE C H N T Q U E S

P r o t e i ni s e x p r e s s e d f r o m c D N A i n p l a s m i dD N A (b) Stable transfection (transformation) Promoter

cDNA

cultured I Transfect I c e l l sb y l i p i dt r e a t m e n t or electroporation {

Proteinis expressedfrom cDNA integrated i n t o h o s tc h r o m o s o m e A EXPERIMENTAL FIGURE5-32 Transientand stable transfection with specially designed plasmid vectors permit expression of cloned genes in cultured animal cells.Bothmethodsemployplasmid vectorsthat containthe usualelements-ORl,selectablemarker(e.g , amp'), and polylinker-that permitpropagationin E. coli and inserlionof a clonedcDNAwith an adjacentanimalpromoter.Forsimplicity, these elementsarenot depicted(a)In transient transfection, the plasmid vectorcontainsan originof replication for a virusthat can replicatern the culturedanimalcells Sincethe vectoris not incorporated into the genome of the culturedcells,production of the cDNA-encoded proteincontinues onlyfor a limitedtime (b) In stabletransfection, the vectorcarries a selectable markersuchas neo',whichconfersresistance to G-418,The relatively few transfectedanimalcellsthat integratethe exogenousDNA into theirgenomesareselected on mediumcontainingG-418 Because the vectoris integratedinto the genome,thesestablytransfected,or transformed, cellswill continueto producethe cDNA-encoded protein as longasthe cultureis maintainedSeethe textfor discussion

L6l

N O T S S I U d XrTN r 9 A O n I S O l _ S I N l U \ l 9 V U l V N O q t N O ] )

'dlr,nrlrsues pue uortnlosar ratear8 qtrlr ueuo lnq'd1snor.r.e.rdpeqrrlsep stuorurredxeuorlezrprrq -d,{ trlt uI ol erep relrtursseprlord poqrau srql 'pesserdxa sr aua8 p uerJ,l.rpup eJeq,4^aurruJolopot pesn eq uef ural -ord relrodar eqr uorsserdxoeqr 'S'S uortres ur paqrrrsep Jo sE lerurup lrue8sue.rlp to uortearr dg ro aua8 perlrpou oqr Surureluoc Jottol uorsse.rdxaprurseld € qlr.4auorlf,oJsupJt dq .roqrrosller olur petnporluror sr eua8 plrqdq eqr uer{l1 'tseJolur urato.rder{l ot uretord ralrodar aql 1o ;o uorssard -xe treuuof, leqr eue8 plJqlq E atEJrJ ol sde,r,ro,AalaqrJJsap e,r\ areH 'sller ur potlotap eq dlluarua.tuor uer rep et)) uta7otQluacsatonlf uaaB se qtns urato.rd.rel.rodere Sursnuo serloruaryopoqteu srql 'surJtordrrro.,{.re4na Jo uorlezr]pto] relnlleJertur pue uorssardxa aql dpnls ot ^,(errre apr,r -ord uer srotf,e^uorssardxE 6ur66e1 utaloJd pue auag

DNtSn

'8It-C ot aruelsrsJr,{q :o1 percelasaq uer ra>lrer.u pau pue aua8 pauolc paler8alur dlqers e rJtr^\ sllal 'uortra; 'er-uoue8tsoq -suelt Jlqetslo1 Jspl Jr..lt ul se',{.ressarau;1 Jqt otul paterSelurueql pup sna]f,nueqt olur peuodsuerlsrqcrq,u'y51q otur paqrrrsuert-esrelarsr sacuanbasUII IErr^ ,(q palueg aua8pauolc erJtuortralur IIer raqv 'sllaf,re^rl pue apsntu 'suor -nau 's11aruals rrtarodoreruaqSurpnlcur'sadlt IIeJ uer1erurueur ;o ^,berre,topr.^ e ttoJur ol salcrtred snrr,t SurllnseJor{l .{\olle 'selcrued snrr.. ererrns palaldtuot jo oql uo uralord il^\ pue adole.,ruosnrllrluel aqr areldar dppea.r uuc qrrq,ra.'(urel Ieurrou -ord g-n5n) snrrl srJrteurotsrelnJrsa^aql uralotdor.{p aqr sr 1o txeluor srql ur posnuratord adola,ruauoruruol V 'addrilar p3.rer perrsepe lreJur ot salcruedsnrr,rprrgdq Surtlnsareql .ln.ollpilr,r\ snrrlrluel lueurqruof,eJe oluJ peleJodrocur uaq,rt teqt uralord odolr^ueIErr^E Jo uorssardxes.^Aolle pruseld leur1aq1 .alcrrred snrr^rlual e olur Surureluoc-a11 3ur3e ]Euorllunj vNu 1err,t 'uratord edole,rua ->1cedro; d.rBssarau rofeu aq] ro] ldecxo 1e-rr.r 'saua8 eqr IIe sorrrel pruseld Sur8e4cedeqt sE u^\ou{ 1e.rr,r

prtuseld puoras V 'VNC leruosoruorqr otur paterSaturaq ueql pue uorldrnsuerl esraler dq VUC olq perdol aq uer IIaJ E olur uorpnporlur uo reqr aFlelotu VNU te8rpl pelceJurdlye.rr,r '9 Ierr^ e ;o srsaqtudslrorrp soJuenbes911 1e4tt rerdeq3 ur poquJsopsV 'soruenbosUII snrr^uua1dq palueg pau se q)ns Je)JeruelqerrelasE ot txou lseJJlur;o eua8 peuop p sur€luoo ptutspli .topan eql se u,{\ou{ 'ptuseld tsrr} ar{J 'sllaf, Ierurue togr€t otul eua8 pauop e Jo uorpnportur luerlrlle rot elqEtrns salcrlred snJr^rlual lueurqruof,eJacnpo.rdol posn a-re'uorlla; -suert tuersuerrdq qlac otur pof,nporlur'sprruseldluaraJJrpeer{l 'gg-g ern8rg ur u,{\oqs sV 'sasnilnuual sp u.ln.oul sasnrrlorler Jo ssEIJe uro{ pelrJep sr uorssa.rdxa lerrl qfns euo yo eldruexe uV 'sllel Ieurue ur pessardxadlqers eq uef, oue8 parJrporu E r{lrq^\ dq dcuercgla eql aseeJrurdlreer8 ol VNC leurosoru -orr{J olur uoruasur luenbasqnspuP s[e] Ieurup otul lErrotEru rrleuoSJo uortfnPoJlur .ro1sasnrrrrdq Pesnsusrusr{JeruJrsEqar{] perroldxae^eq sreqrreeseUsuels^S uolsseldxl lerlnoJlau 's1ana1 aqr rsaqSrq tp tserelurIo uralord eql aonpordlerp asoqtdynueprot paueorJs a.redyyensnstuptre;SueJtelq€ts eqr 'erolaraql 'VNCI poues -ur eqt Surqr.rrsue.rl saler rrer{l ur re}tp il1.^a8It-C or luetsrs Jo 'aruoua8eql ul selrstuopueJ -eJ sauolJ paruro;sueJl Ienpr^pw le srnJf,o uorler8atut asnprefl '8It-C Jo uorterluoJuooq8rq e ;o ecuesardeql ur euolJ e ol esrJarrr8pue aAr Jns IIr,r\ aruos -oruoJr{Jtsoq er{l olur JolJeA uorssardxaaql peteJSolura^pq lerlt sller esoqr,{1ug 'qZt-S arnSrgur pourltno s uorltaJsua,4 alqals tq VNICII pauoll e Sursse.rdxe ro; arnparord Jrseq eql '8It-g sE u.,taou>l un,{uroeu ol peleler dlecrueqt punoduroc rrxol E ot oJu€tsrsersJeJuof,r4tw,n'(,oau pareu8rsep)esera; -suertoqdsoqd urcdruoeuroJ eue8aql sr re>lreruaIqEDOIOS pesn lluoruruoo y 'VNCIT pelresur eql Surquf,suprtJo seter Jreqt ur JaJtIPuerJoIIyl' 8It-C ol luelslsersauolJpaurotsuel IEnpI^P -ur tetuoua8aql ur selrsuopueJ le sJnJrouorte.r8aluresnetofl

uorlecrloor ;o ur6r.ro lerln u reloro leocleltA r o Jo u o 9

pouolS

vNU ler^orlou

u o t s s n ) s t pl o J Ll x a l

aq] aos 'auoue6 uetleuueur eql olu! seue6 pauo;>1o uogle.rEalu!luat)t#a JOI pasn eq ue) slopa^ leJt^oJlau €E-Slun9tJ lVINlNtUldXl
leJe uorlf,unJ pue ef,uonbososorl^, sureloJd pue seue8 osogf qtr^/\lrnpoJd str pue aua8aseosrpe to seJuenb to 'uretord papolue str pup aueSpellelJp -es eql Jo uosrredr.uoJ oqt dJuueprot sr eseasrpuewnq patrrequr.(ue roy osnec3urd1 -rapun aqt Surraqdrcepur dels rsry yecrddraqt 'sdepe.trop 'suorlpJaua8^(ueruJoJlxeu eql ol uorleJoua8euo ruor; I passedueoqo^Erlreqr salelletuetntu Surlsrxaarddq pesnerare seseesrppelrJer{urto sosef lsoru 'uorleraua8Surpara.rdaql ur esore uorlelnru.1\.euE r.uo{ lynsarderu aue8 ,,eseesrp,, e leql q8noqlly 'seseesrp paluor{urSur.rrnrcodluounuoc lsour or{l}o

[:il'j:i:lfffi:"*;"f"' x":T:Ht",,j;i H i:i,l:'.i;

53nOlNH)lI )l1lNl9

UV'ln):l'lol^l I

S UlldvH)

85t

E sepof,ueleql ecuanbesvNC lrol{s P qlrrrr lr 3ur r{lloJls uorls -sry dq lseralul aue8eqt d;1pourol sr utalord Ero uoneJol rel Jo -nllef,Elur aqr Surrerap ro; 3ur33el dCC ol e^Ileuratle uV 'pelelol dlleurrou st utalord roldoJor oql qlII{^{ tp etIS aql'suorneu drosuasur Erlrf,Iprslp eqr lp eouetsoronltdCC dq pazrlecol oq ueJ uotsnJ-unxo,ld Suulnsar aql loldef,er eqt Jo aruonbas Surpoc aqr ot d{C 3ur4uq dq pelcn.llsuoc 'lserluoc uI 'suorneu osoqryo ruseld sr aua8plrqdq eqr uoq.,ra 'uorsn} 'suo.rnaucgtoadsut pessatdxasl -o{c eql 3ur11r1 dJC -npruotd e sp u.^aou>ldllensn uorlern8r;uoJ P uI dCD to ocuanbasSurpocaqt ot dpce.rrppe{ull sI roldef,erlu€roPo aqt .ro; ralourord eqt ueqlN 'suo8ala'3 ur uralord .roldoco.rtue -ropo ue;o uotsserdxeeqr dpnls ol sluaurtradxa3ur33er-449 yo sedlr tueroJ;Ip o^\l Jo asn aqt sot€rlsnll yg-g arn8tg

seua9aseasrc

puebut^llluaplEE uerunH6ur1ero1 'uorlJeloP^PoqrluB roJ eootroaue ro ddc qlr-tr suratord;o 3ur33eroqr sr spoqlau aseqlto uorlecrlddB luel.rodur uV 'slloJ uerleurueru ro lseod ur soua8peuoll sserdxa 01 pesn ag uEf, sJolrel uorsserdxa rrtofre4ng r 'aua8pauolc e ruo{ uralord E slunoue tuepunqe uorl to Jo -cnpord ol{t ^ olle sprruselduroq po^uop sJotf,o^uorssardxgr 'suorlJunJ Pelel -o.r dlerrSolorg e^eq leqt surotord epoJuelluouruoc seua8 'suorlrpuor snorre^ rapun pareln8a.r Petpln8ar-ocgtns dl.relrtursore lpql saua8d;rluepr upr sluourrradxauorssard -xa de.rrBorcnualdrllnur ruou EtEpoql 1o srsdleuerolsnl3 r '(67-9 a;n8rgaas) suorlrpuor tuaraJlrprepun sllel eruesoql ur ro sllar;o saddr tuareJtrpur seua8Jo spuesnorJl;o uorsserdxrJo le^el e^rle -lar erlr slletap dlsnoauetlnurs srsdleuederrBo.rcrurVNC r 'uouezrprrqdgnlls ut dq s11ar8ural1ur perlorep

' pa^uap) uo.r1 2] 668:t8//;p'96611eia e1dn6ue5 [ (Spuet sarn6tl suolnourrloedsururalo.rd 0irpo jo uorle)olleurouoql ])allal pa^lesqo oq]+opuo aq1 elll)rilosuas oq ue) uorlnqt.llslp 01po.ualur fiosuesaq11odt1aq11e {;uosrpuesuolnau lelstpoql ]e luetedde uotsn]dlD-0[lpOaq]ase)srq] eq1o1pele6te]stutalo.rd auerqtrlor.rJ u 1a r u a n b absu r p o6t l r p g q t 6 u e l - ; 1onq1]+ op u ae q 1o 16 1 96 u t 1 u t 1 rilluetsatonll ate (q)'paleqel seMuorsn}-ura}ord {q palrnrlsuo: V Apoqllo)aq}}eq} prlos)solupuap{losuespue(Molrepaqsep) (n,lo.r.ie a1o5 sue6aya) jo peaqaql ursuolnau{rosuestl,ttrads;ourse;doyi: stutalotdslql 0l.lpo]o suopo)pt)eoulue eq1urpassardxe ,{qpaleraua6 senn olll o] dl9 6ur>1ur1 lno+]sll+oq] pueleloLuo.rd ueel6ro; aluenbes uorsn]-ralourord V (e) (dlg) utelordlua>selon11 sue6eyaf Jo '0 tlpo lolda:el ]uelopo eue6aq1o] pesn]sean slqlul 'seua6pauol) eue6eqi 'lueutuedxa e 6urporue le)ruraLll uo.r; passerdxesu1e1o.td lo uotleztte)olrelnlla) alellll)el 6ur66elutelordpue auag t€-S lgn9lJ'lVINlt tluldxl V Lurl0 L

oq uel sVNUru rr;rcadsJo uortnqrJtslppue aruasardaq1 r 'erntxrru E urqtr^\ y11g cr;rcads E slf,elapSurrrolq uraquoN 'OT-S arnSrg aas) eqord ylqq ;o anbruqoarrelrturs eq1palagelolper .{retuaruelduoJ E rltr.{\ uouezrpr.rqfq pue tarlry 'srsa.roqdol p or spueq paleredasaqr ;o (8uruolq) ra;sue.rr -ce1e 1eBSururquor ,tq arnlxrur xalduoc e urqlr^ luatu -8er; ygq rr;rcads 'a13urse pelop uEf, Surnolq urorllnos r uolssardxf auag Apnls ol sluau6erl VNC pauol) 6ursn ulelord uolsnl dJ0-0l,uoo :uolsnl-ulolord (ql

'lpuorlrunJ urerual llrrs pue eleJelotuer aua8pouoll E uorlpf,rtrpotu 1o soddr lpq.ry\uo spuadap uaryo uralord ua,tr8 e 3et ot dCC ro adotrde trorls E esn ol rer.{laq^\Jo arroql eqJ 'adolrda eqr ro; cr;rcads ,(poqrrue Ipuolrouour eql qlr^.\ sllel dq peioerepog upf, uJelord eql 1o Surlaqel-aJuef,soronlJounrurur oqt Jo ruroJ pe33er-adorrdapasserdxeeql'aue8 perJrpouroLIl Sururetuor Jolf,el uorsserdxapruseld e qtr.r uortf,eJsueJlJal -1y '3u83al aio4Qa sp u.,raou>l $ por{terusrql'acuaq ladolrda ue peller srdpoqrrueue dq punog aq upl lpql epudedtror{se r{rns dpoqrrue leuolJouoru u.taou>le dq pazruSof,erspne ourlue Jo

dl9 ol posnl relourord 0luoo :uolsnl-rolourord (e)

AUTOSOMAL RECESSIVE Sickle-cellanemia

Abnormal hemoelobin causesdeformation of red blood cells, which can become lodged in capillaries; also confers resistanceto malaria'

11625of sub-SaharanAfrican origin

Cysric fibrosis

Defective chloride channel (CFTR) in epithelial cells leads to excessivemucus in lungs.

1'12500of European origin

Phenylketonuria (PKU)

Defective enzyme in phenylalanine metabolism (tyrosine hydroxylase) results in excessphenylalanine, leading to mental retardation, unless restricted by diet.

1/10,000 of European origin

Tay-Sachsdisease

Defective hexosaminidaseenzyme leads to accumulation of excesssphingolipids in the lysosomesof neurons, impairing neural development.

1/1000 easternEuropean Jews

Huntington's disease

Defective neural protein (huntingtin) may assembleinto aggregatescausing damage to neural ttssue.

1/10,000of Europeanorigin

Hypercholesterolemia

Defective LDL receptor leads to excessivecholesterol in blood and early heart attacks.

tlI22French Canadians

Duchenne muscular dystrophy (DMD)

Defective cytoskeletal protein dystrophin leads to impaired muscle function.

1/3500 males

Hemophilia A

Defective blood clotting factor VIII leads to uncontrolled bleedine.

1-2110,000 males

AUTOSOMAL DOMINANT

X-LINKED RECESSIVE

provide clues to the molecular and cellular causeof the disease.Historically, researchershave usedwhatever phenotypic clues might be relevant to make guessesabout the molecular basis of inherited diseases.An early example of successful guessworkwas the hypothesisthat sickle-cellanemia,known to be a diseaseof blood cells,might be causedby defectivehemoglobin. This idea led to identification of a specificamino acid substitution in hemoglobin that causespolymerization of the defectivehemoglobin molecules,causingthe sickle-like deformation of red blood cellsin individuals who have inherited two copiesof the Hb' allele for sickle-cellhemoglobin. Most often, however,the genesresponsiblefor inherited diseasesmust be found without any prior knowledge or reasonablehypothesesabout the nature of the affectedgeneor its encodedprotein. In this section,we will seehow human geneticistscan find the generesponsiblefor an inherited disease by following the segregationof the diseasein families' The segregationof the diseasecan be correlatedwith the segregation of many other genetic markers, eventually leading to identification of the chromosomalposition of the affected

gene.This information, along with knowledgeof the sequence of th. hn-".t genome,can ultimately allow the affectedgene mutations to be pinpointed. and the disease-causing

s howOneof Three M a n y I n h e r i t e dD i s e a s e S Major Patternsof Inheritance Human genetic diseasesthat result from mutation in one specific gene exhibit severalinheritance patterns depending on the nature and chromosomal location of the alleles that causethem. One characteristicpattern is that exhibited by a dominant allele in an autosome (that is, one of the 22 human chromosomes that is not a sex chromosome). Becausean autosomal dominant allele is expressed in the heterozygote,usually at least one of the parents of an affected individual will also have the disease'It is often the case that the diseasescaused by dominant alleles appear later in life after the reproductive age. If this were n o i t h e c a s e , n a t u r a l s e l e c t i o nw o u l d h a v e e l i m i n a t e d the allele during human evolution. An example of an EENES H U M A N D I S E A SG I D E N T I F Y I NAGN D L O C A T I N G

.

199

(al Autosomal dominant: Huntington's disease

d

AHD/A* Affected

x

A+/A+ Q

I

Males and females

A-/ANot affected

AHD/A+ Affected (b) Autosomal recessive: Cystic fibrosis

d AcFrR/A+ Carrier

x , I

AcFrR/A+ ? Carrier

* Males and females

ACFTR /ACFTR

ACFTR/A+

Affected (c) X-finked recessive: Duchennemuscular dystrophy

d X* ly

Carrier x

XDMD/X+ Q Carrier

I

v

Males PMDIY Affected

A-/ANoncarrier

A+/AcFrR

Carrier

x+ly Unaffected

Females YDMD/x+ Carrier

x+/x+ Noncarrier

FIGURE 5-35 Threecommoninheritancepatternsfor human geneticdiseases. Wild-type (A)andsexchromosomes autosomal (X andY)areindicated by superscript plussigns(a)In an autosomal d o m i n a ndti s o r d es ru c ha sH u n t i n g t osnd i s e a soen, l yo n em u t a n t alleleisneeded to conferthe diseaself eitherparentis heterozygous for the mutantHDallele,hisor herchildren havea 50 percent c h a n coef i n h e r i t i nt h g em u t a nat l l e l e a n dg e t t i n g t h ed i s e a s(eb )l n an autosomal recessive disorder suchascystic fibrosis, two mutant alleles mustbe present to conferthe diseaseBothparents mustbe heterozygous carriers of the mutantCFIRgenefor theirchildren to be at riskof beingaffected or beingcarriers(c)An X-linked recessive disease suchasDuchenne muscular dystrophy iscauseo oy a recessive mutation on theX chromosome andexhibits thetypicalsex_ linkedsegregatron patternMalesbornto mothers heterozygous for a mutantDMDallelehavea 50 percent chance of inheriting the mutantalleleandbeingaffectedFemales bornto heterozvqous mothers havea 50 percent chance of beinqcarriers

a u t o s o m a l d o m i n a n t d i s e a s ei s H u n t i n g t o n ' s d i s e a s e ,a neural degenerativediseasethat generally strikes in midto late life. If either parenr carries a murant HD allele, e a c h o f h i s o r h e r c h i l d r e n ( r e g a r d l e s so f s e x ) h a s a 5 0 percent chance of inheriting rhe mutanr allele and being a f f e c t e d( F i g u r e5 - 3 5 a ) . A recessiveallelein an autosomeexhibits a quite different segregatronpattern. For an autosomal recessiueallele, both parentsmust be hererozygouscarriersof the allelein order for their children to be at risk of being affectedwith the disease. Each child of heterozygousparenrshas a 25 percentchanceof receiving both recessiveallelesand thus being affected,a 50 percentchanceof receivingone normal and one mutant allele and thus being a carrier, and a 25 percentchanceof receiving two normal alleles.A clear exampleof an autosomalrecessive diseaseis cystic fibrosis, which results from a defectivechloride-channelgeneknown as CFTR (Figure5-35b). Relatedindividuals (e.g.,first or secondcousins)have a relatively high 200

.

c H A p r EsR I

probability of being carriers for the same recessivealleles. Thus children born to related parents are much more likely than those born to unrelated parents to be homozygousfor, and thereforeaffectedby, an autosomalrecessivedisorder. The third common pattern of inheritanceis that of an XLinked recessiueallele. A recessiveallele on the X chromosome will most often be expressedin males,who receiveonly one X chromosome from their mother, but not in females, who receivean X chromosome from both their mother and their father. This leadsto a distinctive sex-linked segregation pattern where the diseaseis exhibited much more frequently in males than in females.For example, Duchenne muscular dystrophy(DMD), a muscledegenerative diseasethat specifically affects males, is causedby a recessiveallele on the X chromosome. DMD exhibits the typical sex-linked segregation pattern in which mothers who are heterozygous and therefore phenotypically normal can act as carriers, rransmitting the DMD allele, and therefore the disease,to 50 percent of their male progeny (Figure5-35c).

M o L E c u L AGRE N E Tr tEcc H N l o u E s

D N A P o l y m o r p h i s mAs r e U s e di n L i n k a g e M a p p i n gH u m a nM u t a t i o n s Once the mode of inheritancehas beendetermined,the next step in determining the position of a diseaseallele is to genetically map its position with respect to known genetic markers using the basic principle of genetic linkage as described in Section5.1. The presenceof many different already mapped genetic rraits, or markers, distributed along the length of a chromosome facilitatesthe mapping of a new mutation by assessingits possiblelinkage to these marker genesln appropriate crosses.The more markers that are available,the more preciselya mutarion can be mapped.The density of genetic markers neededfor a high-resolution human genetic map is about one marker every 5 centimorgans (cM) (as discussedpreviously,one geneticmap unir, or centimorgan, is defined as the distance between two positions along a chromosome that results in one recombinant individual in 100 progeny).Thus a high-resolutiongenericmap requires25 or so geneticmarkersof known position spread along the length of each human chromosome. In the experimentalorganismscommonly used in genetic studies,numerous markers with easily detectablephenotypes are readily availablefor geneticmapping of mutations.This is not the casefor mapping geneswhose mutant allelesare associated with inherited diseasesin humans. However" recombinant DNA technologyhas made availablea wealth of useful DNA-based molecular markers. Becausemost of the human genomedoesnot code for protein, alarge amount of sequence variation exists betweenindividuals. Indeed, it has been estimated that nucleotidedifferencesbetweenunrelatedindividuals can be detectedon an averageof every 103 nucleotides.If thesevariations in DNA sequence,referredto as DNA polymorphisms,can be followed from one generationto the next, they can serve as genetic markers for linkage studies. Currently, a panel of as many as 104 different known polymorphisms whose locations have been mapped in the human genomeis usedfor geneticlinkage studiesin humans.

Restriction fragment length polymorphisms (RFLPs) were the first type of molecular markers used in linkage studies.RFLPsarisebecausemutationscan createor destroy the sitesrecognizedby specificrestriction enzymesthat happen to lie in human DNA, leadingto variationsbetweenindividuals in the length of restriction fragments produced from identical regionsof the genome.Differencesin the sizes of restriction fragments betweenindividuals can be detected by Southern blotting with a probe specific for a region of DNA known to contain an RFLP (Figure5-36a).The segregation and meiotic recombination of such DNA polymorphisms can be followed like typical genetic markers. Figure 5-36b illustrates how RFLP analysis of a family can detect the segregaticlnof an RFLP that can be used to test for statistically significant linkage to the allele for an inherited diseaseor some other human trait of interest. The amassedgenomic sequenceinformation from different humans has led to identification of other useful DNA polymorphisms in recent years. Single-nwcleotidepolymorphisms (SNPs) constitute the most abundant type and are therefore useful for constructing geneticmaps of maximum resolution. Another useful type of DNA polymorphism consistsof a variable number of repetitionsof a one- two-, or Suchpolymorphisms,known as simple three-basesequence. sequencerepeats (SSRs)or microsatellites, presumably are formed by recombinationor a slippagemechanismof either the template or newly synthesizedstrands during DNA Hybridization banding pattern from individual with both allele 1 and allele2

lat

Chromosomalarrangement

't'iri

; g

'ti

t

I

:

i't

:

't

replication. A useful property of SSRsis that different individuals will often have different numbers of repeats.The existenceof multiple versionsof an SSRmakes it more likely to produce an informative segregationpattern in a given pedigreeand therefore be of more generalusein mapping the positionsof diseasegenes.If an SNP or SSRaltersa restriction site, it can be detectedby RFLP analysis. More commonly' however, these polymorphisms do not alter restriction fragments and must be detectedby PCR amplification and DNA sequenclng.

Geneswith a LinkageStudiesCanMap Disease Resolutionof About 1 Centimorgan lVithout going into all the technical considerations,let's see how the allele conferring a particular dominant trait (e.9., familial hypercholesterolemia)might be mapped. The first step is to obtain DNA samplesfrom all the members of a family containing individuals that exhibit the disease.The DNA from each affected and unaffected individual then is analyzed to determine the identity of a large number of known DNA polymorphisms (either SSR or SNP markers can be used). The segregationpattern of each DNA polymorphism within the family is then compared with the segrigation of the diseaseunder study to find those polymorphisms that tend to segregatealong with the disease' Finaily, computer analysisof the segregationdata is used to (b) Grandparents

G randparents

Enzyme Enzynre B

Mutation at site a2 Preventscleavage

i+

,f

e R e s t r i c t i o ne n d o n u c l e a s A

j

B R e s t r i c t i o ne n d o n u c l e a s e

.1,

Fragment lengths

tr

F-okb-l

As

v

[ - - - l P r o b e ds i n g l e - c o p yr e g i o n

Alleles

E

FIGURE5-36 Restrictionfragment length A EXPERIMENTAL can be followed like genetic markers. polymorphisms (RFLPs) (a) In the two homologouschromosomes shown,DNA is treatedwith enzymes(A and B),which cut DNA at two differentrestriction (a and b) The resultingf ragmentsare subjected differentsequences probe (seeFigure5-26)with a radioactive to Southernblot analysis that bindsto the indicatedDNA region(green)to detectthe betweenthe two homologous fragments Sinceno differences by the B enzyme, recoqnized occurin the sequences chromosomes by the probe,as indicatedby a only one fragmentis recognized band However,treatmentwith enzymeA singlehybridization producesradiographically distinctf ragmentsof two differentlengths

tr

r,,*, .!!,

Ilikb-l Fs kb-l

(a1-a2anda1-a3),and two bandsare seen,indicatingthat a mutationhascausedthe lossof one of the a sitesin one of the two of the DNA from a analysis chromosomes(b) Pedigreebasedon RFLP regionknown to be presenton chromosome5. The DNA samples enzymeIaql and analyzedby Southern were cut with the restriction of the genomeexistsin threeallelic region this family, blotting In this by Iaql sitesspaced10, 7 '7, or 6 5 kb apart forms characterized Eachindividualhastwo alleles;somecontainallele2 (7 7 kb) on both at this site Circles and othersare heterozygous chromosomes, gel lanesare in the The males indicate indicatefemales;squares and are generally pedigree above in the the subjects as order same , e l5l 1 : 3 1 ]9 l l tearl , 1 9 8 7C r D o n i s - K ee a l i g n e db e l o wt h e m l A f t e H . I D E N T I F Y IA NN GD L O C A T I NHGU M A ND I S E A SGEE N E S

201

calculatethe likelihood of linkage between each DNA polymorphism and the disease-causing allele. In practice, segregation data are collected from different families exhibiting the same diseaseand pooled. The more families exhibiting a parricular diseasethaican be examined, the greater the statistical significance of evidence for linkage that can be obtained and the grearerthe precisionwith which the distancecan be measuredbetween a linked DNA oolvmorphism and a diseaseallele.Most family studieshave a maximum of about 100 individualsin which linkage betweena diseasegene and a panel of DNA polymorphismscan be tested. This number of individuals setsthe practical upper limit on the resolutionof sucha mapping study to about 1 cenrimorgan,or a physicaldistanceof about 7.5 x 10s basepairs. A phenomenoncalledlinkagedisequilibriumisthe basisfor an alternative strategy,which in some casescan afford a higher degreeof resolution in mapping studies.This approach dependson the particular circumstancein which a genericdisease commonly found in a particular population resultsfrom a single mutation that occurredmany generationsin the past. The DNA polymorphismscarriedby this ancestralchromosomeare collectively known as the haplotype of that chromosome. As the diseasealleleis passedfrom one generationto the next, only the polymorphisms that are closestto the diseasegenewill not be separatedfrom it by recombination. After many generarlons the region that contains the diseasegenewill be evident because this will be the only region of the chromosome thar will carry the haplotype of the ancestralchromosome conservedthrough many generations(Figure5-37).By assessing the distributionof specificmarkersin all the affectedindividualsin a population, geneticistscan identify DNA markers tightly associatedwith

appearedon the ancestralchromosome-in somecasesthis can amount to finding markersthat are so closelylinked to the diseasegenethat even after hundredsof meiosesthey have never beenseparatedby recombinarion.

FurtherAnalysisls Neededto Locatea Disease G e n ei n C l o n e dD N A Although linkage mapping can usually locare a human diseasegene to a region containing about 105 base pairs, as many as 10 different genesmay be located in a region of this size. The ultimate objective of a mapping study is to locate the genewithin a cloned segmenrof DNA and then to determine the nucleotide sequenceof this fragment. The relative scalesof a chromosomalgenetic-ap anJphysicalmaps corresponding to ordered sers of plasmid clones and the nucleotidesequenceare shown in Figure5-38. One strategyfor further localizinga diseasegenewithin the genome is to identify mRNA encoded by DNA in the region of the geneunder study. Comparison of geneexpressionin tissues 2O2

.

c H A p r E 5R |

M o l E c u L AG R E N E TrtEc c H N t e u E s

Generation

1

Newmu+6+:^h

f f l

I Generation 2

cr"ototot"

inp.,.ti",l?i'.": | | F Yitl dirrerent \ huptotvp?'' mf I J nantotvoe fVeioti"recombination

ilI tl ff

I I

'""tt''"" ll iltl ililililt|

A FIGURE 5-37 Linkagedisequilibrium studiesof human populationscan be usedto map genesat high resolution.A newdisease mutation willarisein the contextof an ancestral chromosome amonga setof polymorphisms known asthehaplotype (indicated by pinkshading). Aftermanygenerations, chromosomes thatcarrythe disease mutation willalsocarrysegments of the ancestral haplotype thathavenot beenseparated fromthe disease mutationby recombination Thebluesegments of these chromosomes general represent haplotypes derived fromthegeneral population andnotfromtheancestral haplotype in whichthe mutatron originally aroseThisphenomenon is knownaslinkage disequilibrium Thepositionof the disease mutationcanbe located by scanning chromosomes containing thedisease mutation for highly polymorphisms conserved corresponding to theancestral haplotype from normal and affected individuals may suggesttissuesin which a particular diseasegenenormally is expressed.For instance,a mutation that phenotypically affects muscle, but no other tissue,might be in a genethat is expressedonly in muscle tissue. The expressionof mRNA in both normal and affected individuals generally is determined by Northern blotting or in situ hybridization of labeledDNA or RNA to tissuesections. Northern blots, in situ hybridization, or microarray experiments permit comparison of both the level of expression and the size of mRNAs in mutant and wild-type tissues.Although the sensitivity of in situ hybridization is lower than that of Northern blot analysis,it can be very helpful in identifying an mRNA that is expressedat low levels in a given tissue but at very high levels in a subclassof cells within that tissue.An mRNA that is altered or missing in various individuals affected with a diseasecomparedwith wild-type individualswould be an excellent candidate for encoding the protein whose disrupted function causesthat disease. In many cases,point mutations that give rise to diseasecausing allelesmay result in no detectablechange in the level of expression or electrophoretic mobility of mRNAs. Thus if comparison of the mRNAs expressedin normal and affected individuals reveals no detectabledifferencesin the candidate mRNAs, a search for point mutarions in the

Polymorphic or BAC (l

A T U

T T A tr

A A T (A 750 kb

T A

c

u

'l

T A T T a

u

T A u U

\T LEVELOF RESOLUTION:Cytogenetic map

Physical map

Linkage map

M E T H O DO F Linkageto restriction DETECTION:Chromosome b a n d i n gp a t t e r n f r a g m e n tl e n g t hp o l y morPhismsRFLPS, in Fluorescence s i t u h y b r i d i z a t i o n s i n g l en u c l e o t i d ep o l y (FISH) m o r P h i s m sS N P s ,a n d s l m p l es e q u e n c e repeatsSSRs

5-38 The relationshipbetweenthe geneticand A FIGURE a deptcts Thediagram physicalmapsof a humanchromosome' of detailThe levels at different analyzed humanchromosome when asa wholecanbeviewedin the lightmicroscope chromosome andthe at metaphase, statethatoccurs it isin a condensed by canbe determined ic sequences locationof specif approximate (FISH) At the nextlevelof detail, in sltuhybridization fluorescence

DNA regions encoding the mRNAs is undertaken. Now that highly efficientmethodsfor sequencingDNA are availfrequently determinethe sequenceof canable, researchers DNA isolatedfrom affectedindividualsto of regions didate identify point mutations. The overall strategyis to search for a coding sequencethat consistentlyshowspossiblydelereriousalterationsin DNA from individualsthat exhibit the disease.A limitation of this approachis that the region near the affectedgene may carry naturally occurring polymorphisms unrelated to the gene of interest. Such polymorphisms,not functionally related to the disease,can lead to misidentificationof the DNA fragmentcarrying the geneof interest.For this reason,the more mutant allelesavailable for analysis,the more likely that a gene will be correctly identified.

Sequence map

Hybridization Sanger (dideoxY) to plasmid sequenclng clones

2d to Genomes' FromGenes et al, 2003,Genetics: fromL Hartwell lAdapted Hill ed, McGraw I

s e s u l tf r o m M u l t i p l e M a n y I n h e r i t e dD i s e a s e R GeneticDefects Most of the inherited human diseasesthat are now understood at the molecular level are monogenetic traits; that is, a clearly discerniblediseasestate is produced by a defect in a single gene.Monogenic diseasescausedby mutation in one specific gene exhibit one of the characteristic inheritance patterns shown in Figure 5-35' The genes associatedwith most of the common monogenic diseases have already been mapped using DNA-based markers as describedpreviouslY. However, many other inherited diseasesshow more complicatedpatterns of inheritance,making the identification of the underlying genetic causemuch more difficult' EENES H U M A N D I S E A SG I D E N T I F Y I NAGN D L O C A T I N G

O

203

One type of added complexity that is frequently encountered is genetic heterogeneity.In such cases,mutations in any one of multiple different genes can cause the same disease.For example, retinitis pigmentosa,which is characterizedby degenerationof the retina usually leading to blindness,can be causedby mutations in any one of more than 60 different genes. In human linkage studies, data from multiple families usually must be combined to deter_ mine whether a statisricallysignificant linkage exists be_ t w e e n a d i s e a s eg e n e a n d k n o w n m o l e c u l a r m a r k e r s . Genetic heterogeneitysuch as rhar exhibited by retinitis pigmentosa can confound such an approach becauseany statisticaltrend in the mapping data from one family tends to be canceledout by the data obtained from another fam_ i l y w i t h a n u n r e l a t e dc a u s a t i v eg e n e . Human geneticisrsused two different approachesto _ identify the many genesassociatedwith retinitii pigmenrosa. The first approach relied on mapping studies in &ception_ ally large single families rhar contained a sufficient number of affectedindividuals to provide statisticallysignificant evidencefor linkage betweenknown DNA polymolphisms and a single causativegene. The genesidentified in such studies

retinitis pigmentosa.This approach of using additional in_ formation to focus screeningefforts on a s.rbiet of candidate genesled to identificationof additional rare causativemura_

ldentifying and Locating Human DiseaseGenes r Inherited diseasesand other traits in humans show t h r e e m a j o r p a t t e r n s o f i n h e r i t a n c e :a u t o s o m a l d o m i nant, autosomal recessive,and X-linked recessive(see F i g u r e5 - 3 5 ) . r Genesfor human diseasesand other trairs can be mapped by determining their cosegregation during meiosis with markers whose locations in the genome are known. The closer a geneis to a particular marker, the more likelv thev are to cosegregate, of human geneswith great precision requires of molecular markers distributed along the es. The most useful markers are differencesin the DNA sequence(polymorphisms) between individuals in noncoding regions of the genome. r DNA polymorphisms useful in mapping human genesinclude restriction fragment length polymorphisms (RFLps), single-nucleotidepolymorphisms (SNps), and simple sequencerepeats(SSRs). inkage mapping often can locate a human diseasegene a chromosomal region that includes as many as l0 genes.To identify the geneof interestwithin this candidate region_typicallyrequires expressionanalysis and compari_ son of DNA sequencesbetween wild-type and disiaseaffectedindividuals. r Some inherited diseasescan result from mutations in dif_ ferent genesin different individuals (geneticheterogeneity). The occurrence and severity of other diseasesdepend on the presenceof mutant allelesof multiple genesin the same individuals (polygenictraits). Mapping of the genesassociated with such diseasesis particularly difficult becausethe occurrenceof the diseasecannot readily be correlated to a singlechromosomallocus.

ff,l Inactivatingthe Functionof SpecificGenesin Eukaryotes The elucidation of DNA and protein sequencesrn recent y e a r s h a s l e d t o i d e n t i f i c a t i o no f m a n y g e n e s .u s i n g s e quencepatternsin genomicDNA and the sequencesimilar_ ity of the encodedproteins with proteins oi known function. As discussedin Chapter 6, the general functions of proteins identified by sequencesearchesmay be predicted by analogy with known proteins. However, the precisein vivo roles of such "new" proteins may be lrnclearin the ab_ senceof mutant forms of the correspondinggenes.In this

CHAPTER 5

J

MOLECULAG RENETIC TECHNIQUES

Three basic approachesunderlie these gene-inactivation techniques:(1) replacinga normal genewith other sequences, (2) introducing an allelewhose encodedprotein inhibits functioning of the expressednormal protein, and (3) promoting destructionof the mRNA expressedfrom a gene.The normal endogenousgeneis modified in techniquesbasedon the first approach but is not modified in the other approaches'

(a)

20-nt flanking sequence

.-f-hi"_l

s y n r h sr i s DNJA

-

NormalYeastGenesCan Be Replacedwith M u t a n t A l l e l e sb y H o m o l o g o u sR e c o m b i n a t i o n Modifying the genomeof the yeastS. cereuisiaeis particularly easy for two reasons:yeast cells readily take up exogenous DNA under certain conditions, and the introduced DNA is efficiently exchangedfor the homologous chromosomal site in the recipient cell. This specific,targeted recombination of identical stretchesof DNA allows any genein yeastchromosomesto be replacedwith a mutant allele. (As we discussin Section5.1, recombination between homologous chromosomesalso occurs naturally during meiosis.) In one popular method for disrupting yeast genesin this fashion, the PCR is used to generatea disruption construct containing a selectablemarker that subsequentlyis transfectedinto yeastcells.As shown in Figure 5-39a,primersfor PCR amplification of the selectablemarker are designedto flankinclude about 20 nucleotidesidenticalwith sequences amplified resulting The replaced. ing the yeast gene to be constructcomprisesthe selectablemarker (e.g.,the kdnMX gene,which llke neo' confers resistanceto G-41 8 ) flanked by about 20 basepairs that match the ends of the target yeast gene. Transformeddiploid yeast cells in which one of the two copiesof the target endogenousgenehas beenreplaced by the disruption construct are identified by their resistance phenotype.Theseheterozygous to G-418 or other selectable diploid yeastcellsgenerallygrow normally regardlessof the function of the target gene,but half the haploid sporesderived from thesecellswill carry only the disruptedallele(Figure 5-39b). If a geneis essentialfor viability,then sporescarrying a disruptedallelewill not survive. Disruption of yeastgenesby this method is proving parthe role of proteinsidentifiedby ticularly usefulin assessing analysisof the entire genomic DNA sequence(seeChapter 6). A large consortiumof scientistshas replacedeach of the approximately 6000 genesidentified by this analysiswith the kanMX disruption construct and determinedwhich gene disruptionslead to nonviablehaploid spores.Theseanalyses have shown that about 4500 of the 6000 yeastgenesare not

gene may be viable becauseof operation of backup or compensatorypathways.To investigatethis possibility,yeast geneticistscurrently are searchingfor syntheticlethal mutations that might reveal nonessentialgeneswith redundant functions(seeFigure 5-9c).

*Fri-"|.

-

Z

Disruption construct

(b)

Four haploid spores

FLI G U R E5 - 3 9 H o m o l o g o u s r e c o m b i n a t i o n a EXPERIMENTA constructs can inactivate specific disruption with transfected ( a ) y e a s t . A s u i t a b l ec o n s t r u cfto r d i s r u p t i n ga g e n e s i n target . h et w o p r i m e r s t a r g e tg e n ec a n b e p r e p a r e db y t h e P C R T d e s i g n e df o r t h i s p u r p o s ee a c hc o n t a i na s e q u e n c eo f a b o u t 2 0 yeast n u c l e o t i d e(sn t )t h a t i s h o m o l o g o u st o o n e e n d o f t h e t a r g e t o f D NA a s e g m e n t a m p l i f y t o n e e d e d s e q u e n c e s a s g e n ea s w e l l carryinga selectablemarkergene such as kanMX, which confers to G-418. (b) When recipientdiploid Saccharomyces resistance c e l l sa r et r a n s f o r m e dw i t h t h e g e n e d i s r u p t i o nc o n s t r u c t , h o m o l o g o u sr e c o m b i n a t i obne t w e e nt h e e n d so f t h e c o n s t r u c t s i l l i n t e g r a t et h e a n d t h e c o r r e s p o n d i ncgh r o m o s o m asl e q u e n c ew

nonvrable

O F S P E C I F IGCE N E SI N E U K A R Y O T E S I N A C T I V A T I NTGH E F U N C T I O N

205

(a) Formation of ES cells carrying a knockout mutation neor

fuHSV

G e n eX r e p l a c e m e nct o n s t r u c t

Homologous ,/ r. recombination,? "il" ./

r'

ES-ceilDNA

;

G e n eX

O t h e rg e n e s

I I Gene-targeted linsertion

I II R a n d o m ltnserilon

v

v

M u t a t i o ni n g e n eX

N o m u t a t i o ni n g e n eX

Cellsare resistantto G - 4 1 8a n d g a n c i c l o v i r

C e l l sa r e r e s i s t a ntto G - 4 1 8b u t s e n s i t i v e to ganciclovir

(b) Positive and negative selection of recombinant ES cells O OO 6+

N o n r e c o m b i n a ncte l l s Recombinantswith gene-targetedinsertion

| - r " . , w i t hG - 4 1 8 ( p o s i t i vsee l e c t i o n ) J

o.',oo o-oo Ag

I fr"u, with ganciclovir ( n e g a t i v es e l e c t i o n ) |

*

o, -o rro

< EXPERIMENTAL FIGURE 5-40 lsolationof mouseEScellswith a gene-targeteddisruption is the first stage in productionof knockoutmice.(a)Whenexogenous DNAisintroduced rnto embryonic stem(ES) cells,randominsertion vianonhomologous recombrnation occursmuchmorefrequently thangene-targeted insertion viahomologous recombination Recombinant cellsin which onealleleof geneX (orange andwhite)isdisrupted canbe obtained by usinga recombinant vectorthatcarries geneX disrupted with neo'(green), whichconfers resistance to G-418,and,outside the regionof homology, tkHsv(yellow), thethymidine genefrom kinase herpes simplex vrrusTheviralthymidlne kinase, unlikethe endogenous mouseenzyme, canconvert the nucleotide analog ganciclovir intothe monophosphate form;thisisthenmodified to t h et r i p h o s p h af o t er m ,w h i c hi n h i b i tcse l l u l aDrN Ar e p l i c a t i o i nnE S cellsThusganciclovir iscytotoxic for recombinant EScellscarrying the tkHsv gene.Nonhomologous insertion includes the tkHsv gene, whereas homologous insertion doesnot;therefore, onlycellswith nonhomologous insertion aresensitive to ganciclovir (b) Recombinant cellsareselected by treatment with G-41g,since cellsthatfailto pickup DNAor integrate it intotheirgenomeare sensitive to thiscytotoxic compoundThesurvivrng recombinant cells aretreatedwith ganciclovir Onlycellswith a targeted disruption in geneX, andtherefore lacklng geneanditsaccompanying the fkHsv cytotoxicity, willsurvive[See S L Mansour etal, 1988,Nature336.348l

A useful promoter for this purpose is the yeast GAL1 promoter, which is active in cells grown on galactose but completely inactive in cells grown on glucose. In this approach, the coding sequenceof an essentialgene (X) ligated to the GALl promoter is inserted into a yeast shuttle u..to. (seeFigure 5-17a).The recombinant vector then is introduced into haploid yeastcellsin which geneX has beendisrupted. Haploid cells that are transformed will grow on galactosemedium, since the normal copy of gene X on the vector is expressedin the presenceof galactose.\fhen the cells are transferredto a glucose-containingmedium, geneX no longer is transcribed;as the cells divide, the amount of

c'l

o o-

E S c e l l sw i t h t a r g e t e dd i s r u p t i o ni n g e n eX

Transcriptionof GenesLigatedto a Regulated P r o m o t e rC a n B e C o n t r o l l e dE x p e r i m e n t a l l y Although disruption of an essenrialgene required for cell g r o w t h w i l l y i e l dn o n v i a h l es p o r e sr.h i i m e r h o dp r o v i d e sl i m l e infclrmation about what the encodedprotein actually does in cells.To learn more about how a specificgenecontributesto cell growth and viability investigarorsmust be able to selec_ tively inactivatethe genein a population of growing cells.One method for doing rhis empkrysa regularedpro-oi.. to selec_ tively shut off transcription of an essentialgene. 206

o

c H A p r E5R I

M o L E c u L AGRE N E Tr tEcc H N t o u E S

In an early application of this method, researchersex, plored the function of cytosolic Hsc70 genes ln yeasr. Haploid cells with a disruption in all four redundant Hsc70 geneswere nonviable, unlessthe cells carried a vector containing a copy of the Hsc70 gene that could be ex_ pressedfrom the GALI promoter on galactosemedium. On transfer to glucose,the vector-carryingcells eventually stopped growing becauseof insufficient Hsc70 acivity. C a r e f u l e x a m i n a r i o n o f t h e s e d y i n g c e l l s r e v e a l e dt h a t their secretory proteins could no longer enter the endoplasmic rericulum (ER). This study provided the first evi_ dencefor the unexpectedrole of Hsc70 protein in translocation of secretory proteins into the ER, a process e x a m i n e di n d e t a i l i n C h a p t e r 1 3 .

#

uia"o: Microinjectionof ESCellsinto a Blastocyst

for a FIGURE 5-41 EScellsheterozygous > EXPERIMENTAL disruptedgene are usedto producegene-targetedknockout for a knockout cellsheterozygous stem(ES) mice.Step1: Embryonic (X andhomozygous for a dominant mutationin a geneof interest alleleof a markergene(here,browncoatcolor,A) aretransplanted thatarehomozygous cavityof 4 5-dayembryos intothe blastocoel alleleof the marker(here,blackcoatcolor,a) Step2: for a recessive female intoa pseudopregnant thenareimplanted Theearlyembryos by indicated cellsarechimeras, ES-derived containing Thoseprogeny micethenare theirmixedblackandbrowncoats.Step3: Chimeric fromthismatinghaveE5to blackmice;brownprogeny backcrossed of DNAisolated 4-6: Analysis derived cellsin theirgermline Steps brownmice canidentify froma smallamountof tailtissue of thesemice alleleIntercrossing for the knockout heterozygous that allele, produces for the disrupted homozygous someindividuals 1989,Trends fromM R.Capecchi, mice.lAdapted is,knockout Genet5:70.1

E gffl'"? ::l[T;"0?]X'J"'""' Brown mouse (NA, X-lx+) B l a c km o u s e (ala, X+lX+l 4.5-dayblastocyst

I

EIl"[';:Xl'.ffi ['Ji:;i]:il:; * A F o s t e rm o t h e r

SpecificGenesCan Be PermanentlyInactivated i n t h e G e r m L i n eo f M i c e Many of the methods for disrupting genesin yeast can be applied to genesof higher eukaryotes.Thesealteredgenescan be introduced into the germ line via homologous recombination to produce animals with a gene knockout, or simply "knockout." Knockout mice in which a specificgeneis disrupted are a powerful experimental systemfor studying mammalian development, behavior, and physiology. They also are useful in studying the molecular basisof certain human geneticdiseases. Gene-targetedknockout mice are generatedby a two-stage procedure.In the first stage,a DNA construct containing a disrupted allele of a particular target gene is introduced into embryonic stem (ES)cells.Thesecells,which are derived from the blastocyst,can be grown in culture through many generations (seeFigure 21'-7).In a small fraction of transfectedcells, the introduced DNA undergoeshomologousrecombinationwith the target gene, although recombination at nonhomologous chromosomal sitesoccurs much more frequently' To selectfor cells in which homologous gene-targetedinsertion occurs' the recombinant DNA construct introduced into ES cells needsto include two selectablemarker genes (Figure 5-40). One of thesegenes(neo'),which confersG-418 resistance,is inserted within the target gene (X), thereby disrupting it. The other selectable gene, the thymidine kinase gene from herpes simplex virus (lAHsv),confers sensitivity to ganciclovir, a cytotoxic nucleotide analog; it is inserted into the construct outside the target-genesequence.Only ES cells that undergo homologous reIo-bitr"tiott, and therefore do not incorporate tkHsv, can survivein the presenceof both G-418 and ganciclovir.In these cellsone alleleof geneX will be disrupted. In the second stage in production of knockout mice' ES cellsheterozygousfor a knockout mutation in geneX are injected into a recipient wild-type mouse blastocyst,which subsequentlyis transferred into a surrogatepseudopregnant female mouse (Figure 5-41). The resultingprogeny will be chimeras, containing tissues derived from both the transplantedES cellsand the host cells.If the ES cellsalso are ho-

Black I S.t""t chimericmicefor to wild-typeblackmice I crosses

v

germcells: All germcells: Possible a/X+ A/X+tA/X-: a/X* =r I tt cell-deriveo ProgenY s I will be brown

v

a/a, X+/X* Progenyfrom ES cell-derived germcells !| | s.re"n brown ProgenYDNA -* to identify X'lX+ heterozygotes al EI

Mate X-lX* heterozYgotes

Screen Progeny DNA to identifY lil - I l, X tx- homozYgotes

Knockoutmouse

mozygous for a visible marker trait (e.g., coat color)' then chimeric progeny in which the ES cells survived and proliferated can te identified easily.Chimeric mice are then mated with mice homozygous for another allele of the marker trait to determine if the knockout mutation is incorporated into the germ line. Finally, mating of mice' each heterozygous for the knockout allele, will produce progeny homozygous for the knockout mutation.

C E N E SI N E U K A R Y O T E S T H E F U N C T I O NO F S P E C I F I G INACTIVATING

207

loxP mouse

Cre mouse

A l l c e l l sc a r r ye n d o g e n o u sg e n e Xwith /oxPsitesflankingexon 2

Heterozygousfor gene X knockout; all cellscarry cre gene

Cell{ype-specif ic promoter

Cellsnot expressingCre

CellsexpressingCre

[email protected]

G e n ef u n c t i o ni s n o r m a r

IoxP-Cre mouse All cells carry one copy of loxpmodified gene X, one copy of g e n eX k n o c k o u ta, n d c r e g e n e s

EXPERIMENTAL FTGURE 5-42 The loxp-Crerecombination system can knock out genes in specificcell types. A /oxpsjte is insertedon eachsideof the essential exon2 of the targetgeneX (blue)by homologousrecombination, producinga /oxpmouse.Since the /oxPsitesare in introns,they do not disruptthe functionof X T h e C r e m o u s ec a r r i e o s n e g e n eX k n o c k o u at l l e l ea n d a n i n t r o d u c e d p'l linkedto a cell-type_specific cre gene (orange)from bacteriophage promoter(yellow)The cre gene is incorporatedinto the mouse genomeby nonhomologousrecombination and doesnot affectthe

Development of knockout mice that mimic certain human diseasescan be illustrated by cystic fibrosis. By methodsdiscussedin Section5.4, the recessrve murarion that causesthis diseaseeventuallywas shown to be located in a geneknown as CFTR, which encodesa chloride chan_

rnice are currently being used as a model systemfor stud ing this geneticdiseaseand developingeffectivetherapies

S o m a t i cC e l lR e c o m b i n a t i o C n a nI n a c t i v a t e G e n e si n S p e c i f i cT i s s u e s Investigatorsoften are interestedin examining the effects o f k n o c k o u t m u t a t i o n si n a p a r t i c u l a rt i s s u eo i t h e m o u s e , at a specificstagein development,or both. However, mice carrying a germ-line knockout may have defectsin numer_ ous tissuesor die before the developmentalstageof inter_ est. To addressthis problem, mouse geneticistshave de_ v i s e d a c l e v e r t e c h n i q u et o i n a c t i v a l er a r g e r g e n e s l n 208

.

c H A p r E5R | M o L E c u L AGRE N E Tr tEcc H N t o u E S

-

FE G e n ef u n c t i o n isdisrupted

functionof othergenesln the/oxp-Cre mtcethat resultfrom crossing, Creproteinisproduced onlyin thosecellsin whichthe promoter isactiveThusthesearethe onlycellsin which recombrnation between the/oxPsites catalyzed by Creoccurs, leading to deletion of exon2 Since the otheralleleisa constitutive geneX knockout, deletion between the/oxpsitesresults in complete l o s so f f u n c t i o on f g e n e X i na l lc e l l se x p r e s s iC ng r e B yu s i n g promoters, different researchers canstudytheeffects of knockinq out geneX in various typesof cells specifictypes of somatic cells or at particular times during development This techniqueemploys site-specificDNA recombination sites(calledloxP sires)and the enzymeCre that catalyzesrecombination between them. The loxP-Cre recombination system is derived from bacteriophageP1, but this sitespecificrecombination sysremalso functions when placed in mouse cells. An essentialfeature of this technique is that expression of Cre is controlled by a cell-type-specificpromoter. In loxP-Cre mice generatedby the procedure depicted in Figure 5-42,inactivation of the geneof interest (X) occurs only in cells in which the promoter controlling the cre gene is active. An early application of this techniqueprovided strong evidencethat a particular neurotransmitterreceptor is important for learning and memory. Previouspharmacological and physiologicalstudieshad indicated that normal learning requiresthe NMDA classof glutamatereceptorsin the hippocampus,a region of the brain. But mice in which the gene encoding an NMDA receptor subunit was knocked out died neonatally,precluding analysis of the receptor's role in learning. Following the protocol in Figure 5-42, researchersgeneratedmice in which the receptorsubunit gene was inactivatedin the hippocampusbut expressedin other tissues. These mice survived to adulthood and showed

llll+ Technique Mouse Animation:creatinga Transgenic z/ar\ \\"2

DNA injected into a Pronucleusof a Mouse

miceare produced FIGURE 5-43 Transgenic > EXPERIMENTAL by randomintegrationof a foreigngeneinto the mousegerm (themale intooneof thetwo pronuclei DNAinjected line.Foreign hasa good bythe parents) andfemalehaploidnucleicontributed of the intothe chromosomes integrated of beingrandomly chance intothe recipient is integrated a transgene diploidzygoteBecause it doesnot disrupt recombination, genomeby nonhomologous l l7 . 2 7 3 1 L B r i n s t e r e, t1a9l 8 1C e n d o g e n o u s g e n[ S e se e R , e2

Injectforeign DNA intooneofthe pronuclei

Pronuclei

Fertilizedmouse egg Prlor t o f u s i o no f m a l e a n d f e m a l ep r o n u c l e i

II Transferinjectedeggs I into foster mother

learning and memory defects,confirming a role for thesereceptors in the ability of mice to encode their experiences rnto memory.

I

+

D o m i n a n t - N e g a t i vAel l e l e sC a n F u n c t i o n a l l y l n h i b i t S o m eG e n e s In diploid organisms,as noted in Section5.1, the phenotypic effect of a recessiveallele is expressedonly in homozygous individuals,whereasdominant allelesare expressedin heterozygotes.Thus an individual must carry two copies of a recessiveallele but only one copy of a dominant allele to exhibit the corresponding phenotypes. Sfe have seen how strains of mice that are homozygous for a given recessive knockout mutation can be produced by crossingindividuals that are heterozygousfor the same knockout mutation (see Figure 5-41). For experimentswith cultured animal cells, however, it is usually difficult to disrupt both copies of a genein order to produce a mutant phenotype.Moreover, the difficulty in producing strainswith both copiesof a genemutated is often compounded by the presenceof related genes of similar function that must also be inactivated in order to reveal an observablephenotype. For certain genes,the difficulties in producing homozygous knockout mutants can be avoided by use of an allele carrying a dominant-negativemutation. Theseallelesare genetically dominant; that is, they produce a mutant phenotype even in cells carrying a wild-type copy of the gene. However, unlike other types of dominant alleles,dominantnegativeallelesproduce a phenotypeequivalentto that of a loss-of-function mutatton. Useful dominant-negativealleleshave been identified for a variety of genesand can be introduced into cultured cells by transfection or into the germ line of mice or other organisms. In both cases,the introduced geneis integratedinto the genome by nonhomologous recombination. Such randomly inserted genesare called transgenes;the cells or organisms carrying them are referred to as transgenic.Transgenescarrying a dominant-negative allele usually are engineeredso that the allele is controlled by a regulatedpromoter, allowing expressionof the mutant protein in different tissuesat different times. As noted above, the random integration of exogenousDNA via nonhomologousrecombinationoccursat

o About 10-30% of offspringwill contain foreign DNA in chromosomesof a l l t h e i r t i s s u e sa n d g e r m l i n e Breed mice expressing foreign DNA to proPagate DNA in germline

@

@

a much higher frequency than insertion via homologous recombination. Becauseof this phenomenon' the production of transgenicmice is an efficient and straightforward process

GTPasesfrom an inactive GDP-bound state to an active GTP-bound state dependson their interacting with a corresponding guanine nucleotide exchangefactor (GEF)' A ,rr,.riu.r,small GTPase that permanently binds to the GEF orotein will block conversion of endogenous wild-type imall GTPasesto the active GTP-bound state' thereby inhibiting them from performing their switching function ( F i g u r e5 - 4 4 ) .

C E N E SI N E U K A R Y O T E S T H E F U N C T I O NO F S P E C I F I G INACTIVATING

(a) Cellsexpressingonly wild-type allelesof a small GTPase

Inactive

j

fGo' \-/ Wildtype

(b) Cellsexpressingboth wild-type allelesand a dominant-negativeallele

D o m i n a n t - n e guve a mutant

FIGURE 5-44 Inactivationof the functionof a wild-type GTPase by the actionof a dominant-negative mutantallele. (a)Small(monomeric) (purple) GTPases areactivated by their interaction with a guaninenucleotide exchange factor(GEF), which catalyzes the exchange of GDpfor GTp(b)Introduction of a dominant-negative alleleof a smallGTpase geneintocultured cellsor transgenic animals leadsto expression of a mutantGTpase that binds to andinactivates the GEFAsa result, endogenous wild-type copies of thesamesmallGTPase aretrappedin the inactive GDp-bound stateA singledominant-negative allelethuscauses a loss-offunctionphenotype in heterozygotes similar to thatseenin homozygotes carrying two recessive loss-of-f unctionalleles

R N AI n t e r f e r e n c e C a u s e sG e n eI n a c t i v a t i o nb y Destroyingthe CorrespondingmRNA A recently discoveredphenomenon known as RNA interference (RNAi) is perhaps the mosr straightforward method to inhibir the function of specificgenes.This approach is technically simpler than the methods described above for disrupting genes.First observed in the roundworm C. elegans,RNAi refers to rhe ability of doublestranded RNA to block expression of its corresponding single-strandedmRNA but not that of mRNAs with a difl ferent sequence. As describedin Chapter 8, the phenomenon of RNAi rests on the general ability of eukaryotic cells to cleave double-strandedRNA inro short (23-nt) double-stranded segmentsknown as small inhibitory RNA (siRNA). The RNA endonuclease that catalyzesthis reaction, known as

tween one strand of the siRNA and its complementaryse_ quenceon the target nRNA; subsequently,specificnucle_ asesin the RISC complex then cleave the mRNA/siRNA hybrid. This model accounts for the specificity of RNAi, since it dependson basepairing, and for its potency in si_ lencing gene function, since the complem entary mRNA is 21O

.

cHAprER 5

|

M o L E c u L AG R E N E T tr cE c H N t e u E s

permanently destroyed by nucleolytic degradation. The normal function of both Dicer and RISC is to allow for gene regulation by small endogenous RNA molecules known as micro RNAs (miRNAs). Researchersexploit the micro RNA pathway for intentional silencing of a gene of interest by using either of two generalmethods for generatingsiRNAs of defined sequence. In the first method a double-strandedRNA corresponding to the target genesequenceis produced by in vitro transcription of both senseand antisensecopiesofthis sequence(Figure5-45a). This dsRNA is injected into the gonad of an adult worm. where it is converted to siRNA by Dicer in the developing embryos. In conjunction with the RISC complex, the siRNA molecules causethe corresponding mRNA molecules to be destroyedrapidly. The resulting worms display a phenotype similar to the one that would result from disruption of the corresponding gene itself. In some cases,entry of just a few moleculesof a particular dsRNA into a cell is sufficient to inactivate many copies of the corresponding mRNA. Figure 5-45b illustrates the ability of an injected dsRNA to interfere with production of the corresponding endogenousmRNA in C. elegansembryos.In this experiment, the mRNA levels in embryos were determined by incubating the embryos with a fluorescently labeled probe specific for the mRNA of interest. This technique,in situ hybridization, is useful in assayingexpressionof a particular mRNA in cells and tissuesections. The second method is to produce a specific doublestranded RNA in vivo. An efficient way ro do this is to expressa synthetic gene thar is designedto contain tandem segmentsof both senseand anti-sensesequencescorresDonding to the target gene (Figure 5-45c). \X/henthis gene is transcribed, a double-strandedRNA "hairpin" srructure forms, known as small hairpin RNA, or shRNA. The shRNA will then be cleaved by Dicer to form siRNA molecules. The lentiviral expressionvectors are particularly useful for introducing synrhericgenes for the expressionof shRNA constructsinto animal cells. Both RNAi methods lend themselves to systematic studiesto inactivateeach of the known genesin an organism and to observewhat goeswrong. For example, in initial studies with C. elegans,RNA interferencewith 16,700 genes(about 86 percent of the genome)yielded 1722 visibly abnormal phenotypes.The geneswhose functional inactivation causesparticular abnormal phenotypescan be grouped into sets;each member of a set presumably controls the same signals or events.The regulatory relations between the genes in the set-for example, the genes that control muscledevelopment-can then be worked out. Other organismsin which RNAi-mediated geneinactivation has been successfulinclude Drosophila, many kinds of plants, zebra fish, the frog Xenopus, and mice, and are now the subjects of large-scaleRNAi screens.For example, lentiviral vectors have been designedto inactivate by RNAi more than 10,000 different genes expressedin cultured mammalian cells. The function of the inactivated genescan be inferred from defects in growth or morphology of cell clones transfectedwith lentiviral vectors.

fi| ,oo."rt: RNAInterference (a) In vitro production of double-stranded RNA Antisensetranscript

--\(-

Injected

Noninjected

(c) In vivo production of double-stranded RNA

(RNA|)can 5-45 RNAinterference FIGURE < EXPERIMENTAL functionallyinactivategenesin C.elegansand other for RNA(dsRNA) of double-stranded organisms.(a)Invitroproduction gene, the gene of sequence The coding target RNA|of a specific DNA,is of genomic fromeithera cDNAcloneor a segment derived to a strong vectoradjacent in a plasmid placedin two orientations in vitrousingRNA of bothconstructs promoterTranscription in yields manyRNAcoptes triphosphates polymerase andribonucleoside (identical or sequence) mRNA with the orientation thesense these conditions, orientationUndersuitable antisense complementary to formdsRNAWhenthe willhybridize RNAmolecules complementary by DicerintosiRNAs(b) intocells,it iscleaved isinjected dsRNA by RNA|(seethe worm embryos in of mex3RNAexpression lnhibition was (Left) RNA in embryos mex3 of Expression mechanism) for the text for thismRNA,that with a probespecific by in situhybridization assayed product(Rtgtht) a colored(purple) thatproduces is,linkedto an enzyme mex3 double-stranded with froma worminjected Theembryoderived indicated by mRNA, as mex3 no endogenous produces little or mRNA embryois=50 Fm in length of color.Eachfour-cell-stage theabsence viaan engineered RNAoccurs (c)Invivoproduction of double-stranded geneconstruct isa intocellsThesynthetic directly plasmid introduced of the sequences and antisense sense of both tandemarrangement RNA smallhairpin double-stranded targetgeneWhenit istranscribed, (b) by Dicerto formsiRNAlPart iscleaved TheshRNA forms(shRNA) Nature 391:806 etal. 1998, l fromA Fire

Sensetranscript

r The /oxP-Cre recombination system permits production of mice in which a geneis knocked out in a specifictissue.

siRNA 2+

Inactivating the Function of SpecificGenes in Eukaryotes r Once a gene has beencloned, important clues about its normal function in vivo can be deducedfrom the observed phenotypic effectsof mutating the gene. r Genescan be disrupted in yeast by inserting a selectable marker geneinto one allele of a wild-rype genevia homologous recombination, producing a heterozygousmutant. \7hen such a heterozygoteis sporulated, disruption of an essential genewill producetwo nonviablehaploid spores(Figure5-39). r A yeastgenecan be inactivatedin a controlledmannerby using the GALI promoter to shut off transcription of a genewhen cellsare transferredto glucosemedium.

r In the production of transgeniccells or organisms,exogenous DNA is integrated into the host genome by nonhomologous recombination (seeFigure 5-43). Introduction of a dominant-negativeallele in this way can functionally inactivate a genewithout altering its sequence. r In many organisms,including the roundworm C. elegans, double-stranded RNA triggers destruction of the all the mRNA moleculeswith the samesequence(seeFigure 5-45). This phenomenon, known as RNAI (RNA interference), provides a specificand potent means of functionally inactivating geneswithout altering their structure.

As the examplesin this chapter and throughout the book illustrate, genetic analysis is the foundation of our understanding of many fundamental processesin cell biology. By examining the phenotypic consequencesof mutations that inactivate a particular gene' geneticistsare able to connect knowledge about the sequence'structure' and biochemical

r In mice, modified genescan be incorporated into the germ line at their original genomic location by homologous recombination,producingknockouts (seeFigures5-40 and 5-41).Mouse knockoutscan providemodelsfor human genetic diseases such as cysticfibrosis. P E R S P E C T I VF EO S RT H E F U T U R E

211

Although scientistscontinue to use this classicalgenetic approachto dissectfundamentalcellular processes and biochemical pathways, the availability of iomplete genomic sequenceinformation for most of the common experimental organisms has fundamentally changed the way genetic experiments are conducted. Using various computational methods, scientistshave identified the protein-coding gene sequences in most experimentalorganismsincludingE. coli, yeast, C. elegans,Drosophila, Arabidopsis, mouse, and humans.The genesequences, in turn, revealthe primary amino acid sequenceof the encodedprotein products, providing us with a nearly complete list of the proteins found in each of the major experimentalorganisms. The approach taken by most researchershas thus shifted from discoveringnew genesand proteins to discoveringthe functions of genesand proteins whose sequencesare already known. Once an interestinggenehas beenidentified,genomic sequenceinformation greatly speedssubsequentgeneticmanipulations of the gene,including its designedinactivation, to learn more about its function. Already sets of vectors for RNAi inactivation of most defined senesin the nematode C. elegansnow allow efficientgeneric,ir..n, to be performed in this multicellular organism.Thesemethodsare now being applied to largecollectionsof genesin cultured mammalian cells and in the near future either RNAi or knockout methodswill have beenusedto inactivateeverygenein the mouse. In the past, a scientistmight spend many years studying only a single gene, but nowadays scientistscommonly study whole setsof genesar once. For example,with DNA microarrays the level of expressionof all genesin an organismcan be measuredalmost as easily as the expressionof a singlegene. One of the great challengesfacing geneticistsin the twentyfirst century will be to exploit the vast amount of available data on the function and regulation of individual genesto understandhow groups of genesare organizedto form complex biochemicalpathways and regulatory nerworks.

KeyTerms alleles 166

linkage175

ctone I /')

tlntation 765 Northern blotting 192 phenotype155

|

4

- ^

complementary DNAs (cDNAs) 181 complementation183 DNA cloning 126 DNA library 179 DNA microarray 192 dominant L66 geneknockoul'207 genomics129 genotype166 heterozygous166 homozygous165 hybridization 181 in situ hybridizatton 192 212

.

c H A p r EsR

plasmids178 polymerasechain r e a c t i o n( P C R )1 8 8 p r o b e s1 8 1 recessive165 recombinantDNA 126 recombination175 restriction enzymes176 RNA interference (RNAi)210 segregation167 Southern blotting 191 MOLECULAG RENETIC TECHNIQUES

temperature-sensrtrve mutations 170

transgenes209 vector 1-76

transfection 196 transformationL78

Review the Concepts 1, Genetic mutations can provide insights into the mechanisms of complex cellular or developmentalprocesses.How might your analysisof a geneticmutation be different depending on whether a particular mutation is recessiveor dominant? 2. Give an example of how and why temperature-sensitive mutations might be usedto study the function of essentialgenes. 3. Describehow complementation analysiscan be used to reveal whether two mutations are in the sameor in different genes.Explain why complementation analysiswill not work with dominant mutations. 4, Compare the different usesof suppressorand synthetic lethal mutations in geneticanalysis. 5. Restriction enzymesand DNA ligaseplay essentialroles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA? Describe some general features of restriction enzymesites.ril/hat are the three types of DNA ends that can be generatedafter cutting DNA with restriction enzymes?\{hat reaction is catalyzedby DNA ligase? 6. Bacterial plasmids often serve as cloning vectors. Describethe essentialfeaturesof a plasmid vector. Sfhat are the advantagesand applicationsof plasmidsas cloning vectors? 7. A DNA library is a collectionof clones,eachcontaining a different fragment of DNA, inserted into a cloning vector. What is the differencebetweena cDNA and a genomic DNA library? How can you use hybridization or expressionto screen a library for a specific gene? How many different oligonucleotideprimers would need to be synthesizedas probes to screena library for the gene encoding the peptide Met-Pro-Glu-Phe-Tyr? 8. In 1993, Kerry Mullis won rhe Nobel prize in chemistry for his invention of the PCR process.Describethe three steps in each cycle of a PCR reaction. $fhy was the discoveryof a thermostableDNA polymerase(e.g.,Taq polymerase)so important for the developmentof PCR? 9. Southernand Northern blotting are powerful tools in molecular biology basedon hybridization of nucleic acids. How are these techniques the same? How do they differ? Give some specific applications for each blotting technique. 10. A number of foreign proteins have been expressedin bacterial and mammalian cells. Describe the essential featuresof a recombinantplasmid that are required for expressionof a foreign gene.How can you modify the foreign protein to facilitate its purification? What is the advantage of expressinga protein in mammalian cellsversusbacteria? 11. What is a DNA microarray? How are DNA microarrays usedfor studying geneexpression?How do experimentswith microarrays differ from Northern blotting experiments?

12. In determining the identity of the protein that corresponds to a newly discoveredgene, it often helps to know the pattern of tissueexpressionfor that gene.For example, researchers have found that a genecalledSERPINA6 is expressedin the liver, kidney, and pancreasbut not in other tissues.!7hat techniques might researchersuse to find out which tissuesexpressa particular gene?

b. A wild-type yeastcDNA library, preparedin a plasmid that contains the wild-type URA3* gene' is used to transformX cells,which are then culturedas indicated.Each black spot below representsa singleclone growing on a petri '$7hat plate. are the molecular differencesbetweenthe clones growing on the two plates?How can theseresults be used to identify the geneencodingX?

13. DNA polymorphisms can be used as DNA markers. Describethe differencesbetweenRFLR SNR and SSRpolymorphisms.How can thesemarkersbe usedfor DNA mapping studies? 14. How can linkage disequilibrium mapping sometimcs provide a much higher resolutionof genelocation than classicallinkagemapping? 15. Genetic linkage studies can usually only roughly locate the chromosomalposition of a "disease"gene.How can expression analysis and DNA sequenceanalysis help locate a diseasegenewithin the region identified by linkage mapping? 16. Gene targetingby siRNA techniquesexploits a normal micro RNA pathway that is found in all metazoansbut not in simpler eukaryotessuch as yeast.\7hat are the roles of Dicer and RISC in this pathway? 77. The ability to selectivelymodify the genome in the mousehas revolutionizedmousegenetics.Outline the procedure for generatinga knockout mouse at a specificgenetic locus.How can the loxP-Cresystembe usedto conditionally knock out a gene?\Vhat is an important medicalapplication of knockout mice? 18. Two methods for functionally inactivating a gene withmuout alteringthe genesequenceare by dominant-negative tations and RNA interference(RNAi). Describehow each method can inhibit expressionof a gene.

A culture of yeast that requiresuracil for growth (ura3-) was mutagenized,and two mutant colonies,X and Y, have been isolated.Mating type a cells of mutant X are mated with mating type o cellsof mutant Y to form diploid cells. The parental (ura3 ), X, Y, and diploid cells are streaked onto agar platescontaininguracil and incubatedat 23 "C or 32'C. Cell growth was monitored by the formation of colonieson the culture platesas shown in the figure below. Denotesgrowth of cells

ura3 '/'

ura

w

Parental X

Growthat 23'C

Parental X PCR

d. A construct of the wild-type geneX is engineeredto encode a fusion protein in which the green fluorescentprotein (GFP) is presentat the N-terminus (GFP-X) or the Cterminus (X-GFP) of protein X. Both constructs'presenton a URA3* plasmid, are used to transform X cells grown in the absenceof uracil. The transformants are then monitored for growth at 32oC, shown below at the left. At the right are typical fluorescentimagesof X-GFP and GFP-X cells grown at 23 "C in which green denotesthe presenceof green fluorescentprotein. What is a reasonableexplanation for growth o f G F P - X b u t n o t X - G F P c e l l sa t 3 2 ' C ?

\X \

\

/,

G r o w t ha t 3 2 ' C o n m e d i al a c k i n gu r a c i l

c. DNA is extracted from the parental cells, from X cells, and from Y cells and digested with a restriction enzyme.The digests are analyzedby Southern blot analysis, shown at the left below, using a probe obtained from the gene encoding X. In addition, PCR primers are used to amplify the gene encoding X in both the parental and the X cells.The primersare complementaryto regionsof DNA just external to the geneencoding X. The PCR results are shown in the gel at the right. What can be deducedabout the mutation in the X genefrom thesedata?

Southern

Analyzethe Data

Diploid

G r o w t ha t 2 3 ' C o n m e d i al a c k i n gu r a c i l

Diploid

G F P - Xc e l l

/, G r o w t ha t 3 2 ' C X-GFP

What can be deducedabout mutants X and Y from

a. the data provided?

Growth at 32 "C

G F Pl o c a l i z a t i oinn c e l l s grown at 23 'C THE DATA ANALYZE

O

213

e. Haploid offspring of the diploid cells from part (a) above are generated.XY double mutants constitute 114 of theseoffspring.Haploid X cells,Y cells,and XY cellsin liquid culture are synchronizedat a stagejust prior to budding and then are shifted from 23'C to 32 oC. Examination of the cells 24 hours later revealsthat X cellsare arresredwith small buds, Y cellsare arrestedwith large buds, and XY cellsare arrested with small buds.\Whatis the relationshipbetweenX and Y?

References Genetic Analysis of Mutations to ldentify and Study Genes Adams,A. E. M., D. Botstein,and D. B. Drubin. 1989.A yeast actin-bindingprotein is encodedby sac6,a genefound by suppression of an actin muration. Science243:231. Griffiths, A. G. F., et al. 2000. An Introduction to Genetic Analysis,Tth ed. W. H. Freemanand Company. Guarente,L.1993. Synthericenhancement in geneinteraction:a genetictoof comesof age.TrendsCenet.g:362-3o6. Hartwell, L. H. 1967.Macromolecularsynthesis of temperature-sensitive mutanrs of yeast.J. Bacteriol. 93:1662. Hartwell, L.H. 1974. Geneticcontrol of the cell divisioncycle in yeast.Science183:46. Niisslein-Volhard, C., and E.'Wieschaus. 1980.Mutations affectins segmentnumber and polariryin Drosophila.Nature 287:795-801. Simon,M. A., er al. 1991. Rasl and a putativeguaninenucleotide exchangefactor perform crucialstepsin signalingby the sevenless protein tyrosinekinase.Cell 67:701-776. Tong,A. H., et al. 2001. Systematicgeneticanalysiswith ordered arraysof yeastdeletionmurants.Science294:2364)368. DNA Cloning and Characterization Ausubel,F. M., et al.2002. Current Protocolsin Molecular Biology.Vlley. Gubler,U., and B. J. Hoffman. 1983.A simpleand very efficient method for generatingcDNA libraries. Gene 25:263-289. Han, J. H., C. Stratowa,and W. I. Rutter.1987.Isolationof fulllengthputativerat lysophospholipase cDNA usingimprovedmethods for mRNA isolationand cDNA cloning.Biochem.26:.161.7-1632. Itakura,K., J.J. Rossi,and R. B. Wallace.1984.Synthesis and use of syntheticoligonucleotides.Ann. Reu.Biochem. 53:323-356. Maniatis, T., et al. 1978.The isolation of structural senesfrom libraries of eucaryoticDNA. Cel/ 15:687-701. Nasmyth,K. A., and S. I. Reed.1980.Isolationof senesby complementationin yeast:molecularcloning of a cell-Jyclegene. Proc. Nat'l Acad. Sci.USA 77:21.19-2123. Nathans,D., and H. O. Smith. 1975.Restrictionendonucleases in the analysisand restructuringof DNA molecules.Ann. Reu.Biochem. 44:273193. Roberts,R. J., and D. Macelis.1997.REBAsE-restricrion enzymesand methylases.Nacl. Acids Res.25:248-262. Information on accessinga continuouslyupdateddatabaseon restrictionand modification enzymesat http://www.neb.com/rebase.

214

c H A P T E R5

|

M O L E C U L AG R E N E T TTCE C H N T Q U E S

Using Cloned DNA Fragments to Study Gene Expression Andrews, A.T. 1986. Electrophoresis,2d ed. Oxford University Press. Erlich, H., ed. 1.992.PCR Technology:Principlesand Applicationsfor DNA Amplification. W. H. Freemanand Company. Pellicer,A., M. Wigler, R. Axel, and S. Silverstein.1978. The transfer and stableintegration of rhe HSV thymidine kinasegene into mousecells.Cel/ 4t:1,33-1{1,. Saiki,R. K., et al. 1988. Primer-directed enzymaticamplification of DNA with a thermostableDNA polymerase.Science239:487491. Sanger,F. 1981. Determinationof nucleotidesequences in DNA. Science214:720 5-'1210. Souza,L. M., et al. 1986.Recombinanthuman granulocyte-colony stimulating factor: effectson normal and leukemic myeloid cells. Science232:61-65. 'Wahl, G. M., J. L. Meinkoth, and A. R. Kimmel. 1987. Northern and Southern6lots. Metb. Enzymol. 152:572-581. Wallace,R. B., et al. 1,987.The useof syntheticoligonucleotides as hybridizationprobes.II: Hybridization of oiigonucleotides of mixed sequence to rabbit B-globinDNA. Nzcl. Acids Res.9:879-887. ldentifying and Locating Human Disease Genes Botstein,D., et al. 1980. Constructionof a geneticlinkage map in man using restriction fragmentlength polymorphisms.Az. /. Genet.32:31.4-331.. Donis-Keller,H., et al. 1,987.A geneticlinkage map of the human genome.Cell 5l:319-337. Hartwell, et al. 2000. Genetics:From Genesto Genomes. McGraw-Hill. Hastbacka,T., et al. 1994.The diastrophicdysplasiagene encodesa novel sulfatetransporter:positional cloning by finestructurelinkage disequilibriummapping. Cell 781.073. Orita, M., et al. 1989. Rapid and sensitivedetecrionof point mutations and DNA polymorphismsusing the polymerasechain reaction. Genomics5:874. Tabor,H. K., N.J. Risch,and R. M. Myers.2002. Opinion: candidate-gene approachesfor studyingcomplex generictrairs: practicalconsiderations.Nat. Reu.Genet.3:391,-397. Inactivating the Function of Specific Genes in Eukaryotes Capecchi,M. R. 1989. Altering the genomeby homologousrecombination. Science 244 :'1,288-1,292. Deshaies,R. J., et al. 1988. A subfamily of stressproteins facili, tatestranslocationof secretoryand mitochondrial precursor polypeptides.Nature 332:800-805. Fire, A., et al. 1,998.Porentand specificgeneticinterferenceby double-strandedRNA in Caenorhabditiselegans.Nature 391:806-8'1.1. Gu, H., et al. 1994. Delerion of a DNA polymerasebeta gene segmentin T cellsusing cell type-specificgenetargeting.Science 265:L03-106. Zamore, P. D., T. Tuschl,P.A. Sharp,and D. P. Bartel.2000. RNAi: double-strandedRNA directsthe ATP-dependentcleavageof mRNA at 21 to 23 nucleotideinrervals.Cell 101:25-33. Zimmer, A. 1992. Manipulating the genomeby homorogous recombinationin embryonic stem cells.Ann. Reu.Neurosci. 15:115

CHAPTER

GENES, AND GENOMICS, CHROMOSOMES ThesebrightlycoloredRxFISH-painted chromosomes areboth anomalies and in beautifuland usefulin revealing chromosome of Clinical comparingkaryotypes of differentspecies[@Department Researchers, Incl Cytogenetics, Addenbrookes Hospital/Photo

I n previous chapterswe learnedhow the structure and comI position of proteins allow them to perform a wide variety I of cellular functions. We also examined another vital component of cells, the nucleic acids, and the processby which information encoded in the sequenceof DNA is translated into protein. In this chapter,our focus again is on DNA and proteins as we consider the characteristicsof eukaryotic nuclear and organellar genomes:the features of genesand the other DNA sequencethat comprise the genome, and how this DNA is structured and organized by proteins within the cell. By the beginning of the twenty-first century, molecular biologists had completed sequencingthe entire genomesof hundredsof viruses,scoresof bacteria,and one unicellular eukaryote, the budding yeast S. cereuisiae.In addition, the vast majority of the genome sequenceis also known for the fission yeast S. pombe, and severalmulticellular eukaryotes including the roundworm C. elegans, the fruit fly D. melanogastel,mice, and humans. Detailed analysis of these sequencingdata has revealedinsights into genome organtzation and genefunction. It has allowed researchersto identify previously unknown genesand to estimatethe total number of protein-coding genesencoded in each genome. Comparisons betweengenesequencesoften provide insight into possible functions of newly identified genes. Comparisons of genomesequenceand organizationbetweenspeciesalso help us understand the evolution of organisms. Surprisingly,DNA sequencingrevealedthat a large portion of the genomesof higher eukaryotes does not encode mRNAs or any other RNAs required by the organism. Remarkably, such noncoding DNA constitutes :98.5 percent

of human chromosomal DNA! The noncoding DNA in multicellular organisms contains many regions that are similar but not identical. Variations within some stretchesof this repetitious DNA between individuals are so great that every person can be distinguishedby a DNA "fingerprint" based on these sequencevariations. Moreover, some repetitious DNA sequencesare not found in the same positions in the genomesof different individuals of the same species.At one "junk time, all noncoding DNA was collectively termed 'We now DNA" and was considered to serve no purpose. understandthe evolutionary basisof all this extra DNA, and the variation in location of certain sequencesbetween

OUTLINE 6.1

EukaryoticGene Structure

217

6.2

C h r o m o s o m aOl r g a n i z a t i o no f G e n e s a n d N o n c o d i n gD N A

223

5.3

(Mobile) DNA Elements Transposable

226

6.4

O r g a n e l l eD N A s

236

5.5

G e n o m i c sG: e n o m e - w i d eA n a l y s i so f G e n e Structureand ExPression

6.6

StructuralOrganizationof Eukaryotic Chromosomes

6.7

M o r p h o l o g ya n d F u n c t i o n aEl l e m e n t s of EukaryoticChromosomes

215

individuals. Cellular genomesharbor symbiotic transposable (mobile) DNA elements,sequencesthat can copy themselves and move throughout the genome.Although transposable DNA elementsseemro have little funcrion in the life cycleof an individual organism, over evolutionary time they have shapedour genomesand contributedto the rapid evolution of multicellularorganisms. In higher eukaryores,DNA regions encoding proteins or functional RNAs-that is, genes-lie amidst this expanseof apparently nonfunctional DNA. In addition ro the nonfunctional DNA between genes,noncoding introns are common within genesof multicellularplants and animals.Sequencing of the same protein-coding gene in a variety of eukaryotic specieshas shown that evolutionary pressureselectsfor maintenanceof relativelysimilar sequences in the coding reglons,or exons.In contrast,wide sequence variation,evenincludingtotal loss,occursamon€lintrons,suggesting that most intron sequenceshave little functional significance.However, as we shall see,although most of the DNA sequenceof introns is not functional,the existenceof introns has favored the evolution of multidomain proteins that are common ln highereukaryotes.It also allowed the rapid evolutionof proteinswith new combinationsof functionaldomains. Mitochondria and chloroplastsalso contain DNA that encodesproteins essentialto the function of thesevital organelles.!7e shall see that mitochondrial and chloroplast DNAs are evolutionaryremnantsof the origins of theseorganelles.Comparisonof DNA sequences betweendifferent classes of bacteria and mitochondrial and chloroolast genomeshas revealedthat theseorganellesevolvedfrom in-

tracellular bacteria that developed symbiotic relationships with ancient eukaryotic cells. The sheerlength of cellular DNA is a significant problem with which cells must contend. The DNA in a single human cell, which measuresabout 2 meters in total length, must be contained within cells with diametersof less than 10 pm, a compactionratio of greaterthan 105to 1.In relativeterms,if a cell were 1 centimeter in diameter, the length of DNA packed into its nucleuswould be about 2 kilometers! Specialized eukaryotic proteins associatedwith nuclear DNA exquisitely fold and organizethe DNA so thar it fits into nuclei. And yet at the same time, any given portion of this highly compacted DNA can be accessedreadily for transcription, DNA replication, and repair of DNA damage without the long DNA moleculesbecoming tangled or broken. Furthermore, the integrity of DNA must be maintained during the processof cell division when it is partitioned into daughter cells. In eukaryotes,the complex of DNA and the proteins that organize it, called chromatin, can be visualized as individual chromosomesduring mitosis (seechapter opening figure). As we will seein this and the following chapter,the organization of DNA into chromatin allows a mechanism for regulation of geneexpressionthat is not availablein bacteria. In the first five sections of this chapter, we provide an overview of the landscapeof eukaryotic genes and genomes. First we discussthe structure of eukaryotic genesand the complexities that arise in higher organismsfrom the processingof mRNA precursorsinto alternatively spliced mRNAs. Next we discussthe main classes of eukaryoticDNA includingthe special properties of transposableDNA elementsand how they shaped

> FIGURE6-1 Overview of the structure of genes and chromosomes.DNA of higher eukaryotes consistsof uniqueand repeated s e q u e n c eO s n l y: 1 5 p e r c e not f h u m a nD N A encodesproteinsand functionalRNAsand the regulatorysequences that controltheir expression; the remainderis merelyintrons within genesand intergenicDNA between g e n e s M u c ho f t h e i n t e r g e n iD c N A ,- 4 5 percentin humans,is derivedf rom transposable (mobile)DNA elements,geneticsymbiontsthat havecontributedto the evolutionof contemporary genomes Eachchromosome consrsts of a single,long moleculeof DNA up t o : 2 8 0 M b i n h u m a n so, r g a n i z e d into increasing levelsof condensation by the histone a n d n o n h i s t o n pe r o t e i n sw i t h w h i c h i t i s intricately complexedMuch smallerDNA m o l e c u l easr e l o c a l i z eidn m i t o c h o n d r iaan d chloroplasts

" B e a d so n a s t r i n g "

Nucleosome

Major Types of DNA Sequence S i n g l e - c o pg yenes S i m p l e - s e q u e n cDeN A G e n ef a m i l i e s T r a n s p o s a b lD e N Ae l e m e n t s T a n d e m l yr e p e a t e dg e n e s S p a c e rD N A Introns

216

C H A P T E6R |

GENES G,E N O M t CASN, D C H R O M O S O M E S

contemporarygenomes.We then considerorganelleDNA and how it differs from nuclear DNA. This background preparesus to discussgenomics,computer-basedmethods for analyzingand interpreting vast amounts of sequencedata. The final two sections of the chapter addresshow DNA is physically organizedin eukaryoticcells.'Sfeconsiderthe packagingof DNA and histone proteins into compact complexes(nucleosomes)that are the fundamental building blocks of chromatin, the large-scalestructure of chromosomes,and the functional elementsrequired for chromosomeduplication and segregation.Figure 6-1 provides an overview of theseinterrelatedsubjects.The understandingof genes,genomics,and chromosomesgained in this chapter will prepareus to explore current knowledge about how the synthesis and concentration of each protein and functional RNA in a cell is regulatedin the following two chapters.

lil

Eukaryotic GeneStructure

In molecular terms, a genecommonly is defined as tbe entire nucleic acid seqwencethat is necessaryfor the synthesisof a fwnctionalgeneproduct (polypeptideor RNA). According to this definition, a geneincludesmore than the nucleotidesencoding an amino acid sequenceor a functional RNA, referred to as the coding region. A genealso includesall the DNA sequencesrequired for synthesisof a particular RNA transcript, no matter where those sequences are locatedin relation to the coding region.For example,in eukaryoticgenes,transcriptioncontrol regions known as enhancerscan lie 50 kb or more from the coding region.As we learnedin Chapter4, other critical noncoding regions in eukaryotic genesinclude the promoter, as well as sequencesthat specify 3' cleavage and polyadenylation,known as poly(A) sites, and splicing of primary RNA transcripts,known as splicesiles(seeFigure4-15). Mutations in thesesequences, which control transcriptioninitiation and RNA processing,affect the normal expressionand function of RNAs, producing distinct phenotypesin mutant organisms.We examine these various control elementsof genesin greaterdetail in Chapters7 and 8. Although most genes are transcribed into mRNAs, which encode proteins, some DNA sequencesare transcribedinto RNAs that do not encodeproteins (e.g.,tRNAs and rRNAs described in Chapter 4 and micro RNAs that regulatemRNA stability and translationdiscussedin Chapter 8). Becausethe DNA that encodestRNAs, rRNAs and micro RNAs can cause specific phenotypeswhen mutated, theseDNA regions generallyare referred to as tRNA, rRNA and micro RNA genes, even though the final products of thesegenesare RNA moleculesand not proteins. In this section,we will examine the structure of genesin bacteria and eukaryotesand discusshow their respective gene structuresinfluence geneexpressionand evolution.

M o s t E u k a r y o t i cG e n e sC o n t a i nI n t r o n s a n d P r o d u c em R N A sE n c o d i n gS i n g l eP r o t e i n s As discussedin Chapter4, many bacterialmRNAs (e.g.,the mRNA encodedby the trp operon) include the coding region

for several proteins that function together in a biological process.SuchmRNAs are said to be polycistronic. (A cistron is a genetic unit encoding a single polypeptide.) In contrast' most eukaryotic mRNAs are monocistronic; that is, each mRNA molecule encodes a single protein. This difference betweenpolycistronic and monocistronic mRNAs correlates with a fundamental differencein their translatton. Within a bacterial polycistronic mRNA a ribosome-binding site is locatednear the start site for eachof the protein-coding regions,or cistrons,in the mRNA. Translation initiation can beginat any of thesemultiple internal sites,producing multiple proteins (seeFigure 4-13a).In most eukaryoticmRNAs' however,the 5'-cap structuredirectsribosome binding, and translation beginsat the closestAUG start codon (seeFigure4-13b). As a result, translation beginsonly at this site. In many cases, the primary transcriptsof eukaryoticprotein-codinggenesare processedinto a singletype of mRNA, which is translatedto give a singletype of polypeptide(seeFigure4-15). Unlike bacterialand yeastgenes,which generallylack introns, most genesin multicellular animals and plants contain introns, which are removedduring RNA processingin the nucleus beforethe fully processedmRNA is exported to the cytosol for translation. In many cases,the introns in a geneare considerablylonger than the exons. Although many introns are :90 bp long, the median intron length in human genesis 3.3 kb. Some,however,are much longer: the longestknown human intron is 17,1.06bp, and lies within titan, a gene encoding a structural protein in muscle cells. In comparison, most human exonscontain only 50-200 basepairs. The typiprotein is :50,000 cal human geneencodingan average-size bp long, but more than 95 percentof that sequenceis present in introns and flanking noncoding 5' and 3' regions. Many large proteins in higher organisms that have repeated domains are encoded by genesconsisting of repeats of similar exons separatedby introns of variable length. An example of this is fibronectin, a component of the extracellular matrix. The fibronectin gene contains multiple copies of five types of exons (seeFigure 4-16). Suchgenesevolved by tandem duplication of the DNA encoding the repeated exon, probably by unequal crossingover during meiosisas shown in Figure6-2a.

n nits S i m p l ea n d C o m p l e xT r a n s c r i p t i o U A r e F o u n di n E u k a r y o t i cG e n o m e s The cluster of genesthat form a bacterial operon comprises a single transcription unit that is transcribed from a specific promoter in the DNA sequenceto a termination site. producing a singleprimary transcript. In other words, genesand transcription units often are distinguishablein prokaryotes since a single transcription unit contains severalgeneswhen they are part of an operon. In contrast' most eukaryotic genes are expressedfrom separatetranscription units' and each mRNA is translated into a single protein. Eukaryotic transcription units, however, are classified into two types, dependingon the fate of the primary transcript. The primary transcript produced from a simple transcription unit is processedto yield a singletype of mRNA' encoding E U K A R Y O T IG C E N Es T R U C T U R E .

217

(a) Exon duplication L1

E x o n1

Parental chromosomes

===

E x o n2

Exon 3

L1

Exon 2

Exon 1

Exon 3

===

I

I R e c o m b i n a t i o(nu n e q u acl r o s s i n go v e r )

+ L1 Recombinant cnromosomes

Exon 1

Exon 2

Exon 3

Exon 3

Exon 1

Exon 2

(b) Gene duplication B - g l o b i ng e n e

Parentat I chromosomes I I * Recombinant cnromosomes

R e c o m b i n a t i o(nu n e q u acl r o s s i n g B - s l o b i ng e n e

t

A FIGURE 5-2 Exonand geneduplication.(a)Exonduplication results fromunequal crossing overduringmeiosrs Eachparental chromosome contains oneancestral genecontaining threeexons ( n u m b e r e1d- 3 )a n dt w o i n t r o n sH o m o l o g o n uo s n c o d i nLg1 r e p e a t esde q u e n c lei es5 ' a n d3 ' o f t h eg e n ea, n da l s oi n t h ei n t r o n between exons2 and3 As discussed in Section 6 3, L1sequences havebeenrepeatedly transposed to newsitesin thegenomeoverrne course of humanevolution, sothatallchromosomes arepeppered withthem Theparental chromosomes areshowndisplaced relative to eachother,sothatthe L1sequences arealignedHomologous recombination betweenL1sequences asshownwouldgenerate one recombinant chromosome in whichthegenehasfourexons(two

copies of exon3) andonechromosome in whichthe geneis missing exon3 (b)Unequal crossing overbetweenL'1sequences alsocan generate duplications of entiregenesInthisexample, eachparental chromosome gene,andoneof the contains oneancestral B-globin recombinant chromosomes contains two duplicated genes B-globin S u b s e q u ei n d t e p e n d em nu t t a t i o ni ns t h ed u p l i c a t egde n e cs o u l d l e a dt o s l i g hct h a n g ei sn s e q u e n ct hea tm i g h tr e s u litn s l i g h t l y properties different functional proteinsUnequal of theencoded crossing overalsocanresultfromrarerecombinations between unrelated sequences Notethatthe scalein part(b)is muchlarger (b)seeD H A Fitch thanin part(a) [Part eral, 1991,ProcNat'|. AcadSci. USA88:7396 I

a singleprotein.Mutations in exons,introns,and transcriptioncontrol regions all may influence expressionof the protein encodedby a simpletranscriptionunit (Figure6-3a). In the caseof complex rranscription units, which are quite common in multicellular organisms,the primary RNA transcript can be processedin more than one way, leading to formation of mRNAs containing different exons. Each alternate mRNA, however, is monocistronic, being translated into a single polypeptide, with translation usually initiating ar the first AUG in the mRNA. Multiple mRNAs can arise from a primary transcriptin threeways, as shown in Figure6-3b. Examplesof all three types of alternariveRNA processing occur in the genesthat regulate sexual differentiation in Drosophila (see Figure 8-16). Commonly, one mRNA is produced from a complex transcription unit in some cell types, and a different mRNA is made in other cell types. For example, alternative splicing of the primary fibronectin tran-

script in fibroblasts and hepatocytesdetermineswhether or not the secretedprotein includes domains that adhereto cell surfaces(seeFigure 4-16). The phenomenonof alternative splicing greatly expands the number of proteins encoded in the genomesof higher organisms. It is estimated that -60 percent of human genesare contained within complex transcription units that give rise to alternatively spliced mRNAs encoding proteins with distinct functions, as for the fibroblast and hepatocyteforms of fibronectin. The relationshipbetweena mutation and a gene is not always straightforward when it comes to complex transcription units. A mutation in the control region or in an exon shared by alternatively spliced mRNAs will affect all the alternative proteins encoded by a given complex transcription unit. On the other hand, mutations in an exon present in only one of the alternative mRNAs will affect only the protein encodedby that mRNA. As explained in

218

.

cHAprER 6

|

G E N E sG, E N o M t c sA,N Dc H R o M o s o M E s

Transcription Units ffi ,od."rt: Eukaryotic > FIGURE 6-3 Simpleand complexeukaryotictrans€ription Simple transcription unit units.(a)A simple transcription unitincludes a regionthatencodes , 50kb , oneprotein, extending fromthe 5' capsiteto the 3' poly(A) site, l-l CaPsite andassociated controlregionsIntrons liebetween exons(light bluerectangles) andareremoved duringprocessing of the primary (dashed transcripts redlines); thustheydo notoccurin thefunctional Gene m o n o c i s t r o nmi cR N AM u t a t i o ni sn a t r a n s c r i p t i o n - c o nr et rgoilo n (a b) mayreduce or prevent transcription, thusreducing or eliminatrng Control regions protein. synthesis of theencoded A mutation withinan exon(c)may proteinwith diminished 5' resultin an abnormal activityA mutation nRNA withinan intron(d) thatintroduces a newsplicesiteresults in an protein(b) abnormally spliced mRNAencoding a nonfunctional primary transcription unitsproduce thatcanbe (b) Complex transcription units Complex transcripts processed in alternative ways.(Iop)lf a primary transcript contains Cap site alternative splicesites,it canbe processed intomRNAs with thesame 5' and 3' exonsbut differentinternalexons(Middle)lf a primary transcript hastwo poly(A) sites,it canbe processed intomRNAs with Gene (f or g) are promoters alternative 3' exons(Botton)lf alternative Exon1 produced in a celltypein which activein different celltypes,mRNA1, f isactivated, hasa different firstexon(1A)thanmRNA2 has,which mRNAT S'f----a (andwhereexon1B isproduced in a celltypein whichg isactivated or (aandb) andthosedesignated isused)Mutations in controlregions nRNA2 5' c withinexonssharedbythealternative mRNAs affectthe proteins processed encoded by bothalternatively mRNAsIn contrast, (designated mutations d ande)withinexonsuniqueto oneof the Cap site processed from alternatively mRNAs affectonlythe proteintranslated promoters thatmRNAForgenesthataretranscribed fromdifferent in differentcelltypes(bottom),mutations in differentcontrolregions (f andg) affectexpression onlyin thecelltypein whichthatcontrol Gene Exon1 regionisactive mRNAT

S'f

Poly(A)site

Exon2

f_l-

Exon3

Exon4

-___---l3, T_

Poly(A)

E x o n3

J

or Chapter 5, genetic complementationtests commonly are nRNA2 5'[---f .T used to determine if two mutations are in the same or different genes(seeFigure5-7). However,in the complex transcription unit shown in Figure 6-3b (middle), mutations d Cap site Cap site poty(A) and e would complement each other in a genetic complementation test, even though they occur in the same gene. This is becausea chromosomewith mutation d can express Gene E x o n3 Exon2 ExonlB E x o n1 A a normal protein encoded by mRNA2 and a chromosome with mutation e can express a normal protein encoded by nRNAI 5' mRNA1. Both mRNAs produced from this gene would be presentin a diploid cell carrying both mutations,generating or both protein products and hence a wild-type phenotype. mRNA2 However, a chromosome with mutation c in an exon common to both mRNAs would not complement either mutation d or e. In other words, mutation c would be in the same complementation groups as mutations d and e, even though P r o t e i n - C o d i nG g e n e sM a y B e S o l i t a r yo r B e l o n g d and e themselveswould not be in the same complementaF a m i ly to a Gene tion group! Given these complications with the genetic defThe nucleotidesequenceswithin chromosomal DNA can be inition of a gene, the genomic definition outlined at the of classified on the basis of structure and function' as shown in beginning of this section is commonly used. In the case 'We will examinethe propertiesof eachclass'beginThble 6-1. genes, gene DNA tranprotein-coding a is the sequence genes,which comprise two groups. protein-coding with ning pre-mRNA precursor, equivalent to a transcribed into a roughly 25-50 percent of the organisms, In multicellular plus required unit, any other regulatory elements scription protein-codinggenesare representedonly once in the haploid for synthesisof the primary transcript.The various proteins encoded by the alternatively spliced mRNAs expressed genome and thus are termed solitary genes.A well-studied example of a solitary protein-coding gene is the chicken from one gene are called isoforms. G E N ES T R U C T U R E . EUKARYOTIC

219

CLASS

ITNGTH

(0/o) C0PY NUMBEB lNHUMAN GEN0ME FRACTI0N 0FHUMAN GEN()ME

Protein-coding genes

0.5-2200kb

-25,000

:55" (1.8)1

Tandemlyrepeatedgenes U2 snRNA rRNAs

5 . 1k b + 43 kb+

:20 :300

FIGURE6-18 Exon shuffling via recombination between homologous interspersedrepeats. Recombination repeatsin the intronsof betweeninterspersed separategenesproducestranscriptionunits with a new combinationof exons(greenand blue) ln the exampleshown here,a double crossoverbetween two setsof A/u elements, ( t h em o s ta b u n d a n S t I N E isn h u m a n s r) e s u l t s in an exchangeof exonsbetweenthe two

called enhancersthat can operate over distancesof tens of thousandsof basepairs. Transcription of many genesis controlled through the combined effectsof severalenhancerelements.Insertionof mobile elementsnear such transcriptioncontrol regionsprobably contributed to the evolution of new combinatr,onsof enhancersequences.These in turn control which specificgenesare expressedin particular cell types and the amount oi the encoded protein produced in modern organisms,as we discussin the next chapter' Theseconsiderationssuggestthat the early view of mobile DNA elements as completely selfish molecular parasites missesthe mark. Rather,they have contributed profoundly to the evolution of higher organismsby promoting (1) the generation of genefamilies via geneduplication, (2) the creation of new genesvia shuffling of preexistingexons' and (3) formation of -o.. complex regulatory regionsthat provide multifaceted control of gene expression.Today, researchersare attempting to harnesstranspositionmechanismsfor inserting therapeuticgenesinto patients as a form of genetherapy'

Transposable(Mobile) DNA Elements r Transposable DNA elements are moderately repeated sequencestnterspersedat multiple sites throughout the g.r,o-., of highir eukaryotes. They are present less frequently in prokarYotic genomes. r DNA transposonsmove to new sites directly as DNA; first transcribed into an RNA copy of retrotransporo.t. ".. then is reverse-transcribedinto DNA which the element, ( s e eF i g u r e6 - 8 ) ' r A common feature of all mobile elementsis the presence of short direct repeatsflanking the sequence' r Enzymesencodedby transposonsthemselvescatalyzeinsertion of thesesequencesat new sitesin genomic DNA' r Although DNA transposons'similar in structure to bacterial IS elements,occur in eukaryotes(e'g', the Drosophila P element), retrotransposonsgenerally are much more abundant, especiallyin vertebrates. r LTR retrotransposonsare flanked by long terminal repeats (LTRs), similar to those in retroviral DNA; like retroviruses,they encode reversetranscriptaseand integrase. They move in the genome by being transcribed into RNA, which then undergoesreversetranscription in

G e n e1 l l ] G e n e2 I I I

I Doublecrossover betweenA/uelements { +

9enes ) NA ELEMENTS T R A N S P O S A B (LM EO B I L E D

235

(a)

G e n e1 l l l

I

Trun.ooru."excisionfrom gene

tIsarfllo I S te

G e n e2 = : =

::: I I Trencnn,

y

s a s ei n s e r t i o ni n t o g e n e2

W e a kp o l y ( A ) srgnat

(b)

G e n e ' sp o l y ( A ) srgnat

G e n e1 l l ] 3'exon T r a n s c r i p t i oann d p o l y a d e n y l a t i o n at end of downstreamexon %AAAA l l t s c n t o r ts t e

G e n e2 : : :

::: I I ORF2reversetranscription and insertion I

:: =

:::

the cytosol, nuclear import of the resulting DNA with LTRs, and integration into a host-cell chromosome (see F i g u r e6 - 1 4 ) .

@

sequencesexhibit extensivehomology with small RNAs and are rranscribedby the sameRNA poly_ A/z elements,the most common SINEsin humans, 0-bp sequences found scatteredthroughout the hu_ man genome. r Some interspersedrepeats are derived from cellular RNAs that were reverse-transcribedand inserted rnto genomic DNA at some time in evolutionarv history. Processed pseudogenes derivedfrom mRNAs lack tntrons, a featurethat distinguishesthem from pseudogenes, which aroseby sequencedrift of duplicatedgenes. bile DNA elementsmost likely influencedevolution cantly by servingas recombinationsitesand by mo_ g adjacentDNA sequences.

CHAPTER 6

|

OrganelleDNAs

Although the vast majority of DNA in most eukaryotesis found in the nucleus,some DNA is presentwithin the mitochondria of animals, planrs, and fungi and within the chloroplastsof plants. Theseorganellesare the main cellular sitesfor ATP formation, during oxidative phosphorylation in mitochondria and photosynthesisin chloroplasts (Chapter 12). Many lines of evidenceindicate that mitochondria and chloroplastsevolvedfrom bacteriathat were endocytosedinto ancestral cells containing a eukaryotic nucleus,forming endosymbionts(Figure 6-20). Over evo_ lutionary time, most of the bacterialgeneswere lost from

( s e eF i g u r e6 - 1 7 ) .

236

< FIGURE 5-19 Exonshufflingvia transpositionof a DNAtransposonor LINE retrotransposon. (a)Transposition of an exon(blue)flankedby homologous DNA transposons intoan intronof a second gene As we sawin Figure 6-10,step[, transposase canrecognize andcleave the DNAat the ends of thetransposon inverted repeatsln gene1, if thetransposase cleaves at the leftendof the transposon on the leftandat the rightendof thetransposon on the right,it cantranspose a l lt h ei n t e r v e n i n DgN A i,n c l u d i nt g h ee x o n fromgene1,to a newsitein an intronof gene2 Thenetresultisan insertion of the exonfromgene1 intogene2 (b)lntegration of an exonintoanothergeneviatransposition of a LINE c o n t a i n i nagw e a kp o l y ( As)i g n a l .f s u c ha L I N E i s i n t h e3 ' - m o sitn t r o no f g e n e 1 , t r a n s c r i p t i o fnt h eL I N Ei n t oa n R N A i n t e r m e d i am t ea yc o n t i n ubee y o n di t so w n poly(A) siteandextendintothe 3, exon, t r a n s c r i b i tnhgec l e a v a gaen dp o l y a d e n y l a t i o n s i t eo f g e n e1 i t s e l fT h i sR N Ac a nt h e nb e reverse-transcribed andintegrated by the L I N EO R F 2 p r o t e i n( s e eF i g u r 6 e- ' 7 l ) i n t oa n i n t r o no n g e n e2 , i n t r o d u c i naqn e w3 , e x o n ( f r o mg e n e1 )i n t og e n e2

nucleus. However, mitochondria and chloroplasts in to_ day's eukaryotesretain DNAs encoding some prorernsessentialfor organellarfunction, as well as the ribosomal and transfer RNAs required for synthesis of these proteins. Thus eukaryotic cells have multiple geneticsysrems:a predominant nuclear systemand secondarysystemswith their own DNA, ribosomes, and tRNAs in mitochondria and chloroplasts.

G E N E SG , E N O M t C SA, N D C H R O M O S O M E S

Endocytosisof bacterium caoableof oxidative phosphorylation

,

Endocytosisof bacterium capableof photosYnthesis

Ancestral cell

ATPsynthase t,

Bacterial genome

BacteriaI genome

./

\/ E u k a r y o t i cp l a s m am e m b r a n e

Mitochondrial Mitochondrial genome matrix

Stroma

origin of 6-20 Modelfor endosymbiotic FIGURE by an of a bacterium Endocytosis mitochondriaand chloroplasts. with two an organelle cellwouldgenerate eukaryotic ancestral fromthe eukaryotic derived theoutermembrane membranes, plasma (gray) plasma andthe inneronefromthe bacterial membrane (red)Proteins bacterial localized to the ancestral membrane

suchthatthe portionof the retaintheirorientation, membrane spacenowfacesthe proteinoncefacingthe extracellular fromthe innerchloroplast of vesicles Budding space. intermembrane in of chloroplasts suchasoccursduringdevelopment membrane, of membranes thylakoid generate the plants, would contemporary indicated are DNAs organellar The chloroplasts

M i t o c h o n d r i aC o n t a i nM u l t i p l e m t D N AM o l e c u l e s

colonies. Genetic crossesbetween different (haploid) yeast strains showed that the petite mutation does not segregate with any known nuclear geneor chromosome' In later studies, most petite mutants were found to contain deletions of MtDNA.

Individual mitochondria arclarge enough to be seenunder the light microscope, and even the mitochondrial DNA (mtDNA) can be detectedby fluorescencemicroscopy.The mtDNA is located in the interior of the mitochondrion, the region known as the matrix (seeFigure 12-6). As judged by the number of yellow fluorescent "dots" of mtDNA' a Euglena gracilis cell contains at least 30 mtDNA molecules ( F i g u r e6 - 2 1 ) . Replication of mtDNA and division of the mitochondrial network can be followed in living cells using time-lapsemicroscopy.Such studiesshow that in most organismsmtDNA replicates throughout interphase. At mitosis each daughter cell receivesapproximately the same number of mitochondria, but since there is no mechanism for apportioning exactly equal numbers of mitochondria to the daughter cells, some cells contain more mtDNA than others. By isolating mitochondria from cells and analyztngthe DNA extracted from them, it can be seenthat each mitochondrion contains multiple mtDNA molecules. Thus the total amount of mtDNA in a cell dependson the number of mitochondria, the size of the mtDNA, and the number of mtDNA molecules per mitochondrion. Each of these parametersvaries greatly between different cell types.

m t D N A l s l n h e r i t e dC y t o p l a s m i c a l l y Studies of mutants in yeasts and other single-celledorganisms first indicated that mitochondria exhibit cytoplasmic inheritance and thus must contain their own genetic system (Figure 6-22). For instance,petite yeast mutants exhibit structurally abnormal mitochondria and are incapable of oxidative phosphorylation. As a result, petite cells grow more slowly than wild-type yeasts and form smaller

,

10tr-

t

6-21 Dualstainingrevealsthe FIGURE A EXPERIMENTAL muftipfemitochondrialDNAmoleculesin a growing Euglena of two dyes:ethidium graciliscell.Cellsweretreatedwith a mixture and red fluorescence, a emits and whichbindsto DNA bromide, emits and mitochondria into specifically is incorporated which D|OC6, and emitsa redfluorescence, Thusthe nucleus a greenfluorescence. of yellow-a combination DNAfluoresce areasrichin mitochondrial and Y Hayashi fluorescence [From redDNAandgreenmitochondrial J CellSci93:565 l K Ueda,1989, o R G A N E L L ED N A s

t

237

(a)

Haploidparentswith wild-type nucleargenes

Normal mitochondrion

< FIGURE 6-22 Cytoplasmic inheritanceof the pefite mutation in yeast.Petite-strain mitochondria aredefective in oxidative phosphorylation owingto a deletion in mtDNA(a)Haploid cellsfuse to produce a diploidcellthatundergoes meiosis, duringwhichrandom segregation of parental chromosomes andmitochondria containing mtDNAoccursNotethatalleles for genesin nuclear DNA(represented by largeandsmallnuclear chromosomes colored redandblue) segregate (seeFigure 2:2duringmeiosis 5-5) Incontrast, sinceyeast -50 mtDNAmolecules normally contain percell,allproducts of meiosis usually containbothnormalandpetitemtDNAs andarecapable of (b)Asthesehaploidcellsgrowanddividemitotically, respiration the (including cytoplasm themitochondria) israndomly distributed to the daughter cellsOccasionally, a cellisgenerated thatcontains only petitemtDNAandyieldsa petitecolony. defective Thusformation of suchpetitecellsisindependent of anynuclear geneticmarker.

"Petite" mitochondrion

Diploid zygore

In the mating by fusion of haploid yeastcells,both parents contribute equally to the cytoplasm of the resulting diploid; thus inheritance of mitochondria is biparental. In mammals and most other multicellular organisms,however,the sperm contributeslittle (if any) cytoplasmto the zygote,and virtually all the mitochondria in the embryo are derived from those in the egg, not the sperm. Studiesin mice have shown that 99.99 percentof mtDNA is maternally inherited, but a small part (0.01 percent)is inheritedfrom the male parent. In higher plants, mtDNA is inherited exclusivelyin a uniparental fashion through the femaleparent (egg),not the male (pollen).

M e i o s i s :r a n d o md i s t r i b u t i o n of mitochondriato d a u g h t e rc e l l s

The Size,Structure,and CodingCapacity of mtDNA Vary ConsiderablyBetweenOrganisms

(b)

\ \Mitosis

\

Respiratory-proficient

238

.

C H A P T E6R I

Petite

Respiratoryproficient

Surprisingly,the size of the mtDNA, the number and nature of the proteins it encodes,and eventhe mitochondrial genetic code itself vary gre^iy between different organisms. The mtDNAs of most multicellular animals are :16-kb circular moleculesthat encodeintron-lessgenescompactly arranged on both DNA strands. VertebratemtDNAs encode the two rRNAs found in mitochondrial ribosomes, the 22 tRNAs used to translatemitochondrial mRNAs, and 13 proteins involved in electron transport and AIP synthesis(Chapter 12). The smallestmitochondrial genomesknown arein plasmodium, single-celledobligate intracellular parasitesrhat cause malaria in humans. Plasmodium mtDNAs are only :6 kb, encoding five proteins and the mitochondrial rRNAs. The entire mitochondrial genomesfrom a number of different metazoan organisms (i.e., multicellular animals) have now been cloned and sequenced,and mtDNAs from all these sourcesencode essentialmitochondrial proteins (Figure 6-23). All proteins encodedby mtDNA are synthesized on mitochondrial ribosomes. Most mitochondriasynthesizedpolypeptidesidentified thus far are subunits of multimeric complexesused in electrontransport. ATp svnt h e s i s ,o r i n s e r r i o no f p r o r e i n si n t o t h e i n n e r m i t o c h o n d i i a l membrane or intermembranespace.However, most of the proteins localizedin mitochondria, such as those involved in the processeslisted at the top of Figure 6-23, are encoded by nuclear genes, synthesizedon cytosolic ribosomes, and imported into the organelle by processesdisc u s s e di n C h a p t e r1 3 .

G E N E SG , E N O M I C SA, N D C H R O M O S O M E S

L i p i dm e t a b o l i s m N u c l e o t i d em e t a b o l i s m A m i n o a c i dm e t a b o l i s m

C a r b o h y d r a tm e etabolism H e m es y n t h e s i s Fe-Ssynthesis

U b i q u i n o n es y n t h e s i s Co-factorsynthesis

Chaperones S i g n a l i n gp a t h w a y s

Proteases

DNA repair,replication,etc.

Heme ryase RNA polymerase

TIM

c Cvtochrome 6-23 Proteinsencodedin mitochondrialDNA A FIGURE Onlythe and their involvementin mitochondrialprocesses. a r e d e p i c t e dM o s tm i t o i n n e r m e m b r a n e m i t o c h o n d rm i aal t r i xa n d (blue); mitochondrial areencoded bythenucleus components chondrial components processes nucleus-encoded carriedout by exclusively a r el i s t e da t t h et o p M i t o c h o n d r ci aolm p o n e nst sh o w ni n p i n ka r e genomein but bythe nuclear by mtDNAin someeukaryotes encoded in encoded invariably few components The relatively othereukaryotes. in electron l-V areinvolved mtDNAareshownin orangeComplexes phosphorylation TlM,Sec,Tat,andOxal andoxidative transport

in proteinimportandexport,andinsertion areinvolved translocases e i sa o f p r o t e i nisn t ot h e i n n e rm e m b r a n(eC h a p t e1r3 ) R N a sP 8) lt should the 5'-endof tRNAs(Chapter that processes ribozyme havea multi-subunit be notedthat the majorityof eukaryotes encoded invariantly subunits three with here, I as depicted complex (e g , Saccharomyces' in a few organisms by mtDNA However, thiscomplexis replacedby andPlasmodium), Schizosaccharomyces, Formoredetailson enzyme. single-polypeptide a nucleus-encoded, C h a p t e r1s2 a n d1 3 s e e t r a n s p o r t , a n d m e t a b o l i s m mitochondrial 19:709 Genet Trends ] 2003, al et G Burger from , lAdapted

In contrast to metazoan mtDNAs, plant mtDNAs are many times larger,and most of the DNA doesnot encodeprotein. For instance,the mtDNA in the important model plant Arabidopsis thaliana is 366,924 base pairs, and the largest known mtDNA is =2 Mb, found in cucurbit plants (e.g., melon and cucumber).Most plant mtDNA consistsof long inmobile DNA elementsrestrictedto the mitrons, pseudogenes, and piecesof foreign (chloroplast, compartment, tochondrial nuclearand viral) DNA that were probably insertedinto plant mitochondrial genomesduring their evolution' Duplicated sequencesalso contributeto the greaterlength of plant mtDNAs. Differences in the number of genes encoded by the mtDNA from various organisms most likely reflect the movement of DNA between mitochondria and the nucleus during evolution. Direct evidencefor this movement comes from the observation that several proteins encoded by mtDNA in some speciesare encoded by nuclear DNA in other, closely related species.The most striking example of this phenomenon involves the cor 11 gene, which encodes subunit 2 of cytochrome c oxidase, which constitutes complex IV in the mitochondrial electron transport chain (see Figure 12-1.6).This gene is found in mtDNA in all multicellular plants studied except for certain related speciesof legumes,including the mung bean and soybeans,in which the cox 11geneis nuclear.The cox 1I geneis completely missing from mung beanmtDNA, but a defectivecox 1/ pseudo-

gene that has accumulatedmany mutations can still be recognized in soybeanmtDNA. Many RNA transcripts of plant mitochondrial genesare edited, mainly by the enzyme-catalyzedconversion of selected C residuesto U, and occasionallyU to C' (RNA editing is discussedin Chapter 8.) The nuclear cox lI gene of mrng bean corresponds more closely to the edited cox II RNA transcripts than to the mitochondrial cox 11 genes found in other legumes. These observations are strong evidencethat the cox ll genemoved from the mitochondrion to the nucleusduring mung bean evolution by a processthat involved an RNA intermediate. Presumablythis movement involved a reverse-transcriptionmechanism similar to that by which processedpseudogenesare generatedin the nuclear genome from nucleus-encodedmRNAs. In addition to the large differences in the sizes of mtDNAs in different eukaryotes' the structure of the mtDNA also varies greatly.As mentioned above, mtDNA in most animals is a circular molecule -16 kb' However' the mtDNA of many organismssuch as the protist Tetrahymena exists as linear head-to-tail concatomersof repeating sequence. In the most extreme examples, the mtDNA of the Amoebidium parasiticum is composed of several protist 'h,rndred distinct short linear molecules'And the mtDNA of Trypanosoma is comprised of multiple maxicircles concate,r"t.d (ittt.tlocked) to thousands of minicircles encoding o R G A N E L L ED N A s

o

239

guide RNAs involved in editing the sequenceof the mitochondrial mRNAs encodedin the maxicircles.

P r o d u c t so f M i t o c h o n d r i aG l enes Are Not Exported As far as is known, all RNA transcripts of mtDNA and their translationproducts remain in the mitochondrion in which they are produced, and all mtDNA-encoded proteins are synthesizedon mitochondrial ribosomes. Mitochondrial DNA encodesthe rRNAs that form mitochondrial ribosomes, although most of the ribosomal proteins are imported from the cytosol.In animalsand fungi, all the tRNAs used for protein synthesisin mitochondria also are encoded by mtDNAs. However,in plantsand many prorozoans,most mitochondrialtRNAs are encodedby the nuclearDNA and imported into the mitochondrion. Reflectingthe bacterialancestryof mitochondria, mitochondrial ribosomesresemblebacterial ribosomesand differ from eukaryotic cytosolic ribosomesin their RNA and protein compositions,their size,and their sensitivityto certain antibiotics (seeFigure 4-22). For insrance,chloramphenicol blocks protein synthesisby bacterialand mitochondrial ribosomesfrom most organisms,but cycloheximidedoesnot. This sensitivity of mitochondrial ribosomes ro the imoortant aminoglycosideclass of antibiotics that includ., .hlo."-phenicol is the main causeof the toxicity that theseantibiotics can cause. Conversely,cytosolic ribosomes are sensitiveto cycloheximideand resisrantto chloramohenicol.I

M i t o c h o n d r i aE v o l v e df r o m a S i n g l e E n d o s y m b i o t iE c v e n tI n v o l v i n ga -l Rickettsi a i ke Bacteriu m Analysisof the mtDNA sequences from various eukaryotes, including single-celledprotists that diverged from other eu, karyotes early in evolurion, provides rtrong support for the idea that the mitochondrion had a singleorigin. Mitochondria most likely arosefrom a bacterialsymbiontwhoseclosest contemporary relatives are in the Rickettsiacedegroup. Bacteria in this group are obligate intracellular parasitei. Thus, the ancestor of the mitochondrion probably also had an intracellular life style, putting it in a good location for evolving into an intracellularuylbion,. ihe mtDNA with the largest number of encoded genesso far found is in the protist speciesReclinomonasamericana. All other mtDNAs have a subset of the R. amertcana genes)strongly implying that they evolved from a common ancestor with R. i*rrlcqna, losing different groups of mitochondrial genesby deletion and/or transfer to the nucleusover time. In organismswhose mtDNA includesonly a limited num_ ber of genes, rhe same set of mitochondrial genes are retained, independent of the phyla that includes these organ_ rsms (seeFigure 6-23, orangeproteins). One hypothesisfor why thesegeneswere never successfullytransferredto the nuclear genome is that their encoded polypeptides are too hydrophobic to cross the outer mitochondrial membrane. and 240

.

thereforewould not be imported back into the mitochondria if they were synthesizedin the cytosol. Similarly,the large size of rRNAs may interferewith their transport from the nucleus through the cytosol into mitochondria. Alternatively, these genesmay not have been transferred to the nucleus during evolution becauseregulation of their expressionrn response to conditions within individual mitochondria may be advantageous.If thesegeneswere locatedin the nucleus,conditions within each mitochondria could not influencethe exoression of proteins found in that particular mitochondrion.

M i t o c h o n d r i aG l e n e t i cC o d e sD i f f e r f r o m t h e S t a n d a r dN u c l e a rC o d e The geneticcode used in animal and fungal mitochondria is different from the standard code used in l[ prokaryotic and eukaryotic nuclear genes;remarkably, the code even differs in mitochondria from different species(Table 6-3). '$7hyand how these differencesarose during evolution is mysterious. UGA, for example, is normally a stop codon, but is read as tryptophan by human and fungal mitochondrial translation systems;however,in plant mitochondria, UGA is still recognized as a stop codon. AGA and AGG, the standardnuclear codons for arginine, also code for arginine in fungal and plant mtDNA, but they are stop codons in mammalian mtDNA and serinecodons in Droso,bila mtDNA. As shown in Table 6-3, plant mitochondria appear ro E utilize the standard genetic code. However, comparisons of the amino acid sequencesof plant mitochondrial proteins with the nucleotidesequences of plant mtDNAs suggestedthat CGG could code for either arginine (the ,,stand a r d " a m i n o a c i d ) o r t r y p r o p h a n .T h i s a f p a r e n r n o n s p e c i ficity of the plant mitochondrial code is explained by editing of mitochondrial RNA rranscripts,which can converr cyrosine residuesto uracil residues.If a CGG sequenceis edited to UGG, the codon specifiestryptophan, the standard amino acid for UGG, whereas unedited CGG codons encode the standard arginine. Thus the translation systemin plant mitochondria doesutilize the standard qeneticcode. I

M u t a t i o n si n M i t o c h o n d r i aD l N A C a u s eS e v e r a l G e n e t i cD i s e a s e isn H u m a n s The severity of diseasecausedby a mutation in mtDNA depends on the nature of the mutation and on the proportion of mutant and wild-type mtDNAs presentin a particular cell type. Generally when mutations in mtDNA are found, cells contain mixtures of wild-type and mutant mtDNAs-a condition known as heteroplasmy.Each time a mammalian somatic or germ-line cell divides, the mutant and wild-type mtDNAs segregaterandomly into the daughter cells, as occurs in yeast cells (seeFigure 6-2Zb). Thus, the mtDNA genotype, which fluctuates from one generation and from one cell division to the next, can drift toward predominantlv w i l d - t y p eo r p r e d o m i n a n r l ym u r a n r m r D N A ; . S i n c ea l l e n zymes required for the replication and growth of mammalian mitochondria, such as the mitochondrial DNA and

c H A p r EbR I G E N EcsE, N o M t c A s ,N Dc H R o M o s o M E s

MITOCHOilDBIA CODON

SIANOARO C[)DE

MAMMATS

DBOSI]PHITA NEUR()SPORAYEASTS

UGA

Stop

Trn

Trn ^_r

Trp

Trp

Stop

AGA,AGG

A.g

Stop

Ser

Arg

Arg

Arg

AUA

Ile

Met

Met

Ile

Met

IIe

AUU

Ile

Met

Met

Met

Met

IIe

CUU,CUC,CUA,CUG

Leu

Leu

Leu

Leu

Thr

Leu

PTANTS

proteins. "For nuclear-encoded p' 239; ed', Springer-Verlag. S. Andersonet al., 1981,Nature 290:457;P.Borst,in InternationalCell Biology 1980-1981,H. G' Schweiger, souRCEs: Biol' Deu' Cell In Vitro 1'986, Levings, C' S. and K. Eckenrode V. 10:478483; Sci. Trends Biochem. Raj Bhandary, 1985, and U. L. C. Breitenberger S. Covelloand M. W. Gtay,1,989,Nature34l:662-666. 22:169-176;J.M. Gualberetal., 1989,Nature34'1.:660-662;andP.

RNA polymerases,are encodedin the nucleusand imported from the cytosol, a mutant mtDNA should not be at a "replication disadvantage"lmutants that involve large deletionsof mtDNA might even be at a selectiveadvantagein replication becausethey can replicate faster. Recent researchsuggeststhat the accumulation of mutations in mtDNA is an important component of aging in mammals. Mutations in mtDNA have been observedto accumulate with aging, perhaps due to a decreasein the proofreading ability of DNA polymerase.To study this hypothesis, researchersused gene "knock-in" techniquesto replace the nuclear gene encoding mitochondrial DNA polymerase with normal proofreading activity (seeFigure 4-34) with a mutant gene encoding a polymerasedefectivein proofreading. Mutations in mtDNA accumulatedmuch more rapidly in homozygous mutant mice than in wild-type mice, and the mutant mice aged at a highly acceleratedrate (Frgure6-24). With few exceptions,all human cells have mitochondria, yet mutations in mtDNA affect only some tisThose most commonly affectedare tissuesthat have a sues. high requirementfor ATP produced by oxidative phosphorylation and tissuesthat require most of or all the mtDNA in the cell to synthesizesufficient amounts of functional mitochondrial proteins. For instance, Leber's hereditary optic neuropathy (degeneration of the optic nerve) is causedby a missensemutation in the mtDNA geneencoding subunit 4 of the NADH-CoQ reductase(complex I)' a protein required for ATP production by mitochondria. Any of severallarge deletionsin mtDNA causesanother set of diseasesincluding chronic progressiueexternal ophthalmo' plegia, characterizedby eye defects, and Kearns-Sayresyndrome, characterized by eye defects, abnormal heartbeat and central nervous system degeneration.A third condition, causing "ragged" muscle fibers (with improperly assembled mitochondria) and associateduncontrolled jerky movements,is due to a single mutation in the TIICG loop

(a)

Wild-typemouse

Homozygousmutant

(b) 100 90 80 970 t60 250

E oano

;i d

zv

10 0 o

100 2oo 3oo 400 500 600 700 800 900 1000 Age (days)

6-24 Micewith a mitochondrial FIGURE a EXPERIMENTAL DNA polymerasedefectivefor proofreadingexhibit " i c ew e r ep r e p a r e d p r e m a t u r ea g i n g .A l i n eo f " k n o c k - i nm inthe mutation w i t h a b y m e t h o dds i s c u s s ei ndC h a p t e5r i nactivates p o l y m e r a t s h e a t D N A m i t o c h o n d r i a l g e n ee n c o d i n g e r' so o f r e a d i nf ugn c t i o n(.a ) W i l d - t y paen d t h e p o l y m e r a sp ) he t i c ea t 3 9 0d a y so l d( 1 3m o n t h s T h o m o z y g o umsu t a n m mutanm t o u s ed i s p l a yms a n yo f t h ef e a t u r eosf a n a g e dm o u s e versusage (>720 days,or 24 monthsof age) (b) Plotof survival muranls' homozygous and heterozygous and mice of wild-type T h eh o m o z y g o umsu t a n t cs l e a r lhy a v ea m u c hs h o r t elri f es p a n 309:481 et al, 2005,Sclence G C Kujoth thanwild-typemice [From Gregory and Wisconsin-Madison of of JeffMiller/Universrty Part(a)courtesy PhD l Kuioth DNAS ORGANELLE

241

of the mitochondrial lysine IRNA. As a result of this mutation, the translation of several mitochondrial proteins apparentlyis inhibited. I

ChloroplastsContain LargeDNAsOften E n c o d i n gM o r e T h a n a H u n d r e dp r o t e i n s Like mitochondria, chloroplasts are thought to have evolved from an ancestral endosymbiotic photosvnthetic bacterium(seeFigure6-20). However,the endosymbiotic event giving rise to chloroplasts occurred more recently (L2-1,.5 billion yearsago) than the eventleadingto the evolution of mitochondria (1.5-2.2 billion years ago). Consequentlg contemporary chloroplast DNAs show less structural diversity than do mtDNAs. Also similar to mitochondria, chloroplasts contain multiple copies of the organellar DNA and ribosomes, which synthesizesome chloroplast-encodedproteins using the standard genetic code. Like plant mtDNA, chloroplastDNA is inherited exclusively in a uniparental fashion through the female parent (egg). Other chloroplast proteins are encoded by nuclear genes,synthesizedon cytosolic ribosomes,and then incorporated into the organelle(Chapter 13). I In higher plants, chloroplast DNAs are 120-160 kb long, depending on the species.They initially were thought to be circular DNA molecules becausein genetically tractable organisms like the model plant protozoan Chlamydomonas reinhardtii, the geneticmap is circular. However, recentstudies have revealed that plant chloroplast DNAs are actually long head-to-tail linear concatomersplus recombination intermediates between these long linear molecules. In these studies,researchershave used techniquesthat minimize mechanical breakageof long DNA molecules during isolation and gel electrophoresis,permitting analysisof megabase-size DNA. The complere sequencesof several chloroplast DNAs from higher plants have been determined in the past several years. They contain 120-135 genes, 130 in the important model plant Arabidopsis thaliana. A. thaliana chloroplast DNA encodes 76 protein-coding genes and 54 geneswith RNA products such as rRNAs and tRNAs. Chloroplast DNAs encode the subunits of a bacterial-like RNA folymeraseand expressmany of their genesfrom polycistronic operons as in bacteria (seeFigure 4-l3a). Some chloroplast genescontain introns, but theseare similar to the soecialized introns found in some bacterial genesand in mirochondrial genesfrom fungi and protozoans, rather than the introns of nuclear genes. As in the evolution of mitochondrial genomes,many genesin the ancestralchloroplast endosym_ biont that were redundant with nuclear genes -g.n., have beenlost from chloroplast DNA. Also, many .rr..rtial for chloroplast function have been transferred to rhe nuclear genome of plants over evolutionary time. Recent estimates from sequenceanalysisof the A. thaliana and cyanobacterial genomesindicate that -4,500 geneshave been transferred from the original endosymbiont to the nuclear genome. 242

CHAPTER 5

|

G E N E sG , E N O M t C SA, N D C H R O M O S O M E S

Methods similar to those used for the transformation of yeast cells (Chapter 5) have been developedfor stably introducing foreign DNA into the chloroplasts of higher plants. The large number of chloroplast DNA moleculesper cell permits the introduction of thousandsof copiesof an engineeredgeneinto eachcell, resulting in extraordinarily high levels of foreign protein production. Chloroplast transformation has recently led to the engineeringof plants that are resistant to bacterial and fungal infections, drought, and herbicides. The level of production of foreign proteins is comparable with that achievedwith engineeredbacteria, making it likely that chloroplast transformation will be used for the production of human pharmaceuticalsand possibly for the engineeringof food crops containing high levelsof all the amino acids essentialto humans. I

Organelle DNAs r Mitochondria and chloroplastsmost likely evolved from bacteria that formed a symbiotic relationship with ancestral cells containing a eukaryotic nucleus (seeFigure 6-20). r Most of the genes originally within mitochondria and chloroplastswere either lost becausetheir funcdons were redundant with nucleargenesor moved to the nucleargenome over evolutionary time, leaving different gene sets in the organellarDNAs of different organisms(seeFigure 6-23). r Animal mtDNAs are circular molecules,reflecting their probable bacterial origin. Plant mtDNAs and chloroplast DNAs generally are longer than mtDNAs from other eukaryotes, Iargely becausethey contain more noncoding regions and repetitive sequences. r All mtDNAs and chloroplast DNAs encoderRNAs and some of the proteins involved in mitochondrial or photosynthetic electron transport and ATP synthesis.Most animal mtDNAs and chloroplast DNAs also encode the tRNAs necessaryto translate the organellar mRNAs. r Becausemost mtDNA is inherited from egg cells rather than sperm, mutations in mtDNA exhibit a maternal cytoplasmic pattern of inheritance. Similarlg chloroplast DNA is exclusivelyinherited from the maternal parent. r Mitochondrial ribosomes resemble bacterial ribosomes in their structure, sensitivity to chloramphenicol, and resistanceto cycloheximide. r The genetic code of animal and fungal mtDNAs differs slightly from that of bacteria and the nuclear genome and varies between different animals and fungi (seeTable 6-3). In contrast, plant mtDNAs and chloroplast DNAs appear to conform to the standard geneticcode. r Severalhuman neuromusculardisordersresult from mutations in mtDNA. Patients generally have a mixture of wild-type and mutant mtDNA in their cells (heteroplasmy): the higher the fraction of mutant mtDNA, the more severe the mutant phenotype.

Analysis Genome-wide ff,| Genomics: of GeneStructureand Expression Using automated DNA sequencingtechniques,methods for cloning DNA fragments on the order of 100 kb in length, and computer algorithms to piece together the stored sequence data, researchershave determined vast amounts of DNA sequenceincluding nearly the entire genomic sequence of humans and many key experimental organisms. This enormous volume of data,which is growing at a rapid pace, has been stored and organized in two primary data banks: the GenBank at the National Institutes of Health, Bethesda, Maryland, and the EMBL SequenceData Base at the European Molecular Biology Laboratory in Heidelberg, Germany. These databasescontinuously exchange newly reported sequencesand make them available to scientists throughout the world on the Internet. By now, the genome sequenceshave been completeln or nearly completely,determined for hundreds of viruses and bacteria, scores of archaea,yeasts (eukaryotes),and model multicellular eukaryotes such as the roundworm C. elegans, the fruit fly Drosophila melanogaster,mice, and humans. The cost of sequencinga megabaseof DNA has fallen so low that projects are underway to sequencethe entire genome in cancer cells and compare it to the genomein normal cells from the samepatient in order to determine all the mutations that have accumulatedin that patient's tumor cells. This approach may reveal genes that are commonly mutated in all cancers,as well as genesthat are commonly mutated in tumor cells from different patients with the same type of cancer (e.g., breast versus colon cancer). Such detailed information also may eventually lead to highly individualized cancer treatments tailored to the specific mutations in the tumor cells of a particular patient. In this section, we examine some of the ways researchersare mining this treasuretrove of data to provide insights about gene function and evolutionary relationships, to identify new geneswhose encodedproteins have never been isolated, and to determine when and where genes are expressed.This use of computers to analyze sequencedata has led to the emergenceof a new field of biology: b ioinformatics.

The most widely usedcomputer program for this purpose is known as BLAST (basic/ocal alignment searchrool). The BLAST algorithm dividesthe "new" protein sequence(known as the query sequence) into shorter segments and then searchesthe databasefor significant matches to any of the The matching program assignsa high score stored sequences. to identically matched amino acids and a lower score to matchesbetweenamino acidsthat are related (e.g.,hydrophobic, polar, positively charged, negatively charged) but not identical.When a significantmatch is found for a segment'the BLAST algorithm will searchlocally to extend the region of similarity.After searchingis completed,the program ranks the matches betweenthe query protein and various known proteins accordingto their p-ualwes.This parameteris a measure of the probability of finding such a degreeof similarity between two protein sequencesby chance. The lower the pvalue, the greater the sequencesimilarity between two sequences.A p-value lessthan about 10-' usually is considered as significantevidencethat two proteins sharea common ancestor.Many alternativecomputer programs have beendeveloped in addition to BLAST that can detect relationshipsbetween proteins that are more distantly related to each other than can be detected by BLAST. The development of such methodsis currently an active areaof bioinformaticsresearch. To illustrate the power of this approach, we consider the human geneNF1 . Mutations in NF1 are associated with the inherited diseaseneurofibromatosis f in which multiple tumors develop in the peripheral nervous system' causinglarge protuberancesin the skin. After a cDNA clone of NFl was isolated and sequenced,the deducedsequenceof the NF1 protein was checked against all other protein sequencesin GenBank. A region of NF1 protein was discovered to have considerablehomology to a portion of the yeast protein calledIra (Figure6-25). Previousstudieshad shown that Ira is a GTPase-activatingprotein (GAP) that modulates the GTPaseactivity of the monomeric G protein called Ras (seeFigure 3-32). As we examine in detail in Chapter 16, GAP and Ras proteins normally function to control cell

StoredSequencesSuggestFunctionsof Newly ldentified Genesand Proteins As discussedin Chapter 3, proteins with similar functions often contain similar amino acid sequencesthat correspond to important functional domains in the three-dimensional structure of the proteins. By comparing the amino acid sequence of the protein encoded by a newly cloned gene with the sequencesof proteins of known function, an investigator can look for sequencesimilarities that provide clues to the function of the encoded protein. Becauseof the degeneracy in the geneticcode, related proteins invariably exhibit more sequencesimilarity than the genesencoding them. For this reason, protein sequencesrather than the corresponding are usuallvcompared. DNA seouences

characteristicof the disease.I Even when a protein shows no significant similarity to other proteins with the BLAST algorithm, it may nevertheless share a short sequencethat is functionally important' Such short segmentsrecurring in many different proteins, referred to as structural motifs, generally have similar functions. Several such motifs are described in Chapter 3 and illustratedin Figure3-9.To searchfor theseand other motifs in a new protein, researcherscompare the query protein sequencewith a databaseof known motif sequences.

243

GENoM|CS:GENoME-W|DEANALYS|SoFGENESTRUCTUREANDEXPRESSIoN

NF1 841 TRATFMEVLTK I LOOGTE FDTLAETVLADRFERLVE LVTMMGDOGE LP IA 890 aaaaaoaaaaaa lra 1500 lR IAFLRVF ID lV. . TNYPVNPEKHEMDKMLA iDDFir FIGURE 8-15 Modelfor cleavageand polyadenylation of pre-mRNAs in mammaliancells.Cleavage andpolyadenylation specificity factor(CPSF) bindsto the upstream AAUAAApoly(A) signalCSIFinteracts with a downstream GU-or U-richsequence a n dw i t h b o u n dC P S F f o, r m i n ga l o o pi n t h e R N Ab; i n d i n g of CFI andCFllhelpstabilize the complexBindingof poly(A)polymerase (PAP) thenstimulates cleavage at a poly(A) site,whichusually is 10-35nucleotides 3' of the upstream poly(A) signal.Thecleavage factorsarereleased, as isthe downstream RNAcleavage product, w h i c hi s r a p i d ldy e g r a d e dB.o u n dp A pt h e na d d s: 1 2 A r e s i d u east a slowrateto the 3'-hydroxyl groupgenerated by the creavage reactionBindingof poly(A)-binding proteinil (pABpil) to the initial shortpoly(A) tailaccelerates the rateof additionby pApAfter 200-250A residues pApto stoo havebeenadded,pABpll siqnals polVmenzation

Poly(A) signal [I

s',

3' Pre-mRNA

,, I CPSF, CSIF, CFI,CFII

1

residuesoccurs slowly, followed by rapid addition of up to 200-250 more A residues.The rapid phase requires the binding of multiple copies of a poty(A)-binding protein containing the RRM motif. This protein is designatedpABpII ro distinguish it from the poly(A)-binding protein presentin the cytoplasm. PABPII binds to the short A tail initially added by PAP,stimulating the rate of polymerization of additional A residuesby PAP,resulting in rhe fast phase of polyadenylation (Figure 8-15). PABPII is also responsiblefor signaling poly(A) polymerase to terminate polymerization when the poly(A) tail reachesa length of 200-250 residues,although the mechanismfor controlling the length of the tail is not yit understood. Binding of PABP to the poly(A) tail is essential for mRNA export into the cytoplasm.

N u c l e a rE x o n u c l e a s eDse g r a d eR N AT h a t l s Processed Out of Pre-mRNAs

poty(A) p o l y ( A )s i t e s i g n a l \

J.,""'un"

ATP o-€j-

ppi

slow PolYadenYlation

+ CSIF,CFl,CFll

Becausethe human genome contains long introns, only :5 percent of the nucleotides that are polymerized by RNA polymerase II during transcription are retained in mature, processedmRNAs. Although this process appears inefficient, it probably evolved in multicellular organismsbecause the processof exon shuffling facilitated the evolution of new

As mentionedearlier,the 2,,5,-phosphodiesterbond in excised introns is hydrolyzed by a debranching enzyme,yielding a linear molecule with unprotected ends that can be attacked by exonucleases(seeFigure 8-11). The predominant nuclear decaypathway is 3' -+ 5' hydrolysis by 11 exonucleases that associatewith one another in a large protein complex called the exosome.Other proteins in the complex include RNR helicasesthat disrupt base pairing and RNA-protein interactions that would otherwiseimpedethe exonucleases. Exosomesalso function in the cytoplasm, as discussedlater. In addition, the exosome appears to degrade pre-mRNAs that have not been properly spliced or polyadenylated. It is not yet clear how the

336

C H A P T E R8

|

posT-TRANSCR|pTtoNA GLE N EC O N T R O L

ATP ppi

Rapid PolYadenYlation

-zoo ou 3'

exosomerecognizesimproperly processedpre-mRNAs. But in yeast cells with temperature-sensitivemutant poly(A) polymerase(Figure8-15), pre-mRNAs are retainedat their sitesof transcription at the nonpermissivetemperature.Theseabnormally processedpre-mRNAs are releasedin cellswith a second mutation in a subunit of the exosomefound only in nuclear and not cytoplasmicexosomes(PM-Scl; 100 kD in humans). Also, exosomesare found concentratedat sitesof transcription in Drosophila polytene chromosomes,where they are associated with RNA polymeraseII elongation factors. Theseresults suggestthat the exosomeparticipatesin an as yet poorly understood quality-control mechanismthat recognizesaberrantly processed pre-mRNAs, preventing their export to the cytoplasm and ultimately leadingto their degradation. To avoid being degraded by nuclear exonucleases,nascent transcripts, pre-mRNA processing intermediates, and mature mRNAs in the nucleus must have their ends protected.As discussedabove,the 5' end of a nascenttranscript is protectedby addition ofthe 5'cap structureas soon as the 5' end emergesfrom the polymerase.The 5' cap is protected becauseit is bound by a nuclear cap-binding complex, which protects it from 5' exonucleasesand also functions in export of mRNA to the cytoplasm. The 3' end of a nascent transcript lies within the RNA polymeraseand thus is inaccessible to exonucleases(seeFigure4-12). As discussedpreviously, the free 3' end generatedby cleavageof a pre-mRNA downstream from the poly(A) signal is rapidly polyadenylatedby the poly(A) polymeraseassociatedwith the other 3' processing factors, and the resulting poly(A) tail is bound by PABPII (Figure 8-15). This tight coupling of cleavageand polyadenylation protects the 3' end from exonucleaseattack.

pre-mRNAs of higher organisms. A network of interactions between SR proteins, snRNPs' and splicing factors forms a cross-exonrecognition complex that specifiescorrect splicesites(seeFigure 8-13)' r The snRNAs in the spliceosomeare thought to have an overall tertiary structure similar to that of group II selfsplicing introns. r For long transcription units in higher organisms,splicing of exons usually begins as the pre-mRNA is still being formed. Cleavageand polyadenylation to form the 3' end of the mRNA occur after the poly(A) site is transcribed. r In most protein-coding genes' a conserved AAUAAA poly(A) signal lies slightly upstream from a poly(A) site where cleavageand polyadenylation occur. A GU- or Urich sequence downstream from the poly(A) site contributes to the efficiency of cleavageand polyadenylation. r A multiprotein complex that includes poly(A) polymerase(PAP)carries out the cleavageand polyadenylation of a pre-mRNA. A nuclear poly(A)-binding protein, PABPII, stimulatesaddition of A residuesby PAP and stops addition once the poly(A) tail reaches 200-250 residues ( s e eF i g u r e8 - 1 5 ) . r Excised introns and RNA downstream from the cleavagel poly(A) site are degradedprimarily by exosomes,multiprotein complexesthat contain eleven3' -> 5' exonucleasesas well as RNA helicases.Exosomesalso degradeimproperly processedpre-mRNAs.

fp| Regulationof Pre-mRNA Processing Processingof Eukaryotic Pre-mRNA r In the nucleus of eukaryotic cells, pre-mRNAs are associated with hnRNP proteins and processedby 5' capping, 3' cleavageand polyadenylation, and splicing before being transported to the cytoplasm (seeFigure 8-2). r Shortly after transcriptioninitiation, a cappingenzymeassociatedwith the phosphorylatedCTD of RNA polymerase II addsthe 5' cap to the nascenttranscript. Other RNA processingfactors involved in RNA splicing, 3' cleavage,and polyadenylation also associate with the phosphorylated CTD, increasingthe rate of transcriptionelongation.Consequently, transcription does not proceed at a high rate until RNA processingfactors become associatedwith the CTD, where they are poised to interact with the nascent premRNA as it emergesfrom the surface of the polymerase. r Five different snRNPs interact via basepairing with one another and with pre-mRNA to form the spliceosome(see Figure 8-11). This very large ribonucleoproteincomplex catalyzestwo transesterificationreactions that join two exons and remove the intron as a lariat structure, which is subsequentlydegraded(seeFigure 8-8). r SR proteins that bind to exonic splicing enhancer sequencesin exons are critical in defining exons in the large

Now that we've seenhow pre-mRNAs are processedinto mature, functional mRNAs' we consider how regulation of this processcan contribute to genecontrol. Recall from Chapter 5 that higher eukaryotescontain both simple and complex tran-

transcription units 1-69o7oof all human transcription units) can be processedin alternative ways to yield different mRNAs that encodedistinct proteins (seeFigure 6-3).

A l t e r n a t i v eS p l i c i n gl s t h e P r i m a r yM e c h a n i s m for RegulatingmRNAProcessing The discovery that a large fraction of transcription units in higher organisms encode alternatively spliced mRNAs and that differently splicedmRNAs are expressedin different cell types revealedthat regulation of RNA splicing is an importun, g.n"-.ontrol mechanismin higher eukaryotes.Although many examples of cleavageat alternative poly(A) sites in pre-mRNAs are known, alternative splicing of different exons is the more common mechanismfor expressingdifferent O F P R E - m R N AP R O C E S S I N G REGULATION

337

Pre-mRNAs

(a) sxl

mRNAs

q .-

z

(b) tra

? -/Y .-\

gsxt'rotein

W+ J

4

-+

t-fl-t} 1

2

?rra protein

5

(c) dsx

A FIGURE 8-16 Cascade of regulatedsplicingthat controlssex determinationin Drosophilaembryos.Forclarity,onlythe exons (boxes) andintrons(blacklines) whereregulated splicing occursare shownSplicing isindicated by reddashed linesabove(female) and bluedashed linesbelow(male) the pre-mRNAs Vertical redlinesin exonsindicate ln-frame stopcodons, whrchprevent synthesis of functional proteinOnlyfemaleembryos produce functional Sxl protein, whichrepresses splicing betweenexons2 and3 in sxlpremRNA(a)andbetweenexons1 and2 in tra pre-mRNA (b) (c)In contrast, the cooperative bindingof Traproteinandtwo SRproteins,

Rbpl andfra2,activates splicing betweenexons3 and4 and cleavage/polyadenylation Anat the 3' endof exon4 in dsxprem R N Ai n f e m a l e m b r y o sI n m a l ee m b r y o w s ,h i c hl a c kf u n c t i o n a l Tra,the SRproteins do not bindto exon4, andconsequently exon3 isspliced to exon5 ThedistinctDsxproteins produced in female andmaleembryos asthe resultof thiscascade of regulated splicing repress transcription of genesrequired for sexual differentiation of the opposite sex.[Adapted fromM J Mooreet al, 1993,in R Gesteland press, andJ Atkrns, eds,IheRNAWorld, ColdSpring pp 303-357 Harbor l

proteins from one complex transcription unit. In Chapter 4, for example, we mentioned that fibroblasts produce one type of the extracellular protein fibronectin, whereas hepatocytes produce another type. Both fibronectin isoforms are encoded by the same transcription unit, which is spliced differendy in the two cell types to yield two different mRNAs (seeFigure4-16).ln other cases,alternativeprocessingmay occur simultaneouslyin the samecell type in responseto different developmentalor environmental signals.First we discussone of the best-undersrood examplesof regulatedRNA processingand then briefly consider the consequencesof RNA splicing in the developmentof rhe nervous sysrem.

The Sxl protein, encodedby the sex-lethalgene,isthe first protein to act in the cascade(Figure 8-16). The Sxl protein is present only in female embryos. Early in development,the gene is transcribed from a promoter that functions only in female embryos. Later in development,this female-specific promoter is shut off and another promoter for sex-letbal becomesactive in both male and female embryos. However, in the absenceof early Sxl protein, the sex-lethalpre-mRNA in male embryos is spliced to produce an mRNA that contains a stop codon early in the sequence.The net result is that male embryos produce no functional Sxl protein either early or later in development. In contrast, the Sxl protein expressedin early female embryos directs splicing of the sex-lerEal pre-mRNA so that a functional sex-lethalmRNA is produced (Figure 8-16a). Sxl accomplishesthis by binding to a sequencein the pre-mRNA near the 3' end of the intron between exon 2 and exon 3, thereby blocking the proper association of U2AF and tJ2 snRNP.As a consequence, the U1 snRNP bound to the 3, end of exon 2 assembles into a spliceosomewith U2 snRNp bound to the branch point at the 3' end of the intron betweenexons 3 and 4,leading to splicing of exon 2 to 4 and skipping of exon 3. The resulting female-specificsex-lethal mRNA is translated into functional Sxl protein, which reinforces its own expressionin female embryos by continuing to cause skipping of exon 3. The absenceof Sxl protein in male embryos allows the inclusion of exon 3 and, consequently,of the stop codon that preventstranslation of functional Sxl protein.

A Cascade o f R e g u l a t e dR N AS p l i c i n gC o n t r o l s D r o s o p h i l aS e x u a lD i f f e r e n t i a t i o n One of the earliestexamplesof regulatedalternarivesplicing of pre-mRNA came from studiesof sexual differentiaiion in

splicing in Drosophila embryos. More recent researchhas provided insight into how theseproteins regulate RNA processingand ultimately lead to the creation of two different sex-specifictranscriptionalrepressorsthat suppressthe development of characteristicsof the oppositesex. 338

.

c H A p r E8R I

posr-TRANscRtploN GA ELN E coNTRoL

U2AF and U2 snRNP to the 3' end of the intron between exons 3 and 4, just as other SR proteins do for constitutively spliced exons (see Figure 8-13). The TralTra2lRbpl complexes may also enhancebinding of the cleavage/polyadenylation complex to the 3' end of exon 4.

and ActivatorsControl SplicingRepressors Splicingat Alternative Sites

d

A FIGURE 8-17 Modelof splicingactivationby Traproteinand embryos, the 5RproteinsRbpl and Tra2.In femaleDrosophila isactivated by bindingof splicing of exons3 and4 in dsxpre-mRNA Rbpl andTra2 fra/Tra2lRbp1 complexes to sixsitesin exon4 Because in theabsence of Tra,exon4 isskipped cannotbindto the pre-mRNA A, : polyadenylation in maleembryos. Seethetextfor discussion 2002,Nature 418:236] fromT.Maniatis andB Tasic, lAdapted Sxl protein also regulatesalternative RNA splicing of the transformergenepre-mRNA (Figure8-16b).In male embryos, where no Sxl is expressed,exon 1 is spliced to exon 2, which contains a stop codon that prevents synthesisof a functional transformer protein. In female embryos, however, binding of Sxl protein to the 3' end of the intron between exons 1 and 2 blocks binding of U2AF at this site. The interaction of Sxl with transformer pre-mRNA is mediated by two RRM domains in the protein (seeFigure 8-5).Vhen Sxl is bound, U2AF binds to a lower-affiniry site farther 3' in the pre-mRNA; as a result exon 1 is spliced to this alternative 3' splice site, eliminating exon2 with its stop codon. The resulting female-specifictransformer nRNA, which contains additional constitutively spliced exons, is translated into functional Transformer (Tra) protein. Finally, Tra protein regulatesthe alternativeprocessingof pre-mRNA transcribed from the double-sex gene (Figure 8-16c). In female embryos,a complex of Tra and two constitutively expressedproteins,Rbpl and Tra2, directssplicingof exon 3 to exon 4 and also promotescleavage/polyadenylation at the alternativepoly(A) site at the 3' end of exon 4-leading to a short, female-specificversion of the Dsx protein. In male embryos,which produce no Tra protein, exon 4 is skipped,so that exon 3 is spliced to exon 5. Exon 5 is constitutively splicedto exon 6, which is polyadenylatedat its 3' end-leading to a longer,male-specificversion of the Dsx protein. As a result of the cascadeof regulatedRNA processingdepictedin Figure 8-16, different Dsx proteins are expressedin male and femaleembryos.The male Dsx protein is a transcriptionalrepressor that inhibits the expression of genes required for female development.Conversely,the female Dsx protein repressestranscription of genesrequired for male development. complex Figure 8-17 illustrates how theTrafta2iRbpl is thought to interact with double-sex(dsx)pre-mRNA. Rbpl andTra2 are SR proteins, but they do not interact with exon 4 in the absenceof the Tra protein. Tra protein interactswith Rbpl and Tra2, resulting in the cooperative binding of all three proteins to six exonic splicing enhancersin exon 4. The bound Tra2 and Rbpl proteins then promote the binding of

As is evident from Figure 8-15, the Drosophila Sxl protein and Tra protein have opposite effects:Sxl prevents splicing' causingexons to be skipped, whereasTra promotes splicing. The action of similar proteins may explain the cell-typespecificexpressionof fibronectin isoforms in humans. For instance,an Sxl-like splicingrepressorexpressedin hepatocytes might bind to splicesitesfor the EIIIA and EIIIB exons in the fibronectin pre-mRNA, causing them to be skipped during RNA splicing (seeFigure4-16). Alternatively,a Tralike splicing activator expressedin fibroblastsmight activatethe splice sites associatedwith the fibronectin EIIIA and EIIIB exons' leading to inclusion of these exons in the mature mRNA. Experimental examination in some systemshas revealedthat inclusion of an exon in some cell types versusskipping of the same exon in other cell types results from the combined influenceof severalsplicing repressorsand enhancers. Alternative splicing of exons is especially common in the nervous system,generatingmultiple isoforms of many proteins required for neuronal developmentand function in both vertebratesand invertebrates.The primary transcripts from thesegenesoften show complex splicing patterns that can generate several different mRNAs' with different spliced forms expressedin different anatomical locationswithin the central nervous system.We consider two remarkable examplesthat illustrate the critical role of this processin neural function. Expression of K*-Channel Proteins in Vertebrate Hair Cells In the inner ear of vertebrates, individual "hair cells," which are ciliated neurons' respond most strongly to a specific frequency of sound. Cells tuned to low frequency (:50 Hz) are found at one end of the tubular cochlea that makes up the inner ear; cells responding to high frequency (:5000 Hz\ arefound at the other end (Figure8-18a).Cells in between the ends respond to a gradient of frequenciesbetween theseextremes.One component in the tuning of hair cells in reptiles and birds is the opening of K*ion channelsin resDonseio increasedintracellular Ca2*concentrations.The Ca2* concentration at which the channel opens determines the frequency with which the membrane potential oscillates and hencethe frequency to which the cell is tuned' The gene encoding this Ca2+-activatedK+ channel is expressedas multiple, alternatively spliced mRNAs. The various proteins encodedby thesealternative mRNAs open at different Ca2* concentrations. Hair cells with different response frequenciesexpressdifferent isoforms of the channel protein depending on their position along the length of the cochlea (see Figure 23-30). The sequencevariation in the protein is very complex: there are at leasteight regions in the mRNA where alternative exons are utilized, permitting the expression of 576 possibleisoforms(Figure8-18b).PCR analysisof mRNAs from O F P R E - m R N AP R O C E S S I N G REGULATION

339

(a)

through post-translational modifications of splicing factors playsa significantrole in modularingneuron function.

Apical h a i rc e l l ( 5 0H z )

Auditory nerve cell body

Basal h a i rc e l l (5000Hz)

Cytosol

outside) of only about 1,70-fold.Thus by coupling the transport of two Na+ ions to the transport of one glucose, the two-Na*/one-glucose symporter permits cells to accumulate a very high concentration of glucoserelative to the external

Oveview Animation: BiologicalEnergyInterconversions Exrenol

2Na+o a

OGlucose

++ Inward-facing conformation

FIGURE 11-25 Operationalmodel for the two-Na+/one_ glucosesymporter.Simultaneous bindingof Na+andglucose to the conformation with outward-facing bindingsites(stepIl) causes a conformational changein the proteinsuchthatthe boundsubstrates aretransiently occluded, unableto dissociate intoeithermedium(stepZ) In stepEt the proteinassumes a

466

C H A P T E R1 1

I

Outward-facing conformation

thirdconformation with inward-facing sitesDissociation of the boundNa* andglucose (stepB) allowsthe protern intothecytosol to revertto itsoriginaloutward-facing (step[), ready conformation to transportadditional physiology substrate[SeeE Wrightet.at,2OO4, 19:370 for detailson the structureand function of thrs and related transportersl

T R A N S M E M B R A NTER A N S P O R O T F I O N SA N D S M A L L M O L E C U L E 5

concentration. This means that glucosepresent even at very low concentrations in the lumen of the intestine or in the forming urine can be efficiently transported into the lining cells and not lost from the body. The two-Na+/one-glucose symporter is thought to contain L4 transmembrane a helices with both its N- and Ctermini extending into the cytosol. A truncated recombinant protein consisting of only the five C-terminal transmembrane o helices can transport glucose independently of Na* across the plasma membrane, down its concentration gradient. This portion of the molecule thus functions as a glucose uniporter. The N-terminal portion of the protein, including helices 1-9, is required to couple Na+ binding and influx to the transport of glucoseagainst a concentration gradient. Figure 11-25 depicts the current model of transport by Na*/glucose symporters.This model entails conformational changesin the protein analogousto those that occur in uniport transporters, such as GLUT1, which do not require a

cotransportedion (seeFigure 11-5). Binding of all substrates to their sites on the extracellular domain is required before the protein undergoesthe conformational change that transitions the substrate-bindingsites from outward to inward facing; this ensures that inward transport of glucose and Na* ions are coupled.

BacterialSymporterStructureRevealsthe Mechanismof SubstrateBinding No three-dimensional structure of a mammalian sodium symporter has been determined' but the structuresof several homologous bacterial sodium-amino acid transporters have provided considerable information about symport function. The bacterial two-Na*/one-leucine symporter shown in Figure 1'1'-26aconsistsof 12 membrane-spanning a helices.Two of the helices (numbers 1, and 6l have nonhelical segmentsin the middle of the membrane that form part of the leucine-bindingsite.

fT

!l

Symporter eod.ust:The Two-Na+/one-Leucine

structureof the two-Na-11-26 Three-dimensional A FIGURE /one-feucinesymporterfrom the bacteriumAquifex aeolicus' (a)TheboundL-leucine, ionare two sodiumions,anda chloride The shownasCPKmodelsin yellow,purpleandgreen,respectively are cthelices thatbindthe Na*or leuctne threemembrane-spanning of thetwo sodiumions brown,blue,andorange(b)Binding colored

oxygens side-chain atomsor carboxyl oxygen main-chain to carbonyl (red)that arepartof helices1 (brown),6 (blue),or 8 (orange)lt is thatoneof thesodiumions(top)isalsoboundto the important A Yamashita leucine(yellow). [From groupof the transported carboxyl 431:811 Nature 2004, et al, Yernool D see also 437 :215: Nature 2005, et al, transporters l of thisandrelated andfunction onthestructure fordetails

C O T R A N S P O RBTY S Y M P O R T E RASN D A N T I P O R T E R S

467

Amino acid residues involved in binding the leucine and the two sodium ions are located in the middle of the membrane-spanning segment (as depicted for the twoNa*/one-glucosesymporter in Figure 11-25) and are close together in three-dimensional space. This demonstrates that the coupling of substrate and ion transport in these transporters is the consequenceof direct or nearly direct physical interactions of the substrates.Indeed, one of the sodium ions (number 1 in Figure 11-26b) is bound to the carboxyl group of the transported leucine,indicating how binding of sodium and leucine are coupled. Each of the two sodium ions is bound to six oxyge., ,to-r. Sodium 1, for example, is also bound to carbonyl oxygens of several transporter amino acids as well as to carbonyl oxygens and the hydroxyl oxygen of one threonine. Equally importantly, there are no water moleculessurrounding either of the bound sodium atoms, as is the case for K+ ions in potassium channels (see Figure 11-20). Thus as the sodium ions lose their water of hydration in binding to the transporter,they bind to six oxygen atoms with a similar geometry. This reducesthe activation energy for binding of sodium ions and preventsother ions, such as porassium, from binding in place of sodium. One striking feature of the structure depicted in Figu r e 1 1 - 2 6 i s t h a t t h e b o u n d s o d i u m i o n s a n d l e u c i n ea r e occluded-that is, they cannot diffuse out of the protein to either the surrounding extracellular or cytoplasmic media. Apparently the process of crystallization of this protein with its bound substrateshas "trapped" it into an intermediate transport step (see Figure 11-25) in which the protein appears to be changing from a conformation with an exoplasmic- to one with a cytosolic-facing binding site.

Na+-LinkedCa2+Antiporter ExportsCa2*from C a r d i a cM u s c l eC e l l s In cardiac muscle cells a tbree-Na+/one-Ca2* anti\orter. rather than the plasma membrane Ca2* Alpase dis.ussej earlier, plays the principal role in maintaining a low concentration of Ca2* in the cytosol. The transporr reacrron mediated by this cation antiporter can be written 3 Na+or, * Ca2*;, ; -

3 Na+1. * C"'*o,.

Note that the movement of three Na+ ions is required to power the export of_oneCa2' ion from the .ytoto1, with a lcal*J of :2 x 10-7 M, ro the extracellularmedium, with a [C"t*] of 2 x 10-3 M, a gradientof some 10,000-fold.In all muscle cells, a rise in the cytosolic Ca2* concentration in cardiac muscle triggers conrraction; by lowering cytosolic Ca'-, operation of the Na+/Ca2+ 2lliporter reducesthe strengthof heart musclecontracrion. The Na*/K+ ATPasein the plasma membrane of cardiac muscle cells, as in other body cells, createsthe N a * concentration gradient necessaryfor export of Caz* 468

.

c H A p r E R1 1 |

by the Na*-linked Ca'* antiporter. As mentioned earlier, inhibition of the Na*/K* AIPase by the drugs ouabain and digoxin lowers the cytosolic K* concentration and, more relevant here, simultaneouslyincreasescytosolic Na*. The resulting reduced Na* electrochemicalgradient across the membranecausesthe Na+-linked Ca2* antiDorterto function less efficiently. As a result, fewer Ca21 ions are exported and the cytosolic Ca2* concentration increases, causing the muscle to contract more strongly. Becauseof their ability to increasethe force of heart muscle contractions, drugs such as ouabain and digoxin that inhibit the Na-/K- ATPase are widely used in the treatment of congestiveheart failure. I

SeveralCotransportersRegulateCytosolicpH The anaerobic metabolism of glucoseyields lactic acid, and aerobic metabolism yields CO2, which adds water to form carbonic acid (H2CO3).Theseweak acids dissociate,yielding H- ions (protons); if these excessprotons were not removed from cells, the cytosolic pH would drop precipitously, endangering cellular functions. Two types of cotransport proteins help remove some of the "excess" protons generatedduring metabolism in animal cells. One is a Na- HCO j- /Cl antiporter, which imports one Na+ ion together with one HCO3-, in exchangefor export of one Cl ion. The cytosolic enzymecarbonic anhydrasecatalyzesdissociation of the imported HCO3- ions into CO2 and an OH- (hydroxyl)ion: HCO.-

;-

CO, + OH

The OH- ions combine with intracellular protons, forming water, and the CO2 diffuses out of the cell. Thus the overall action of this transporter is to consume cytosolic H+ ions, thereby raising the cytosolic pH. Also importanr in raising cytosolic pH is a Na* /H* antiporter, which couplesentry of one Na* ion into the cell down its concenrrationgradient to the export of one H+ ron. Under certain circumstances,the cytosolic pH can rise beyond the normal range of 7 .2-7.5. To cope with the excess OH- ions associatedwith elevated pH, many animal cells utilize an anion antiporter that catalyzesthe one-for-one exchangeof HCO3- and Cl acrossthe plasma membrane.At high pH, this C/ /HCO3- antiporter exports HCO3(which can be viewed as a "complex" of OH and CO2) in exchangefor import of Cl-, thus lowering the cytosolic pH. The import of CI- down its concentration gradient (Cl -.air- ) Cl .r,oror)powers the transport. The activity of all three of these anriport proteins depends on pH, providing cells with a finely tuned mechanismfor controlling the cytosolic pH. The two antiporters that operateto increasecltosolic pH are activated when the pH of the cytosol falls. Similarly, a rise in pH above 7.2 stimulates the CI-iHCO3- antiporter, leading to a more rapid export of HCO3- and decreasein the cytosolic pH. In this manner,the cytosolic pH of growing cells is maintained very closeto pH7.4.

T R A N S M E M B R ATNREA N s p o RoTF t o N s A N D S M A L LM O L E C U L E S

A PutativeCation ExchangeProteinPlaysa Key R o l ei n E v o l u t i o no f H u m a nS k i nP i g m e n t a t i o n Sequencingof the human, mouse, and rat genomesindicates the presenceof hundreds of putative transport proteins, but the functions of most of these are as yet unknown. A particularly interesting human transporter called SLC24A5 emerged from a study of zebrafish that had abnormal skin color; in fish homozygous for the golden mutation, the eponymous black horizontal stripes were very pale (Figure 11-27a and b). Microscopy showed that the mutant fish had a much lower amount of the black pigment called melanin, and melanin vesicles,called melanosomes,were much smaller and paler than normal (Figure 11-27 c and d). Positional cloning of the golden gene demonstrated that it encodesa putative cation exchange protein termed SLC24A5. Immunofluorescence studies showed that the protein is found in intracellular

membranes,likely in the membrane of the melanosomeor its precursor,but the ions transported by SLC24A5 are not yet known. However, the amino acid sequence of the SLAC24A5 protein is closestto that of severalsodium/calcium antiporters, so the protein is likely a sodium/calcium antlporter. Most strikingly, investigators showed that the human version of SLC24A5 is highly similar in sequenceto the zebrafish protein; when the human protein is expressedin mutant golden zebrafish,it complementsthe mutant phenotype and the fish have normal black stripes. The most evolutionarily conservedform of the gene, or allele, most similar to the wild-type zebrafish gene predominates in dark-skinned African and East Asian human populations. In contrast. a version, or variant allele, of the SLC24A5 gene with a single amino acid change that is thought to encode a less active protein is found in virtually all people of European origin. Studies of the allele frequenciesin admixed populations indicate that different forms, or polymorphisms, in iust this cation transporter play a key role in determining the darkness of human skin color' Clearly much needsto be learned about the role of this transporter in cell physiology and how a single point mutation in this gene accountsfor the large differencesin skin pigmentation characteristic of individuals of European, African, and Asian origin.

t r o t e i n sE n a b l eP l a n t N u m e r o u sT r a n s p o r P Vacuolesto AccumulateMetabolitesand lons

11-27 Zebratishmutationsin the gene encodingthe A FfGURE causethe golden skin pigment cation exchangerSLC24A5 phenotype.Lateralviewsof adultwild-type(a)andgolden(b) (arrowheads) Scale bars,5 mm Insets showmelanophores zebrafish (inset, thatareon 0 5 mm) Goldenmutantshavemelanophores paler, thannormal andmoretransparent smaller, average fromwildmicrographs of skinmelanophores electron Transmission type(c) andgolden(d)larvaeshowthat goldenskinmelanophores (arrowheads fewer arethinnerandcontarn showedges) l c a lb e a r si n ( c ) a n d( d ) ,1 0 0 0n m l F r o m m e l a n o s o m e s t hnaonr m a S Scrence 310:1 782,1 etal, 2005, R L Lamason

The lumen of plant vacuolesis much more acidic (pH 3-6) than is the cytosol (pH 7.5). The acidity of vacuolesis maintained by a V-classAlP-powered proton pump (seeFigure 1,1,-9)and by a pyrophosphate-poweredpump that is unique to plants. Both of thesepumps, located in the vacuolar membrane, import H* ions into the vacuolar lumen against a concentration gradient. The vacuolar membrane also conchannels that transport these anions tains Cl- and NO: from the cytosol into the vacuole. Entry of these anions against their concentration gradients is driven by the insidepositive potential generated by the H* pumps. The comtined operation of these proton pumps and anion channels producesan inside-positiveelectricpotential of about 20 mV across the vacuolar membrane and also a substantial pH gradient (Figure 11-28). The proton electrochemical gradient across the plant vacuole membrane is usedin much the sameway as the Na* electrochemicalgradient acrossthe animal-cell plasma membrane: to power the selectiveuptake or extrusion of ions and small molecules by various antiporters. In the leaf, for example, excesssucrosegeneratedduring photosynthesisin the day is stored in the vacuole; during the night' the stored sucrose moves into the cytoplasm and is metabolized to CO2 and H2O with concomitant generation of ATP from ADP and P;. A proton/sucrose antiporter in the vacuolar membrane operatesto accumulatesucrosein plant vacuoles.The inward movement of sucrose is powered by the outward movement of H*, which is favored by its concentration C O T R A N S P O RBTY S Y M P O R T E RASN D A N T I P O R T E R S

469

H*-pumping proteins ADP+ P;

Cotransport by Symporters and Antiporters PPi

2Hlon-channel

r Cotransporters use the energy releasedby movement of an ion (usually Ht or Na*) down its electrochemicalgradient to power the import or export of a small molecule or different ion against its concenrrationgradient.

H' + +

P l a n tv a c u o l el u m e n ( p H= 3 - 6 ) Nat

H*

Ca2*

Sucrose

H+

Cytosol ( p H= 7 . 5 )

Protonantiportproteins A FIGURE 11-28 Concentration of ionsand sucroseby the plant vacuole.Thevacuolar membrane contains two typesof protonpumps(orange): (/eft)anda a V-class H* ATpase pyrophosphate-hydrolyzing protonpump(flght)thatdiffersfromall otheriontransport proteins andprobably isuniqueto plantsThese pumpsgenerate a low luminalpHaswellasan inside-positive potential electric across thevacuolar membrane owingto the inward pumpingof H* ions Theinside-positive potential powersthe movement of Cl- andNOr- fromthecytosol throughseparate (purple)Protonantiporters proteins channel (green), powered by the H + g r a d i e nat ,c c u m u l aNt ea + ,C a 2 +a, n ds u c r o si n e s i dteh ev a c u o l e . [ A f t e r P R e aa n d D S a n d e r s1, 9 8 7 ,p h y s i o t p l a n t 7 1 . t 3 1 ; J M M a a t h u i sa n d D S a n d e r s1, 9 9 2 ,C u r r O p i n C e l lB i o l . 4 . 6 6 1 ;a n d p A R e ae t a l , 1 9 9 2 . TrendsBiochem Sci. 17:348 l

gradient (lumen > cytosol) and by the cytosolic-negative potendal acro-ssthe vacuolar membrane (seeFigure 11-28). Uptake of Ca2* and Na+ into the vacuole from the cytosol against their concentration gradients is similarly mediated by proton antiporters. Understandingof the transport proteins in plant vacuolar membraneshas the potential for increasingagriculproduction in high-salt (NaCl) soils, which are found throughout the world. Becausemost agriculturally useful crops cannot grow in such saline soils, agricultural scientists have long sought to develop salt-tolerant plants by traditional breedingmerhods.\With the availability of the cloned gene encoding the vacuolar Na*/H* antiporter, researchers can now produce transgenicplants that overexpressthis transport protein, leading to increasedsequestrationof Na* in the vacuole. For insrance,rransgenlctomato plants that overexpressthe vacuolar Na*/H* antiporter can groq flower, and produce fruit in the presenceof soil NaCl concentrations that kill wild-type plants. Interestingly although the leavesof thesetransgenictomato plants accumulatelarge amounts of salt, the fruit has a very low salt content. I

470

CHAPTER 11

I

r The cells lining the small intestine and kidney tubules express symport proteins that couple the energetically favorable entry of Na+ to the import of glucose and amino acids against their concentration gradients (see Figure 11-25). r The molecular structure of a bacterial Na+-amino acid symporter revealshow binding of Na* and leucineare coupled and provides a snapshot of an occluded transport intermediate in which the bound substratescannot diffuse out of the protein. r In cardiac musclecells,the export of Ca2* is coupled to and powered by the import of Na* by a cation antiporter, which transports 3 Na* ions inward for each Ca2* ion exported. r As judged by mutations in zebrafish and polymor, phisms in humans, the presumed sodium/calcium cotransporter SLC24A5 plays a major role in forming melanin granules and in regulating the darkness of human skin pigmentation. r Two cotransportersthat are activated at low pH help maintain the cytosolic pH in animal cells very close to 7.4 despitemetabolic production of carbonic and lactic acids.One, a Na*/H* antiporter,exports excessprotons. The other, a Na*HCO3-lClcotransporrer, imports HCO3 , which dissociatesin the cytosol to yield pHraising OH- ions. r A CI-/HCO3 antiporter that is activated at high pH functions to export HCO3 when the cytosolic pH rises above normal and causesa decreasein pH. r Uptake of sucrose,Na*, Ca2*, and other substances into plant vacuoles is carried out by proton antiporters in the vacuolar membrane.Ion channelsand proton pumps in the membrane are critical in generatinga large enough proton concentration gradient to power accumulation of ions and metabolites in vacuoles by these proton antiporters (see Figure 11-28).

Transepithel iaI Transport Previous sections illustrated how several types of transporters function together to carry out important cell functions (seeFigure 11,-2).Here,we exrend this concept by focusing on the transport of several types of molecules and ions acrossthe sheetlikelayers of epithelial cells that cover

T R A N S M E M B R A NTER A N S P O ROTF I O N SA N D S M A L LM O L E C U L E 5

most external and internal surfacesof body organs. Like all epithelial cells, an intestinal epithelial cell is said to be polarized becauseits plasma membrane is organized into at least two discreteregions.Typically, the surfacethat facesthe outside of the organism, here the lumen of the intestine,is called the apical, or top, surface, and the surface that faces the inside of the organism is called the basolateral surface (see Figure 19-9). Specializedregions of the epithelial-cellplasma membrane, called cell junctions, connect the cells and provide strength and rigidity to the cell sheet (seeFigure 1,9-9for details). One of these types of cell junctions-the tight junction-is of particular interesthere sincetight junctions prevent many water-solublesubstanceson one side of an epithelium from moving acrossto the other side through the extracellular space betweencells. For this reason, absorption of nutrients from the intestinal lumen into the blood occurs by the two-stage process called transcellwlar transport: import of moleculesthrough the plasma membrane on the apical side of intestinal epithelial cells and their export through the plasma membrane on the bloodfacing (basolateral,or serosal) side (Figure 11-29). The apical portion of the plasmamembrane,which facesthe intestinal lumen, is specialized for absorption of sugars, amino acids, and other moleculesthat are produced from food by various digestive enzymes.Numerous fingerlike projections (100 nm in diameter) called microvilli greatly increasethe area of the apical surfaceand so the number of

2 Na+/glucose symporter

GLUTz Glucose

Glucose

FI

t

2Na

Na

Glucose 2 Na'

Na+76+ ATPase

Apical membrane T i g h tj u n c t i o n Cytosol Low NaH i g hK *

11-29Transcellular transportof glucosefrom the A FIGURE in the intestinallumeninto the blood.TheNa*/K*ATPase generates membrane Nat andK* concentration surface basolateral (step1) Theoutwardmovement gradients of K+ ionsthrough (notshown)generates an inside-negative K* channels nongated gradient potentialBoththe Na* concentration and membrane from potential areusedto drivethe uptakeof glucose the membrane located symporter lumenbythetwo-Na'/one-glucose the intestinal (step2) Glucose leaves thecellvia membrane in the apicalsurface located uniporter a glucose catalyzed by GLUT2, facilitated diffusion (step3) membrane in the basolateral

transport proteins it can contain, enhancingthe cell's absorptive capacitY.

Multiple TransportProteinsAre Neededto Move Glucoseand Amino AcidsAcrossEpithelia Figure 11-29 depicts the proteins that mediate absorption of glucose from the intestinal lumen into the blood and illustrates the important concept that different types of proteins are localizedto the apical and basolateralmembranesof epithelial cells.In the first stageof this process'a two-Na*/oneglucosesymporter located in microvillar membranesimports glucose, against its concentration gradient' from the intestinal lumen acrossthe apical surfaceof the epithelial cells.As noted above, this symporter couples the energeticallyunfavorable inward movement of one glucosemoleculeto the en-

port, are pumped out across the basolateralmembrane, which facesthe underlying tissue.Thus the low intracellular Na* concentration is maintained. The Na*/K* ATPasethat accomplishesthis is found exclusivelyin the basolateral membraneof intestinalepithelialcells' The coordinatedoperation of thesetwo transport proteins allows uphill movement of glucoseand amino acids from the intestine into the cell. This first stage in transcellular transport ultimately is powered by ATP hydrolysis by the Na*/l(- ATPase. In the secondstage,glucoseand amino acidsconcentrated inside intestinal cells by symportersare exported down their concentrationgradientsinto the blood via uniport proteins in the basolateralmembrane.In the caseof glucose,this movement is mediatedby GLUT2 (seeFigure 11-29).As noted earlier, this GLUT isoform has a relatively low affinity for glucosebut increasesits rate of transport substantiallywhen the glucosegradient acrossthe membranerises(seeFigure 11-4). The net result of this two-stage processis movement of Na* ions, glucose,and amino acidsfrom the intestinallumen acrossthe intestinalepithelium into the extracellularmedium that surrounds the basolateralsurfaceof intestinal epithelial cells.Tight junctions betweenthe epithelialcellspreventthese moleculesfrom diffusing back into the intestinal lumen, and eventually they move into the blood. The increasedosmotic pressurecreated by transcellular transport of salt' glucose, and amino acids acrossthe intestinal epithelium draws water from the intestinal lumen into the extracellular medium that surrounds the basolateralsurface.In a sense,salts, glucose, and amino acids "carry" the water along with them.

S i m p l eR e h y d r a t i o nT h e r a p yD e p e n d so n t h e OsmoticGradientCreatedby Absorption of G l u c o s ea n d N a An understandingof osmosisand the intestinal absorption of salt and glucose forms the basis for a simple

TRANSEPITHELIT AR L ANSPORT

471

therapy that savesmillions of lives each year, particularly in Iess-developedcountries. In these countries, cholera and other intestinal pathogens are major causesof death of young children. A toxin released by the bacteria acrivates chloride secretion by the intestinal epithelial cells into the lumen; water follows osmotically, and the resultant massive loss of water causesdiarrhea, dehydration,and ultimately death. A cure demands not only killing the bacteria with antibiotics but also rehydration-replacement of the water that is lost from the blood and other tissues. Simply drinking water does nor help, becauseit is excretedfrom the gastrointestinal tract almost as soon as it enters. Howeve! as we have just learned. the coordinated transport of glucoseand Na* acrossthe inrestinalepithelium creates a transepirhelial osmotic gradient, forcing movement of water from the intestinal lumen acrossthe cell layer and ultimately into the blood. Thus giving affected children a solution of sugarand salt to drink (but not sugar or salt alone)causesthe osmoticflow of water into the blood from the intestinallumen and leadsto rehydration.Similar sugar-saltsolu ns are the basisof popular drinks used by athletesto get gar as well as water into the body quickly and efficiently.

Cl /HCO3 antiporter at-

HC03-

Cl- channel

CI HCO3-

K+ channel

J.",oon'" anhvdrase I

coz Basolateral memorane

2

I + OH co, v o tl

x2

"

l,-- NADH+ H+ LactateI

dehydrogenase N

cH3-cH

Acetaldchyde

| \> NAD* v oHo

MITOCHONDRION

ttl

cH3-cH-C-OH Lastlc acid

NADH + H+

coz

NAD'

x2

CoA-SH

Pyruvate d e h y dr o g e n a s e

NAD+ NADH

Overallreactionsof anaerobicmetabolism: G l u c o s+e 2 A D P+ 2 P , ----> 2 ethanol+ 2 CO2+2 ATP+ 2 H2O G l u c o s e + 2 A D P +P 2 , ---> 2 lactate + 2 ATP+ 2 H1O NADH

C i t r i ca c i d cycle

NAD+

Oxidative phosphorylation

-28 ADP + -28 Pi -28 AfP + -28 H2O

A FIGURE 12-5 Anaerobicversusaerobicmetabolismof glucose.The ultimatefateof pyruvate formedduringglycolysis depends on the presence or absence of oxygen. In theformation of pyruvate fromglucose, onemolecule (byaddition of NAD+isreduced of two electrons) to NADHfor eachmolecule of pyruvate formed(seeFigure12-3, reaction6) (a)In the absence of oxygen, two electrons aretransferred from eachNADHmolecule to an acceptor molecule to regenerate NAD+,whichis required for continued glycolysis. In yeasts(/eft),acetaldehyde isthe electronacceptorandethanolisthe product. Thisprocess iscalledalcoholic fermentationwhen oxygenis limitingin muscle cells(nght),NADHreduces pyruvate to formlacticacid,regenerating NAD+. (b) In the presence of oxygen,pyruvateistransported into mitochondriaFirstit isconverted by pyruvate dehydrogenase intoonemolecule of CO2andone of aceticacid,the latterlinkedto coenzyme A (CoA-SH) to form acetylCoA, concomitant with reduction of onemolecule of NAD+to NADH.Further metabolism of acetylcoA andNADHgenerates approximately an additional 28 molecules of ATPperglucose molecule oxidized. 484

C H A P T E R1 2

I

CELLULAR ENERGETICS

2CO2 Overallreactionof aerobicmetabolism: Glucose+ 6 02 + -30 ADP + -30 Pi ----> 6 CO2+ 36 H2O+ -30 ATP

the polymer glycogen,a storageform of glucose(Chapter 2), directly to glucose 6-phosphate (without involvement of hexokinase,step [). Under theseconditions, there is a reduction in fructose 2,6-bisphosphatelevels and decreased phosphofructokinase-1activity (Figure 12-4). As a result, glucose6-phosphatederived from glycogenis not metabolized to pyruvate; rather, it is converted to glucose by a phosphataseand releasedinto the blood to nourish the brain and red blood cells,which dependprimarily on glucose as an energy fuel. In all cases,the activity of these regulated enzymesis controlled by the level of small-molecule metabolites, generally by allosteric interactions, or by hormone-mediated phosphorylation and dephosphorylation reactions (Chapter 15 gives a more detailed discussion of hormonal control of glucose metabolism in liver and muscle).

G l u c o s el s F e r m e n t e dU n d e r A n a e r o b i cC o n d i t i o n s Many eukaryotesare obligate aerobes:they grow only in the presenceof molecular oxygen and metabolizeglucose(or related sugars)completely to CO2, with the concomitant production of a large amount of ATP. Most eukaryotes, however, can generate some ATP by anaerobic metabolism. A few eukaryotesare facubatiue anaerobes:they grow in either the presenceor the absenceof oxygen. For example, annelids,mollusks,and someyeastscan live and grow for days without oxygen. In the absenceof oxygen, yeasts convert the pyruvate produced by glycolysisto one molecule each of ethanol and CO2; in these reactions two NADH molecules are oxidized to NAD* for each two pyruvates converted to ethanol, thereby regeneratingthe supply of NAD- (Figure 12-5a, left). This anaerobic degradation of glucose, called fermentation, is the basis of beer and wine production. Oxygen deprivation can also affect glucosemetabolism in animals. During prolonged contraction of mammalian skeletal muscle cells-for example, during exercise-oxygen within the muscle tissue can becomelimited and glucosecatabolism is limited to glycolysis(stageI). As a consequence, muscle cells convert the pyruvate from glycolysis to two molecules of lactic acid by a reduction reaction that also oxidizes two NADHs to NAD*s (Figure L2-5a, right). Although the lactic acid is releasedfrom the muscle into the blood, if the contractions are sufficiently rapid and strong, the lactic acid can transiently accumulate in that tissue and contribute to muscle and joint pain during exercise.Once it is secretedinto the blood, some of the lactic acid passesinto the liver, where it is reoxidized to pyruvate and either further metabolizedto C02 aerobically or converted back to glucose.Much lactate is metabolized to CO2 by the heart, which is highly perfused by blood and can continue aerobic metabolism at times when exercising, oxygen-poor skeletal muscles secretelactate. Lactic acid bacteria (the organisms that spoil milk) and other prokaryotes also generateATP by the fermentation of glucoseto lactate.

, itochondria U n d e rA e r o b i cC o n d i t i o n sM EfficientlyOxidizePyruvateand Generate ATP(Stagesll-lv) In the presenceof oxygen, pyruvate formed by glycolysis is transported into mitochondria, where it is oxidized by 02 to CO2 and H2O via a seriesof oxidation reactions. The overall process by which cells use 02 and produce COz is collectively termed cellular respiration (Figure 12-5b). Reactions in the mitochondria (stagesII-IV) generatean estimated 28 additional ATP molecules per original glucose molecule, far outstripping the ATP yield from anaerobic glucosemetabolism. Oxygen-producing photosynthetic cyanobacteria appeared about 2.7 billion years ago' The subsequentbuildup in the earth's atmosphere of sufficient oxygen during the next approximately billion years opened the way for organisms to evolve the very efficient aerobic oxidation pathway, which in turn permitted the evolution, especially during what is called the Cambrian explosion' of large and complex body forms and associatedmetabolic activities. In effect, mitochondria are ATP-generating factories, taking full advantageof this plentiful oxygen. We first describe their structure and then the reactions they employ to degrade pyruvate.

M i t o c h o n d r i aA r e D y n a m i cO r g a n e l l e s with Two Structurallyand Functionally D i s t i n c tM e m b r a n e s Mitochondria (Figure 12-6) are among the larger organelles in the cell. A mitochondrion is about the size of an E. coli bacterium, which is not surprising, becausebacteria are thought to be the evolutionary precursorsof mitochondria (see Chapter 6 and the discussionof endosymbiont hypothesis, below). Most eukaryotic cells contain many mitochondria, collectively occupying as much as 25 percent of the volume of the cytoplasm. The numbers of mitochondria in a cell, hundreds to thousandsin mammalian cells, are regulated to match the cell's requirements for ATP (e.g., stomach cells' which use a lot of ATP for acid secretion,have many mitochondria). Analysis of fluorescentlylabeled mitochondria in living cellshas shown that mitochondria are highly dynamic. They undergo frequent fusions and fissions that generate tubular, sometimesbranched networks (Figure 1'2-7),which may account for the wide variety of mitochondrial morphologiesseenin different types ofcells. Fusionsand fissions apparently play a functional role as well becausegeneticdisruptions in GTPasesuperfamily genesrequired for thesedynamic processescan disrupt function, such as maintenance of proper inner membrane electrical potential, and cause human disease,such as the neuromuscular diseaseCharcotMarie-Tooth subtype 2A. The details of mitochondrial structure can be observed with electron microscopy (seeFigure 9-8). Mitochondria have two distinct kinds of concentricallyrelated membranes. The outer membrane definesthe smooth outer perimeter of the mitochondrion. The inner membrane has numerous

: L Y C O L Y S IASN D T H E C I T R I CA C I D C Y C L E A N D F A T T YA C I D C A T A B O L I S MG F T R SS T T E P SO F G L U C O S E

Video: Mitochondrion Reconstructedby ElectronTomography (b) F6F1complexes Intermembrane space C r i s t a ej u n c t i o n s

FIGURE 12-6 Internalstructureof a mitochondrion. ( a )S c h e m a tdi ica g r a m s h o w i ntgh ep r i n c i p m a le m b r a n a en sd compartments Thecristae formsheets andtubesby invagination o f t h ei n n e rm e m b r a naen dc o n n e ct o t t h ei n n e m r embrane throughrelatively smalluniformtubularstructures calledcnsta junctionsTheintermembrane spaceappears continuous with the lumenof eachcristaTheFeF,complexes (smallredspheres), whichsynthesize ATP, areintramembrane particles thatprotrude fromthecristae andinnermembrane intothe matrixThematrix contains the mitochondrial (small DNA(bluestrand), ribosomes

Video: MitochondrialFusionand Fission (d

E X P E R I M E N TFA L U RtE2 - 7 M i t o c h o n d r iuan d e r g o IG rapidfusionand fissionin living cells.Mitochondria labeled with a fluorescent proteinin a livingnormalmurineemoryontc fibroblast wereobserved usingtime-lapse fluorescence microscopy Several mitochondria undergoing fusion(top)or (bottom)areartificially jn blueandwith fission highllghted arrowslModified fromD C Chan, 2006,Cell125(])j241-12521

486

c H A P T E R1 2

|

CELLULAE RN E R G E T T C S

(largeyellowspheres) (b)Computerbluespheres), andgranules generated modelof a section of a mitochondrion fromchicken brain. Thismodelisbased on a three-dimensional electron microscopic image calculated froma series of two-dimensional electron micrographs recorded at regularintervals Thistechnique isanalogous to a threedimensional x-raytomogram or CATscanusedin medical imaging (yellow-green), Notethetightlypacked cristae the innermembrane (lightblue),andtheoutermembrane (darkblue)[part(a)courtesy of T. Frey;part (b) from T. Freyand C Mannella,2000, TrendsBiochem Sci 25:319l

invaginationscalled cristae (seeFigure 12-6). These membranes topologically define two submitochondrial compartments: the intermembrane space, between the outer and inner membranes,and the matrix, or central compartment, which forms the lumen within the inner membrane.'When individual mitochondria fuse, each of their distinct comparrments intermixes (e.g.,matrix with matrix, inner membrane with inner membrane). Fractionation and purification of these membranes and compartments have made it possible to determine their protein, DNA, and phospholipid compositions and to localize each enzyme-catalyzedreaction to a specific membrane or comparrment. About 1000 polypeptides are required to make and maintain mitochondria and permit them to function. Only a small number of these-13 in humans-are encoded by mitochondrial DNA genes, while the remaining proteins are encoded by nuclear genes ( C h a p t e r6 ) . The most abundant protein in the outer membrane is mitochondrial porin, a transmembrane channel protein similar in structure to bacterial porins (seeFigure 10-1S). Ions and most small molecules(up to about 5000 Da) can

readily pass through these channel proteins when they are open. Although there may be metabolic regulation of the opening of mitochondrial porins and thus the flow of metabolites across the outer membrane, the inner membrane with its cristae are the major permeability barriers between the cytosol and the mitochondrial matrix, limiting the rate of mitochondrial oxidation. Protein constitutes 76 percent of the total weight of the inner membrane-a higher fraction than in any other cellular membrane. Many of these proteins are key participants in cellular respiration. They include ATP synthase, proteins responsiblefor electron transport, and a wide variety of transport proteins that permit the movement of metabolites between the cytosol and the mitochondrial matrix. The human genomeencodes48 membersof a family of mitochondrial transport proteins. One of these is called the ADP/ATP carrier, an antiporter that moves newly synthesizedATP out of the matrix and into the inner membrane space(and subsequentlythe cytosol) in ex'!flithout this changefor ADP originating from the cytosol. essential antiporter, the energy trapped in the chemical bonds in mitochondrial ATP would not be availableto the rest of the cell. The invaginating cristae greatly expand the surface area of the inner mitochondrial membrane (see Figure 12-6), enhancing its capacity to generateATP. In typical liver mitochondria, for example,the area of the inner membrane, including cristae, is about five times that of the outer membrane. In fact, the total area of all inner mitochondrial membranes in liver cells is about 1,7 times that of the plasma membrane. The mitochondria in heart and skeletal muscles contain three times as many cristae as are found in typical liver mitochondria-presumably reflecting the greater demand for AIP by muscle cells. Note that plants have mitochondria and perform cellular respiration as well. In plants, stored carbohydrates,mostly in the form of starch, are hydrolyzed to glucose.Glycolysis then produces pyruvate, which is transported into mitochondria, as in animal cells. Mitochondrial oxidation of pyruvate and concomitant formation of ATP occur in photosynthetic cells during dark periods when photosynthesisis not possible and in roots and other nonphotosynthetic tissuesat all times. The mitochondrial inner membrane, cristae, and matrix are the sites of most reactions involving the oxidation of pyruvate and fatty acids to CO2 and H2O and the coupled synthesisof ATP from ADP and P1, with each reaction occurring in a discretemembrane or spacein the mitochondrion (Figure12-8). The last three of the four stagesof glucoseoxidation are r StageII. Conversionof pyruvate to acetyl CoA, followed by oxidation to CO2 in the citric acid cycle.Theseoxidations are coupled to reduction of NAD* to NADH and of FAD to FADH2. (Fatty acid oxidation follows a similar route, with conversion of fatty acyl CoA to acetyl CoA.) Most of the reactionsoccur in or on the membrane facing the matrIX.

r StageIII. Electron transfer from NADH and FADH2 to 02 via an electron transport chain within the inner membrane, which generatesa proton-motive force acrossthat membrane. r StageIV. Harnessingthe energy of the proton-motive force for ATP synthesisin the mitochondrial inner membrane. StagesIII and IV are together called oxidative phosphorylation.

In Stagell, Pyruvatels Oxidizedto CO2 and High-EnergyElectronsStored in ReducedCoenzymes Pyruvate formed during glycolysis in stage I in the cytosol is transportedinto the mitochondrial matrix (Figure 12-8). StageII metabolism accomplishesthree things: (1) it converts the 3-carbon pyruvate to three moleculesof CO1' Q) it generates high-energy electron carriers (NADH and FADH2) that will be used for electrontransport (stageIII); and (3) it generatesa GTP molecule, which is then converted to ATP: GTP + ADP i-

GDP + AIP

StageII can be subdivided into two distinct parts: (1) the generationof acetyl CoA plus one molecule of COz and one NADH and (2\ the conversion of acetyl CoA to two molecules of CO2 and the high-energy intermediatesNADH (3 molecules),FADH2, and GTP. Generation of Acetyl CoA \il/ithin the mitochondrial matrix, pyruvate reactswith coenzymeA, forming CO2 and acetyl CoA and NADH (Figure 12-8). This reaction, catalyzedby pyruuate - 8.0 kcaUmol)and dehydrogena.sais highly exergonic(AG"' : essentiallyirreversible. Acetyl CoA (Figure 1'2-9) plays a central role in the oxidation of fatty acids and amino acids.In addition, it is an intermediate in numerous biosynthetic reactions' including transfer of an acetyl group to histone proteins and many mammalian proteins, and synthesisof lipids such as cholesterol. In respiring mitochondria, however' the acetyl group of acetyl CoA is almost always oxidized to CO2 via the citric acid cycle. Citric Acid Cycle Nine sequentialreactions operate in a cycle to oxidize acetyl CoA to CO2. The cycle is referred to by severalnames:the citric acid cycle, the tricarboxylic acid (or TCA) cycle, and the Krebs cycle. The net result is that for each acetyl group entering the cycle as acetyl CoA, two moleculesof CO2, three of NADH' and one each of FADH2 and GTP are produced. As shown in Figure 12-1'0,the cycle begins with condensation of the two-carbon acetyl group from acetyl CoA with the four-carbon molecule oxaloacetate to yield the six-carboncitric acid (hencethe name citric acid cycle).In both reactions 4 and 5, a CO2 molecule is releasedand NAD+ is reduced to NADH. Reduction of NAD- to NADH also occurs during reaction 9; thus three NADHs

: L Y C O L Y S IASN D T H E C I T R I CA C I D C Y C L E F T R SS T T E p SO F G L U C o 5 EA N D F A T T YA C I D C A T A B O L I S MG

487

Outer mitochondrial membrane {permeable to metabolites)

coz

Intermembrane space

StageI Glucose

2 NAD*-J I 2 NADH.f" z efP J 2 Pyruvate -

Pyruvate

-----?2COt

Acetyl CoA

C i t r i ca c i d cycre

Mitochondrlal matrix

Succinate

2 e- + 2H* + !Or---+ Hrg Fumarate

Qz

Hzo

FoF,complex

A FIGURE 12-8 Summaryof aerobicoxidationof glucoseand fatty acids.Stagel: Inthecytosol, glucose isconverted to pyruvate (glycolysis) andfattyacidto fattyarylCoA hTruvate andfattyacylCoA thenmoveintothemitochondrion Mitochondrial porins maketheouter membrane permeable to thesemetabolites, butspecific rranspon (colored proteins ovals) in theinnermembrane arerequired to import pyruvate (yellow) andfattyacids(blue)intothematrixFattyacyl groupsaretransferred fromfattyarylCoAto an intermediate carriel transported across (blueoval),andthenreattached the innermembrane to CoAon thematrixsideStagell: Inthemitochondrial matrix, pyruvate andfattyacylCoAareconverted to acetylCoAandthen oxidized, releasing CO2Pyruvate isconverted to acetylCoAwiththe formation of NADHandCOr;two carbons fromfattyacylCoAare convefted to acetylCoAwiththeformation of FADH,andNADH Oxidation of acetylCoAin thecitricacidcycleqenerates NADHand

FADH2, GTBandCO2.Stagelll: Electron transport reduces oxygen to waterandgenerates (blue)from a proton-motive force.Electrons reduced coenzymes aretransferred viaelectron-transport complexes (blueboxes) to 02 concomitant withtransport of H* ions(red)fromthe matrixto theintermembrane generating space, theproton-motive force Electrons fromNADHflowdirectly fromcomplex I to complex lll, bypassing complex ll Electrons fromFADH, flowdirectly fromcomplex ll to complex lll,bypassing complex I StagelV:ATPsynthase, the FoFl (orange), complex harnesses the proton-motive forceto synthesize ATp (purpleandgreenovals) rnthematrix,Antiporter proteins transport ADp andP;intothematrixandexporlhydroxyl groupsandATpNADH generated in thecytosol isnottransported directly to thematnxoecause theinnermembrane rsimpermeable to NAD+andNADH;instead, a (red)transports shuttlesystem electrons fromcytosolic NADHto NAD+in the matrix02 diffuses intothematrix,andCOrdiffuses our

are generatedper turn of the cycle.In reaction 7, two electrons and two protons are transferredto FAD, yielding the reducedform of this coenzyme,FADH2. Reaction 7 is distinctive becauseit not only is an intrinsic part of the citric acid cycle (stageII), but also it is caralyzedty a membrane-

attached enzyme that is an intrinsic part of the electron transport chain (stageIII). In reaction 6, hydrolysis of the high-energythioester bond in succinyl CoA is coupled to synthesisof one GTP by subsrrate-levelphosphorylation. (BecauseGTP and ATP are interconvertible,this can be

Coenzyme A (CoA) a F I G U R E l 2 ' 9T h e s t r u c t u r e o fa c e t y lC o A . T h j s c o m p o u n d i s an importantintermediatein the aerobicoxidationof pyruvate,fatty

488

c H A P T E R1 2

|

CELLULAE RN E R G E T T C S

a c i d s , a n d m a n y a m i n o a c il d t asl.s o c o n t r i b u t e s a c eg tr yolu p s i n many biosynthetic pathways

N A D H+ H HrO

coo I nu

tc-coo

HO-C-H

tl HC I

I

V /

QH, t-

coo-

iaa

vvv

crs-Aconitate

Malate

I Hro\tl

coo-

coo.1.,, UN

I CH"

t-

coo-

HC

I coo-

Z

Fumarate

//

,r Y

FADH,

t-

CH, I'

QH,

lC H "= FA

c:o I coo-

t-' coo

Succinate

H-C-COO

I nu

cooI

GDP + Pi + H2O

GTP + HSCoA

t

I

E

HO-C-H

/l

coolsocitrate

4-Keto-

glutarate C O r + N A D H+ H '

+ N A D H+ H -

12-10The citricacidcycle.AcetylCoAis metabolized a FIGURE In NADHandFADH2. electron carriers to C02andthe high-energy fromacetylCoAcondenses acetylresidue 1, a two-carbon reaction to formthe six-carbon molecule oxaloacetate with the four-carbon (2-9)eachmolecule of citrate reactions citrate.In the remaining losingtwo C02 backto oxaloacetate, converted iseventually In eachturn of the cycle,four pairsof in the process. molecules fromcarbonatoms,forminqthreemolecules areremoved electrons

of GTP andonemolecule of FADH2, of NADH,onemolecule Thetwo carbonatomsthatenterthe cyclewith acetylCoAare y lo A I n s u c c t n aat en d h i g h l i g h t ei ndb l u et h r o u g hs u c c i n C theycanno longer molecules, whicharesymmetric fumarate, haveshownthat studies lsotope-labeling denoted. be specifically thesecarbonatomsarenot lostin theturn of the cyclein which onewill be lostasC02duringthe next theyenter;on average, turns. the otherin subsequent and turn of the cycle

consideredan ATP-generatingstep.) Reaction 9 regenerates oxaloacetate,so the cycle can begin again. Note that molecular 02 does not participatein the citric acid cycle. Most enzymesand small moleculesinvolved in the citric acid cycle are soluble in the aqueousmitochondrial matrix. Theseinclude CoA, acetylCoA, succinylCoA, NAD*, and NADH, as well as most of the eight cycle enzymes. Succinate dehydrogenase(reaction 7), however, is a component of an integral membraneprotein in the inner membrane,with its active site facing the matrix. When mitochondria are disrupted by gentle ultrasonic vibration or osmotic lysis, non-membrane-boundenzymesin the citric acid cycle are releasedas very large multiprotein complexes.Within such complexes the reaction product of one enzyme is thought to pass directly to the next enzymewithout diffusing through the solution. However,much work is neededto determine the structuresof these large enzyme complexes as they exist in the cell. Since glycolysis of one glucose molecule generatestwo acetyl CoA molecules, the reactions in the glycolytic pathway and citric acid cycle produce six CO2 molecules, 10 NADH molecules, and two FADH2 molecules per glucose molecule(Table 12-1). Although thesereactionsalso generate four high-energyphosphoanhydridebonds in the form of

two ATP and two GTP molecules' this represents only a small fraction of the available energy releasedin the complete aerobic oxidation of glucose.The remaining energy is itored as high-energy electrons in the reduced coenzymes NADH and FADH2. The goal of stagesIII and IV is to recover this energy in the form of ATP.

T r a n s p o r t e risn t h e I n n e r M i t o c h o n d r i a l MembraneHelp Maintain AppropriateCytosolic and Matrix Concentrationsof NAD* and NADH In the cytosol NAD+ is required for step 6 of glycolysis (see Figure 12-3), and in the mitochondrial matrix NAD+ is reqrri..d for conversion of pyruvate to acetyl CoA and for th... tt.pt in the citric acid cycle (4, 5, and 9 in Figure 12-

FADH2 to FAD as it reduces02 to water and converts the energy stored in the high-energy electrons in the reduced

: L Y C O L Y S IASN D T H E C I T R I CA C I D C Y C L E A N D F A T T YA C I D C A T A B O L I S MG F I R S Ts T E P SO F G L U C O S E

489

c02M0ltcljlts PBODUCED

fltAcTt0N

NAD+ Ml)LECULES FAD M{]TECULES REOUCED TONADH REDUCED T0tADH2

(OR ATP GTP)

L glucose molecule to 2 pyruvate molecules

0

2

0

z

2 pyruvates to 2 acetyl CoA molecules

a L

z

0

0

2 acetyl CoA to 4 CO2 molecules

4

t)

z

2

Total

5

10

2

+

forms of these molecules into a proton-motive force. Even though 02 is not involved in any reaction of the citric acid cycle, in the absenceof 02, this cycle soon stops operating as the intramitochondrial suppliesof NAD* and FAD dwindle due to the inability of the electron transport chain to oxidize NADH and FADH2. These observations raise the question of how a supply of NAD+ in the cytosol is regenerated. If the NADH from the cytosol could move into the mitochondrial matrix and be oxidized by the electron transport chain and if the NAD+ product could be transported back into the cytosol, regenerationof cytosolic NAD+ would be

Cytosol

,

simple. However, the inner mitochondrial membrane is impermeableto NADH. To bypassthis problem and permit the electrons from cytosolic NADH to be transfer red indirectly to 02 via the electron transport chain, cells use severalelectron shuttles to transfer electrons from cytosolic NADH to NAD+ in the matrix. Operation of the most widespreadshuttle-the malate-aspartateshwttle-is depicted in Figure 12-11. For every complete "turn" of the cycle,there is no overall change in the numbers of NADH and NAD* moleculesor the intermediatesaspartateor malate used by the shuttle.However, in the cytosol, NADH is oxidized to NAD+, which can be used

NADHcytosot NAD*cytosol

oxaroacetate \E/

Aspartate

, t",.,"

( \ - K e t olgu t a r a t eG l u t a m a t e Gluta

Mitochondrial inner membrane Glutamate

_->-_)

r r - K e t o g l u t ar a t e G l u t a m a t e

I Aspartate

\q/

FIGURE 12-11The malateshuttle.Thiscyclical series of reactions transfers electrons fromNADHin thecytosol (intermembrane space) a c r o stsh e i n n e rm i t o c h o n d r m i ael m b r a n w e ,h i c hi s i m p e r m e a b l e to NADHitself,to NAD* in the matrixThenet resultisthe replacement of cytosolic NADHwith NAD+and matrixNAD+ with NADHStepll: Cytosolic malatedehydrogenase transfers electrons fromcytosolic NADHto oxaloacetate, formingmalate. S t e pf , l : A n a n t i p o r t e( b r l u eo v a l )i n t h e i n n e rm i t o c h o n d r i a l m e m b r a nter a n s p o r m t sa l a t ei n t ot h e m a t r i xi n e x c h a n gf e or cr-ketogIutarate. StepS: MitochondriaI malatedehydrogenase converts malatebackto oxaloacetate, reducing NAD+in the matrix to NADHin the processStepE: Oxaloacetate. whichcannot CHAPTER 12

I

CELLULAR ENERGETICS

,,"nuY,1ll';,"."',

Oxaloacetate €-----------

Matrix

490

o - K e t o gI u t ar a t e

/E\

Malare

NADHmatrix NAD*m"tri"

directly crossthe innermembrane, isconverted to aspartate by additionof an aminogroupfromglutamateInthistransaminasecatalyzed reaction in the matrix,glutamate is converted to cr-ketoglutarate (redoval)exports Step[: A secondantrporter aspartate to the cytosolin exchange for [email protected]: A cytosoltc transamrnase converts aspartate to oxaloacetate and ct-ketoglutarate to glutamate, completing the cycleTheblue arrowsreflectthe movement of the cr-ketoglutarate, the red arrowsthe movement of glutamate, andthe blackarrowsthat of aspartate/malate lt is noteworthy that,asaspartate and malatecycleclockwise, glutamate andcr-ketoglutarate cyclein the oppositedirection

for glycolysis,and in the matrix, NAD* is reducedto NADH, which can be usedto generateATP via stagesIII and IV * NADH-.1'1" NADH.yrorot + NAD;".. * --+NAD.*y,oro1

MitochondrialOxidation of Fatty Acids GeneratesATP

o R-C

Up to now, we have focusedmainly on the oxidation of carbohydrates,namely glucose,for ATP generation.Fatty acids are another important source of cellular energy. Cells can take up either glucose or fatty acids from the extracellular spacewith the help of specifictransporter proteins (Chapter 11). Should a cell not needto immediatelyburn thesemolecules,it can store them as a polymer of glucosecalled glycogen (especiallyin muscleor liver) or as a trimer of fatty acids covalently linked to glycerol, called a triacylglycerol or triglyceride. In some cells, excessglucose is converted into fatty acids and then triacylglycerols for storage. However, unlike microorganisms, animals are unable to convert fatty acids to glucose.lWhen the cells need to burn these energy storesto make ATP (e.g.,when a resting muscle beginsto do work), enzymesbreak down glycogen to glucose or hydrolyze triacylglycerols to fatty acids, which are then oxidized to generateATP:

o cH3-(CH2)"-C- O-CH2 ^l

YI

* 3 Hro +

cH3-(cH2),-c-o-cH

oxidation. The differenceslie in the cytosolic stageI and the first part of the mitochondrial stageII. In stageI, fatty acids are convertedto a fatty acyl CoA in the cytosol in a reaction coupled to the hydrolysis of ATP to AMP and PPl (inorganic pyrophosphate)(seeFigure 12-8):

O- + HSCoA + ATP ------->

Fatty acid

o R-C-SCOA+AMP+PPI Fatty acyl CoA

Subsequenthydrolysis of PP1to two molecules of P; drives this reaction to completion. To transfer the fatty acyl group into the mitochondrial matrix, it is covalently transferred to a molecule called carnitine, moved across the inner mitochondrial membrane by an acylcarnitine transporter protein (seeFigure 12-8' blue oval), and then on th; matrix side, the fatty acyl group is released from carnitine and reattached to another CoA molecule' The activity of the acyl carnitine transporter is regulated to prevent oxidation of fatty acids when cells have adequate energy (ATP) supPlies. In the first part of stage II' each molecule of a fatty acyl CoA in the mitochondrion is oxidized in a cyclical sequence of four reactionsin which all the carbon atoms are converted two at a time to acetyl CoA with generation of FADH2 and NADH (Figure 1,2-1'2a).For example, mitochondrial oxidation of each molecule of the 18-carbon stearic acid'

?l

cH3- (cH2)"-c-o-cH2

HO-CH2

Triacylglycerol O

HO-CH

l

3 CH3-(CH2)"-C-OH + HO-CH2 Fatty acid

GlYcerol

Fatty acidsare the major energysourcefor many tissues, particularly adult heart muscle.In humans,in fact, the oxidation of fats is quantitatively more important than the oxidation of glucose as a source of ATP. The oxidation of 1 g of triacylglyceride to CO2 generatesabout six times as much AIP as does the oxidation of 1 g of hydrated glycogen. Thus triglycerides are more efficient than carbohydrates for storage of energy,in part becausethey are stored in anhydrous form and can yield more energy when oxidized and also becausethey are intrinsically more reduced (have more hydrogens)than carbohydrates.In mammals, the primary site of storageof triacylglyceridesis fat (adipose)tissue,whereasthe primary sitesfor glycogenstorage are muscle and the liver. Just as there are four stagesin the oxidation of glucose, there are four stagesin the oxidation of fatty acids.To optimize the efficiency of ATP generation,part of stageII (citric acid cycle oxidation of acetyl CoA) and all of stagesIII and IV of fatty acid oxidation are identical to those of glucose

section, the reduced NADH and FADH2 with their highenergyelectronsfrom stageII will be used in stageIII to generct; a proton-motive force that in turn is used in stageIV to power ATP synthesis.

PeroxisomalOxidation of Fatty Acids GeneratesNo ATP Mitochondrial oxidation of fatty acids is the major sourceof ATP in mammalian liver cells, and biochemistsat one time believedthis was true in all cell types. However, rats treated with clofibrate, a drug that affectsmany featuresof lipid metabolism, were found to exhibit an increasedrate of fatty acid oxidation and a large increasein the number of peroxisomes in their liver cells.This finding suggestedthat peroxisomes'as well as mitochondri a, can oxidize fatty acids' These small or-

carbonsin the fatty acyl chain, or (Cs)' medium-(C3-Crz),

: L Y C O L Y S IASN D T H E C I T R I CA C I D C Y C L E F I R S TS T E P SO F G L U C O s EA N D F A T T YA C I D C A T A B O L I S MG

491

> FIGURE12-12 Oxidation of fatty acids in mitochondria and peroxisomes.In both mitochondrial oxidation(a)and peroxisomal oxidation(b),fatty acidsare convertedto acetylCoA by a seriesof four enzyme-catalyzed reactions(showndown the centerof the fioure) A fatty acylCoA moleculeis convertedto u..tyl CoA and a fatty acylCoA shortenedby two carbonatoms Concomitantly, one FADmolecule is reducedto FADH2and one NAD* molecule is reducedto NADH The cycleis repeatedon the shortenedacylCoA untilfatty acidswith an evennumberof carbonatomsare completelv converted to acetylCoA In mitochondrra, electrons from FADH2and NADHenterthe electrontransport chainand ultimately are usedto generateATp;the acetylCoA generatedisoxidizedrn the citricacid cycle,resulting in release of CO2and ultimately the synthesis of additionalATP Becauseperoxisomes lackthe electrontransportcomplexescomposlng the electrontransportchainand the enzymesof the citricacidcycle,oxidationof fatty acidsin these organellesyieldsno ATPlAdapted fromD L Netson principlesof andl\,4M Cox,Lehninger Biochemistry,3d ed , 2000,WorthPublishers l

( a ) M I T O C H O N D R I AOLX t D A T | O N (b)PEROXTSOMAL OXtDATION

o R- CH2-CH2-CHr-C-SCoA Fatty acyl CoA

o

H r O+ ' t / z O ,

il

R- CH2-CH: CH-C-SCoA

HrO

NADH exportedfor reoxidation

R-CHr-C-SCoA I

o

Acyl CoA shortened by two carbon atoms +

o Citricacid +cycre

l

H3C-C-SCoA Acetyl CoA

Acetyl CoA exported

stead it is transported into the cytosol for use in the synthesis of cholesterol(Chapter10) and other metabolites.

oxidation of fatty acids, which is coupled to generation of ATP, peroxisomal oxidation of fatty acids is not linked to ATP formation, and energy is releasedas heat. The reaction pathway by which fatty acids are degraded to acetyl CoA in peroxisomesis similar to that used in mito_

dases, peroxisomes contain abundant catalase, which quickly decomposesthe H2O2, a highly cytotoxic metabo_ lite. NADH produced during oxidation of fatty acids is exported and reoxidized in the cytosol; there is no need for a malate/aspartateshuttle here. peroxisomesalso lack the cit_ ric acid cycle, so acetyl CoA generatedduring peroxisomal degradation of fatty acids cannot be oxidized further: in492

c H A P T E R1 2

|

cELLULAR ENERGETTCS

First Steps of Glucoseand Fatty Acid Catabolism: Glycolysisand the Citric Acid Cycle r In a processknown as aerobicoxidation, cellsconvert the energy releasedby the oxidation ("burning") of glucoseor fatty acidsinto the terminal phosphoanhydridebond of ATp. r The complete aerobic oxidation of each molecule of glucoseproduces six moleculesof CO2 and approximately 30 ATP molecules.The entire process,which starts in the cytosol and moves into the mitochondrion, can be divided into four stages:(I) glycolysis to pyruvate in the cytosol, (II) pyruvate oxidation to C02 in the mitochondrion. (III) electron transport to generatea proton-motive force together with conversion of molecular oxygen to wate! and (IV) ATP synthesis. r The mitochondrion hastwo distinctmembranes(outerand inner) and two distinct subcompartments(intermembrane

space between the two membranesand the matrix surrounded by the inner membrane).Aerobic oxidation occurs in the mitochondrial matrix and on the inner mitochondrial membrane. r Each turn of the citric acid cycle releasestwo molecules of CO2 and generatesthree NADH molecules,one FADH2 molecule. and one GTP. r In glycolysis (stageI), cytosolic enzymesconvert glucose to two moleculesof pyruvate and generatetwo molecules each of NADH and ATP. r The rate of glucoseoxidation via glycolysisand the citric acid cycle is regulated by the inhibition or stimulation of severalenzymes,dependingon the cell'sneed for ATP. Glucoseis stored (asglycogenor fat) when ATP is abundant. r Some of the energy releasedin the early stagesof oxidation is temporarily stored in the reducedcoenzymesNADH or FADH2, which carry high-energy electrons that subsequently drive the electron transport chain (stageIII). r In the absenceof oxygen (anaerobicconditions),cellscan metabolize pyruvate to lactate or (in the case of yeast) to ethanol and CO2, in the processconvertingNADH back to NAD*, which is necessaryfor continued glycolysis.In aerobic conditions (presenceof oxygen),pyruvate is transported into the mitochondrion, where stagesII through IV occur.

chain, also known as the respiratorychain into the protonmotive force.'We first describethe logic and componentsof the electron transport chain and the pumping of protons acrossthe mitochondrial inner membrane.'Weconcludethe sectionwith a discussion of the magnitude of the proton-motive force produced by electron transport and proton pumping. In the following section,we describestageIV, focusing on the structure of the AIP synthaseand how it usesthe proton-motive force to synthesizeATP.

StepwiseElectronTransportEfficientlyReleases t h e E n e r g yS t o r e di n N A D Ha n d F A D H 2 During electron transport' electrons are released from NADH and FADH2 and eventually transferred to 02, forming H2O according to the following overall reactions: NADH + H+ + 1/z02 --+ NAD* + H2O, LG: -52'6 kcal/mol FADH2 -r 1/z02 --+ FAD + H2O, L'G : -43.4 kcal/mol Recall that the conversion of 1 glucosemolecule to CO2 via the glycolytic pathway and citric acid cycle yields 10 NADH and-2 FADH2 molecules (seeTable 12-1). Oxidation of -613 kcal/mol thesereducedcoenzymeshas a total AGo'of

r In stage II, the three-carbon pyruvate molecule is first oxidized to generateone moleculeeach of CO2, NADH' and acetyl CoA. The acetyl CoA is then oxidized to CO2 by the citric acid cycle. r Neither glycolysis(stageI) nor the citric acid cycle (stage II) directly use molecularoxygen (02). r The malate/aspartateshuttle regeneratesthe supply of for continuedglycolysis. cytosolicNAD* necessary r Like glucoseoxidation, the oxidation of fatty acids takes place in four stages.In stageI, fatty acids are converted to fatty acyl CoA in the cytosol. In stageII, the fatty acyl CoA is first converted into multiple acetyl CoA moleculeswith generationof NADH and FADH2. Then, as in glucoseoxidation, the acetyl CoA entersthe citric acid cycle. StagesIII and IV are identical for fatty acid and glucoseoxidation. r In most eukaryotic cells, oxidation of short- to longchain fatty acids occurs in mitochondria with production of ATR whereas oxidation of very long chain fatty acids occurs primarily in peroxisomes and is not linked to ATP production; the releasedenergy is converted to heat.

Slfl The ElectronTransportchain and Generationof the Proton-MotiveForce Most of the energy releasedduring the oxidation of glucose and fatty acidsto CO2 (stagesI and II) is convertedinto highenergyelectronsin the reducedcoenzymesNADH and FADH2. \7e now turn to stageIII, in which the energytransiently stored in the coenzymesis converted by an electron transport

duction of FAD, which requires lessenergy. The energy carried in the reduced coenzymescan be released by oxidizing them. The biochemical challengefaced by the mitochondrion is to transfer,as efficiently as possible' the energy releasedby this oxidation into the energy in the terminal phosphoanhydridebond in ATP. P,t- * H* + ADP3- -+ATPa- + H2o, L,G : +7.3 kcal/mol A relatively simple one-to-onereaction in which reduction of one coenzyme molecule and synthesis of one ATP occurs would be terribly inefficient, becausethe AG'' for ATP generation from ADP and P1is substantially less than for the coenzymeoxidation and much energywould be lost as heat' To efficiently recover the energ5 the mitochondrion first converts the energy of coenzyme oxidation into a protonmotive force using a seriesof electron carriers' all but one of which are integral components of the inner membrane'

ElectronTransportin Mitochondrials Coupled t o P r o t o nP u m P i n g At severalsites during electron transport from NADH and FADH2 to C,2,protons from the mitochondrial matrix are 493

THEELECTRoNTRANSPORTcHA|NANDGENERAT|oNoFTHEPRoToN-MoT|VEFoRcE

pH electrode

O, solution

c

60

o

8= 40 +P

.=-

20

a)

(J n

0 Mitochondrion EXPERIMENTAL FIGURE 12-13Electrontransferfrom NADH to 02 is coupledto proton transportacrossthe mitochondrial membrane.lf NADHisaddedto a suspension of mitochondria depleted of 02, no NADHisoxidizedWhena smallamountof O, is (arrow), addedto thesystem thereisa sharprisein theconcentration of protonsin thesurrounding mediumoutside the mitochondria pumped acrossthe inner membrane;this generares proton concentration and electricalgradientsacrossthe inner membrane (seeFigure 12-2). This pumping causesthe pH of the mitochondrial matrix to becomehigher (i.e.,the H+ concentration is lower) than that of the intermembranespaceand cytosol.An electricpotential acrossthe inner membranealso resultsfrom the pumping of H* outward from the matrix, which becomes negative with respect to the intermembrane space.Thus free energy releasedduring the oxidation of NADH or FADH2 is storedboth as an electricpotential and a proton concentrarion gradient-collectivelS the proton-motive force-across the

major source of ATP in aerobic nonphotosyntheticcells. Much evidenceshows that in mitochondria and bacteriathis processof oxidative phosphorylation dependson generarion of a proton-motive force acrossthe inner membrane (mitochondria) or bacterial plasma membrane, with electron transport, proton pumping, and ATp formation occurring simultaneously.In the laboratory, for instance, addition o] 02 and an oxidizable substratesuch as pyruvate or succinare to isolated intact mitochondria results in a net synthesisof ATP if the inner mitochondrial membrane is intact. In the presence of minute amounts of detergents that make the membrane leaky, electron transport and the oxidation of these metabolites by 02 still occurs. However, under these conditions no ATP is made, becausethe proton leak prevents the maintenance of the transmembrane proton concentration gradientand the membraneelectricporential. The coupling between elecrron transporr from NADH (or FADH2) to 02 and proron rransporr aiross the inner mitochondrial membrane can be demonstrutedexperimentally 494

.

cHAprE1 R2 I c E L L U L AER NERGETtcs

60 120 180 E l a p s etdi m e( s )

240

300

(decrease in pH) Thustheoxidation of NADHby 02 iscoupled to the movement of protons out of the matrixOncethe 02 isdepleted, the protons excess slowlymovebackintothe mitochondria (powering the synthesis of ATP)andthe pHof the extracellular mediumreturns t o i t si n i t i avl a l u e .

with isolated, intact mitochondria (Figure 12-13). As soon as 02 is addedto a suspensionof mitochondria in an otherwise O2-free solution that contains NADH, the medium outside the mitochondria transiently becomesmore acidic (increasedproton concentration), becausethe mitochondrial outer membrane is freely permeableto protons. (Remember that malate/aspartateand other shuttles can convert the NADH in the solution into NADH in the matrix.) Once the 02 is depleted by its reduction, the excessprotons in the medium slowly leak back into the matrix. From analysisof the measuredpH changein such experiments,one can calculate that about 10 protons are transported out of the matrix for every electron pair transferred from NADH to 02. To obtain numbers for FADH2, the above experiment can be repeated,but with succinateinsteadof NADH as the substrate. (Recall that oxidation of succinateto fumarate in the citric acid cycle generatesFADH2; see Figure 12-10). The amount of succinateaddedcan be adiustedso that the amount of FADH2 generatedis equivalentto the amount of NADH in the first experiment. As in the first experiment, addition of oxygen causes the medium outside the mitochondria to becomeacidic, but lessso rhan with NADH. This is not surprising becauseelectronsin FADH2 havelesspotential energy (43.4 kcal/mol) than electrons in NADH (52.6 kcal/mole). and thus it drives the translocation of fewer protons from the matrix and a smaller changein pH.

ElectronsFlow from FADH2and NADHto 02 T h r o u g hF o u rM u l t i p r o t e i nC o m p l e x e s I7e now examine more closely the energetically favored movement of electronsfrom NADH and FADH2 to the final electron acceptor,02. For simplicity, we will focus our discussion on NADH. In respiring mitochondria, each NADH molecule releasestwo electronsto the electron transDort

chain; these electrons ultimately reduce one oxygen atom (half of an 02 molecule),forming one moleculeof water: NADH--+NAD* + H* + 2e t/rOr--HrO 2e- + 2H' + As electronsmove from NADH to 02, their potential declines by 1.14 V, which correspondsto 26.2 kcal/mol of electronstransferred,or :53 kcal/mol for a pair of electrons. As noted earlier,much of this energyis conservedin the proton-motive force generatedacross the inner mitochondrial membrane. There are four large multiprotein complexesin the electron transport chain that span the inner mitochondrial membrane: NADH-CoQ reductase(complex I, >40 subunits), swccinate-CoQreductase(complex II, 4 subunits), CoQH2-cytochromec reductdse(complexIII, 11 subunits), and cytochrome c oxidase (complex IV, 13 subunits). Electrons from NADH flow from complex I to III to IV, bypassing complex II; electronsfrom FADH2 flow from complex II to III to IV, bypassingcomplex I (seeFigure 12-8). Each complex contains several prosthetic groups that participate in moving electrons.These small nonpeptide organic moleculesor metal ions are tightly and specificallyassociatedwith the multiprotein complexes(Table 12-2).

COMP()NENT PROTEIN

GROUPSPR{]STHETIC

NADH-CoQ reductase (complex I)

FMN Fe-S

Succinate-CoQreductase (complex II)

FAD Fe-S

CoQH2-cytochrome c reductase (complex III)

Heme by Heme bp1 Fe-S Heme c1

Cytochrome c

Heme c

Cytochrome c oxidase (comPlex IV)

Crru2* Heme a LutHerne a3

*-Not included is coenzyme Q, an electron carrier that is not permanently bound to a protein complex. iou*.,.' J. \Xl.De Pierre and L. Ernster, L977, Ann. Reu. Biochem' 46:201..

Heme and the Cytochromes Severaltypesof heme,an ironcontaining prostheticgroup similar to that in hemoglobin and myoglobin (Figure 12-14a\, are tightly bound (covalently or noncovalently) to a set of mitochondrial proteins called cytochromes.Each cytochrome is designatedby a letter, such as A, b, c, or c1. Electron flow through the cytochromesoccurs by oxidation and reductionof the Fe atom in the centerof the hememolecule: Fe3* + e-

.

. --> Fe2*

Becausethe heme ring in cytochromesconsistsof alternating double- and single-bondedatoms, a large number of resonance hybrid forms exist. These allow the extra electron delivered to the cytochrome to be delocalizedthroughout the heme carbon and nitrogen atoms as well as the Fe ion. The various cytochromes have slightly different heme groups and surrounding atoms (called axial ligands), which

(b)

ta) HrC:CH II

9H.

Protein

tl

CH,

l--l o2c-cH2

H,C

H2c-co2

12-14 Hemeand iron-sulfurprostheticgroupsin A FIGURE bg the electrontransportchain.(a)Hemeportionof cytochromes c reductase of CoQHz-cytochrome andbs,whicharecomponents in allhemes (complex is present ring(yellow) lll) Thesameporphyrin porphyrin ring differin the to the attached substituents Thechemical

accept chain.All hemes transport in theelectron othercytochromes (Fe-S) (b) cluster iron-sulfur Dimeric time. at a oneelectron andrelease sulfur and inorganic are two atoms: four S to is bonded Fe atom Each proteinAll Fe-S of the associated sidechains two arein cysteine at a time. oneelectron acceptandrelease clusters

O F T H E P R O T O N - M O T I VFEO R C E T R A N S P O RC T H A I NA N D G E N E R A T I O N THE ELECTRON

495

generate different environments for the Fe ion. Therefore, each cytochrome has a different reduction potential, or tendency to accept an electron-an important property dictating the unidirectional "downhill" electron flow along the chain. Just as water spontaneously flows downhill from a higher to lower potential energy state-but not uphill-so too do electronsflow in only one direction from one heme (or other prosthetic group) to another due to their differing reduction potentials. All the cytochromes, excepr cytochrome c, are componentsof integral membranemultiprotein complexesin the inner mitochondrialmembrane. fron-Sulfur Clusters lron-sulfur clustersare nonheme,ironcontaining prosrheticgroups consistingof Fe atoms bonded both to inorganicS atomsand to S atomson cysteineresiduesin a protein (Figure I2-l4b). Some Fe aroms in the cluster bear a *2 charge;othershavea *3 charge.However,the net chargeof eachFe atom is actuallybetween+2 and *3, becauseelectrons in their outermost orbitals together with the extra electron delivered via the transport chain are dispersedamong the Fe atoms and move rapidly from one atom to another.Iron-sulfur clustersacceptand releaseelecffonsone at a time. Coenzyme Q (CoQ) Coenzyme e (Coe), also called ubiquinone, is the only small-moleculeelectron carrier in the chain that is not a protein-bound prosthetic group (Figure 12-15). It is a carrier of both protons and electrons.The oxidized quinone form of CoQ can accepr a single electron to

o (coo) ubiquinone ( o x i d i z feodr m )

H3co

cH, itt (CHr-CH:C-CH2)10-H

H3CO

o I e rl

J

os e m i q u i n o n e( c o e ; ) { f r e er a d i c a l )

H3cO

CH.

H3CO

(CHr-CH:J-CH2)10-H

9H'

form a semiquinone, a charged free radical denoted by CoQ .. Addition of a secondelectronand two protons (thus a total of two hydrogen atoms) to CoQ-. forms dihydroubiquinone (CoQH2), the fully reducedform. Both Coe and CoQH2 are solublein phospholipidsand diffuse freely in the hydrophobic centerof the inner mitochondrial membrane. This is how it participatesin the electron transport chaincarrying electronsand protons betweenthe complexes. As shown in Figure 12-16, CoQ acceptselectronsreleased from NADH-CoQ reductase(complex I) or succinate-Coe reductase(complex II) and donates them to CoeH2cytochrome c reductase(complex III). Importantly, reduction and oxidation of CoQ are coupled to pumping of protons. Ifhenever CoQ acceptselectrons,it does so at a binding site on the matrix (also called the cytosolic) face of the protein complex, always picking up protons from the medium there. \Thenever CoQH2 releasesits electrons,it doesso at a srteon the intermembranespace(also called the exoplasmic)side of the protein complex, releasingprotons into the intermembrane (or exoplasmic) fluid. Thus transport of each pair of electronsby CoQ is obligatorily coupled to movement of two protons from the matrix to the intermembranespacefluid. NADH-CoQ Reductase (Complex l) Electronsare transferred from NADH to CoQ by NADH-CoQ reducrase(Figure 12-16).In bacteriathe massof this complex is about 500 kDa (-14 subunits),whereasfor the L-shapedeukaryoticcomplex it is 1 MDa (14 centraland as many as 32 accessorysubunits). NAD- is exclusively a two-electron carrier: it accepts or releasesa pair of electronssimultaneously.In NADH-Coe reductase (complex I), electronsfirst flow from NADH to FMN (flavin mononucleotide), a cofactor related to FAD, then to an iron-sulfur clusteq and finally to CoQ. FMN, like FAD, can accept two electronsbut does so one electron at a trme. Each transported electron undergoesa drop in potential of =360 mV, equivalenrto a AG'' of -16.6kcallmol for the two electrons transported. Much of this releasedenergy is used to transport four protons across the inner membrane per molecule of NADH oxidized by the complex I. Those four protons are distinct from the two protons transferredto the CoQ in the chemical reaction shown above. The overall reaction catalyzedby this complex is

U.

zut +

"-

NADH + CoQ * 6H*1. --+

t.l

J

(Reduced) (Oxidized)

NAD- * Hti. + CoeH2 + 4H+o,t

OH

(Oxidized)

Dihydroquinone 1 999H,) (fully reduced form)

H3co

cH, ?*' (CHr-CH:C-CH2)10-H

H3CO OH

A FIGURE12-15 Oxidized and reduced forms of coenzyme e (CoQ),which can carry two protons and two electrons. Because of its long hydrocarbon "tail" of isopreneunits,Coe, alsocalled ubrquinone, is solublein the hydrophobic coreof phospholipid bilayers and is verymobile.Reductionof Coe to the fully reducedform, eH2 (dihydroquinone), occursin two stepswith a half-reduced free-radical intermediate , l l e ds e m i q u i n o n e ca 496

.

c H A p r E R1 2 |

C E L L U L AERN E R G E T t c s

(Reduced)

Succinate-CoQ Reductase (Complex ll) Succinatedehydrogenase,the enzyme that oxidizes a molecule of succinate to fumaratein the citric acid cycle(and in the processgenerares the reduced coenzymeFADH2), is one of the four subunits of complex II. In this way the citric acid cycle is physically as well as functionally linked to the electron transport chain. The two electronsreleasedin conversionof succinateto fumarate are transferredfirst to FAD in succinatedehydrogenase,then to iron-sulfur clusters-regenerating FAD-and finally to Coe,

llll+ Animation:ElectronTransport

at (b) Fromsuccinate

( a ) F r o mN A D H Intermembranespace (exoplasmic) 4 H+++

zn

Exoplasmic oO

Cytosolic

4HMatrix

(cytosolic) NADH

1120+ 22H O 2H* H* H z O

zn

NAD++ H+

NADH-CoOreductase { c o m p l e xl )

CoOH2-cytochrome c reductase (complex lll)

Complex lll

Gytochrome c oxidase (complex lV)

Succinate

Fumarate+2 H*

reductase Succinate-CoO (comPlexll)

FIGURE 12-16 Multiproteincomplexesand mobileelectron (bluearrows) carriersof the electrontransportchain.Electrons (l-lV) Electron flow throughfour majormultiprotein complexes rsmediated eitherbythe lipid-soluble movement between complexes form)or reduced form;CoQHz, molecule coenzyme Q (CoQ,oxidized proteincytochrome c (cytc),Themultipleprotein thewatersoluble frompassing electrons to pump usethe energyreleased complexes protons space(redarrows) fromthe matrixto the intramembrane (a)Pathway l, flowto complex fromNADHFromNADHelectrons perpairof aretranslocated thenlllandthenlV A totalof 10 protons intothe thatflowfromNADHto O, Theprotonsreleased electrons

I are of NADHby complex matrixspaceduringoxidation lV, by complex from 02 water of in formation the consumed fromthesereactions in no netprotontranslocation resulting (via flow fromsuccinate (b)Pathway Electrons fromsuccinate released lllandthenlV Electrons ll to complex in complex FADHz) ll areused in complex to fumarate of succinate duringoxidation additional without translocating to CoQHz CoQ reduce to fromCoQHz transport of electron protons, Theremainder proceeds bythe samepathwayasfor the NADHpathwayin (a). to 02, fromsuccinate transported Thusfor everypairof electrons lV lll and complexes by protons are translocated six

which binds to a cleft on the matrix side of the transmembrane portions of complex II (Figure 72-16). The overall reaction catalyzedby this complex is

Figure 12-12).There are severalfatty acyl-CoA dehydrogenase enzymeswith specificitiesfor fatty acyl chains of different lengths.Theseenzymesmediate the initial step in a four-step processthat removestwo carbons from the fatty acyl group by oxidizing the carbon in the B position of the fatty acyl chain (thus the entire processis often referred to as B-oxidation). Thesereactionsgenerateacetyl CoA, which in turn entersthe citric acid cycle. They also generatean FADH2 intermediate and NADH. The FADH2 generated remains bound to the enzymeduring the redox reaction,as is the casefor complex II. A water-soluble protein called electron transfer flauoprotein (ETF) transfersthe high-energy electrons from the FADH2 in the acyl-CoA dehydrogenaseto electron transfer flauoprotein:ubiquinoneoxidor eductase(ETF: QO), a membraneprotein that reducesCoQ to CoQH2 in the inner membrane.This CoQH2 intermixes in the membrane with the other CoQH2 moleculesgeneratedby complexesI and II.

Succinate+ CoQ --+fumarate + CoQH2 (Reduced)

(Oxidized) (Oxidized)

(Reduced)

Although the AGo' for this reactionis negative,the released energyis insufficientfor proton pumping in addition to reduction of CoQ to form CoQH2, which then dissociates from complex II. Thus no protons are translocateddirectly acrossthe membraneby the succinate-CoQreductasecomplex, and no proton-motive force is generatedin this part of the respiratorychain. Shortly we will seehow the protons and electronsin the CoQH2 moleculesgeneratedby complex I and complex II contribute to the generationof the proton-motive force. Complex II generatesCoQH2 from succinatevia FAD/ FADH2-mediatedredox reactions.Another setof proteinsin the matrix and inner mitochondrialmembraneperformsa comparedox reactionsto generate rable setof FAD/FADH2-mediated CoQH2 from fatty acyl CoA. Fatty acyl-CoA dehydrogenase, which is a water-solubleenzyme,catalyzesthe first stepof the oxidation of fatty acyl CoA in the mitochondrial matrix (see

CoQH2-Cytochrome c Reductase(Complex lll) A CoQHz generatedeither by complex I or complex II (or ETF:QO) donates two electronsto CoQH2-cytochrome c reductase(complex III), regeneratingoxidized CoQ. Concomitantlyit releases into the intermembranespacerwo protonspreviouslypickedup on the matrix face, generatingpart of the proton-motive force

NF T H E P R O T O N - M O T I VFEO R C E T H E E L E C T R OTNR A N S P O RCTH A I NA N D G E N E R A T I OO

497

(Figure 12-16). Vithin complex III, the releasedelectronsfirst are transferredto an iron-sulfur cluster within complex III and then to cltochrome c1 or to two &-type cytochromes (by and bs, seeQ cycle below). Finally, the two electronsare transferred sequentially to two molecules of the oxidized form of cytochrome 6, a water-soluble peripheral protein that diffuses in the intermembranespace.For eachpair of electronstransferred, the overall reaction catalyzed by the CoQH2-cytochrome c reductasecomplex is CoQH2 + 2 Cytc3* *2 H+i. -+ Coe + 4 H+o,t+ 2 Cytc}+ (Reduced)

(Oxidized)

(Oxidized)

(Reduced)

The AG'' for this reaction is sufficiently negative that two protons in addition to those from CoQH2 are translocated from the mitochondrial matrix across the inner membrane for each pair of electronstransferred; this involves the proton-motive Q cycle, discussedlater. The heme protein cytochrome c and the small lipid-soluble molecule Coe play similar roles in the electron transport chain in that they both serveas mobile electron shuttles,transferring electrons(and thus energy)betweenthe complexesof the elecrronrransporr chain. Cytochrome c Oxidase (Complex lV) Cytochrome c, after being reduced by CoQH2-cytochrome c reductase(complex III), is reoxidized as it transports electrons,one at a time, to cytochrome c oxidase (complex IV) (Figure 12-16). Mitochondrial cytochrome c oxidases contain 13 different subunits, but the catalytic core of the enzyme consists of only

three subunits.The function of the remaining subunits is less well understood. Bacterial cytochrome c oxidases contain only the three catalyric subunits. Four moleculesof reduced cytochrome c bind, one at a time, to the oxidase.An electron is transferred from the heme of each cytochrome c, first to the pair of copper ions called Crr^2*,then to the heme in cytochrome a, and next to the Cub2+ and the heme in cytochrome a3 that together make up the oxygen reduction center. The electrons are finally passedto 02, the ultimate electron acceptor,yielding 4 H2O, which together with CO2 is one of the end products of the oxidation pathway. Proposed intermediatesin oxygen reduction include the peroxide anion (Ort-) and probably the hydroxyl radical iOH.), as well as unusual complexes of iron and oxygen atoms. These intermediateswould be harmful to the cell if they escaped from the reaction center, but they do so only rarely (seethe discussionof reactiveoxygen speciesbelow). During transport of four electrons through the cytochrome c oxidase complex, four protons from the matrix space are translocatedacrossthe membrane.However, the mechanism by which theseprotons are translocatedis not known. For each four electronstransferred, the overall reaction catalyzed by cytochrome c oxidase is 4 C y t c 2 * * 8 H + 1 , + 0 2 - + 4 C y t c 3 ++ 2 H z O + (Reduced)

4H+o,t

(Oxidized)

The poison cyanide, used as a chemical warfare agent, by spies to commit suicide when captured, in gas chambers to executeprisoners, and by the Nazis (Zyklon B

(a) C o m p l e xl l l d i m e r C o m p l e xl V ,-

#-

Supercomplexl/lll2llV gupspsomplexl/lll,

-

Complex I ATP synthase

-

C o m p l e xl l l d i m e r ( l l l 2 )

-

Complex lV

-

C o m p l e xl l

**-

EXPERIMENTAL FIGURE l2-17 Electrophoresis and electron microscopicimaging identifiesan electrontransportchain supercomplex containingcomplexesl, lll, and lV.(a)Membrane proteins in isolated bovineheartmitochondria weresolubilized wlth a detergent, andthe complexes andsupercomplexes wereseparated by gelelectrophoresis usingthe bluenative(BN)-PAGE method.Each blue-stained bandwithinthe gelrepresents protein the indicated complex or supercomplex, with ll12 representing a dimerof complex lll Intensity of the bluestainisapproximately proportional to theamount of complex or supercomplex present(b)Supercomplex l/lllrllV was

498

C H A P T E R1 2

I

CELLULAR ENERGETICS

extracted fromthe gel,andthe particles werenegatively stained with 1% uranylacetate andvisualized by transmission electron microscopy. lmages of 228 particles werecombined at a resolution o'f-3 4 nm to generate an averaged imageof the complex viewed fromthesidein the planeof the membrane Approximate locations of thecomplex llldimerandcomplex lV areindicated by dashed ovals; the outlineof complex I isalsoindicated by a dashed line (white).Scalebaris 10 nm. fAdapted fromE Schafer et al, 2006, ]. Biol. Chem 2A1Q2): 1537 O-1537 5 l

gas) for the mass murder of Jews and others, is toxic becauseit binds to the heme a3 in mitochondrial cytochrome c oxidase (complex IV), inhibiting cellular respiration and therefore production of ATP. Cyanide is one of many toxic small moleculesthat interfere with energy production in mitochondria. I

ReductionPotentialsof ElectronCarriersFavor ElectronFlow from NADHto 02

Electron Transport Supercomplexes Over 50 years ago Britton Chance proposed that electron transport complexes might assembleinto large supercomplexes.Doing so would bring the complexesinto closeand highly organized proximity, which might improve the speed and efficiency of the overall process.However, an alternativeview holding that the complexesbehaved as independententities diffusing freely in the inner membrane became the dominant paradigm. During the past several years, genetic, biochemical, and biophysical studies have provided very strong evidencefor the existenceof electron transport chain supercomplexes.These studies involved relatively new gel electrophoreticmethods called blue native (BN)-PAGE and colorless native (CN)-PAGE, which permit separation of very large macromolecular protein complexes, and electron microscopic analysisof their threedimensionalstructures. One such supercomplex contains one copy of complex I, a dimer of complex III (III2), and one or more copies of complex IV (Figure 1,2-1,7).The unique phospholipid cardiolipin (diphosphatidylglycerol)

is a measureof the equilibrium constant of that partial reaction. lfith the exception of the b cytochromes in the CoQH2-cytochrome c reductasecomplex, the standard reduction potential Eo' of the electron carriers in the mitochondrial respiratory chain increasessteadily from NADH to 02. For instance,for the partial reaction

Cardiolipin o

g6

+lta-o-[-o.-X-.o

do

As we saw in Chapter 2, the reduction potential E fot a partial reduction reaction

NAD* +H*

I

a-o-i-

appears to play an important role in the assembly and function of these supercomplexes.Generally not observed in other membranes of eukaryotic cells, cardiolipin has been observed to bind to integral membrane proteins of the inner membrane (e.g., complex II). Genetic and biochemical studies in yeast mutants in which cardiolipin synthesisis blocked have establishedthat cardiolipin contributes to the formation and activity of mitochondrial supercomplexes,and thus it has been called the glue that holds together the electron transport chain, though the precise mechanism remains to be defined. In addition, there is evidencethat cardiolipin may influence the inner membrane'sbinding and permeability to protons and consequentlythe proton-motive force.

+2C_

-

'NADH

-320 mV, the value of the standard reduction potential is for transfer + kcal/mol 14.8 AGo' of which is equivalentto a proceed to tends partial reaction Thus this of two electrons. toward the left, that is, toward the oxidation of NADH to NAD+. By contrast, the standard reduction potential for the partial reactron Cytochromeco*(Fe3*) + e

-

- cytochromecred(F.t*)

is +220 mV (AG"' : -5.1 kcal/mol)for transferof one electron. Thus this partial reaction tends to proceed toward the * right, that is, toward the reduction of cytochrome c (Fe3 ) to cytochrome c (Fe'-). The final reaction in the respiratory chain, the reduction of 02 to H2O 2H-

) HO< ) o

= reduced molecule

Oxidized molecule * e- -

+ 'lror+

2e- -+H2O

has a standard reduction potential of +816 mV (AG'' : -37.8 kcal/mol for transfer of two electrons),the most positive in the whole series;thus this reaction also tends to proceedtoward the right. As illustrated in Figure 12-1'8,the steady increasein Eo' values,and the correspondingdecreasein AGo' values' ofthe carriers in the electron transport chain favors the flow of electrons from NADH and FADH2 (generatedfrom succinate) to oxygen.

ExperimentU s s i n gP u r i f i e dC o m p l e x e s the Established Stoichiometryof Proton Pumping The multiprotein complexesresponsiblefor proton pumping coupled to electron transport have been identified by selectively extracting mitochondrial membranes with detergents, isolating each of the complexes in nearly pure form, and then preparing artificial phospholipid vesicles (liposomes)containing each complex. $7hen an appropriati electrondonor and electronacceptorare added to such

O F T H E P R O T O N - M O T I VFEO R C E T R A N S P O RC T HAINAND GENERATION THE ELECTRON

Redox potential tmV)

F r e ee n e r g y (kcal/mol)

60 -400 -

NADH-CoO reductase (complex l) NADH

NAD++ H+

\.v 2 e-

F u m a r a t e+ 2 H + 5U

-200

Succinate-CoO reductase(complexll) 40

H+

")

Fe-S

30

H* Cyt c.,

CoQHr-cytochrome c r e d u c t a s e( c o m p l e x l l l ) Cyt c cuu

I

20

t*

10

(complex lV)

800

2 e-

tlz Oz + 2H*

HzO

FIGURE 12-18Changesin redoxpotentialand free energy duringstepwiseflow of electronsthroughthe respiratory chain.Bluearrowsindicate electron flow;redarrows, translocation of protons across the innermitochondrial membraneElectrons pass throughthe multiprotein complexes fromthoseat a lowerreduction

potential to thosewith a higher(morepositive) (leftscale), potential with a corresponding reduction in freeenergy(rightscale)The energyreleased aselectrons flowthroughthreeof thecomplexes is sufficient to powerthe pumpingof H* ionsacross the membrane, establishing a proton-motive force

liposomes,a changein pH of the medium will occur if rhe embedded complex transporrs protons (Figure 12-19). Studies of this type indicate that NADH-Coe reductase (complex I) translocatesfour protons per pair of electrons transported, whereas cytochrome c oxidase (complex IV) t r a n s l o c a t e st w o p r o t o n s p e r e l e c t r o n p a i r t r a n s p o r t e d (or, equivalently,for every two moleculesof cytochrome c oxidized). Current evidencesuggeststhat a total of 10 protons are transportedfrom the matrix spaceacrossthe inner mitochondrial membranefor everyelectronpair that is transferredfrom NADH to 02 (seeFigure 12-1,6).Becausesuccinate-Coe reductase(complexII) doesnot transport protons and complex I is bypassedwhen the electronscome from succinatederived FADH2, only six prorons are rransported acrossthe

membrane for every electron pair that is transferred from this FADH2 to 02.

s00

c H A P T E R1 2

|

CELLULAE RN E R G E T T C S

The Q CycleIncreasesthe Numberof Protons Translocatedas ElectronsFlow Through C o m p l e xl l l Experiments such as the one depicted in Figure 12-1,9have shown that four protons are translocated across the membrane per electron pair transported from CoQH2 through CoQH2-cytochrome c reductase(complex III). Thus this complex transports two protons per electron transferred, whereas cytochrome c oxidase (complex IV) transports only one proton per electrontransferred.An evolutionarily conservedmechanism, called the Q cycle, accounts for the

(a)

-../

Phospholipid membrane

t02+ 2 Ht Hzo

(reduced)

into the intermembranespace,but one moleculeof CoQH2 is regeneratedfrom CoQ at the Q1 site (seeFigure 12-20, bottom).Thus the net result of the Q cycleis that four protons are translocatedto the intermembranespacefor every two electrons transported through the CoQH2-cytochrome c reductasecomplex and acceptedby two moleculesof cytochromec. The translocatedprotons are all derived from CoQH2, which

2Ht

lntermembrane space CoOH2 l2e I

K* Valinomycin-bound (b) Matrix

E a

q)

E -o-

GoOH2-cytochromec reductase(complex lll)

012 Elapsed time(min) FIGURE12-19 Electrontransfer from A EXPERIMENTAL reduced cytochrome c to 02 via cytochrome c oxidase (complex lV) is coupled to proton transport. The oxidasecomplexis c incorporated into liposomes with the bindingsitefor cytochrome positioned on the outersurface(a)When 02 and reducedcytochrome to 02 to form H2Oand protons c are added,electronsare transferred aretransportedfrom the insideto the mediumoutsideof the v e s i c l e sA d r u g c a l l e dv a l i n o m y c iwna s a d d e dt o t h e m e d i u mt o of H*, dissipatethe voltagegradientgeneratedby the translocation which would otherwisereducethe numberof protonsmovedacross the membrane(b) Monitoringof the medium'spH revealsa sharp drop in pH followingadditionof 02 As the reducedcytochromec and the becomesfully oxidized,protonsleakbackinto the vesicles, p H o f t h e m e d i u mr e t u r n st o i t s i n i t i avl a l u e M e a s u r e m e nst sh o w that two protonsare transportedper O atom reducedTwo electrons are neededto reduceone O atom, but cytochromec transfersonly of Cyt c'* are oxidizedfor eachO one electron;thus two molecules 1986,J Biol Chem26128254] reduced lAdaptedfrom B Reynafarleetal,

two-for-one transport of protons and electronsby complex I I I ( F i g u r e1 2 - 2 0 ) . The substratefor complex III, CoQH2, is generatedby severalenzymes,includingNADH-CoQ reductase(complex I) and succinate-CoQreductase(complex II), electron transfer flauoprotein:ubiquinone oxidoreductase(ETF:QO, during B-oxidation), and, as we shall see,by complex III itself. In one turn of the Q cycle,two moleculesof CoQH2 are oxidizedto CoQ at the Q. siteand releasea total of four protons

At Oo site: 2 CoOH2 + 2 Cyt C+ ---') ( 4 H + , z l e) 2 CoO+ 2 Cyt C+ +2 e +4 H+{outside)

(2e I At O; site: CoO + 2 e + 2 H+lmatrix -----+CoOH2 ";6sy ( 2 H ' ' 2 e \ Net O cycle (sum of reactions at Oo and O;): + CoOH2+ 2 Cyr C'+ 2 H+1661rix side) 12H*,'l t: I CoO + 2 Cyt C+ + 4 H+loutside) (2e ) t h r o u g hc o m p l e xl l l t o c y t o c h r o m ec , 4 H " P e r2 e t r a n s f e r r e d t o t h e i n t e r m e m b r a n sep a c e released A FIGURE12-20 The Q cycle.The Q cyclebeginswhen a molecule from the combinedpool of reducedCoQH, in the membranebinds to the Qo site on the intermembranespace(outel side of the portionof complexlll (steptr) There,CoQHz transmembrane space(stepEEI) and two protonsinto the intermembrane releases (stepB) One of the dissociate two electronsand the resultingCoQ protein and cytochromec1, iron-sulfur via an is transported, electrons that eachcytochromec directlyto cytochromec (stepEE) (Recall shuttlesone electronfrom complexlll to complexlV) The other b1 and bs and partiallyreduces electronmovesthroughcytochromes second,Qi, siteon the to the bound an oxidizedCoQ molecule matrix(inner)sideof the complex,forming a CoQ semiqutnone anion,Q ' (step4). The processis repeatedwith the bindingof a secondCoQH2at the Qo site(stepEt), proton release(stepEE), reductionof anothercytochromec (stepEEI),and additionof the other electronto the Q-'bound at the Qi site(stepZ) There,the additionof two protonsfrom the matrixyieldsa fully reducedCoQHz (stepsE and 9), moleculeat the Qrsite,which then dissociates (step I0) and begin freeingthe Q to bind a new moleculeof CoQ l99O, J Biol Chem B Trumpower from again the Q cycleover lAdapted BiochemSci26:4451 et al, 2001,Trends andE Darrouzet 265:11409,

NF T H E P R O T O N - M O T I VFEO R C E T H E E L E C T R OTNR A N S P O RCTH A I NA N D G E N E R A T I OO

501

obtained its protons from the matrix, as a consequenceof the reduction of CoQ catalyzedby either NADH-CoQ re, ductase (complex I) or by CoQH2-cytochrome c reductase (complex III) (seeFigure 12-16). Although seeminglycumbersome, the Q cycle optimizes the numbers of protons pumped per pair of elecrronsmoving through complex III. The Q cycle is found in all plants and animals as well as in bacteria. Its formation at a very early stageof cellular evolution was likely essentialfor the successof all life-forms as a way of convertingthe potential energyin reducedcoenzymeQ into the maximum proton-motive force acrossa membrane. How are the two electronsreleasedfrom CoQH 2 at the Qo site directed to different acceptors, either to Fe-S, cytochrome c1 and then cytochrome c (upward in Figure 1220) or to cytochrome bL, cytochrome bs, and then CoQ at the Q1 site (downward in Figure 12-20)?The answer is simple and depends on a flexible hinge in the Fe-S-containing protein subunit of complex III. Initially the Fe-Scluster is close enough to the Qo site to pick up an electron from CoQH2 bound there. Once this happens, a segment of the protein containing this Fe-Scluster swings the cluster away from the Qo site to a position near enough to the heme on cytochrome c1 for electron transfer to occur. With the Fe-S subunit in this alternate conformation, the second electron releasedfrom CoQH2 bound to the Qo site cannot move to the Fe-Scluster-it is too far away, so it takes an alternative path open to it via a somewhat less thermodynamically favored route to cytochrome 61.

The Proton-MotiveForcein Mitochondria ls Due Largelyto a Voltage GradientAcross t h e I n n e rM e m b r a n e One result of the electron transport chain is the generation of the proton-motive force (pmf), which is the sum of a transmembraneproton concentration (pH) gradient and electricpotential, or voltage, gradient. It has beenpossibleto determine experimentally the relative contribution of the two componentsto the total pmf. The relative contributions depend on the permeability of the membrane to ions other than H+. A significant voltage gradient can develop only if the membrane is poorly permeable to other cations and to anions. Otherwise, anions would leak across from the matrix to the intermembrane spacealong with the protons and prevent a voltage gradient from forming. Similarly cations leaking acrossfrom the intermembrane spaceto the matrix (exchangeof like charge) would also short-circuit voltage gradient formation. Indeed, the inner mitochondrial membrane is poorly permeablero other ions. Thus proron pumping generatesa voltage gradient that makes it energetically difficult for additional prorons ro move across becauseof charge repulsion. As a consequence,proton pumping by the electron transport chain establishesa robust voltage gradient in the context of a rather small pH gradient. Becausemitochondria are much too small to be impaled with electrodes,the electricpotential and pH gradient across the inner mitochondrial membrane cannot be determined by direct measurement. Nevertheless,it has been possible to

502

CHAPTER 12

I

CELLULAE RN E R G E T I C S

develop methods to measureindirectly these critical values. The electricpotential can be measuredby adding radioactive 42K* ions and a trace amount of valinomycin to a suspension of respiring mitochondria. Although the inner membrane is normally impermeableto K*, valinomycin is an ionophore, a small lipid-soluble molecule that selectively binds a specific ion (in this case, K*) and carries it across otherwise impermeable membranes.In the presenceof valinomycin, a2K* equilibrates across the innir membrane of isolated mitochondria in accordancewith the electric potential: the more negativethe matrix side of the membrane, the more 42K* will be attracted to and accumulatein the matrix. At equilibrium, the measuredconcentration of radioactive K+ ions in the matrix, [K6], is about 500 times greater than that in the surrounding medium, [Ko"J. Substitution of this value into the Nernst equation (Chapter 11) shows that the electricpotential E (in mV) acrossthe inner membranein respiring mitochondria is - 160 mV, with the matrix (inside) negatlve: fK'-l E : - 5 9 l o e # i : - 5 e l o g 5 0 0: - 1 6 0 m V L N o u rl

Researcherscan measurethe matrix (inside)pH by trapping pH-sensitivefluorescent dyes inside vesiclesformed from the inner mitochondrial membrane, with the matrix side of the membrane facing inward. They also can measure the pH outside of the vesicles(equivalent to the intermembrane space)and thus determine the pH gradient (ApH), which turns out to be -1 pH unit. Since a differenceof one pH unit representsa tenfold differencein H+ concentrarion, according to the Nernst equation a pH gradient of one unit across a membrane is equivalent to an electric potential of 59 mV at 20 'C. Thus, knowing the voltage and pH gradients, we can calculatethe proton-motive force, pmf, as ^ T \ - (l R q/ - 59 ApH x Ap = -p m f : v ' /H I : \t where R is the gasconstantof 1.987 call(degree.mol),7 is the temperature (in degreesKelvin), F is the Faraday constant 123,062 call(V.mol)1, and V is the transmembraneelectric potential; V and pmf are measuredin millivolts. The electric potential V acrossthe inner membraneis - 160 mV (negative inside matrix) and ApH is equivalent to :60 mV. Thus the total pmf is -220 mV, with the transmembraneelectric potential responsiblefor about 73 percentof the total.

ToxicBy-productsof ElectronTransport C a n D a m a g eC e l l s About 1-2 percent of the oxygen metabolized by aerobic organisms, rather than being converted to water, is partially reducedto the superoxideanion radical (02 ). Superoxideis unstable in aqueous biological liquids, breaking down into especially toxic hydrogen peroxide (HzOz) and then hydroxyl radicals.Theseand other reactiue

oxygen species(ROS), which contribute to what is often called cellular oxidatiue stress, can be highly toxic, because they chemically modify proteins, DNA, and unsaturated fatty acyl groups in membrane lipids, thus interfering with normal function. Indeed, ROS are purposefully generated by body defensecells (e.g.,macrophages)to kill pathogens. In humans, excessiveor inappropriate generationof ROS has been implicated in many diverse diseases,including heart failure, neurodegenerativediseases,alcohol-induced liver disease,diabetes,and aging. Although ROS can be generatedby a number of metabolic pathways, the major source of ROS appearsto be the electron transport chain, in particular mechanismscoupled to complexes I and III. The semiquinone form of ubiquinone, CoQ-. (seeFigure 72-15), an intermediateform of CoQ generatedin the Q cycle, may play a particularly important role in superoxidegeneration. To help protect against ROS toxicity, mitochondria have evolved several defensemechanisms,including the use of enzymes that inactivate superoxide first by converting it to H2O2 (Mn-containing superoxide dismutase) a n d t h e n t o H 2 O ( g l u t a t h i o n e p e r o x i d a s e ,w h i c h a l s o detoxifies the lipid hydroperoxide products formed when ROS react with unsaturated fatty acyl groups). Cardiac mitochondria also have catalase(normally only found in p e r o x i s o m e s )t o h e l p b r e a k d o w n H z O z . T h i s i s n o t s u r p r i s i n g , b e c a u s et h e m o s t o x y g e n - c o n s u m i n go r g a n i n mammals is the heart. In addition, the small molecule antioxidants c-lipoic acid and vitamin E help protect the mitochondrion from ROS. f

ElectronTransport and Generation of the Proton-Motive Force r By the end of the citric acid cycle (stageII), much of the energy originally present in the covalent bonds of glucose and fatty acids is converted into high-energy electrons in the reduced coenzymesNADH and FADH2. The energy from theseelectronsis used to generatethe proton-motive force. r In the mitochondrion, the proton-motive force is generated by coupling electron flow (from NADH and FADH2 to 02 ) to the uphill transport of protons from the matrix across the inner membrane to the intermembrane space. This processtogether with the synthesisof ATP from ADP and P1driven by the proton-motive force is called oxidative phosphorylation. r The flow of electronsfrom FADH2 and NADH to 02 is directedthrough multiprotein complexes.The four major complexesareNADH-CoQ reductase(complexI), succinate-CoQ reductase(complex II), CoQH2-cytochrome c reductase (complex III), and cytochrome c oxidase (complex IV). r Each complex contains one or more electron-carrying prostheticgroups: iron-sulfur clusters,flavins, hemegroups, and copper ions (seeTable 12-2). Cytochrome c, which contains heme, and coenzymeQ (CoQ), a lipid-soluble small

molecule,are mobile carriersthat shuttle electronsbetween the complexes. r ComplexesI, III, and IV pump protons from the matrix into the intermembrane space.Complexes I and II reduce CoQ to CoQH2, which carries protons and high-energy electrons to complex III. The heme protein cytochrome c carries electrons from complex III to complex IV, which usesthem to pump protons and reduce molecular oxygen to water. r The high-energyelectronsfrom NADH enter the electron transport chain through complex I, whereasthe high-energy electronsfrom FADH2 (derivedfrom succinatein the citric acid cycle) enter the electron transport chain through complex II. Additional electrons derived from FADH2 by the initial step of fatty acyl-CoA B-oxidation increasethe supply of CoQH 2 avallable for electron transport. r \(ithin the inner membrane, electron transport complexes assembleinto supercomplexesheld together by cardiolipin, a specialized phospholipid. Supercomplex formation may enhancethe speedand efficiency of generation of the proton-motive force. r Each electron carrier acceptsan electron or electron pair from a carrier with a lesspositive reduction potential and transfers the electron to a carrier with a more positive reduction potential. Thus the reduction potentials of electron carriers favor unidirectional electron flow from NADH and FADH2 to 02 (seeFigure 12-1'8). r The Q cycle allows four protons (rather than two) to be translocatedper pair of electronsmoving through complex III (seeFigure 12-20). r A total of 10 H+ ions are translocated from the matrix acrossthe inner membrane per electron pair flowing from NADH to 02 (seeFigure 12-1,6),whereas 6 H* ions are translocatedper electron pair flowing from FADH2 to 02. r The proton-motive force is due largely to a voltage gradient across the inner membrane produced by proton pumping; the pH gradient plays a quantitatively less important role. r Reactive oxygen species(ROS) are toxic by-products of the electron transport chain that can modify and damage proteins, DNA, and lipids. Specificenzymes(e.g.,glutathinone peroxidase, catalase)and small molecule antioxidants (e.g.,vitamin E) help protect againstROS-induced damaqe.

the Proton-Motive Harnessing Processes Forcefor Energy-Requiring The hypothesisthat a proton-motive force across the inner mitochondrial membrane is the immediate source of energy for ATP synthesiswas proposedin 1'961by PeterMitchell. Virtually all researchersstudying oxidative phosphorylation and photosynthesisinitially reiected his chemiosmotic hypothesis. They favored a mechanism similar to the then

EO R C EF O R E N E R G Y - R E Q U I R I N PG ROCESSES H A R N E S S I NT GH E p R O T O N - M O T I V F

'

503

well-elucidated substrate-levelphosphorylation in glycolysis, in which chemical transformation of a substrate molecule (i.e.,phosphoenolpyruvate) is directly coupled to ATP synthesis.Despite intenseefforts by a large number of investigators, however, compelling evidencefor such a direct mechanismwas neverobserved. Definitive evidencesupporting Mitchell's hypothesis depended on development of techniquesto purify and reconstitute organellemembranesand membrane proteins. The experiment with vesiclesmade from chloroplast thylakoid membranes(describedin detail below) that contain ATP synthase, outlined in Figure 12-21, was one of several demonstratingthat this protein is an ATP-generatingenzyme and that ATP generation is dependenton proton movement down an electrochemical gradient.It turns out that the protons actually move tbrougD the ATP synthaseas they rraversethe membrane!

troFr --1

Bacterium

,1

Plasma memorane

Mitochondrion Intermembranesoace

Outer membrane

Matrix

,0 Fl

,.1

noe + e,

)

lLIr '

:j pH 7.5 attt'

Chloroplast

' ai:r::llr'rr""

a"

T h y l a k o i dm e m b r a n e

S o a kf o r s e v e r a m l inutes at pH 4.0

L i gh t

pH 4.0

v

ADP + P,

ATP H* li:i:li:la:l:li:illlia::iiilrrl:

,,,:"' rlr

H+ pH 4.0

.l.,1 pH 8.0

EXPERIMENTAL FTGURE 12-21Synthesis of ATpby FeFl dependson a pH gradientacrossthe membrane.lsolated chloroplast thylakoid vesicles containing FoF,particles wereequllibrated in the darkwith a buffered solution at pH4.0 Whenthe pH in the thylakoid lumenbecame 4 0, thevesicles wererapidlymixedwith a solution at pH8 0 containing ADPandP, A burstof ATpsynthesis accompanied thetransmembrane movement of protons drivenbythe 1 0 , 0 0 0 - f oHl d* c o n c e n t r a t g i orna d i e n( ltO 4 M v e r s u1sO - 8M ) I n similar experiments using"inside-out" preparations of mitochondrial membrane vesicles, an artificially generated membrane electric potential alsoresulted in ATPsynthesis c H A P T E R1 2

|

HI

,t

/---'>

A

Af P

:;::rpHa.o

I I A d d a s o l u t i o no f p H 8 . 0 II t h a t c o n t a i n sA D P a n d P 1

ADP + P;

Intermembrane space Stroma

Fl

uI illi ,riil,

504

Outer membrane

CELLULAE RN E R G E T T C S

Inner memDrane T h v l a k o i dm e m b r a n e

A FIGURE 12-22Chemiosmosis in bacteria,mitochondria, and chloroplasts. Themembrane surface facinga shaded areaisa cytosolic face;thesurface facingan unshaded, whiteareaisan exoplasmic face,Notethatthecytosolic plasma faceof the bacterial membrane, the matrixfaceof the innermitochondrial membrane, andthestromal faceof thethylakoid membrane areallequivalent Duringelectron protons transport, arealwayspumpedfromthe cytosolic faceto theexoplasmic face,creating a protonconcentration (exoplasmic gradient face> cytosolic face)andan electric potential (negative cytosolic faceandpositive exoplasmic face)across the membraneDuringthe synthesis protons of ATP, flow in the reverse (downtheirelectrochemical direction gradient) throughATPsynthase (FoFr complex), whichprotrudes in a knobat the cytosolic facein all CASCS

As we shall see,the ATP synthaseis a multiprotein complex that can be subdivided into two subcomplexescalled Fe (containing the transmembraneportions of the complex) and F1 (containingthe globular portions of the complex that sit above the membrane and point toward the matrix spacein mitochondria). Thus the ATP synthaseis

ward what becamethe stromal spaceof the chloroplast (describedin detail below). In all cases,ATP synthaseis positioned with the globular F1 domain, which catalyzesATP synthesis,on the cytosolic face of the membrane, so ATP is always formed on the cytosolic face of the membrane (seeFigure 1'2-22).Protons always flow through ATP synthasefrom the exoplasmic to the cytosolic faceof the membrane, which in the mitochondrion is from the intermembrane to the matrix space.This flow is driven by the proton motive force. InvariablS the cytosolic face has a negativeelectric potential relative to the exoplasmic face. In addition to ATP synthesis,the proton-motive force acrossthe bacterial plasma membraneis usedto power other processes,including the uptake of nutrients such as sugars (using proton/sugar symporters) and the rotation of bacterial flagella. Chemiosmotic coupling thus illustrates an important principle introduced in our discussionof active transport in Chapter 1.1.:the membrane potential, the concentrdtion gradients of protons (and other ions) across a membrane, and the phosphoanhydride bonds in ATP are equiualent and interconuertibleforms of chemical potential energy.Indeed, AIP synthesisthrough ATP synthasecan be thought of as active transport ln reverse.

often also called the FeFl complex; we will use the terms interchangeably.

T h e M e c h a n i s mo f A T PS y n t h e s i sl s S h a r e d , itochondria, A m o n g B a c t e r i aM and Chloroplasts Although bacteria lack any internal membranes,aerobic bacteria nonethelesscarry out oxidative phosphorylation by the same processesthat occur in eukaryotic mitochondria. Enzymes that catalyze the reactions of both the glycolytic pathway and the citric acid cycle are presentin the cytosol of bacteria; enzymesthat oxidize NADH to NAD* and transfer the electrons to the ultimate acceptor 02 reside in the bacterialplasmamembrane. The movement of electronsthrough thesemembranecarriers is coupled to the pumping of protons out of the cell. The movement of protons back into the cell, down their concentration gradient, is coupled to the synthesisof ATP. This general processis similar for bacteria and eukaryotes (in both mitochondriaand chloroplasts)(Figuret2-22). The bacterial ATP synthases(F6F1complex) are essentiallyidentical in structure and function to the mitochondrial and chloroplast ATP synthasesbut are simpler to purify and study. A primitive aerobic bacterium was probably the progenitor of mitochondria in eukaryotic cells (Figure 12-23). hccording to this endosymbionthypothesis,the inner mitochondrial membrane would be derived from the bacterial plasma membrane with its cytosolic face pointing toward what became the matrix space of the mitochondrion. Similarly in plants the progenitor'splasma membranebecamethe chloroplast'sthylakoid membrane and its cytosolic face pointed to-

ATPSynthaseComprisesTwo Multiprotein ComplexesTermedFsand F1 With generalacceptanceof Mitchell's chemiosmoticmechanism, researchersturned their attention to the structure and operation of the F6F1complex. The FsFl complex, or AIP synthase,has two principal components, Fe and F1, both of which are

Eukarvotic o l a s m am e m b r a n e Endocytosisof bacterium caoableof oxidative phosphorylation

I Endocytosisof bacterium capableof photosynthesis

Bacterial p l a s m am e m b r a n e

B a c t e r i apl l a s m a m e m b r a n eb e c o m e s i n n e rm e m b r a n e of chloroplast

B a c t e r i apl l a s m a m e m b r a n eb e c o m e s i n n e rm e m b r a n e of mitochondrion

a(-- .{

,-#r..\

l n n e r m e m b r a n eb u d s off thylakoid vesicles

Thylakoid memorane

M i t o c h o n d r i am l atrix

12-23 Endosymbiont hypothesis for the evolutionary a FIGURE Endocytosis of a origin of mitochondriaand chloroplasts. eukaryotic cell(stepII) wouldgenerate bacterium by an ancestral with two membranes, derived an organelle theoutermembrane plasma membrane andthe inneronefrom fromtheeukaryotic (stepE) TheF1subunitof ATPsynthase, membrane the bactenal membrane, wouldthen to thecytosolic faceof the bacterial localized

(/eft)or chloroplast mitochondrion facethe matrixof the evolving membrane, (ngrht)Budding fromthe innerchloroplast of vesicles in contemporary chloroplasts of duringdevelopment suchasoccurs with the F1subunit membranes thethylakoid plants, wouldgenerate stroma(step face,facingthe chloroplast on the cytosolic remaining faces; areaarecytosolic facinga shaded surfaces B) Membrane faces areaareexoplasmic facinqan unshaded surfaces

H A R N E s s I N G T H E P R o T o N - M o T | V E F o R c E F o R E N E R G Y - R E Q U I R | N G P R o c E s 505 sES

Animation:ProtonTranslocating, RotaryF-ATPase{lttt 100nm ------------>l

l x i ddiizziinngg aq g e nntt( e 3 l et c t r o na c c e p t o r )

12-33 PhotoelectrontransPort,the primaryevent in < FIGURE of a photonof light,oneof the photosynthesis. Afterabsorption center in the reaction pairof chlorophyll a molecules excited special (/eft)donatesviaseveral intermediates an electronto a looselybound surface of the molecule, the quinoneQ, on the stromal acceptor charge irreversible an essentially membrane, creating thylakoid (righi fhe electron cannoteasily across the membrane separation the positively centerto neutralize returnthroughthe reaction of waterto molecular a. In plantstheoxidation chlorophyll charged ll. calledphotosystem place complex in a multiprotein oxygen takes photoelectron transport photosystem I usesa similar Thecomplex the electron water,it reduces pathway,but insteadof oxidizing c a r r i eNr A D P - .

to the primary electron acceptor,quinone Q, near the stromal surfaceof the thylakoid membrane (Figure i2-33). This light-driven electron transfer,called photoelectron transport, dependson the unique environment of both the chlorophylls and the acceptor within the reaction center. Photoelectron transport, which occurs nearly every time a photon is absorbed, leavesa positive charge on the chlorophyll a closeto the luminal surface of the thylakoid membrane (opposite side from the stroma) and generatesa reduced, negatively chargedacceptor(Q-) near the stromal surface. The Q- produced by photoelectron transport is a powerful reducing agent with a strong tendencyto transfer an electron to another molecule, ultimately to NADP+. The positively charged chlorophyll a*, a strong oxidizing agent, attracts an electron from an electron donor on the luminal surface to regeneratethe original chlorophyll a. In plants, the oxidizing power of four chlorophyll a* moleculesis used,by way of intermediates,to remove four electronsfrom 2 H2O moleculesbound to a site on the luminal surfaceto form 02: 2HzO * 4 chlorophylla* --+4 H* + C2+ 4 chlorophyll a These potent biological reductants and oxidants provide all the energy neededto drive all subsequentreactions of photosynthesis:electron transport (stage 2), ATP synthesis (stage3), and CO2 fixation (stage4). Chlorophyll a also absorbs light at discretewavelengths shorter than 680 nm (see Figure 12-32). Such absorption raisesthe molecule into one of severalexcited states,whose energiesare higher than that of the first excited state describedabove,which decayby releasingenergywithin 10-12 seconds(1 picosecond,ps) to the lower-energyfirst excited state with loss of the extra energy as heat. Becausephotoelectron transport and the resulting charge separationoccur only from the first excited state of the reactron-center chlorophyll a, the quantum yield-the amount of photosynthesisper absorbedphoton-is the samefor all wavelengths of visible light shorter (and therefore of higher energy)than 680 nm. How closely the wavelength of light matches the absorption spectraof the pigmentswill determinehow likely it is that the photon will be absorbed. Once absorbed, the

photon's exact wavelength is not critical, provided it is energetic enough to push the chlorophyll into the first excited state.

I n t e r n a lA n t e n n aa n d L i g h t - H a r v e s t i n g ComplexesIncreasethe Efficiency of Photosynthesis Although chlorophyll a moleculeswithin a reaction center that are involved directly with charge separation and electron transfer are capableof directly absorbing light and initiating photosynthesis,they most commonly are energizedindirectly by energy transferred to them from other light-absorbing and energy-transferringpigments. These other pigments, which include many other chlorophyll molecules, are involved with absorption of photons and passingthe energyto the chlorophyll a molecules in the reaction center. Some are bound to protein subunitsthat are consideredto be intrinsic componentsof the photosystemand thus are called internal antennas;others are bound to proteinscomplexesthat bind to but are distinct from the photosystemcore proteins and are called light-harvesting complexes(LHCs). Even at the maximum light intensity encountered by photosynthetic organisms (tropical noontime sunlight),eachreaction-centerchlorophyll a moleculeabsorbs only about one photon per second' which is not enough to support photosynthesis sufficient for the needs of the plant. The involvement of internal antenna and LHCs greatly increasesthe efficiency of photosynthesis,especiallyat more typical light intensities,by increasingabsorption of 680-nm light and by extending the range of wavelengths of light that can be absorbedby other antennapigments. Photonscan be absorbedby any of the pigment molecules in internal antennasor an LHC. The absorbedenergyis then rapidly transferred(in l sr ssecordSurtros lereue8 puotes V ' ( 1 - 9 1 a ; n 8 r g )s s a c o r d yeraua8srqt dq snolfnu pue 'seruosrxorad'slseldorolqc

'errpuoqcolnu'(gg) unpcrler f,Iruselclopua eql ot Pelros ere aql Jo rolrolut snoenbeaql otul euErqluou suretord'a11aue3.ro aLItssorf,Eurato.rdarrluaeql uoItef,olsuEJlol spPelSurla8rel Jo 'suralord elgnlos-Jete,t\JoJ seeJel{,\\'euerqruatueqr 1o redel -lq pldl aqt olur urelord el{t Jo uorlrosul ot sPeelSurta8rel 'suralordouerquau rog 'elelduor st utelord aqr;o srsagruls r e U pu o o sJ o u o l r e l s u e rSr u r . r n Jp J t l l r JJ n J J oU E Jp u e a l l e u e B -ro ue relnllor€rJur Jo euerqruau aq] ot utolord e 1o 3ur -ta8ret oL{I 'sassacordJo sPul>l sserord sa^lo^ul rsrlJ leraue8 '3ut1,tosutalo,tdto 3ut7.a8w1. lueJeJJIPdre,t o,r,rlsessedtuocue utalotd sE ot parraJerdylensn'suotleurlsep relnllol radord rreqt ol sutalord pezrsaqluds dl,Lrau yo dra,ttlep oq1 dlradord uollrunJ ol IIOJoqr roJ suollur -ol dq suralo.rd raqlo e pecnpord rr3Lll qreer lsnu tferror IIel OqrIIE PUEOseql 'llel Oqlruo{ uollerJasroJ eJEJJns IIer eI{] ol pellrrrp eq tsntu selnJelou SuqeuSrseprrdeddlodpue saudz -ua aql sluauodtuoo se xIrlpIU relnlleterxo yo se a,rnseSrp IIe^\ pue 'snalcnu aql or paraS:eteq lsnru saseraurdyod VNC PUE etuos 'eue;quraru eurseld VNU sp qcns seurdzuealqnlos-Jate,&\ eql ol pare^rlapoq tsnu sutalord ralrodsuert pue suralordrol -dalar auoruroqdueru 'alduexa Jod 'eJpJrns eql ot ro IIor IIOJ ere IIOI lecrddr aql uqlr.,raallaue8rorelnortred p ol Paro^ITeP e ur pernpord surelo.rdJo spuDlruore;tlp eqr to JIEqse dueu se ta.ra.,u.og'losoldc eql urqlr,4 uretuer dueur puu 'seruosoqrr are sutalo.rdeseqlJo dlr.roleur crlosotdrdq pezrsaqruds '0005 rnoqe 'y1actsead e isutalord spuDl lsp^ oql Jo ruerollp 000'0I o1 dn suteluoJIIer ueITEIUtueru lerrddl 'sraq)Jeasau lrouotrJol o]oqd/oinbeN [ ]ul pue 'ouelqu.Jeul g euol4 t orlardsrosselordl aredsauerqureLurelur 'Pupuoqto]ttiJ aq11osluaLupedLuot rauur'xuleuraq] 6urpnl:u1 ut poAloAUt sutelotdltlosoy{l ate uotlettdsat aql o1pa1e6.re1 snoupA puesutelotd sutelotdauelqLreul oqf olepnsllal aq].to]paurlsap fuolar:aso^ra)orUl qbnoreq1,Losauerquayypalabtelate qtrqrrir eduol lelnllaler}ul {1nnau o} s}uar-u1t suralordpaztsaqlu{s oql +ooM] burmoqs lla) e ]o qdet6ottruuolllolabutuuelsy

sttttNVDuo cNV slNVuElEl t OINI

sNEroud9Ntnonl

U]IdVH)

overview Animation:ProteinSortingflttt Outernuclear membrane I n n e rn u c l e a r membrane

Nucleus

"\ C6osol

Membrane Matrix Peroxisome

Outermembrane

:l\

d\tu

6 t

Matrix Inner memorane Mitochondrion

Chloroplast

tr/ i

/\

\@ \

Plasma /a membrane

Lysosome l

SECRETORY PATHWAY FIGURE 13-1 Overviewof major protein-sorting pathwaysin eukaryotes. All nuclear-encoded mRNAs are translated on cytosolic ribosomesRight(nonsecretory pathways). Synthesis of proteins lacking an ERsignalsequence iscompleted (step[) Thoseproteins on freeribosomes thatcontainno targeting sequence arereleased intothe cytosol andrematn tnere (stepE). Proteins with an organelle-specific targeting sequence (pink)firstarereleased (stepZ) butthenare intothecytosol imported intomitochondria, chloroplasts, peroxisomes, or the (stepsB-E) Mitochondrial nucleus andchloroplast proteins passthroughtheouterandinnermembranes typically to enter

the matrixor stromal space, respectively Otherproteins aresortedto othersubcompartments of theseorganelles by additional sorting proteins stepsNuclear enterandexitthroughvisible poresin the nuclearenvelopeLeft(secretory pathway):Ribosomes synthesizing proteins nascent pathwayaredirected in the secretory to the rough (ER) endoplasmic (pink;steps[, reticulum byan ERsignalsequence iscompleted on the ER,theseproteins Z) Aftertranslation can moveviatransport (stepB) Further vesicles to the Golgicomplex proteins sortingdelivers eitherto the plasma membrane or to (stepsEE, @ ) Theprocesses lysosomes underlying the secretory pathway(stepsB, El, shadedbox)arediscussed in Chapter'l4

well as in the plasma membrane. Targeting to the ER generally involves nascent proteins still in the process of being synthesized.Once translocatedacross the ER membrane, proteins are assembledinto their native conformation by protein-folding catalystspresenrin the lumen of the ER. This process is monitored carefullS and only after their folding

and assemblyis complete are proteins permitted to be transported out of the ER to other organelles.Proteins are also modified in various ways after translocation into the ER. These modifications can include addition of carbohydrate groups, stabilization of protein structure through disulfide bond formation, and specificproteolytic cleavages.Proteins

534

CHAPTER 13

|

M O V T N GP R O T E t NtSN T O M E M B R A N E A SN D O R G A N E L L E S

s€s

l N V U S l A l t A U l l H t S S O U ) VS N E I O U d , l . U O l _ : l U ) tJSO N O t J _ V ) O ' l S N V U l

uortpluarJoarupseql q71M'satuoso,otuq8not potuJol'solcrse,r posoll IIErusotur dn s>1ea.rq gg q8not eql (pezrueSouoqare sllal uaql6'(7-91 arn8rg)aue.rqurauUA reqlo ruoq tf,unsrp dlleclSoloqdrorusreaddueJErns slr teql souosoqrr qlr^ pap -pnls dlesuep os sr asnEreq gg eql sE u.,\aou>l sr deru. q8not 1r -qted .{roterrasaql Sur.ratuasurelord selref,oJrer{t Ug aqt Io uonrod oql 'UE or{t Jo areJrnsoql ot punoq ere leqt sauos -oqIJ uo pazrsaqludsere daqr se suralo.rddrolarcesolur paleJ -odroJur ere sprf,e ourrue peleqel dla,rrtreorper 'sy1orqcns uI 'sllrJ reulre rltporJued qtrlr\ sluaurradxa 3ur1age1-aspd dq parepnnla lsrrJ ara.t uralord drotarcas e yo srsoqlu.,{s erJtreryedlelerpaurur rnJJo lugt stuo^ato aruanbesaq1 'demqredsrqt Surdpnrsur pesndlapm uoaq o^Er{daqt 'acuep -unge ]eer8 ur (r31ogpue UE ''3'a) de,vrqred,{rorarcasaql ;o selleue8roeql urEtuor sylec.{rotonas qJns asnpJJfl'ourlsoturar{l ot ppel terlt selnDnp olur pelerres aft wql sarudzuaarrrtsa8rp 'aluelsur.ro;'s11arreurle IEJeAes Jo sertrluenba8rel ozrsaqluds JrlpeJf,ued'surelo.rdcr;rcadsto slunoup a8rel ;o uorloJJosJoI pazqenedsare sller yo seddruretJet '(suretordxrJlpru relnllel -erxa ''3'a) suralord dlarrerrE eterfossllel Jo ile g8noqlly rardeqr 3urmo11o1 or{t ur possorppesr trodsue.rl alJrse^1o ssecordaql 'UA eql retue ,(aqrse pJrJrporueJEpue p1o;suralo.rdaorl 't'€I uorlf,osur 'oroq roprsuof,osle olN rol -deqc srqr ur possnlsrpsallaue8rorer{to eqr ot suratord 3ur Jo -la8.retol Jppurs ,{ylecgsrueqceru eJEsessacordesor{lesnpJoq 'euerqruetu UE er{l olur peuasur aq UEJsura}o.rdJruos A\oq pue UA aql ot pareSretere suratord ,(rolarcas.{\oq ssnf,srp a.\\ relder{f,srr.{lJo suorlreso,v\l tsrrJeqt uI 'selrrse,r;o Sursn; (seuososll 'r31o5 aql ot pue Surppnqq8norqr of,EJrnsIIef ro trodsuerl uretord (t) pue'uerunl UE erp eprsuruou€f,l;Iporu pue Surploy urelord (7) 'aue.rqurau UA eqt ssorre uou -EJolsuertpue srsaqtudsuralord (1) :sdarsaarqt se,rlo,rurdezn -qled drolerJaseqf rusrupqreu lrseq eql 'suralo.td{.toptt Jo -as sE dle^IlJellof, sulelord asaqr ol raJar o.&\tlIfIIduIS roJ '(4rt 't-tt arn8rg) saurososdlpue '€1og 'UA aq] Jo euprq -ruoru eqt .ro acrds leurrunl snoanbe Jrll ur aprserler{l surel -ord delr suralord Surt.ros Surzrsaqtuds ro1 pue patorJes pue -qled drolerces eruesaql .{llerluasseesn slleJ rrrod.re4na 11y

ouerquawul aql ssor)vsurolord fto1ene5lo uorle)otsue4l$l 'sarod realonu snolJnu eql q8norqr to tno pue olur surato.rd 'satuosrxoradpue 'slseld ;o uodsue.rt agt JaAoJa.n tlleurg -orolql 'errpuoqcolnu ol suratord;o Surta8reteqursep ueql ar16 de.nqred drolanas ar{t retue deql se suralo.rd ot Jnf,f,o leqt suortplrtrpou leuorlelsuerl-1sodaql Surpnlcur'Ug eqt ol surato;dJo Surla8relreloJ e.taterdeqr egr 1o rred lsrrJ eqr uI ieueJqureu eql ssoJJEJaJsuEJl 'V Ieuortrerrprunse^rrp wql KBnua Jo eJrnos eql sr reql1 isuretuopuroto.rdpJplo; atepouurofJe lr llr,ry\lo 'alels peplotun ue ur dluo q8norqr sseduer suralord leql ,{orreu os Ieuueql eqt sr 'relnrrlred u1 i.radelq oueJqurou oqt ssorf,€suralordJo reJsuprts.^aol]E wql Puupq) uotlr2?olsup4eqr Jo ernlrnrts eq] sr rEqlN 't

'z lecuanbasleu8rsaqt rc1 rclQatat oqt sI rel{lN ;seruenbasleu8rs;o sad& raqlo IUory1I saqsrn8url -srp teq.ry\pue 'atuanbaspu8rs oqt to ornleu JI{r sI leqlN 'I :suortsanb rnoJ ro^^suEol >loesl[,ry\e^'\tardeqr lEluaurPpunt 3urla3rel-uralordagl to qlPa roc srqt ur Pessnlsrpslua^,re 'palelduoc sr oupJqlrrerueql ssoJf,?uollefolsueJl eJuo saseelordrryrcadsdg uralo.rdoJnletu oql uroJt PeAoIuoJoJ€ ueuo soJuenbesyeu8rs'dleurg 'suratord roldore.r Jeqlo PUP saruonbasleu8rs.raqlola.{ uo spuedapSurlrosqons lelleue8ro le8rel eqr ulqll^/r luaurl.reduof,qns e qf,EOr ol requnt pauos dlluanbasqnse:e sutelord aruos AIV ;o stsdlo;pdq sE qJns ssarord e]qero^E dllecrle8reuauE ol uollelolsuerl Surldnor dq pa,rerqcr dllensn sl 'useldoldf, oql olul lno >1ceqSurp{s lnoqtll\ 'alyeue8touP olul uralo.rdE Jo raJsuerl Ieuonrarrprun erll redepq euerquou aqr q8nolqr ssed ol ureto.rdeqr s.^oll€ l:-tll Puueq) uotlo)olsuotT to PUDIauos ol porreJsuertsI ulel{f, utalo.rd aq} loldof,er Surpuodsa:ror aqr qlr/v\palJEJOluIseq acuanbasleu3rs u Sututeluoc utalord p aluo 'surta8rul 1o dlnr;roeds aql suralo8 ecuonbasleu8ts .seJuenbas e ur pepof,uouorleuroJur JI{} reqt Sut.rnsuesnql leu8rs ;o spur>1cr;rcedsol dyuo PuIq rpgr sutalord roldacar Jo les e serrrer allaue8ro qcea'sap4f,ad lpuBrsto sacuanbas Su4a7nx-a4wdn pe11etoslr aru esaqr :(1-E1 arn8rg eas) 'sptce ourtue saruanbespu8rs su dlporraua8 u,vloul 05-02 ';1eslt utelord eqr ;o ocuanb ;o seruenbes urqtl.ry\dllensn -es prle ouILuE eql ulqll.ry\poPorua sI uolleullsop a11aue3 -ro relnrrued e ot utelo.rd v le?rct ol uoIlEIuroJuI agt let{l 'ef,uelsurro; 1r,roo1A{ou el( 'salleur8ro JelnllaleJlul snoIJEA aqt IIE ol Surl.rosutoto:d uralo8 susru?qJalullseq elues el{l

'suo'Er',reuosarrdsep r'gr u^ oqst^"U ttf,iJi"ilirq*U*,

's;edeltq pelelndrueru ,(1aa:;aq uEf, stuolsds orlll uI qcn5 prdrl lenr;rup otul palerod.rocut sluauodtuoo urelo.rd peg -rrnd aql Sursnpetntrlsuorer ueoq e^Pq IIOI eqi ut sassalo-rd 'uorltPPP uI 'seuerg uorlprolsuErt rolpur eql Jo duetu -uer.u rElnllerPrlur lueraJJlpeql Jo I{lPe ssorf,?uollef,olsuerl ro; pa.unber stueuodulof, relnllel eqr Jo dueru pet;ttuept a,reqstsrSolorq11ar'sdatsuorleJolsuerl relncrlred elnJexJ ol elqeun sluulnlu Surd;rruaprJoJ suooJf,srtleuaS Pu€ spoqreur 'sa1nr uorlecr;rrnd leJlrueqlolg Jo uolleulqruoo e Sursn -elour llprus pup suol ot reureq e se .radepqaql Surldnrsrp lnoqtr^r euErqtueluP ssoJrepelerolsuErl eg Plnol salnJalou pue auerglueu cr;nads euo dluo uretord a8rel dlezrrreler,vloq ot potrerrp eq plnor utalo.rdua,l,t8e .ttoq :3urg;eq attnb era.'rn 'JoIJ d11erlrurssocord Surlros-utelord srql Jo saJnlee' oA/rI -elur slr olur peloru Jo eueJqueu o1laue8roJI{l olul pelJesul dlluanbesqnspue sellaueSrorrlnllef,Erlul Jo seuerqlueu eql ol pala8rel are sutalord ^\oq euluexa a.vrleldeqc :,#l""lrr", -leferlur Jo seuprqrueruaql ol Surla8rel utalo.rdruor; .{lluec -r;ru8rs sJeJlp lr dlleousrueqlatu asnef,agrordeqr lxJu JI{l 'I ur Surlros uratord Peseq-olllsa^ssnf,slPe11.'@oqPapvqs -91 arn8rg aes)raqloue to euerqrueu aql qllltl osn; uaql pue auo Jo auergueu oqr tuo{ Pnq 13qrself,Ise^IIPtus e1laue3.ro ,(rolercaseqr 3uo1epelrodsuerl a.re Jo uorlfe aqr dq dezrrqrBd 'r31o5 eql sI uolleullsoP af,Erns lyar ro 'aruosos.,{1 IBUI}esoq,,la

s l ' l ' l l N V 9 u o c N V s 3 N V U S l A l l Ao l _ N t s N E I o U d 9 N t n o N

u a e q r o t a u o s o q r r e q l s t J e r t p u r a t o J d t u e J s E ua q l u r 'losotdr eqt ur seruos af,uonbas UA enprser-0€ot -9I e Ieu8rs -ogrJ eeJJuo sur8aquratord d.rola.rras e ;o srsaqtudsJaUV ul aql ol sulaloJd Alolelra5

luo)seN sle6tel

a ) u a n b o sl e u O l Sl e u l u r a l - N ) t q o q d o r p f HV g3 qbnoraq] +o uauJnloql ol luole^tnbo'soLlosol)tu.l eql optsul aresurelordepeu Ilnnauaq] ]eq] solp)tpur6urpurlsrql luablelepqlrm ]uaurlparl{q pa,{otlsep}slt}st auetquiau Ieuloso.l)tru oq} }o lar.lleq ifrlrqeauradeql 1rIluo eseelotdeq1{q palseOrp ele sou.]osolltuJ eq} q]lM paler)osse surelordfuoleltespalaqeloql luebtalepe +o o)uosqe ro a)uosordaq] ur oseo]oldp q1^^paleol] aje soLuoso.t)Lll perltnd eq1 asol)nspue let}uola+}tp 16raldeql) uorlebnltlua>luerpet6-,{1suep e Iq ulaq+u.tot1 peletedaseq ue) pue sa;leuebro ]o uorleurqulo) snouprqurolr roqlo ueq] {lrsuep1ue,4onq teleetOqfnul e aneq 'solxosoqu sotuosor)rLU punoq aneq{eq} esne>egsau;osol.l/upalle) sal)rsa^ euseldeq1 lleursolut g3 qOnoteq16uueaqspue oue..tqLUaLU 6uunlrer,r'pezruabouoqole ueq] sllo)oql poloqelaulo)aqsurelotd pezrsaqluris {lnneu{;uo }eLllos spt)eoutL|epalaqelotpej q}tMoLUt} e Jo] palpqn)ura.resllo) srsaqlu{s ta11e {;poqs uaLUnl +ar.rq !l aql o} pozrle)ol eresurelotdfuolettes alellsuoLuap slueutuadxa 6urlaqe1 lpq] 'Ul oql regua suralo.rdtuo1a,oe5 €-€t tunglJ lvl_NllAjlUldXJ < urolojd Alololsas 1 o u o r l s a b r po p t t

t t

u ralord Joleloas ;o uor1se616

t

:tr4 L r ' #

t

|

€t Ull_dVH)

9€S

'ouErqujeur uE aqt ssorf,Epepeerql sr uratord .{rolarcaslualseu E Jo snurrurel-N er{l ,ra,oqpue sur8 -ag srsaqludsrraqt reue .{llroqs surato.rddrotertes se pazruSo -rar ere saprtdaddlod .4orl Jo uortsanbeqt pasrersrqt se qtns stueruuodxg 'sallrsel ueunl oql un{tr^^ dn pue sauros UE ]o -oqrr aseqt ,{g parrpord seprrdad.,tlod eqt (auerquetu Ug aql Jo arpJ rrlosotdr aqr or punoq sauosoqu uo pazrsaqtu.{s are surato.rdd.rola.rcas q8noqlle tEql elertsuoruap 'asealord e qlr.^apeluen ore sller palaqey-as1nd Luo{ palelosr seruos -orrnu qrrq.{\ ur 'g-91 ernSrg ur percrdapstuaurr.radxaeq1 '(eprslnoeqt uo saruosoqu) IJaJttetur eql ur puno; teql se

(e)upd] a)uanbasleu6rsX3 I opeled9 1o,4sapno; ue 6urureluotaprided{1od e 1osrsaq}u,{s uralord6uunp uJnln)t}al >rLuseldopue aq] ol po]rnr)ar1a6seulosoqupunoq-ouelqulon le)rluoprare seulosoqutrlosolI: aarJpue punoq-auelqulou]eqt oloN Ul eq1uo srsoqlu,{s ure}ord1o uorleluasa.rder )r}puloq)S(q) surelordrtolerlesuouloqlo lo trlosol{t 6urzrsaqlu{s ole asaLl} Alqeunserd1luapr^o oJesoLL]osoqt.t (aal])porl)eueun-ouelquta[! Mo] uo pau]lo]ole pue pe]oj)os0q o1 v sourosoqupoqle]le-auelquaLu arp lla) ,roadi{tsrq}{q pezrseqlu{s surelotdoq} +o }solA llo).reut)e rrleer>uede ur g3 q6noraq] o] poq)e1]esoLuosoql1o qder6ottrut uoj])oll (e) 'Ul q6nor aql lo arnpnlts Z-€l lunglJ V

AI rt

t

uolunlH3

+

auerqursruul aulosoou P"qrntiV

luebrelep qllM leall

losol^C

s l r un qn s leurosoqru

saruosoqu poqcelle qu,v\ saruoso,tctli^l

(q)

f f i / l"^ f f i nl^

, . , " f.l8f

v{$

L

l-- *-I

$'sE'

'

,

rrrrl9'6

Qqr

w

I ,

;:.

i , ...,'., l, :r,:.., '.$,1'1

suerquror.rJ uf

uaurnl uf

losol^3

Lts

l N V U S t A l t A U l l H - L S S O U f VS N t S I O U dA U O I I U ) l S l O N O T I V ) O ' l S N V U I

rau€ saurl ruOrOtJIPlE sarnlxlu uoIlJEer egl or PepPP aqt uo rotderor dUS eql ol Surpurqlq auerqueru UE Jql oJeA\ satuosolcnu tsJuJurrradxeJSaI{l uI 'JnJJo ol uoll -pJolsuErtrot JOProut luasa.rdJq lsntu sJtuosoJf,Iulqllqr^ ol xalduor auosoqrr-uratordluacseueql sle8rel urqt dUS lxaldruor a3.re1e Sururol 'lrunqns Ipuosoqrr a8.reyaql se le srsaqtudsutatord 1o a8els astrard oql eullurataP ol sp uretord tuerseu E ur aJuanbesleu8rsUE or{rqtoq or sluorurradxaluanbasqn5'(y-E1 orn8rg) srnc peuSrsapere,ry\ IIO,,\\ -f,o seruosoJf,rru sputq dlruetsuerlteql alrrtred uralordoalonuoqrrrrlosotdc eql olur lJodsuerl urolord ou 'PolalduoJ p sl eqr 01 POPp?ere sotuosorr eqJ 'ouprqtuetu oql ur parelol 'roldere.r sr srseqtudsuralord ralJE IUOls.,(s dUS UE -rr.u 'srsoqtudsuralord Surrnp luesald erE saluosorf,rluoql str pue (495) oprlred uorlruSorar-leu8rs eql arp 8ur JI -la8ret srql ur stuauodruoc .{a4 o,uo oql 'arar{t uaqt }a8-ret dluo peloruoJ acuanbesI€UBISsll sEL{Pue seluosoJJltu ;r uortruSorerecuanbas-leu8rs e'auerqueru olur pelerodJorursr uretoJd.{rolarcaslecrd& P lPql POlEJls lsntu tusruEqceru -uouep urotsds slql qll.&\ sluaruuedxe IEIIIuI 'sof,uonb relnllor ror{lo due rltr^{ tou tnq euerqr.uau Jqr qtr,lr UE -as uorterJosse ur pazrsaqludsa;e sureto.rddrolarces acurg leu8rs UE Jo alpJ pup uollrunJ aql PaIJITEIIa^Pq sotuosoqrJPunoq u^\o Jlaql ;o paddrrrs soluosorflul Pue surslord6urz^;o.rpAH-dIg o^ I ^q 'tualsdsSutzrseqluds 'ulelord drolaroase Surpocue VNUtu p a l e r l r u ls l u o r l e ) o l s u e 4l e u o t l e l s u e J l o ) -uratord salPnts e 3utzrlr1n rerJ-lloJ IerllueqJoIfl .auerqrue{u ua eql 'uorl9Jolsu€Jl sE ol uretord eqt Sulla8r€l ro; elqrsuodsardreutqceuraql qll^{ IeuorlEIsuPJlof, ol peJlelerssaro.rd€ 'oLuosoqrJ agr or punoq ylrlssr urato-rd sefuenbas 1eu3rs;o uollf,eJolul eql Jot IefIIIJJ SI lEr{l elIS (tuarseu)pazrsaqruds dlaralduocur aqt elrr{1\^. sur8aquorunl Surpurq € ruroJ soJuenbasleu8rs gE Jo erof, aql uI senplsor rrqoqdorpdq aqt snqJ 'uaunl Ug aqr ol pererolsuerl UE aql olur sutatord drotarros lsolu Jo trodsueJl aLItsnql '(97-y an3rg aas) tllosoldr pelllpotu P qlns 'rrqoqdorpdlJ PUE auosogrr er{t ur sr uralo;d ]auupr{re urqlr^.\porrnq ';;o sI acuanbasPaPPBel{l Papl^ord 'saJuenbas dlluarcrttns aq 3uo1 pe^eell Ilrls arp sprlB ounuE os Jo 0t lxeu eqt pue 'auosoqrr ourrue Ieullurol-N PaPpB tltl./lr surolord rrlosol,{r aql prre llr./!\ralel teqt eouanbasleu8rsaqr Surpnlrur ruorj aPnrlord os .ro sprrE ourruE0t rsrrJer{l 'lurod srqt tv parnpord e^Eq srel{rruasal'sanbruqlJrVNCI lueulqulorer 'uatunl 'ueunl aueJqlueul Ug oql ssorJ ol alqeun eql otul Sursn IeruosoJJrrueqt ur pozrletol oq ol uraloJdf.rolanas (aJuanbasuofE '1osol.{ceql uI suleruarurelord patalduor egl ro; ropro ur reqraSotprlull ere sprru ourrup PorJrpou oql os ro 0/ lsrrJ eqr eroteq popp€ 0q tsntu seuosorf,rr.ulEr{l sy 'aruanbesleu8rse se uorlJunJ ol uralord e to snulluJel-N sluarurrodxeasaql 'un8aq peq srseqtu.(suratord aqr;o dlrlrqeaqt qsIIoqEupr uolletntu dq eror rtqoqdorpdq pJ,ln.oqs oql otur spne ouILuEpa8reqc to uoltrnporlul eql ro aruanb -as yeu8rse ruort spIJE oultue crqoqdotpdq el{l Iero^as Jo (etuelsul 'uollJun; rIaIJrroJ roC IEII to uortalep orlcads oqt -uassosr seouanbas gg eror crqoqdorpdq eq1 leu8rs Jo acuenoes 'sllor ur PunoJsurol ;eubrs1o le^ourorpue ecuenbes;eubrs ourosoJcr.lr olur urelo.rd;o -old at{l uI luasard tou dyyensne:r sacuanbespu ,,elnleru,, l n o q i l Mu r e q c u o o s u e r ll e u o r l e l s u e r l o c -8rs snqr lauosoqrr oqt uo Surle8uola llrls sr 1r alrqzrtutalo-ld uraloroarnleN eqt urorJ pe^po]Jst oluanbasluu8ls aql'surelord drolercas '(a.ror lsoru roJ 'uotuluoJ ur JIDII a,req .,{aqlJSLi!\Jeqlolnq aql) senprsarcrqoqdorpfq U-g Jo qllorls snonulluoJ E ot tuarelpe splfe oultue pa8reqc dle.ttlrsodeJotu Jo euo uIEl -uol suralo:d drolarcasluarotllP Jo sef,uenbesleu8rs aq1 IIE 'pazrsaqtuds ag ol uralord eqr;o tred lsrlt eql 'uralord aqt 1o snurrural-N erp lp patelol sr dllurrdll aruenbasleu8rsgg uy '({tt't-tt arn8rgeas)auerquraruUfl aqr ssorreeprrdaddlod Sur.r,rorBoql to uolleJolsuEJl saleIlIuI Pue auPJqluetu :srsorllu^suralordoor]-lloJ (q) lueserdsaurosorcrLU

ecuanbes;eubrs OU JOleAOUrAr :soLuosolcrLU olul u o r l e r o o r o c uorN

t

sauerq urour ppv eLuosorcrur luasardsourosoruluou lsrseqluAsurelo.rdoorl-lloo (e)

uralotd6uttnpluesardeleseuosolltu.t (q)stsaqlu^s ;t {1uo al)lsen aql ssol)epale)olsuel] s1tsasolpueeuelqulaLu a>uanbes leu6ts stutalold oql ul pozlsaqluAs srlnq (e)saulosol)tul ]o a)uasqe q)lqMo] e 6utpoluaVNUUr aql pappestutalotd,to1er>es fuoler>es 6uturel puei11g'dIV'sVNU]'saulosoqll >r1oso1b ser-ul{zue leuot1>un; -uot uels{soarJ-llo) (g-g;etn6t3eas) e urlno paule)stsrsaqlu,is jo oal,-auosoqll aleq)tqM'sottlosor)ll.lJ souerqurauJ Ul o] luelentnbo 'seurosoqtJ pelPl)osse uleqlsdtlls'suot.*661 6urrrno;;e uorielosr ]o q)lqM'vlcl q]rMsaLuosol)lul solelaq) +o]uoulleo{ uol}elsuej} olut sutelotd,fuolallas oi peldnorsrsauiosol)tu.t +ouollelolsuell ln))o aaj]-lloff ;snoauel;nu!s siuer-utladxe ]eq}alerlsuoruep pue uolle)olsue4 t-€l lun9lJ'lvINltNluldxl < uorlelsueJl

s r r ' E N V 9 U O C N V S t N V U S I A 3 I AO t _ N tS N E I O U d 9 N t n O N

I

tr UtIdVHf

8ES

seop auerqueu UE eqt ur roldalar eqr ot punoq ser1 ue loldaf,or eql r{lr^\ 8ur>llop dg auerqruou UA eqr dUS dUS xalduror euosoqrr/urerlf,luaJseu/d1s oqt rarle dlug .UA aql o1 xaldruor eruosoqrr-urpr{f, tuJtseu ogl s8ur.rqdUS ar{J 'uetunl otul uortef,olsueJtro1 3uo1oot SunuocaqruoJJurer{f luef,seu UE ar{t olur uortef,olsuerl uralo.rdro; perrnba.re.re eqt slue.tard euosoqrr aart or{l qtr.a pue uralord d.rota.rcas ro atuosoqu eqr qrr.,talJpratur dUS aqt ur seprrdaddlodraqrg 'auprqrueu e Jo ulel{r luef,seuaqr i{roq qrl. dus aql uorlreretur 13r{l pue suretord Jo UE ar{l ol uroql sla8rel ,,(1o,rrna1as stseSSns Surpur;slql'(t-gI arn8rgees)uralord eralduroceql f.role.rrasluerseu;o sleu8rsleurr.urot-Ncrqoqdorpdqeql qtr^ 'luasqe ere seurosorf,rr.u ueq.v\ slf,protur tpqt UOIJsnoSoleueue ureluof,or rq8noqr sl tgd to ;o srsaqludsSurrrqrqurdqareqr uralord d.rola;case ;o uorte8uole s,4^olsdUS Jo acuasardeql uor8arorqoqdo-rp,(q eqI'(eS-tI orn8rg)sureql eprstrqoqdo.rp -dq dq paurl sr of,€'rnsrouur asoq^\ 1{1snor,r,ard paqrrtsep tuetsdsuorlplsuprt aa{-llel eqt uJ Uelr E surrluoJ W{ Jo ernl 'slleJ -lnrls eql Ierrelleq Jo euprqruerucnuseldoldrer{tssorf,E oqrpu' sutalord d.role.rcas A,rrrrrrqtl,ll9:ilJfi suletoJd uorlPf,olsuerl aqt ul luef,s'u ol uorlJunJ snoSoleue tsd Jo 'WC sE u.4^ou{ urelo.rd -IJ uOaIUequorlf,EJalur rar{louB punoJ elErlrur o1 ,{pea.r ue sruro;rad qlFI^\ to lprro1ceqe ol sno8 'dCC -oloruoq sr surur1o ore qrog pue 'losotdc oqr ot selcdre.r punoq aprsorqogdorplg qrrzusJnprserprre ourtue dUS {req 'raqro rraql eseeler rlreo roldarer slr pue ruorJ dueru qleo SurureruoJtsd 1o uor8er V 'uraloJd drolarcesluotspu 495 Sutlrroossrp raUV 'ereld elet uer uorterolsuert ereq^. e ur acuanbesleu8rs oql or spurg ter{t trunqns eql sr urato.rd 'auerqruaur relncrlred sql teqr eruapr^e 'sacuenbospu8rs gg ot pa]url Ug aqt uo elrs e ol oruosogrJpue urpr{l luof,seu 'roru -ssorcdllecnueqr aq uec (794) suralord aqt JoJSUEJ] solertrur'pootstapun sr Jeuuer.u E ur tou lEql ,o dUS oql Jo euo 'pue roldacer -Px3qel{l rot ploJJslsE s3 slJe qrlr{^ 'vNu rPrroepnu-Oo€E pue eqr ,{lqruassesrp sarueduoc dus dus ;o 'ssacordsrql ur roldarer -lp dJC punoq aqr 01 punoq saprrdaddlodalorrsrpxrs Jo dn epetu sr dUS eql 1o srsdlorpdll str pue dUS eql Jo elor erJrpue srsaqludsuralord drolarces luarrnf, Jno sezrreruuns9-€I orn8rg ;o Surpuets.repun 'salnrelou dJc Punoq qroq dtc Sutzlyo;pdq yo alqeder ere leqt setrs olrlfe atalduoc o.,ia,l ru;o1 daqr taqlaSor eruoJ sureloJd o,,urraql ueqm lnq ,41g ;o srsdlorpdqer{t roJ etrs JAurE etaydtuor p suretuof,ouolp llungns reqtreN'reurporataq lecr.rlauturds-opnesd E ruroJ o1 raqlaSol aruot dJC Jo alntoloru a13urse ol punog qlee 'surato.rdasaqr ISIC pue r{J{ ar{l ler{t s,vroqsqg-91 ern8rg to uonerf,ossrppue Surpurq oqt e^rrp uer srsdlorplq pue SurpurqdIC Jo e1c^,tr e ^ oq otur lq8rsur sapr,rord,snxlonbo snwnql errotreqeer{Jreer{l ruo{ '(IsrC) trunqns D roldof, -or dUS eqr pup (WS) aUS to trunqns tgd aqr yo sSoleue;o ernrrnrts eql alc ot punoq ere roldalar dus aqr to lrunqns r0aqr pue dUS to lrungns tgd er{t qroq ueq^\ pouaqr8uerrssr rolderer dUS oqr qlr.Lrxalduoo auosoqrr/urer.lrtuelspu/dUs ( l r u n q n?s9 dd u s ) (llunqns7rroldocordus) aqt Jo uortrerelul 'trunqns fl .ro11euse pup lrunqns D ue r.tJl Asrl :sllunqnso^\l to dn apetuauerqrueudE aqt uratord (q) Jo le.r8atur 'VOOZ' (q)Ued I t1€:€0€a]ual)S' le]a er)o1f iJLlor]pa]depe '966 ' urol]peldepe (e) LgLtt6 ]a ueuaa) 1 ila) ]redl le [ U taLUtp aq]1o{;qu.ressesrp 6ursnel,o)e+la}ut eq}sozlllqe}sop dCg o1srs{1olpA;1 soln)aloLU eq1to1 d1g punoqq}oqrrosrs{lotpIq sa]rso^rpeoMl ]o uotleullo]sMollelauJlple)ulaL]lLrLris-rues aq11o {lquressyloultpaq}oztltqe}s pues}tunqns urelotdeq1uoaM}aq O)elrelur aql ul llj dfg jo saln)alouJ punoqo^^iaq] laLllo q)eao] pulqAsll pueqlj uoqMpuet1D ]o oln)alouJ auoo] putq ue) q)pe pue sll qlg pue srs{1otp,iq pallotluot 6urpurq {q 419 srsuralord asoq]uoaMlaq uotlfelalut oql Moqsalellsnllt surelotd q+lpue(lolda)ol D aq] Oolouoq ]runqns dUS lo +o lellal)eq aql) sll o] punoqdf9 ]o olnlrnrlsaql (q) sa>uenbes leu6rs q]rM surell) apts osoqm (aldlnd) ])eralur spt)e ouL!e trqoqdotplq qllMpaullUel)o6rele sureluo) q)lqM'qll urureiuop oulpurq eql sMoqslopouro)ellnssrql setuanbes Ul spulqielll tsd +o leuOrs uorlrodeqto1sno6o;ou.roq sruralotdqJJleua])pq oq1(e)'(dUS) epryed uorlru6ore.r-;euErs eq1lo elnpnrls S-€l lUngll >

(dus lo lrunqnstgd ol polelor) u r e u r o p6 u r p u r q - a c u a n b e s - 1 e u q6 ; 3r s

ul aql olul

uorlp)olsuBJl utalojd ut €l)tupd uotltu6olcH lBUStSaLll l0 uorl3unj pue ajnl)njls :lselpod

ll[]

FocusAnimation:Synthesisof Secetedand Membrane-Bound Proteins mRNA

SRP

Signal sequence

SRPreceptor

GDP+ Pi

Translocon (closed)

Translocon (open)

-tl I l , t-aLa \tt\k ti....F a/ a \ sat aa a f

Folded protein

FIGURE 13-6 Cotranslational translocation. polypeptide Steps[, [: chainelongates, it chainStepE: Asthe polypeptide Oncethe ERsignalsequence emerges fromthe ribosome, passes it isbound intothe ERlumen,where throughthetranslocon channel (SRP). by a signal-recognition particle StepS: TheSRpdelivers the thesignalsequence iscleaved by signalpeptidase andisrapidly ribosome/nascent polypeptide complex to the SRpreceptor in the ER degradedStep6: Thepeptide chaincontinues to elongate as membrane. Thisinteraction isstrengthened by bindingof GTpto the mRNAistranslated towardthe 3' end Because the ribosome boththe SRP anditsreceptor. Step4: Transfer of the ribosome/nascent isattached to thetranslocon, thegrowingchainisextruded polypeptide to thetranslocon leadsto openingof thistranslocation throughthetranslocon intothe ERlumenStepsfl, S: Once channel andinsertion of the signalsequence andadjacent segment iscomplete, is released, translation the ribosome the remainder of the growingpolypeptide intothe centralpore Boththe SRpand of the proteinisdrawnintothe ERlumen,thetranslocon closes, SRPreceptor, oncedissociated fromthetranslocon, hydrolyze their andthe oroteinassumes itsnativefoldedconformation. boundGTPandthenarereadvto initiate theinsertion of another

SRP releasethe nascent chain, allowing elongation to continue at the normal rate. Thus the SRPand SRPreceptor not only help mediate interaction of a nascentsecretoryprotein with the ER membrane but also act together to permit elongation and synthesis of complete proteins only when ER membranesare present,

Passageof Growing PolypeptidesThrough the Transloconls Driven by EnergyReleased D u r i n gT r a n s l a t i o n Once the SRP and its receptor have targeted a ribosome synthesizinga secretoryprotein to the ER membrane, the ribosome and nascentchain are rapidly transferredto the translocon, a protein-lined channel within the membrane. As translation continues, the elongating chain passesdi-

rectly from the large ribosomal subunit into the central pore of the translocon. The 50S ribosomal subunit is aligned with the pore of the translocon in such a way that the growing chain is never exposed to the cytoplasm and is prevented from folding until it reaches the ER lumen ( F i g u r e1 3 - 5 ) . The translocon was first identified by mutations in the yeast gene encoding Sec61o,which causeda block in the translocation of secretoryproteins into the lumen of the ER. SubsequentlSthree proteins called the Sec61complex were found to form the mammalian translocon: Sec51cr, an integral membrane protein with 10 membrane-spanning ct helices,and two smaller proteins, termed Sec61B and Sec51"y.Chemical cross-linking experiments demonstrated that the translocating polypeptide chain comes into contact with the Sec61a protein in both yeast and

T R A N S L O C A T I OO NF S E C R E T O RPYR O T E I N A S C R O s sT H E E R M E M B R A N E

539

ArtificialmRNA

Cytosol

Sec61o Microsomal membrane

Crosslinking agent Nascent protein

Microsomal lumen

NH:

EXPERIMENTAL FIGURE 13-7 Sec61cis a translocon component.Cross-linking experiments showthatSec6lcrisa proteinsas translocon component that contactsnascentsecretory theypassintothe ERlumen.An mRNAencoding the N-terminal wastranslated in 70 aminoacidsof the secreted oroteinorolactin (seeFigure13-4b). The a cell-free system containing microsomes mRNAlackeda chain-termination onelysine codonandcontained a codon,nearthe middleof the sequence. Thereactions contained chemically modifiedlysyl-tRNA in whicha light-activated crosslinkingreagent wasattached to the lysine sidechainAlthoughthe polypeptide entiremRNAwastranslated, couldnot the completed fromthe ribosome be released withouta chain-termination codon andthusbecame"stuck"crossing the ERmembrane. Thereaction mixtures thenwereexposed to an intense light,causing the nascent proteins chainto become werenear covalently boundto whatever it in thetranslocon. Whentheexperiment wasperformed using microsomes frommammalian cells,the nascent chainbecame linkedto Sec61oDifferent covalently versions of the prolactin mRNA werecreated sothatthe modified lysine residue wouldbe placedat different distances fromthe ribosome; to Sec61c was cross-linking observed onlywhenthe modifiedlysine waspositioned withinthe translocation channel[Adapted 1992,Science fromT.A Rapoport, 258:931, andD Gorlich andT.A Rapoport, 1993, Cell75:615]1

mammalian cells, confirming its identity as a translocon component (Figure 1 3-7). lfhen microsomes in the cell-free translocation system were replaced with reconstituted phospholipid vesiclescontaining only the SRP receptor and Sec61complex, nascent secretory protein was translocated from its SRP/ribosome complex into the vesicles.This finding indicates that the SRP receptor and the Sec61 complex are the only ERmembrane proteins absolutely required for translocation. Becauseneither of these can hydrolyze ATP or otherwise provide energyto drive the translocation, the energyderived from chain elongation at the ribosome appears to be sufficient to push the polypeptide chain acrossthe membrane in one direction.

540

CHAPTER 13

I

The translocon must be able to allow passageof a wide variety of polypeptide sequenceswhile remaining sealedto small moleculessuch as ATP and amino acids. Furthermore, to maintain the permeability barrier of the ER membrane in the absenceof a translocating polypeptide, there must be some way to regulate the translocon so that it is closed in its default state, opening only when a ribosome-nascentchain complex is bound. A high-resolution structure of the Sec61 complex from the archaebacteriumMethanococcusiannaschii was recently determined by x-ray crystallograph5 which suggestshow the translocon preservesthe integrity of the membrane(Figure13-8).The 10 transmembranehelices of Sec6lcr form a central channel through which the translocating peptide chain passes.A constriction in the middle of the central pore is lined with hydrophobic isoleucine residues that may form a gasket around the translocating peptide. In addition, the structural model of the Sec61 complex (which was isolated without a translocating peptide and therefore is presumed to be in a closed conformation) reveals a short helical peptide plugging the central channel. Biochemical studies of the Sec51complex have shown that the peptide that forms the plug undergoes a significant conformational change during active translocation, and researchersthink that once a translocating peptide enters the channel, the plug peptide swings away to allow translocation to proceed. As the growing polypeptide chain entersthe lumen of the ER, the signal sequenceis cleavedby signal peptidase,which is a transmembraneER protein associatedwith the translocon (seeFigure 13-6). Signalpeptidaserecognizesa sequence on the C-terminal side of the hydrophobic core of the signal peptide and cleavesthe chain specifically at this sequence once it has emergedinto the luminal spaceof the ER. After the signal sequencehas been cleaved,the growing polypeptide moves through the translocon into the ER lumen. The translocon remains open until translation is completed and the entire polypeptide chain has moved into the ER lumen. Electron microscopy of the Sec61complex isolated from the ER of eukaryotic cells reveals that three or four copies of Sec51acoassemblein the plane of the membrane.The functional significanceof this association between translocon channels is not understood at this time. but the oligomerization of translocon channels may facilitate the association between the translocon, signal peptidase, and other luminal protein complexes that participate in the translocation process.

ATPHydrolysisPowersPost-translational Translocationof SomeSecretoryProteins in Yeast In most eukaryotes,secretoryproteins enter the ER by cotranslationaltranslocation.In yeast,however,some secretory proteins enter the ER lumen after translation has been completed. In such post-translational translocation, the translocating protein passesthrough the sameSec61translocon that is used in cotranslational translocation. However, the SRP

M O V I N GP R O T E I NISN T O M E M B R A N E A SN D O R G A N E L L E S

(a) Side view

i

;

;n PIug

(b) Top view

P o r er i n g

Lateralexit to lipid bilayer

Plug removeo

EXPERIMENTAL FIGURE 13-8 Structureof a bacterialSec61 complex.Thestructure of thedetergent-solubilized Sec61 complex fromthearchaebacterium (alsoknownasthe Secy M jannaschl complex) wasdetermined (a)A sideview byx-raycrystallography showsthe hourglass-shaped channel throughthe centerof the pore A ringof isoleucine residues at theconstricted waistof the poremay forma gasketthat keepsthe channel sealed to smallmolecules even polypeptide asa translocating passes throughthechannelWhenno peptideispresent, translocating thechannel isclosedby a short plug,Thisplugisthoughtto moveout of thechannel helical during translocation Inthisviewthefronthalfof proteinhasbeenremoved to bettershowthe pore.(b)A viewlookingthroughthe centerof the channel showsa region(onthe leftside)wherehelices mayseparate allowinglateralpassage of a hydrophobic transmembrane domain intothe lipidbilayer. fromA R Osborne etal, 2005.Ann Rev. [Adapted CellDev.Biology 21:529l

and SRP receptor are not involved in post-translational translocation, and in such casesa direct interaction between the translocon and the signal sequenceof the completedprotein appears to be sufficient for targeting to the ER membrane. In addition, the driving force for unidirectional translocation acrossthe ER membraneis provided by an additional protein complex known as rhe Se;63 complex and a member of the Hsc70 family of molecular chaperonesknown as BiP.The tetrameric Sec63complex is embeddedin the ER membrane in the vicinity of the translocon. whereas BiP is

within the ER lumen. Like other members of the Hsc70 famlIy, BiP has a peptide-binding domain and an ATPasedomain. These chaperonesbind and stabilize unfolded or partially folded proteins(seeFigure3-15). The current model for post-translationaltranslocation of a protein into the ER is outlined in Figure 13-9. Once the Nterminal segmentof the protein enters the ER lumen, signal peptidase cleavesthe signal sequencejust as in cotranslational translocation (step [). Interaction of BiP.ATP with the luminal portion of the Sec53complex causeshydrolysis of the bound ATR producing a conformational change in BiP that promotes its binding to an exposed polypeptide chain (step [). Sincethe Sec63complex is located near the translocon, BiP is thus activated at sites where nascent polypeptidescan enter the ER. Certain experimentssuggest that in the absenceof binding to BiP, an unfolded polypeptide slides back and forth within the translocon channel. Such random sliding motions rarely result in the entire polypeptide'scrossingthe ER membrane. Binding of a molecule of BiP.ADP to the luminal portion of the polypeptide prevents backsliding of the polypeptide out of the ER. As further inward random sliding exposesmore of the polypeptide on the luminal side of the ER membrane. successive binding of BiP.ADP moleculesto the polypeptide chain acts as a ratchet, ultimately drawing the entire polypeptide into the ER within a few seconds(stepsB and 4). O" a slower time scale,the BiP molecules spontaneouslyexchangetheir bound ADP for ATP, leading to releaseof the polypeptide, which can then fold into its native conformation (steps E and 6). The recycled BiP.ATP then is ready for another interaction with Sec53.BiP and the Sec53complex are also required for cotranslational translocation. The details of their role in this process are not well understood, but they are thought to act at an early stageof the processsuch as threading the signal peptide into the pore of the translocon. The overall reaction carried out by BiP is an important example of how the chemical energy releasedby the hydrolysis of ATP can power the mechanical movement of a protein across a membrane. Bacterial cells also use an ATPdriven process for translocating completed proteins across the plasma membrane. In bacteria the driving force for translocation comes from a cytosolic ATPaseknown as the SecA protein. SecA binds to the cytoplasmic side of the translocon and hydrolyzes cytosolic AIP. By a mechanism that is not well understood, the SecA protein pushes segments of the polypeptide through the membrane in a mechanical cvcle coupled to the hvdrolvsis of ATP.

Translocation of Secretory Proteins Across t h e E RM e m b r a n e r Synthesisof secretedproteins, integral plasma-membrane proteins, and proteins destinedfor the ER, Golgi complex, or lysosome begins on cytosolic ribosomes,which become attachedto the membraneof the ER, forming the rough ER (seeFigure 13-1, left).

T R A N S L O C A T I OO NF S E C R E T O RPYR O T E I N A S C R O S ST H E E R M E M B R A N E

541

Translocating polypeptide chain

Translocon

ER lumen NHs* Cleaved s i gn a l sequenc

BiP (bound to ATP)

FIGURE 13-9 Post-translational Thismechanism translocation. isfairlycommonin yeastandprobably in higher occurs occasionally random eukaryotes Smallarrowsinside thetranslocon represent polypeptide slidingof thetranslocating inwardandoutwardSuccessive prevents bindingof BiP.ADP to entering segments of the polypeptide the chainfromslidingout towardthecytosol[See K E Matlack etal, 1997 277:938 . Science I

r The ER signal sequenceon a nascent secretory protein consistsof a segmentof hydrophobic amino acids, generally locatedat the N-terminus. r In cotranslational translocation, the signal-recognition particle (SRP) first recognizesand binds the ER signal sequenceon a nascent secretoryprotein and in turn is bound by an SRP receptor on the ER membrane, thereby targeting the ribosome/nascentchain complex to the ER. r The SRP and SRP receptor then mediate insertion of the nascent secretoryprotein into the translocon (Sec61complex). Hydrolysis of two moleculesof GTP by the SRP and its receptor drive this docking processand causethe dissociation of SRP(seeFigures13-5 and 13-6).As the ribosome attached to the translocon continues translation, the unfolded protein chain is extruded into the ER lumen. No additional energy is required for translocation. r The translocon contains a central channel lined with hydrophobic residues that allows transit of an unfolded protein chain while remaining sealedto ions and small hydrophilic molecules.In addition, the channel is gated so that it only is open when a polypeptide is being translocated.

542

CHAPTER 13

I

r In post-translational translocation, a completed secretory protein is targetedto the ER membrane by interaction of the signal sequencewith the translocon. The polypeptide chain is then pulled into the ER by a ratcheting mechanism that requires ATP hydrolysis by the chaperone BiP, which stabilizesthe enteringpolypeptide (seeFigure 13-9). In bacteria, the driving force for post-translational translocation comes from SecA,a cytosolic ATPasethat pushespolypeptides through the translocon channel. r In both cotranslational and post-translationaltranslocation, a signal peptidasein the ER membranecleavesthe ER signal sequencefrom a secretoryprotein soon after the Nterminus entersthe lumen.

lnsertionof Proteinsinto the ERMembrane In previous chapters we have encountered many of the vast array of integral (transmembrane)proteins that are present throughout the cell. Each such protein has a unique orientation with respectto the membrane'sphospholipid bilayer.

M O V I N GP R O T E I NISN T O M E M B R A N E A SN D O R G A N E L L E S

Integral membrane proteins located in the ER, Golgi, and lysosomes and also proteins in the plasma membrane, which are all synthesizedon the rough ER, remain embedded in the membrane in their unique orientation as they move to their final destinationsalong the same pathway followed by soluble secretory proteins (see Figure 13-1, left).During this transport, the orientation of a membrane protein is preserved;that is, the samesegmentsof the protein always face the cytosol, whereas other segments always face in the opposite direction. Thus the final orientation of these membrane proteins is establishedduring their biosynthesison the ER membrane.In this secrion,we first seehow integral proteins can interact with membranes and then examine how severaltypes of sequences,collectively known as topogenic sequences,direct the membrane insertion and orientation of various classesof integral proteins. Theseprocessesoccur via modifications of the basic mechanism used to translocatesoluble secretoryproteins acrossthe ER membrane.

SeveralTopologicalClassesof Integral MembraneProteinsAre Synthesized on the ER The topology of a membraneprotein refers to the number of times that its polypeptide chain spansthe membrane and the orientation of these membrane-spanning segmentswithin the membrane.The key elementsof a protein that determine

coo

Cytosol

its topology are membrane-spanningsegmentsthemselves, which usually are ct-helicescontaining 20-25 hydrophobic amino acids that contribute to energeticallyfavorable interactions within the hydrophobic interior of the phospholipid bilayer. Most integral membrane proteins fall into one of the four topological classesillustrated in Figure 13-10. Topological classesI, II, and III comprise single-passproteins, which have only one membrane-spanninga-helical segment. Type I proteins have a cleaved N-terminal ER signal sequenceand are anchored in the membrane with their hydrophilic N-terminal region on the luminal face (also known as the exoplasmic face) and their hydrophilic Cterminal region on the cytosolic face. Type II proteins do not contain a cleavableER signal sequenceand are oriented with their hydrophilic N-terminal region on the cytosolic face and their hydrophilic C-terminal region on the exoplasmic face (i.e., opposite to type I proteins). Type III proteins have the same orientation as type I proteins but do not contain a cleavablesignal sequence.These different topologies reflect distinct mechanismsused by the cell to establish the membrane orientation of transmembrane segments,as discussedin the next section. The proteins forming topological classIV contain two or more membrane-spanning segments and are sometimes called multipass proteins. For example, many of the membrane transport proteins discussedin Chapter 11 and the numerous G protein-coupled receptors covered in Chapter 15 belong to this class. A final type of membrane protein

NHst

ii,,ltla itirir Exoplasmic space (ERor Golgi lumen; cell exterior)

i Cleaved s i gn aI sequence

NHs'

Type I LDL receptor InfluenzaHA orotein Insulinreceoto'. Growth hormone receptor

Type ll Asialoglycoprotein receptor

Type lll

Type lV

Cytochromep450

Transferrinreceptor Golgi galactosyltransferase Golgi sialyltransferase

A FIGURE 13-10ERmembraneproteins.Fourtopological classes proteins of integral membrane aresynthesized on the roughERas wellasa fifthtypetethered to the membrane by a phospholipid proteins anchor. Membrane areclassified bytheirorientation in the membrane andthetypesof signals theycontainto directthemthere In classes l-lv the hydrophobic segments of the proteinchainformo helices embedded in the membrane bilayer; the regions outside the membrane arehvdrophilic andfold intovarious conformations. All

G protein-coupledreceptors Glucosetransporters Voltage-gatedCa2+channels A B C s m a l l m o l e c u l ep u m p s CFTR(Cl-) channel

N Hg*

GPI-linkedprotein Plasminogen activator receptor Fasciclinll

Sec61 proteins a helicesThetypelV havemultiple transmembrane typelV to thatof G protein-coupled herecorresponds topologydepicted on theexoplasmic sideof receptors: the N-terminus seveno helices, side.Othertype on the cytosolic the membrane, andthe C-terminus numberof helices andvarious lV proteins mayhavea different E Hartmann etal, andC-terminus. orientations of the N-terminus [See andS,D,Black, andC.A Brown 1989, ProcNat'lAcad.SciUSA86:5786, 1989,JBiol Chem254:44421 I N S E R T I OO N F P R O T E I NISN T OT H E E R M E M B R A N E

543

lacks a hydrophobic membrane-spanningsegment altogether; instead, these proteins are linked to an amphipathic phospholipid anchor that is embedded in the membrane (Figure 13-10, right).

Internal Stop-Transfer and Signal-Anchor S e q u e n c eD s e t e r m i n eT o p o l o g y o f S i n g l e - P a sPsr o t e i n s \Ve begin our discussionof how membraneprotein topology is determined with the membrane insertion of integral proteins that contain a single,hydrophobic membrane-spanning segment.Two sequencesare involved in targeting and orienting type I proteins in the ER membrane,whereastype II and type III proteins contain a single,internal topogenicsequence. As we will see,there are three main types of topogenic sequencesthat are used to direct proteins to the ER membrane and to orient them within it. We have alreadybeenintroduced to one, the N-terminal ER signalsequence.The other two, introduced here, are internal sequencesknown as stop-transfer anchor sequencesand signal-anchorsequences. Type I Proteins All type I transmembraneproteins possess an N-terminal signal sequencethat targetsthem to the ER as well as an internal hydrophobic sequencethat becomesthe membrane-spanninga helix. The N-terminal signal sequence

on a nascenttype I protein, like that of a secretoryprotein, initiates cotranslationaltranslocationof the protein through the combined action of the SRP and SRP receptor.Once the Nterminus of the growing polypeptide entersthe lumen of the ER, the signalsequenceis cleaved,and the growing chain continues to be extruded across the ER membrane. However, unlike the casewith secretoryproteins,when the sequenceof approximately 22 hydrophobic amino acidsthat will become a transmembrane domain of the nascent chain enters the translocon,it stopstransferofthe protein through the channel (Figure 13-11). The structure of the Sec61complex suggests that the channelmay be able to open like a clamshell,allowing the hydrophobic transmembranesegmentof the translocating peptide to move laterally betweenthe protein domains constituting the translocon wall (seeFigure 13-8). \Whenthe peptide exits the translocon in this manner, it becomesanchored in the phospholipid bilayer of the membrane.Because of the dual function of sucha sequenceto both stop passageof the polypeptidechain through the transloconand to becomea hydrophobic transmembranesegment in the membrane bilayer,it is called a stop-transferanchor sequence. Once translocation is interrupted, translation continues at the ribosome, which is still anchored to the now unoccupied and closedtranslocon. As the C-terminus of the protein chain is synthesized,it loops out on the cytosolic side of the membrane.When translationis completed,the ribosome is

Cytosol

Open translocon

'l,.il ji;i i lr,!t rl

'fr " Signal peptidase

Nascent polypeptide chain

Stop-transfer ancnor sequence

Cleaved s i gn aI sequence

ER lumen

NHs NH:

proteins. FIGURE 13-11Positioning type lsingle-pass Step[: Afterthe ribosome/nascent chaincomplex becomes associated with a translocon in the ERmembrane, the N-terminal signal sequence iscleaved Thisprocess occurs bythesamemechanism (seeFigure astheonefor soluble proteins secretory 13-6)Steps2, untilthe hydrophobic stop-transfer anchor B: Thechainiselongated sequence issynthesized andentersthe translocon, whereit prevents the nascent chainfromextruding fartherintothe ERlumen [email protected]: Thestop-transfer anchorsequence moveslaterally between 544

CHAPTER 13

I

NHs

in the phospholipid the translocon subunits andbecomes anchored probably bilayer. At thistime,thetranslocon closesStepS: As synthesis continues, theelongating chainmayloopout intothe andtranslocon cytosolthroughthe smallspacebetweenthe ribosome rscomplete, Step6: Whensynthesis the ribosomal subunits are released intothe cytosol, leaving the proteinfreeto diffusein the m e m b r a n[eS e e HD o e t a,l1 9 9 6C, e l8l 5 : 3 6 a9 n, d WM o t h e s e t,a1l9 9 7 , Cell89:523l

M O V I N GP R O T E I NISN T O M E M B R A N E A SN D O R G A N E L L E S

releasedfrom the translocon and the C-terminus of the newly synthesizedtype I protein remains in the cytosol. Support for this mechanism has come from studies in which cDNAs encoding various mutant receptorsfor human growth hormone (HGH) are expressedin cultured mammalian cells. The wild-type HGH receptor, a typical type I protein, is transported normally to the plasma membrane. However, a mutant receptor that has charged residues inserted into the single a-helical membrane-spanningsegment or that is missingmost of this segmentis translocatedentirely into the ER lumen and is eventually secretedfrom the cell as a soluble protein. These kinds of experimentsestablishthat the hydrophobic membrane-spanningo helix of the HGH receptor and of other type I proteins functions both as a stoptransfer sequenceand a membrane anchor that preventsthe C-terminus of the protein from crossingthe ER membrane. Type ll and Type lll Proteins Unlike type I proteins, type II and type III proteins lack a cleavableN-rerminal ER signalsequence.Instead, both possessa single internal hydrophobic signal-anchorsequencethat functions as both an ER signal sequenceand membrane-anchorsequence.Recall that type II

and type III proteins have opposite orientations in the membrane (seeFigure 13-10); this differencedependson the orientation that their respectivesignal-anchorsequencesassume within the translocon.The internal signal-anchorsequencein type II proteins directs insertion of the nascentchain into the ER membrane so that the N-terminus of the chain facesthe cytosol, using the sameSRP-dependentmechanismdescribed for signal sequences(Figure 13-l2a). However, the internal signal-anchorsequenceis not cleayedand moves laterally between the protein domains of the translocon wall into the phospholipid bilayer, where it functions as a membrane anchor.As elongationcontinues,the C-terminal region of the growing chain is extruded through the transloconinto the ER lumen by cotranslationaltranslocation. In the case of type III proteins, the signal-anchor sequence, which is located near the N-terminus, inserts the nascent chain into the ER membrane with its N-terminus facing the lumen, in the opposite orientation of the signal anchor in type II proteins. The signal-anchor sequenceof type III proteins also functions like a stop-transfer sequence and prevents further extrusion of the nascentchain into the ER lumen (Figure 13-12b). Continued elongation of the

(a)

(b)

E Nascent polypeptide chain NHs* NH:*

Cposol E

E

mRNA

coo + + +

ilttffi

i,ri:j;ii:l:,1

1ru,|i NH : *

SignalER lumen a n c n o r sequence

coo FIGURE 13-12Positioningtype ll and type ilt single-pass proteins.(a)Typell proteinsStep[: Afterthe internal signalanchorsequence issynthesized on a cytosolic ribosome, it isbound by an SRP(notshown), whichdirects the ribosome/nascent chain complex to the ERmembrane Thisissimilar to targeting of soluble proteins secretory exceptthatthe hydrophobic signalsequence is not located at the N-terminus andis notsubsequently cleavedThe nascent chainbecomes oriented in thetranslocon with itsN-terminal portiontowardthecytosolThisorientation isbelieved to be mediated by the positively charged residues shownN-terminal to thesignalanchorsequence StepE:As the chaintselongated andextruded i n t ot h el u m e nt,h ei n t e r n asli g n a l - a n c hmoorv e lsa t e r a lol yu to f t h e

bilayer. translocon andanchors the chainin the phospholipid iscompleted, theC-terminus of the StepB: Onceproteinsynthesis polypeptide subunits is released intothe lumen,andthe ribosomal Step[: Assembly arereleased intothe cytosol(b)Typelll proteins. pathway to thatof typell proteins exceptthatpositively isby a similar sequence charged residues on theC-terminal sideof thesignal-anchor withinthetranslocon segment to be oriented causethetransmembrane portionoriented to the cytosol andthe N-terminal with itsC-terminal s i d eo f t h ep r o t e i inn t h eE Rl u m e nS t e p [s, B : C h a i ne l o n g a t i o n portionof the proteiniscompleted in the cytosol, of theC-terminal arereleased. M Spiess andH F Lodish, andribosomal subunits [See 1986, Cell 44:177, and H Do et al , 1996, Ce//85:369 l

I N S E R T I OO N F P R O T E I NISN T OT H E E R M E M B R A N E

545

chain C-terminal to the signal-anchor/stop-transfer sequenceproceeds as it does for type I proteins, with the hydrophobic sequence moving laterally between the translocon subunits to anchor the polypeptide in the ER membrane(seeFigure 13-11). One of the features of signal-anchor sequencesthat appears to determine their insertion orientation is a high density of positively chargedamino acids adjacentto one end of the hydrophobic segment.For reasonsthat are not well understood,thesepositively chargedresiduestend to remain on the cytosolic side of the membrane, not traversing the membrane into the ER lumen. Thus the position of the charged residuesdictates the orientation of the signal-anchorsequencewithin the translocon as well as whether or not the rest of the polypeptide chain continues to pass into the ER lumen: type II proteins tend to have positively charged residues on the N-terminal side of their signal-anchor sequence,orienting the N-terminus in the cytosol and allowing passageof the C-terminal side into the ER (Figure 1.3-L2a), whereas type III proteins tend to have positively charged residues on the C-terminal side of their signal-anchor sequence,inserting the N-terminus into the translocon and restricting the C-terminus to the cytosol (Figure 13-1,2b). A striking experimental demonstration of the importance of the flanking charge in determining membrane ori-

entation is provided by neuraminidase,a type II protein in the surface coat of influenza virus. Three arginine residues are located just N-terminal to the internal signal-anchorsequencein neuraminidase.Mutation of thesethree positively charged residues to negatively charged glutamate residues causes neuraminidase to acquire the reverse orientation. Similar experimentshave shown that other proteins, with either type II or type III orientation, can be made to "flip" their orientation in the ER membrane by mutating charged residuesthat flank the internal signal-anchorsegment.

M u l t i p a s sP r o t e i n sH a v eM u l t i p l eI n t e r n a l TopogenicSequences Figure 13-13 summarizesthe arrangementsof topogenic sequencesin single-passand multipass transmembrane proteins. In multipass (type IV) proteins, each of the membrane-spanninga helices acts as a topogenic sequence in the ways that we have already discussed:they can act to direct the protein to the ER, to anchor the protein in the ER membrane, or to stop transfer of the protein through the membrane. Multipass proteins fall into one of two types depending on whether the N-terminus extends into the cytosol or the exoplasmicspace(e.g.,the ER lumen, cell exterior). This N-terminal topology usually is determined

STA= Internalstop-transferanchorsequence SA = Internalsignal-anchorsequence

(a) Type I

( b ) T y p el l

N H 3 +Signal sequence

NH:*

(c) Type lll

NHs*

(d)Type lV-A

NHs*

coo STA

+++

coo SA

coo

+++ SA Cvtosol

Lumen COO

STA

SA

Lumen

(e) Type lV-B

Cytosol

C H A P T E R1 3

Cytosol

Lumen

+++

I

STA

SA

Cytosol

Lumen

NHqt

STA

546

sequences determine < FIGURE 13-13Topogenic orientationof ERmembraneproteins.Topogenic hydrophilic sequences areshownin red;soluble, portions sequences form in blue Theinternal topogenic or cthelices thatanchorthe proteins transmembrane of proteinsin the membrane(a)TypeI proteins segments anda singleinternal signalsequence containa cleaved (b, c)Typell andtypelll stop-transfer anchor(STA). (SA) proteins signal-anchor containa singleinternal in theorientation of these Thedifference sequence. proteins depends largely on whetherthereisa high charged aminoacids(+ + +) on density of positively (typell)or on sideof the SAsequence the N-termrnal (typelll).(d,e) SA sequence sideof the the C-terminal proteins lacka cleavable signal Nearly all multipass in theexamples shownhere. asdepicted sequence, facesthe cytosol, TypelV-Aproteins, whoseN-terminus typell S sequences andSTA containalternating TypelV-Bproteins, whoseN-terminus faces sequences followedby the lumen,beginwith a typelllSAsequence Proteins typell SAand STAsequences of alternating (oddor eachtypewith differentnumbersof ct helices even)areknown

Lumen

COO

+++ SA

STA

MOVINGPROTEINS INTO MEMBRANES AND ORGANELLES

Cytosol

SA

STA

by the hydrophobic segment closest to the N-terminus and the charge of the sequencesflanking it. lf a type IV protein has an euen number of transmembrane cr helices, both its N-terminus and C-terminus will be oriented toward the same side of the membrane (Figure 13-13d). Conversely, if a type IV protein has an odd number of a helices, its two ends will have opposite orientations ( F i g u r e1 3 - 1 3 e ) . Type lV Proteins with N-Terminus in Cytosol Among the multipass proteins whose N-terminus extends into the cytosol are the various glucose transporters (GLUTs) and most ion-channel proteins, discussedin Chapter 11. In these proteins, the hydrophobic segmentclosestto the N-terminus initiates insertion of the nascent chain into the ER membrane with the N-terminus oriented toward the cytosol; thus this a-helical segment functions like the internal signalanchor sequenceof atype II protein (seeFigure 13-12a).As the nascent chain following the first a helix elongates, it moves through the translocon until the secondhydrophobic a helix is formed. This helix prevents further extrusion of the nascentchain through the translocon;thus its function is similar to that of the stop-transferanchor sequencein a type I p r o t e i n ( s e eF i g u r e1 3 - 1 1 ) . After synthesisof the first two transmembranecl helices, both ends of the nascentchain face the cytosol and the loop between them extends into the ER lumen. The C-terminus of the nascentchain then continues ro grow into the cytosol, as it does in synthesis of type I and type III proteins. According to this mechanism,the third a helix acts as another type II signal-anchor sequenceand the fourth as another stop-transferanchor sequence(Figure 13-13d). Apparently, once the first topogenic sequenceof a multipass polypeptide initiates associationwith the translocon, the ribosome remains attached to the translocon, and topogenic sequences that subsequentlyemerge from the ribosome are threaded into the translocon without the need for the SRP and the SRP receptor. Experiments that use recombinant DNA techniques to exchangehydrophobic cr heliceshave provided insight into the functioning of the topogenic sequencesin type IV-A multipass proteins. Theseexperimentsindicate that the order of the hydrophobic a helicesrelative to each other in the growing chain largely determineswhether a given helix functions as a signal-anchor sequenceor stop-transfer anchor sequence. Other than its hydrophobicitS the specific amino acid sequenceof a particular helix has little bearing on its function. Thus the first N-terminal a helix and the subsequent odd-numbered ones function as signal-anchor sequences,whereas the intervening even-numberedhelices function as stop-transferanchor sequences. Type lV Proteins with N-Terminus in the Exoplasmic Space The large family of G protein-coupled receptors,all of which contain seventransmembranect helices,constitute the most numerous type IV-B proteins, whose N-terminus extends into the exoplasmic space.In theseproteins, the hy-

drophobic ct helix closestto the N-terminus often is followed by a cluster of positively charged amino acids, similar to a As a retype III signal-anchorsequence(seeFigure 1,3-1,2b)'. sult, the first a helix inserts the nascent chain into the translocon with the N-terminus extending into the lumen (seeFigure 13-13e).As the chain is elongated,it is inserted into the ER membrane by alternating type II signal-anchor sequencesand stop-transfer sequences,as just describedfor type IV-A proteins.

A PhospholipidAnchor TethersSomeCellSurfaceProteinsto the Membrane Somecell-surfaceproteins are anchored to the phospholipid bilayer not by a sequenceof hydrophobic amino acids but by a covalently attached amphipathic molecule, glycosylphosphatidylinositol (GPI) (Figure 1.3-1.4aand Chapter 10). These proteins are synthesizedand initially anchored to the ER membrane exactly like type I transmembrane proteins, with a cleavedN-terminal signal sequenceand internal stoptransfer anchor sequencedirecting the process (see Figure 13-11).However,a short sequenceof amino acidsin the luminal domain, adjacent to the membrane-spanningdomain, is recognizedby a transamidaselocated within the ER membrane. This enzymesimultaneously cleavesoff the original stop-transferanchor sequenceand transfersthe luminal portion of the protein to a preformed GPI anchor in the membrane (Figure 1.3-'1.4b). \X/hy change one type of membrane anchor for another? Attachment of the GPI anchor, which results in removal of the cytosol-facing hydrophilic domain from the Proteinswith GPI protein, can have severalconsequences. anchors, for example, can diffuse relatively rapidly in the plane of the phospholipid bilayer membrane. In contrast, many proteins anchored by membrane-spanningct helices are impeded from moving laterally in the membrane becausetheir cytosol-facing segments interact with the cytoskeleton. In addition, the GPI anchor targets the attachedprotein to the apical domain of the plasma membrane in certain polarized epithelial cells, as we discussin C h a p t e r1 4 .

The Topologyof a MembraneProteinOften Can Be Deducedfrom lts Sequence As we have seen,various topogenic sequencesin integral membrane proteins synthesizedon the ER govern interac'When sciention of the nascent chain with the translocon. tists begin to study a protein of unknown function, the identification of potential topogenic sequenceswithin the corresponding gene sequencecan provide important clues about the protein's topological class and function. Suppose, for example, th