
26,912 5,027 263MB
Pages 1406 Page size 252 x 318.24 pts Year 2010
Ninth Edition
Biology Kenneth A. Mason University of Iowa
Jonathan B. Losos Harvard University
Susan R. Singer Carleton College
based on the work of Peter H. Raven Director, Missouri Botanical Gardens; Engelmann Professor of Botany, Washington University George B. Johnson Professor Emeritus of Biology, Washington University
rav32223_fm_AP_i-xxviii.indd i
12/4/09 11:08:17 AM
Reinforced Binding What does it mean?
BIOLOGY, NINTH EDITION Published by McGraw-Hill, a business unit of The McGraw-Hill Companies, Inc., 1221 Avenue of the Americas, New York, NY 10020. Copyright © 2011 by The McGraw-Hill Companies, Inc. All rights reserved. Previous editions © 2008, 2007, and 2005. No part of this publication may be reproduced or distributed in any form or by any means, or stored in a database or retrieval system, without the prior written consent of The McGraw-Hill Companies, Inc., including, but not limited to, in any network or other electronic storage or transmission, or broadcast for distance learning. Some ancillaries, including electronic and print components, may not be available to customers outside the United States. This book is printed on acid-free paper. 1 2 3 4 5 6 7 8 9 0 DOW/DOW 1 0 9 8 7 6 5 4 3 2 1 0
This textbook is widely adopted by colleges and universities yet it is frequently used in high school for teaching Advanced Placement*, honors and electives courses. Since high schools frequently adopt for several years, it is important that a textbook can withstand the wear and tear of usage by multiple students. To ensure durability, McGraw-Hill has elected to manufacture this textbook in compliance with the “Manufacturing Standards and Specifications for Textbook Administrators” (MSST) published by the National Association of State Textbook Administrators (NASTA). The MSST manufacturing guidelines provide minimum standards for the binding, paper type, and other physical characteristics of a text with the goal of making it more durable. *Pre-AP, AP and Advanced Placement program are registered trademarks of the College Entrance Examination Board, which was not involved in the production of and does not endorse these products.
ISBN 978–0–07–893649–4 MHID 0–07–893649–7 Vice President, Editor-in-Chief: Marty Lange Vice President, EDP: Kimberly Meriwether David Publisher: Janice Roerig-Blong Director of Development: Kristine Tibbetts Director of Development: Elizabeth Sievers Senior Developmental Editor: Lisa Bruflodt Senior Developmental Editor: Rose M. Koos Marketing Director: Patrick E. Reidy Lead Project Manager: Sheila M. Frank Senior Production Supervisor: Kara Kudronowicz Senior Media Project Manager: Tammy Juran Senior Designer: David W. Hash Interior Designer: Christopher Reese (USE) Cover Image: computer generated model of DNA molecules, ©Doug Struthers/Stone/Getty Images, Inc.; water lily, ©Chad Kleitsch/Science Faction/Corbis; Galapagos giant tortoise, ©Digital Vision/PunchStock; retrovirus, conceptual computer artwork, ©PASIEKA/SPL/Science Photo Library/Getty Images, Inc.; studio shot of purple Lathyrus, sweet pea flower, ©Polina Plotnikova/Red Cover/Getty Images, Inc.; seated Orangutan reaching up, ©Dave King/Dorling Kindersley/Getty Images, Inc. Senior Photo Research Coordinator: Lori Hancock Photo Research: Danny Meldung/Photo Affairs, Inc Art Studio: Electronic Publishing Services Inc., NYC Compositor: Electronic Publishing Services Inc., NYC Typeface: 10/12 Janson Printer: R. R. Donnelley All credits appearing on page or at the end of the book are considered to be an extension of the copyright page. Library of Congress Cataloging-in-Publication Data Biology / Peter H. Raven ... [et al.]. -- 9th ed. p. cm. Includes index. ISBN 978–0–07–893649–4 — ISBN 0–07–893649–7 (hard copy : alk. paper) 1. Biology. I. Raven, Peter H. QH308.2.R38 2011 570--dc22 2009034491
www.mhhe.com
rav32223_fm_AP_i-xxviii.indd ii
12/4/09 11:08:18 AM
Brief Contents
Preface
Guided Tour Contents
Part
29 30 31 32 33 34 35
v x
xxi
I The Molecular Basis of Life
1
1 The Science of Biology 1 2 The Nature of Molecules and the Properties of Water 3 The Chemical Building Blocks of Life 33
Part 4 5 6 7 8 9 10
II
The Biology of the Cell
III Genetic and Molecular Biology
207
20 21 22 23 24 25
IV Evolution
V The Diversity of Life
26 The Tree of Life 507 27 Viruses 528 28 Prokaryotes 545
507
456
55 56 57 58 59 60
729
VII Animal Form and Function
863
The Animal Body and Principles of Regulation 863 The Nervous System 887 Sensory Systems 915 The Endocrine System 937 The Musculoskeletal System 961 The Digestive System 981 The Respiratory System 1001 The Circulatory System 1018 Osmotic Regulation and the Urinary System 1038 The Immune System 1055 The Reproductive System 1084 Animal Development 1105
Part
396
Genes Within Populations 396 The Evidence for Evolution 417 The Origin of Species 436 Systematics and the Phylogenetic Revolution Genome Evolution 474 Evolution of Development 492
Part
43 44 45 46 47 48 49 50 51 52 53 54
VI Plant Form and Function
Plant Form 729 Vegetative Plant Development 753 Transport in Plants 769 Plant Nutrition and Soils 786 Plant Defense Responses 802 Sensory Systems in Plants 814 Plant Reproduction 839
Part
11 Sexual Reproduction and Meiosis 207 12 Patterns of Inheritance 221 13 Chromosomes, Mapping, and the Meiosis–Inheritance Connection 239 14 DNA: The Genetic Material 256 15 Genes and How They Work 278 16 Control of Gene Expression 304 17 Biotechnology 327 18 Genomics 352 19 Cellular Mechanisms & Development 372
Part
Part 36 37 38 39 40 41 42
59
Cell Structure 59 Membranes 88 Energy and Metabolism 107 How Cells Harvest Energy 122 Photosynthesis 147 Cell Communication 168 How Cells Divide 186
Part
17
Protists 567 Green Plants 588 Fungi 614 Overview of Animal Diversity 633 Noncoelomate Invertebrates 649 Coelomate Invertebrates 666 Vertebrates 693
VIII Ecology and Behavior
Behavioral Biology 1132 Ecology of Individuals and Populations Community Ecology 1185 Dynamics of Ecosystems 1207 The Biosphere 1230 Conservation Biology 1256
1132 1162
Appendix A A-1 Glossary Credits Index
G-1 C-1
I-1 iii
rav32223_fm_AP_i-xxviii.indd iii
11/23/09 3:01:19 PM
About the Authors Kenneth Mason is a lecturer at the University of Iowa where he teaches introductory biology. He was formerly at Purdue University where for 6 years he was responsible for the largest introductory biology course on campus and collaborated with chemistry and physics faculty on an innovative new course supported by the National Science Foundation that combined biology, chemistry, and physics. Prior to Purdue, he was on the faculty at the University of Kansas for 11 years, where he did research on the genetics of pigmentation in amphibians, publishing both original work and reviews on the topic. While there he taught a variety of courses, was involved in curricular issues, and wrote the lab manual for an upper division genetics laboratory course. His latest move to the University of Iowa was precipitated by his wife’s being named president of the Pictured left to right: Susan Rundell Singer, Jonathan Losos, Kenneth Mason
University of Iowa.
Jonathan Losos is the Monique and Philip Lehner Professor for the Study of Latin America in the Department of Organismic and Evolutionary Biology and curator of herpetology at the Museum of Comparative Zoology at Harvard University. Losos’s research has focused on studying patterns of adaptive radiation and evolutionary diversification in lizards. The recipient of several awards, including the prestigious Theodosius Dobzhanksy and David Starr Jordan Prizes, and the Edward Osborne-Wilson Naturalist Award. Losos has published more than 100 scientific articles.
Susan Rundell Singer is the Laurence McKinley Gould Professor of the Natural Sciences in the department of biology at Carleton College in Northfield, Minnesota, where she has taught introductory biology, plant biology, genetics, plant development, and developmental genetics for 23 years. Her research interests focus on the development and evolution of flowering plants. Singer has authored numerous scientific publications on plant development, contributed chapters to developmental biology texts, and is actively involved with the education efforts of several professional societies. She received the American Society of Plant Biology’s Excellence in Teaching Award, serves on the National Academies Board on Science Education, and chaired the National Research Council study committee that produced America’s Lab Report.
iv
rav32223_fm_AP_i-xxviii.indd iv
11/23/09 3:01:19 PM
Committed To Excellence
T
his edition continues the evolution of the new Raven & Johnson’s Biology. The author team is committed to continually improving the text, keeping the student and learning foremost. We have an improved design and updated pedagogical features to complement the new art program and completely revised content of the transformative eighth edition of Biology. This latest edition of the text maintains the clear, accessible, and engaging writing style of past editions while maintaining the clear emphasis on evolution and scientific inquiry that made this a leading textbook for students majoring in biology. This emphasis on the organizing power of evolution is combined with a modern integration of the importance of cellular and molecular biology and genomics to offer our readers a text that is student-friendly while containing current content discussed from the most modern perspective. We are committed to producing the best possible text for both student and faculty. Lead author, Kenneth Mason (University of Iowa) has taught majors biology at three different major public universities for more than 15 years. Jonathan Losos (Harvard University) is at the cutting edge of evolutionary biology research and has taught evolutionary biology to both biology majors and nonmajors students. Susan Rundell Singer (Carleton College) has been deeply involved in science education policy issues on a national level. The extensive nature of the revision for the eighth edition allowed the incorporation of the most current possible content throughout. This has been continued in the ninth edition. Here we provide a more consistent approach to concepts so that the reader is not buried in detail in one chapter and left wondering how something works in another. In all chapters, we provide a modern perspective emphasizing the structure and function of macromolecules and the evolutionary process that has led to this structure and function. This modern approach is illustrated with two examples. First, genomics are not given one chapter and otherwise ignored. Instead, results from the analysis of genomes are presented in context across the text. It is important that these results are provided in the context of our traditional approaches and not just lumped into a single chapter. We do not ignore the unique features of this approach and therefore provide two chapters devoted to genomics and to genome evolution. A second example is expanded coverage of noncoding RNA. It is hard to believe how rapidly miRNA have moved from a mere curiosity to a major topic in gene expression. We have included both new text and graphics on this important topic. The results from complete genome sequencing have highlighted this important category of RNA that was largely ignored in past texts.
The revised physiology unit has been further updated to strengthen the evolutionary basis for understanding this section. The single chapter on circulation and respiration has been broken into two to provide a more reasonable amount of material for the student in each chapter. The coverage of temperature regulation has also been moved to the introductory chapter 43: The Animal Body and Principles of Regulation to provide a concrete example of regulation. All of this should enhance readability for the student as well as integrate this material even closer with the rest of the text. The entire approach throughout the text is to emphasize important biological concepts. This conceptual approach is supported by an evolutionary perspective and an emphasis on scientific inquiry. Rather than present only dry facts, our conceptual view combines an emphasis on scientific inquiry.
Our Consistent Themes It is important to have consistent themes that organize and unify a text. A number of themes are used throughout the book to unify the broad-ranging material that makes up modern biology. This begins with the primary goal of this textbook to provide a comprehensive understanding of evolutionary theory and the scientific basis for this view. We use an experimental framework combining both historical and contemporary research examples to help students appreciate the progressive and integrated nature of science.
Biology Is Based on an Understanding of Evolution When Peter Raven and George Johnson began work on Biology in 1982 they set out to write a text that presented biology the way they taught in their classrooms—as the product of evolution. We bear in mind always that all biology “only makes sense in the light of evolution;” so this text is enhanced by a consistent evolutionary theme that is woven throughout the text, and we have enhanced this theme in the ninth edition. The enhanced evolutionary thread can be found in obvious examples such as the two chapters on molecular evolution, but can also be seen throughout the text. As each section considers the current state of knowledge, the “what” of biological phenomenon, they also consider how each system may have arisen by evolution, the “where it came from” of biological phenomenon. We added an explicit phylogenetic perspective to the understanding of animal form and function. This is most obvious in the numerous figures containing phylogenies in the form and function chapters. The diversity material is supported by the most up-to-date approach to phylogenies of both
v
rav32223_fm_AP_i-xxviii.indd v
11/23/09 3:01:19 PM
animals and plants. Together these current approaches add even more evolutionary support to a text that set the standard for the integration of evolution in biology. Our approach allows evolution to be dealt with in the context in which it is relevant. The material throughout this book is considered not only in terms of present structure and function, but how that structure and function may have arisen via evolution by natural selection.
Biology Uses the Methods of Scientific Inquiry Another unifying theme within the text is that knowledge arises from experimental work that moves us progressively forward. The use of historical and experimental approaches throughout allow the student not only to see where the field is now, but more importantly, how we arrived here. The incredible expansion of knowledge in biology has created challenges for authors in deciding what content to keep, and to what level an introductory text should strive. We have tried to keep as much historical context as possible and to provide this within an experimental framework consistently throughout the text. We use a variety of approaches to expose the student to scientific inquiry. We use our new Scientific Thinking figures to walk through an experiment and its implications. These figures always use material that is relevant to the story being told. Data are also provided throughout the text, and other figures illustrate how we arrived at our current view of the topics that make up the different sections. Students are provided with Inquiry Questions to stimulate thinking about the material throughout the book. The questions often involve data that are presented in figures, but are not limited to this approach, also leading the student to question the material in the text as well.
Biology Is an Integrative Science The explosion of molecular information has reverberated throughout all areas of biological study. Scientists are increasingly able to describe complicated processes in terms of the
This chapter covers one of the fastest-progressing fields in biology. It must cover fundamental topics as well as a wide variety of real and potential applications of the technology. The chapter does all of this well. There is good continuity from one section to the next, which I find important to make the text “readable.” Michael Lentz University of North Florida
interaction of specific molecules, and this knowledge of life at the molecular level has illuminated relationships that were previously unknown. Using this cutting-edge information, we more strongly connect the different areas of biology in this edition. One example of this integration concerns the structure and function of biological molecules—an emphasis of modern biology. This edition brings that focus to the entire book, using this as a theme to weave together the different aspects of content material with a modern perspective. Given the enormous amount of information that has accumulated in recent years, this emphasis on structure and function provides a necessary thread integrating these new perspectives into the fabric of the traditional biology text. Although all current biology texts have added a genomics chapter, our text was one of the first to do so. This chapter has been updated, and we have added a chapter on the evolution of genomes. More importantly, the results from the analysis of genomes and the proteomes they encode have been added throughout the book wherever this information is relevant. This allows a more modern perspective throughout the book rather than limiting it to a few chapters. Examples, for instance, can be found in the diversity chapters, where classification of some organisms were updated based on new findings revealed by molecular techniques. This systems approach to biology also shows up at the level of chapter organization. We introduce genomes in the genetics section in the context of learning about DNA and genomics. We then come back to this topic with an entire chapter at the end of the evolution unit where we look at the evolution of genomes, followed by a chapter on the evolution of development, which leads into our unit on the diversity of organisms. Similarly, we introduce the topic of development with a chapter in the genetics section, return to it in the evolution unit, and dedicate chapters to it in both the plant and animal units. This layering of concepts is important because we believe that students best understand evolution, development, physiology, and ecology when they can reflect on the connections between the microscopic and macroscopic levels of organization. We’re excited about how we moved the previous high-quality textbook forward in a significant way for a new generation of students. All of us have extensive experience teaching undergraduate biology, and we’ve used this knowledge as a guide in producing a text that is up to date, beautifully illustrated, and pedagogically sound for the student. We’ve also worked to provide clear explicit learning objectives, and more closely integrate the text with its media support materials to provide instructors with an excellent complement to their teaching.
Ken Mason, Jonathan Losos, Susan Rundell Singer
vi
committed to excellence
rav32223_fm_AP_i-xxviii.indd vi
11/23/09 3:01:20 PM
Cutting Edge Science Changes to the Ninth Edition Part I: The Molecular Basis of Life The material in this section does not change much with time. However, we have updated it to make it more friendly to the student. The student is introduced to the pedagogical features that characterize the book here: learning objectives with various levels of cognitive difficulty, scientific thinking figures, and an integrated approach to guide the student through complex material. In chapter 1, the idea of emergent properties has been clarified and material added to emphasize the nonequilibrium nature of biology. This will help introduce students to the fundamental nature of biological systems and prepare them for the rest of the book. Part II: Biology of the Cell The overall organization of this section was retained, but material on cell junctions and cell-to-cell interactions was moved from chapter 9 to chapter 4, where it forms a natural conclusion to cell structure. Within chapter 4 microsome/ peroxisome biogenesis was clarified to complete the picture of cell structure. The nature of trans fats is clarified, a subject students are likely to have been exposed to but not understand. A brief discussion of the distribution of lipids in different membranes was also added. Chapter 7 — The organization of chapter 7 was improved for greater clarity. ATP structure and function is introduced earlier, and the opening summary section covering all of respiration was removed. This allows the information to unfold in a way that is easier to digest. A new analogy was added for the mechanism of ATP synthase to make this difficult enzyme more approachable. Chapter 8 — The section on bacterial photosynthesis was completely rewritten for clarity and accuracy. In addition to the emphasis we always had on the experimental history of photosynthesis, the scientific thinking figures for chapters 7 and 8 are complementary and cross referenced to reinforce how we accumulate evidence for complex phenomenon such as chemiosmosis. Chapter 9 — The removal of the cell junction material keeps the focus of chapter 9 on signaling through receptors, making this difficult topic more accessible. The distribution of G protein-coupled receptor genes in humans and mouse was updated. Chapter 10 — The discussion of bacterial cell division was updated again to reflect the enormous change in our view of this field. The organization of the chapter was tightened, by combining mitosis and cytokinesis as M phase. Not only is this a consensus view in the field, it simplifies the overall organization for greater clarity.
Part III: Genetic and Molecular Biology The overall organization of this section remains the same. The splitting of transmission genetics into two chapters allows students to first be introduced to general principles, then tie these back to the behavior of chromosomes and the more complex topics related to genetic mapping. Content changes in the molecular genetics portion of this section are intended to do two things: (1) update material that is the most rapidly changing in the entire book, and (2) introduce the idea that RNA plays a much greater role now than appreciated in the past. The view of RNA has undergone a revolution that is underappreciated in introductory textbooks. This has led to a complete updating of the section in chapter 16 on small RNAs complete with new graphics to go with the greatly expanded and reorganized text. This new section should both introduce students to exciting new material and organize it so as to make it coherent with the rest of the chapter. The new material is put into historical context and updated to distinguish between siRNA and miRNA, and the mechanisms of RNA silencing. Material on the classical bacterial operons trp and lac was also refined for greater clarity. Chapter 11 — The information on meiotic cohesins and protection of cohesins during meiosis I was clarified and updated. This is critical for students to understand how meiosis actually works as opposed to memorizing a series of events. Chapter 12 — The second example of epistasis, which did not have graphical support in the eighth edition, was removed. This allows the remaining example to be explored in greater detail. The organization of the explication of Mendel’s principles was tightened to improve clarity. Chapter l4 —Material on the eukaryotic replisome was updated and the graphics for this refined from the last edition. Archaeal replication proteins are also introduced to give the student a more complete view of replication. Chapter 15 —Has been tightened considerably. The example of sickle cell anemia was moved from chapter l3 to 15, where it fits more naturally in a discussion of how mutations affect gene function. Chapter 17 — Our goal is to help students apply what they’ve learned about molecular biology to answering important biological questions. This chapter has been revised to balance newer technologies with approaches that continue to be used in both the research and education communities. RNAi applications to diseases like macular degeneration and next-generation sequencing technology are introduced by building on what the student already knows about DNA replication, transcription, and PCR. Chapter 18 — Our book is unique in having two chapters on genomes. The first extends the molecular unit to the scale of whole genomes, and chapter 24 focuses
committed to excellence
rav32223_fm_AP_i-xxviii.indd vii
vii
11/23/09 3:01:20 PM
on comparative genomics after students have learned about evolution. This organization is core to our full integration of evolution throughout the book. Chapter 18 has been revised to demonstrate the broad relevance of genomics, from understanding the evolution of speech to identifying the source of the 2001 anthrax attacks. Chapter 19 — The material on stem cells was completely rewritten and updated. The content was reorganized to put it into an even more solid historical context using the idea of nuclear reprogramming, and how this led to both the cloning of mammals and embryonic stem cells. New information on induced pluripotent stem cells is included to keep this as current as possible. This topic is one that is of general interest and is another subject about which students have significant misinformation. We strove to provide clear, wellorganized information. Part IV: Evolution The evolution chapters were updated with new examples. A strong emphasis on the role of experimental approaches to studying evolutionary phenomena has been maintained and enhanced. Chapter 20 — The various processes that can lead to evolutionary change within populations are discussed in detail. Notably, these processes are not considered in isolation, but explored through how they interact. Chapter 21 — This chapter presents a state-of-the-art discussion of the power of natural selection to produce evolutionary change and the ever-increasing documentation in the fossil record of evolutionary transitions through time. It also discusses a variety of phenomena that only make sense if evolution has occurred and concludes with a critique of arguments posed against the existence of evolution. Chapter 22 — The process of speciation and evolutionary diversification is considered in this chapter. It includes current disagreements on how species are identified and how speciation operates. Chapter 23 — An up-to-date discussion of not only how phylogenies are inferred, but their broad and central role in comparative biology is the focus of chapter 23. Chapter 24 — This chapter has been revised to incorporate the rapidly growing number of fully sequenced genomes in a conceptual manner. We included the paradigm-changing findings that noncoding DNA plays a critical role in regulating DNA expression. This chapter and chapter 25 illustrate how we integrate both evolution and molecular biology throughout our text. Chapter 25 — With updated examples we explore the changing perspectives on the evolution of development. Specifically, the field is shifting away from the simplified view that changes in regulatory regions of genes are responsible for the evolution of form. viii
Part V: Diversity of Life on Earth In revising the diversity chapters (protist, plants, and fungi) our emphasis was on integrating an evolutionary theme. The fungi chapter was restructured to reflect the current phylogenies while keeping species that are familiar to instructors at the fore. While competitors have two plant diversity chapters, we have one. We integrated the diversity of flowers and pollination strategies, as well as fruit diversity into the plant unit to enable students to fully appreciate morphological diversity because they have already learned about plant structure and development. Chapter 26 — This chapter has been updated so instructors have the option of using it as a stand-alone diversity chapter if their syllabus is too crowded to include the extensive coverage of diversity in the unit. Endosymbiosis has been consolidated in this chapter (moving some of the content from chapter 4). Chapter 27 — Material on archaeal viruses was added to incorporate this area of active research that is often ignored. The approach to HIV drug treatments was completely redone with revised strategies and updated graphics. The discussions of prions and viroids were also revised. Chapter 28 — All health statistics in chapter 28 were updated, including information on TB, HIV and STDs. A discussion on archaeal photosynthesis was added to the section on microbial metabolism. Chapter 30 — Findings of several plant genome projects informed the revision of the plant chapter. The remarkable desiccation tolerance of moss is emphasized in a Scientific Thinking figure exploring the genes involved in desiccation tolerance. New findings on correlations between the rate of pollen tube growth and the origins of the angiosperms have also been integrated into the chapter. Chapter 31 — Since the previous edition, much has been learned about the evolution of fungi, fundamentally changing relationships among groups. We revised the fungal phylogenies in this chapter to conform with the current understanding of fungal evolution, while contextualizing the older taxonomic groupings that may be more familiar to some readers. Chapters 32–34 — These chapters have been completely overhauled to emphasize the latest understanding, synthesizing molecular and morphological information, on the phylogeny of animals. We refocused these chapters to emphasize the differences in major morphological, behavioral, and ecological features that differentiate the major animal groups, placing a strong emphasis on understanding the organism in the context of its environment. Chapter 32 is an overview, which could be used as a standalone chapter, setting the stage for Chapters 33 on non-coelomate animals and Chapter 34 on coelomates. Chapter 35 — This chapter on vertebrates was revised to incorporate current ideas on vertebrate phylogeny and to emphasize the phylogenetic approach to understanding evolutionary diversification.
committed to excellence
rav32223_fm_AP_i-xxviii.indd viii
11/23/09 3:01:20 PM
Part VI: Plant Form and Function As with the animal unit we incorporated an evolutionary theme. In the Scientific Thinking figures, as well as the text, we challenge the students to combine morphological, developmental, and molecular approaches to asking questions about plants. The goal is to help students integrate their conceptual understanding over multiple levels of organization. In addition, most of the questions at the end of the chapter are new. Chapter 36 — The section on leaf development has been updated to include a molecular analysis of the role of a key gene, UNIFOLIATA, in compound leaf development. Chapter 39 — Throughout the unit we included relevant examples to illustrate core concepts in plant biology. Here we added information about the effect of pH on germination and included a Scientific Thinking figure to more fully engage the student in considering pH effects in an agricultural context. The discussion of elevated CO2 levels and increased temperatures on plant growth was updated. The very complex interactions affecting carbon and nitrogen content in plants is addressed at the level of plant and cell physiology. In addition, they are discussed at the ecosystem level later in the text in a more coherent presentation of the effects of climate change. Chapter 41 — The section of phytochrome was reorganized and updated. The emphasis is on guiding the student away from the historic examples of morphological responses to different day lengths to a clear, coherent understanding of how red and far red light affect the conformation of phytochrome and the signaling pathway it affects. Part VII: Animal Form and Function Several organizational changes were made to this section to enhance overall coherence. The entire section was reinterpreted with the intent of better integrating evolution into all topics. The material on temperature regulation was moved from chapter 50 (8E) to the introductory chapter 43. This both provides an illustrative example to the introduction to homeostasis and removes a formerly artificial combination of temperature control and osmotic control. Respiration and circulation were made into separate chapters (49 and 50), allowing for greater clarity and removing an overly long chapter that was a barrier to understanding. Chapter 44 — The material on synaptic plasticity was rewritten with new graphics added. And in chapter 46 the addition of learning objectives and our integrated pedagogical tools make a complex topic more approachable. A new Scientific Thinking figure was added as well.
Chapter 51 — The osmotic regulation material in this chapter is more coherent as a separate section without the temperature regulation material. Chapter 52 — This chapter was reorganized and restructured to emphasize the existence of innate versus adaptive immunity. This replaces the old paradigm of nonspecific versus specific immunity. This reorganization and new material also emphasize the evolutionary basis of innate immunity, which exists in invertebrates and vertebrates. Chapter 54 — The material on organizer function was updated. The Scientific Thinking figure uses molecular approaches introduced in part III and a figure that was already in the chapter. This figure is much more pedagogically useful in this repurposing than as a static figure and illustrates the use of these figures. Part VIII: Ecology and Behavior The ecology chapters have been revised with a particular focus on providing up-to-date information on current environmental issues, both in terms of the problems that exist and the potential action that can be taken to ameliorate them. Chapter 55 — Completely revised with a strong emphasis on neuroethological approaches to understanding behavioral patterns, this chapter emphasizes modern molecular approaches to the study of behavior. Chapter 56 — Considers the ecology of individuals and populations and includes up-to-date discussion of human population growth. Chapter 57 — The ecology of communities is discussed in the context of the various ecological processes that mediate interactions between co-occurring species. With updated examples, chapter 57 illustrates how different processes can interact, as well as emphasizing the experimental approach to the study of ecology. Chapter 58 — This chapter focuses on the dynamics of ecosystems. It has been updated to emphasize current understanding of the how ecosystems function. Chapter 59 — The chapter has been extensively updated to provide the latest information on factors affecting the environment and human health with a clear focus on the biosphere and current environmental threats. Chapter 60 — And finally, chapter 60 considers conservation biology, emphasizing the causes of species endangerment and what can be done. Data and examples provide the latest information and thinking on conservation issues.
committed to excellence
rav32223_fm_AP_i-xxviii.indd ix
ix
11/23/09 3:01:20 PM
Committed to Preparing Students for the Future Understand Biology With the Help of . . . Integrated Learning Outcomes Each section begins with specific Learning Outcomes that represent each major concept. At the end of each section, Learning Outcomes Reviews serve as a check to help students confirm their understanding of the concepts in that section. Questions at the end of the Learning Outcomes Review ask students to think critically about what they have read.
22.1
Any opportunity to identify “learning outcomes” is a welcome addition; we are forced more and more to identify these in learning assessments. I would use these as a guide for students to understand the minimum material they are expected to learn from each section.
The Nature of Species and the Biological Species Concept
Learning Outcomes 1. 2. 3.
22.1
Distinguish between the biological species concept and the ecological species concept. Define the two w kinds of reproductive isolating mechanisms. mecha Describe the relationship of reproductive isolating mechanisms to the biological c species concept.
The Nature of Species and the Biological Species Concept
Any concept of a species must account for two phenom phenomena: the distinctiveness of species that occur together at a single locality, and the connection that exists among different popula populations belonging to the same species.
Sympatric species inhabit the sam same me locale but remain distinct
Learning Outcomes 1. 2. 3.
Put out birdfeeders on your balcony or in your back yyard, and you will attract a wide variety of birds (especially if you include different kinds of foods). In the midwestern United States, for example, you might routinely see cardinals, cardin blue hummingbirds jays, downy woodpeckers, house finches—even humm in the summer. Although it might take a few days of careful observation, obs you would soon be able to readily distinguish the many man different species. The reason is that species that occur together (termed sympatric) are distinctive entities that are phe phenotypically different, utilize different parts of the habitat, and behave differently. y This observation is generally true not only for birds, but also for most other types of organis organisms. appear Occasionally, y two species occur together that app beyond to be nearly identical. In such cases, we need to go bey visual similarities. When other aspects of the phenot phenotype chemicals are examined, such as the mating calls or the chemi exuded by each species, they usually reveal great dif differences. In other words,, even though we might have tro trouble distinguishing them, the organisms themselves have no such difficulties.
Distinguish between the biological species concept and the ecological species concept. Define the two kinds of reproductive isolating mechanisms. Describe the relationship of reproductive isolating mechanisms to the biological species concept.
Populations of a species exhibit geographic variation Within a single species, individuals in populations that occur in different areas may be distinct from one another. Such groups of distinctive individuals may be classified as subspecies (the vague term race has a similar connotation, but is no longer commonly used). In areas where these populations occur close to one another, individuals often exhibit combinations of features characteristic of both populations (figure 22.1). In other words, even though geographically distant populations may appear distinct, they are usually connected by intervening populations that are intermediate in their characteristics. www.ravenbiology.com
Michael Lentz University of North Florida
The biological species concept focuses on the ability to exchange genes What can account for both the distinctiveness of sympatric species and the connectedness of geographically separate populations of the same species? One obvious possibility is that each species exchanges genetic material only with other members of its species. If sympatric species commonly exchanged genes, which they generally do not, we might expect such species to rapidly lose their distinctions, as the gene pools (that is, all of the alleles present in a species) of the different species became homogenized. Conversely, the ability of geographically distant populations of a single species to share genes through the process of gene flow may keep these populations integrated as members of the same species. Based on these ideas, in 1942 the evolutionary biologist Ernst Mayr set forth the biological species concept, which defines species as “. . . groups of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups.” In other words, the biological species concept says that a species is composed of populations whose members mate with each other and produce fertile offspring—or would do so if they came into contact. Conversely, populations whose members do not mate with each other or who cannot produce fertile offspring are said to be reproductively isolated and, nd, therefore, are members of different species. What causes reproductive isolation? If organisms anisms cannot interbreed or cannot produce fertile offspring, they clearly belong at are considto different species. However, some populations that rtile offspring, ered separate species can interbreed and produce fertile
Eastern milk snake (Lampropeltis Lampropeltis triangulum um triangulum) r
“Intergrade” rgrade” form Red milk snake (Lampropeltis triangulum syspila)
Learning Outcomes Review 22.1 Species are populations of organisms that are distinct from other, cooccurring species, and are interconnected geographically. The biological species concept therefore defines species based on their ability to interbreed. Reproductive isolating mechanisms prevent successful interbreeding between species. The ecological species concept relies on adaptation and natural selection as a force for maintaining separation of species. ■
How does the ability to exchange genes explain why sympatric species remain distinct and geographic populations of one species remain connected?
Scarlet kingsnake (Lampropeltis triangulum elapsoides)
Figure 22.1 Geographic variation in the milk lk snake, k Lampropeltis triangulum. Although subspecies appear pear phenotypically quite distinctive from one another, theey are connected by populations that are phenotypically intermediate. rmediate. chapter ch
22 The Origin of Species
437
In Print and Online The online eBook in Connect Plus™ provides students with clear understanding of concepts through a media-rich experience. Embedded animations bring key concepts to life. Also, the ebook provides an interactive experience with the Learning Outcome Review questions. Contact your McGraw-Hill/Glencoe sales representative for pricing information.
x
rav32223_fm_AP_i-xxviii.indd x
11/23/09 3:01:20 PM
www.glencoe.com/raven9 Companion Website Students can enhance their understanding of the concepts with the rich study materials available to at www.glencoe.com/raven9. This open access website provides self-study options with chapter pretest quizzes to assess current understanding, animations that highlight topics students typically struggle with and textbook images that can be used for notetaking and study.
Transporter protein
A Consistent and Instructional Visual Program
Dopamine
The author team collaborated with a team of medical and scientific illustrations to create the unsurpassed visual program. Focusing on consistency, accuracy, and instructional value, they created an art program that is intimately connected with the text narrative. The resulting realistic, 3-D illustrations will stimulate student interest and help teachers teach difficult concepts. Cocaine Receptor protein
Figure 44.18 How cocaine alters events at the synapse. When cocaine binds to the dopamine transporters, it prevents reuptake of dopamine so the neurotransmitter survives longer in the synapse and continues to stimulate the postsynaptic cell. Cocaine thus acts to intensify pleasurable sensations.
Rough endoplasmic reticulum (RER)
Figure 15.22 Synthesis of proteins on RER. Proteins that are synthesized on RER arrive at the ER because of sequences in the peptide itself. A signal sequence in the amino terminus of the polypeptide is recognized by the signal recognition particle (SRP). This complex docks with a receptor associated with a channel in the ER. The peptide passes through the channel into the lumen of the ER as it is synthesized.
SRP binds to signal peptide, arresting elongation
Signal recognition particle (SRP)
Signal Exit tunnel
Ribosome synthesizing peptide
296
part
Cytoplasm
Lumen of the RER
Protein channel
Docking
NH2 Polypeptide elongation continues
The art is quite good! The colors are well saturated and the figures are clear and often compelling, particularly in showing the molecular complexity of these molecules and cells. Susan J Stamler College of DuPage
III Genetic and Molecular Biology
xi
rav32223_fm_AP_i-xxviii.indd xi
11/23/09 3:01:29 PM
www.glencoe.com/raven9 Apply Your Knowledge With. . . SCIENTIFIC THINKING
NEW Scientific Thinking Art
Hypothesis: The plasma membrane is fluid, not rigid.
Key illustrations in every chapter highlight how the frontiers of knowledge are pushed forward by a combination of hypothesis and experiment. These figures begin with a hypothesis, then show how it makes explicit predictions, tests these by experiment and finally demonstrates what conclusions can be drawn, and where this leads. These provide a consistent framework to guide the student in the logic of scientific inquiry. Each illustration concludes with open-ended questions to promote scientific inquiry.
Prediction: If the membrane is fluid, membrane proteins may diffuse laterally. Test: Fuse mouse and human cells, then observe the distribution of membrane proteins over time by labeling specific mouse and human proteins. Human cell Mouse cell
Knowing how scientists solve problems, and then using this knowledge to solve a problem (as an example) drives home the concept of induction and deduction — I applaud this highly!
Fuse cells
Marc LaBella Ocean County College
SCIENTIFIC THINKING Hypothesis: There are positive regulators of cell division.
Allow time for mixing to occur
Intermixed membrane proteins
Prediction: Frog oocytes are arrested in G2 of meiosis I. They can be induced to mature (undergo meiosis) by progesterone treatment. If
Result: Over time, hybrid cells show increasingly intermixed proteins.
maturing oocytes contain a positive regulator of cell division, injection of
Conclusion: At least some membrane proteins can diffuse laterally in
cytoplasm should induce an immature oocyte to undergo meiosis.
the membrane.
Test: Oocytes are induced with progesterone, then cytoplasm from these
Further Experiments: Can you think of any other explanation for these
maturing cells is injected into immature oocytes.
observations? What if newly synthesized proteins were inserted into the
Remove cytoplasm
membrane during the experiment? How could you use this basic
Inject cytoplasm
experimental design to rule out this or other possible explanations?
Figure 5.4 Test of membrane fluidity.
Progesteronetreated oocyte
Arrested oocyte
Oocyte in meiosis I
Result: Injected oocytes progress G2 from into meiosis I. Conclusion: The progesterone treatment causes production of a positive regulator of maturation: Maturation Promoting Factor (MPF). Prediction: If mitosis is driven by positive regulators, then cytoplasm from a mitotic cell should cause a G1 cell to enter mitosis. Test: M phase cells are fused with G1 phase cells, then the nucleus from
?
Inquiry question Based only on amino acid sequence, how would you recognize an integral membrane protein?
the G1 phase cell is monitored microscopically.
Inquiry Questions Questions that challenge students to think about and engage in what they are reading at a more sophisticated level. M phase cell
G1 phase cell
Fused cells
Conclusion: Cytoplasm from M phase cells contains a positive regulator that causes a cell to enter mitosis. Further Experiments: How can both of these experiments be rationalized? What would be the next step in characterizing these factors?
Figure 10.16 Discovery of positive regulator of cell division.
xii
committed to preparing students for the future
rav32223_fm_AP_i-xxviii.indd xii
11/23/09 3:01:34 PM
Review Questions U N D E R S TA N D 1. What property distinguished Mendel’s investigation from previous studies? a. b. c. d.
Synthesize and Tie It All Together With . . . End-of-Chapter Conceptual Assessment Questions Thought-provoking questions at the end of each chapter tie the concepts together by asking the student to go beyond the basics to achieve a higher level of cognitive thinking.
Mendel used true-breeding pea plants. Mendel quantified his results. Mendel examined many different traits. Mendel examined the segregation of traits.
2. The F1 generation of the monohybrid cross purple (PP) × white (pp) flower pea plants should a. b. c. d.
all have white flowers. all have a light purple or blended appearance. all have purple flowers. have (¾) purple flowers, and ¼ white flowers.
3. The F1 plants from the previous question are allowed to selffertilize. The phenotypic ratio for the F2 should be a. b.
all purple. 1 purple:1 white.
c. d.
3 purple:1 white. 3 white:1 purple.
4. Which of the following is not a part of Mendel’s five-element model? a. b. c. d.
Traits have alternative forms (what we now call alleles). Parents transmit discrete traits to their offspring. If an allele is present it will be expressed. Traits do not blend.
5. An organism’s ___________ is/are determined by its _____________. a. b.
genotype; phenotype phenotype; genotype
c. d.
alleles; phenotype genes; alleles
6. Phenotypes like height in humans, which show a continuous distribution, are usually the result of a. b. c. d.
an alteration of dominance for multiple alleles of a single gene. the presence of multiple alleles for a single gene. the action of one gene on multiple phenotypes. the action of multiple genes on a single phenotype.
1. A dihybrid cross between a plant with long smooth leaves and a plant with short hairy leaves produces a long smooth F1. If this F1 is allowed to self-cross to produce an F2, what would you predict for the ratio of F2 phenotypes? a. b. c. d.
9 long smooth:3 long hairy:3 short hairy:1 short smooth 9 long smooth:3 long hairy:3 short smooth:1 short hairy 9 short hairy:3 long hairy:3 short smooth:1 long smooth 1 long smooth:1 long hairy:1 short smooth:1 short hairy
2. Consider a long smooth F2 plant from the previous question. This plant’s genotype a. b. c. d.
must be homozygous for both long alleles and hairy alleles. must be heterozygous at both the leaf length gene, and the leaf hair gene. can only be inferred by another cross. cannot be determined by any means.
3. What is the probability of obtaining an individual with the genotype bb from a cross between two individuals with the genotype Bb? a. b. 238
½ ¼
part
a. b.
c. d.
0
½ ¼
c. d.
16
5. You discover a new variety of plant with color varieties of purple and white. When you intercross these, the F1 is a lighter purple. You consider that this may be an example of blending and self-cross the F1. If Mendel is correct, what would you predict for the F2? a. b. c. d.
1 purple:2 white:1 light purple 1 white:2 purple:1 light purple 1 purple:2 light purple:1 white 1 light purple:2 purple:1 white
6. Mendel’s model assumes that each trait is determined by a single factor with alternate forms. We now know that this is too simplistic and that a. b. c. d.
a single gene may affect more than one trait. a single trait may be affected by more than one gene. a single gene always affects only one trait, but traits may be affected by more than one gene. a single gene can affect more than one trait, and traits may be affected by more than one gene.
SYNTHESIZE 1. Create a Punnett square for the following crosses and use this to predict phenotypic ratio for dominant and recessive traits. Dominant alleles are indicated by uppercase letters and recessive are indicated by lowercase letters. For parts b and c, predict ratios using probability and the product rule. a. b. c.
A P P LY
I think that the end-of-chapter summary and review questions are thorough and written well. I very much like the way that they are categorized into understanding, application, and synthesizing. I use these types of questions on my exams. So I think that these end-of-chapter questions can be used as homework or in class work to help prepare students for exams.
4. What is the probability of obtaining an individual with the genotype CC from a cross between two individuals with the genotypes CC and Cc?
A monohybrid cross between individuals with the genotype Aa and Aa A dihybrid cross between two individuals with the genotype AaBb A dihybrid cross between individuals with the genotype AaBb and aabb
2. Explain how the events of meiosis can explain both segregation and independent assortment. 3. In mice, there is a yellow strain that when crossed yields 2 yellow:1 black. How could you explain this observation? How could you test this with crosses? 4. In mammals, a variety of genes affect coat color. One of these is a gene with mutant alleles that results in the complete loss of pigment, or albinism. Another controls the type of dark pigment with alleles that lead to black or brown colors. The albinistic trait is recessive, and black is dominant to brown. Two black mice are crossed and yield 9 black:4 albino:3 brown. How would you explain these results?
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
III Genetic and Molecular Biology
Dr. Sharon K. Bullock UNC Charlotte
Integrated Study Quizzes Study quizzes have been integrated into the Connect Plus ebook for students to assess their understanding of the information presented in each section. End of chapter questions are linked to the answer section of the text to provide for easy study. The notebook feature allows students to collect and manage notes and highlights from the ebook to create a custom study guide.
committed to preparing students for the future
rav32223_fm_AP_i-xxviii.indd xiii
xiii
11/23/09 3:01:37 PM
Committed to Biology Educators McGraw-Hill Connect Biology
Presentation Center
Connect Biology™ is a web-based assignment and assessment platform that gives students the means to better connect with their coursework, with their teachers, and with the important concepts that they will need to know for success now and in the future.
In addition to the images from your book, this online digital library contains photos, artwork, animations, and other media from an array of McGraw-Hill textbooks that can be used to create customized lectures, visually enhance tests and quizzes, and make compelling course websites or attractive printed support materials.
With Connect Biology you can deliver assignments, quizzes, and tests online. A robust set of questions and activities are presented and tied to the textbook’s learning objectives. As a teacher, you can edit existing questions and author entirely new problems. Track individual student performance — by question, assignment, or in relation to the class overall — with detailed grade reports. Integrate grade reports easily with Learning Management Systems (LMS) such as WebCT and Blackboard. And much more. ConnectPlusTM Biology provides students with all the advantages of ConnectTM Biology, plus 24/7 access to an eBook. This mediarich version of the book includes animations, videos, and inline assessments placed appropriately throughout the chapter. Connect Plus Biology allows students to practice important skills at their own pace and on their own schedule. By purchasing eBooks from McGrawHill students can save as much as 50% on selected titles delivered on the most advanced eBook platforms available. Contact your Glencoe/ McGraw-Hill sales representative to discuss eBook pricing and packaging options.
Quality Test Bank All questions have been written to fully align with the Learning Outcomes and content of the text. Provided within a computerized test bank powered by McGraw-Hill’s flexible electronic testing program EZ Test Online, teachers can create paper and online tests or quizzes in this easy to use program! A new tagging scheme allows you to sort questions by difficulty level, topic, and section. Imagine being able to create and access your test or quiz anywhere, at any time, without installing the testing software. Now, with EZ Test Online, teachers can select questions from multiple McGraw-Hill test banks or author their own, and then either print the test for paper distribution or give it online.
Powerful Presentation Tools Everything you need for outstanding presentation in one place! ■
FlexArt Image PowerPoints — including every piece of art that has been sized and cropped specifically for superior presentations as well as labels that you can edit, flexible art that can be picked up and moved, tables, and photographs
■
Animation PowerPoints — Numerous full-color animations illustrating important processes. Harness the visual impact of concepts in motion by importing these slides into classroom presentations or online course materials
■
Lecture PowerPoints — with fully embedded animations
■
Labeled and unlabeled JPEG images — Full-color digital files of all illustrations, which can be readily incorporated into presentations, exams, or custommade classroom materials
xiv
rav32223_fm_AP_i-xxviii.indd xiv
11/24/09 10:37:19 AM
Active Learning Exercises Supporting biology faculty in their efforts to make introductory courses more active and student-centered is critical to improving undergraduate biological education. Active learning can broadly be described as strategies and techniques in which students are engaged in their own learning, and is typically characterized by the utilization of higher order critical thinking skills. The use of these techniques is critical to biological education because of their powerful impact on students’ learning and development of scientific professional skills. Active learning strategies are highly valued and have been shown to: ■ ■ ■ ■
Help make content relevant Be particularly adept at addressing common misconceptions Help students to think about their own learning (metacognition) Promote meaningful learning of content by emphasizing application
■
Foster student interest in science
Guided Activities have been provided for teachers to use in their course for both in-class and out-of-class activities. The Guided Activities make it easy for you to incorporate active learning into your course and are flexible to fit your specific needs.
Teacher’s Manual for *Advanced Placement Biology This robust teacher’s resource was developed specifically for Advanced Placement Biology courses using Biology, 9th Edition by Raven, Mason, Losos, and Singer. Each chapter includes a chapter discussion, pacing suggestions, “student misconceptions and common pitfalls”, activities, web resources, lab suggestions and other resources as appropriate. Each chapter also includes sample multiple choice and free-response questions similar to questions on the AP Exam.
AP* Achiever Advanced Placement Exam Preparation Guide for Biology The AP* Achiever was written specifically for students enrolled in an Advanced Placement Biology course. The AP Achiever is designed to be used with one of the top selling college biology textbooks, Biology, 9th Edition by Raven, Mason, Losos, and Singer, although it can be used effectively with any college level biology textbook. The AP* Achiever includes: ■
An introduction to the AP Biology Course and Exam; including comprehensive tips on writing essays for the free-response section of the exam.
■
Each chapter includes a chapter summary and sections highlighting critical material required for the AP Biology Exam. Each chapter also includes sample multiple choice and freeresponse questions with answers and explanations.
■
Two complete practice exams parallel the Advanced Placement Biology Exam in terms of question type, style, format and number of questions. Each practice exam includes answers and thorough explanations.
Test Bank for *Advanced Placement Biology A test bank to accompany Biology, 9th Edition by Raven, Mason, Losos, and Singer has been adapted specifically for Advanced Placement courses. There are 5 choices for each multiple choice question and many questions refer to figures, diagrams and data sets. Freeresponse questions are included for each chapter.
Laboratory Manuals Biology Laboratory Manual, Ninth Edition Vodopich and Moore ISBN: 0-07-338306-6 This laboratory manual is designed for an introductory course for biology majors with a broad survey of basic laboratory techniques. The experiments and procedures are simple, safe, easy to perform, and especially appropriate for large classes. Few experiments require a second class meeting to complete the procedure. Each exercise includes many photographs, traditional topics, and experiments that help students learn about life. Procedures within each exercise are numerous and discrete so that an exercise can be tailored to the needs of the students, the style of the instructor, and the facilities available. Biological Investigations Lab Manual, Ninth Edition Dolphin ISBN: 0-07-338305-8 This independent lab manual can be used for a one- or two-semester majors’ level general biology lab and can be used with any majors’ level general biology textbook. The labs are investigative and ask students to use more critical thinking and hands-on learning. The author emphasizes investigative, quantitative, and comparative approaches to studying the life sciences.
Focus on Evolution Understanding Evolution, Seventh Edition Rosenbaum and Volpe ISBN: 0-07-338323-6 As an introduction to the principles of evolution, this paperback text is ideally suited as a main text for general evolution or as a supplement for general biology, genetics, zoology, botany, anthropology, or any life science course that utilizes evolution as the underlying theme of all life. committed to biology educators
rav32223_fm_AP_i-xxviii.indd xv
xv
11/24/09 10:37:22 AM
Committed to Quality 360° Development Process
Morris Maduro, University of California, Riverside
McGraw-Hill’s 360° Development Process is an ongoing, never-ending, education-oriented approach to building accurate and innovative print and digital products. It is dedicated to continual large-scale and incremental improvement, driven by multiple user feedback loops and checkpoints. This is initiated during the early planning stages of our new products, intensifies during the development and production stages, then begins again after publication in anticipation of the next edition.
Leslie Jones, Valdosta State
This process is designed to provide a broad, comprehensive spectrum of feedback for refinement and innovation of our learning tools, for both student and instructor. The 360° Development Process includes market research, content reviews, course- and product-specific symposia, accuracy checks, and art reviews. We appreciate the expertise of the many individuals involved in this process.
Contributing Authors Active Learning Exercises Frank Bailey, Middle Tennessee State University Steve Howard, Middle Tennessee State University Michael Rutledge, Middle Tennessee State University Chapter Contributors
Matt Neatrour, Northern Kentucky University Lynn Preston, Tarrant County College Website Tom Pitzer, Florida International University Marceau Ratard, Delgado Community College Amanda Rosenzweig, Delgado Community College Instructor Media Mark Browning, Purdue University Brenda Leady, University of Toledo
Digital Board of Advisors We are indebted to the valuable advice and direction of an outstanding group of advisors, led by Melissa Michael, University of Illinois at Urbana-Champaign. Other board members include: Randy Phillis, University of Massachusetts John Merrill, Michigan State Russell Borski, North Carolina State Deb Pires, University of California, Los Angeles Bill Wischusen, Louisiana State University David Scicchitano, New York City University Michael Rutledge, Middle Tennessee State Lynn Preston, Tarrant County College Karen Gerhart, University of California, Davis
Daphne Fautin, University of Kansas
Jean Heitz, University of Wisconsin, Madison
Shelley Jansky, University of Wisconsin, Madison
Mark Lyford, University of Wyoming
Stephanie Pandolfi, Wayne State University James Traniello, Boston University Instructor’s Manual Mark Hens, University of North Carolina, Charlotte Integrated eBook Study Guide David Bos, Purdue University Koy Miskin, Purdue University Kathleen Broomall, Miami University, Oxford Test Bank
General Biology Symposia Every year McGraw-Hill conducts several General Biology Symposia, which are attended by instructors from across the country. These events are an opportunity for editors from McGraw-Hill to gather information about the needs and challenges of instructors teaching the major’s biology course. It also offers a forum for the attendees to exchange ideas and experiences with colleagues they might not have otherwise met. The feedback we have received has been invaluable and has contributed to the development of Biology and its supplements. A special thank you to recent attendees:
Brian Bagatto, University of Akron Tom Sasek, University of Louisiana at Monroe Stephanie Pandolfi, Wayne State University Connect Content Contributors Susan Hengeveld, Indiana University Salvatore Tavormina, Austin Community College Scott Cooper, University of Wisconsin, LaCrosse Brian Shmaefsky, Lone Star College Phil Gibson, Oklahoma University
Sylvester Allred Northern Arizona University Michael Bell Richland College Arlene Billock University of Louisiana Lafayette Stephane Boissinot Queens College, the City University of New York David Bos Purdue University Scott Bowling Auburn University Jacqueline Bowman Arkansas Technical University Arthur Buikema Virginia Polytechnic Institute
Anne Bullerjahn Owens Community College Helaine Burstein Ohio University Raymond Burton Germanna Community College Peter Busher Boston University Richard Cardullo University of California — Riverside Jennifer Ciaccio Dixie State College Anne Barrett Clark Binghamton University Allison Cleveland University of South Florida, Tampa
xvi
rav32223_fm_AP_i-xxviii.indd xvi
11/23/09 3:01:45 PM
Jennifer Coleman University of Massachusetts, Amherst Sehoya Cotner University of Minnesota Mitch Cruzan Portland State University Laura DiCaprio Ohio University Kathyrn Dickson California State College, Fullerton Cathy Donald-Whitney Collin County Community College Stanley Faeth Arizona State University Donald French Oklahoma State University Douglas Gaffin University of Oklahoma Karen Gerhart University of California, Davis Cynthia Giffen University of Wisconsin — Madison William Glider University of Nebraska, Lincoln Christopher Gregg Louisiana State University Stan Guffey The University of Tennessee Bernard Hauser University of Florida, Gainesville Jean Heitz Unversity of Wisconsin — Madison Mark Hens University of North Carolina, Greensboro Albert Herrera University of Southern California
Ralph James Hickey Miami University of Ohio, Oxford Brad Hyman University of California — Riverside Kyoungtae Kim Missouri State University Sherry Krayesky University of Louisiana, Lafayette Jerry Kudenov University of Alaska Anchorage Josephine Kurdziel University of Michigan Ellen Lamb University of North Carolina — Greensboro Brenda Leady University of Toledo Graeme Lindbeck Valencia Community College Susan Meiers Western Illinois University Michael Meighan University of California, Berkeley John Mersfelder Sinclair Community College Melissa Michael University of Illinois at Urbana-Champaign Leonore Neary Joliet Junior College Shawn Nordell Saint Louis University John Osterman University of Nebraska— Lincoln Stephanie Pandolfi Wayne State University C.O. Patterson Texas A&M University
Nancy Pencoe State University of West Georgia Roger Persell Hunter College Marius Pfeiffer Tarrant County College NE Steve Phelps University of Florida Debra Pires University of California, Los Angeles Eileen Preston Tarrant County College NW Rajinder Ranu Colorado State University Marceau Ratard Delgado Community College City Park Melanie Rathburn Boston University Robin Richardson Winona State University Amanda Rosenzweig Delgado Community College — City Park Laurie Russell Saint Louis University Connie Russell Angelo State University David Scicchitano New York University Timothy Shannon Francis Marion University Brian Shmaefsky Lone Star College — Kingwood Richard Showman University of South Carolina Robert Simons University of California, Los Angeles
Steve Skarda Linn Benton Community College Steven D. Skopik University of Delaware Phillip Sokolove University of Maryland Brad Swanson Central Michigan University David Thompson Northern Kentucky University Maureen Tubbola St. Cloud State University Ashok Upadhyaya University of South Florida, Tampa Anthony Uzwiak Rutgers University Rani Vajravelu University of Central Florida Gary Walker Appalachian State University Pat Walsh University of Delaware Elizabeth Weiss-Kuziel University of Texas at Austin Holly Williams Seminole Community College David Williams Valencia Community College, East Campus Michael Windelspecht Appalachian State University Mary Wisgirda San Jacinto College, South Campus Jay Zimmerman St. John’s University
Tien-Hsien Chang Ohio State University Genevieve Chung Broward College Cynthia Church Metropolitan State College of Denver William Cohen University of Kentucky James Collins Kilgore College Joanne Conover University of Connecticut Iris Cook Westchester Community College Erica Corbett Southeastern Oklahoma State University Robert Corin College of Staten Island — CUNY William G. R. Crampton University of Central Florida Scott Crousillac Louisiana State University—Baton Rouge Karen A. Curto University of Pittsburgh Denise Deal Nassau Community College Philias Denette Delgado Community College Mary Dettman Seminole Community College—Oviedo Ann Marie DiLorenzo Montclair State University Ernest DuBrul University of Toledo Richard Duhrkopf Baylor University Susan Dunford University of Cincinnati Andrew R. Dyer University of South Carolina — Aiken Carmen Eilertson Georgia State University Richard P. Elinson Duquesne University William L. Ellis Pasco-Hernando Community College Seema Endley Blinn College Gary Ervin Mississippi State University Karl Fath Queens College — CUNY
Zen Faulkes The University of Texas — Pan American Myriam Feldman Lake Washington Technical College Melissa Fierke State University of New York Gary L. Firestone University of California — Berkeley Jason Flores UNC — Charlotte Markus Friedrich Wayne State University Deborah Garrity Colorado State University Christopher Gee University of North Carolina-Charlotte John R. Geiser Western Michigan University J.P. Gibson University of Oklahoma Matthew Gilg University of North Florida Teresa Golden Southeastern Oklahoma State University Venkat Gopalan Ohio State University Michael Groesbeck Brigham Young University Theresa Grove Valdosta State University David Hanson University of New Mexico Paul Hapeman University of Florida Nargess Hassanzadeh-Kiabi California State University— Los Angeles Stephen K. Herbert University of Wyoming Hon Ho State University of New York at New Paltz Barbara Hunnicutt Seminole Community College Steve Huskey Western Kentucky University
Cynthia Jacobs Arkansas Tech University Jason B. Jennings Southwest Tennessee Community College Frank J. Jochem Florida International University—Miami Norman Johnson University of Massachusetts Gregory A. Jones Santa Fe Community College Jerry Kaster University of Wisconsin— Milwaukee Mary Jane Keith Wichita State University Mary Kelley Wayne State University Scott Kight Montclair State University Wendy Kimber Stevenson University Jeff Klahn University of Iowa David S. Koetje Calvin College Olga Kopp Utah Valley University John C. Krenetsky Metropolitan State College of Denver Patrick J. Krug California State University — LA Robert Kurt Lafayette College Marc J. LaBella Ocean County College Ellen S. Lamb University of North Carolina — Greensboro David Lampe Duquesne University Grace Lasker Lake Washington Technical College Kari Lavalli Boston University Shannon Erickson Lee California Sate University- Northridge Zhiming Liu Eastern New Mexico University J. Mitchell Lockhart Valdosta State University David Logan Clark Atlanta University
9th Edition Reviewers Tamarah Adair Baylor University Gladys Alexandre-Jouline University of Tennessee at Knoxville Gregory Andraso Gannon University Jorge E. Arriagada St. Cloud State University David Asch Youngstown State University Jeffrey G. Baguley University of Nevada — Reno Suman Batish Temple University Donald Baud University of Memphis Peter Berget Carnegie Mellon University Randall Bernot Ball State University Deborah Bielser University of Illinois— Champaign Wendy Binder Loyola Marymount University Todd A. Blackledge University of Akron Andrew R. Blaustein Oregon State University Dennis Bogyo Valdosta State University David Bos Purdue University Robert Boyd Auburn University Graciela Brelles-Marino California State Polytechnic University—Pomona Joanna Brooke DePaul University Roxanne Brown Blinn College Mark Browning Purdue University Cedric O. Buckley Jackson State University Arthur L. Buikema, Jr. Virginia Tech Sharon Bullock UNC — Charlotte Lisa Burgess Broward College Scott Carlson Luther College John L. Carr University of Louisiana — Monroe Laura Carruth Georgia State University Dale Cassamatta University of North Florida Peter Chabora Queens College—CUNY
committed to quality
rav32223_fm_AP_i-xxviii.indd xvii
xvii
11/23/09 3:01:46 PM
Thomas A. Lonergan University of New Orleans Andreas Madlung University of Puget Sound Lynn Mahaff y University of Delaware Jennifer Marcinkiewicz Kent State University Henri Maurice University of Southern Indiana Deanna McCullough University of Houston—Downtown Dean McCurdy Albion College Richard Merritt Houston Community College—Northwest Stephanie Miller Jefferson State Community College Thomas Miller University of California, Riverside Hector C. Miranda, Jr. Texas Southern University Jasleen Mishra Houston Community College Randy Mogg Columbus State Community College Daniel Moon University of North Florida Janice Moore Colorado State University Richard C. Moore Miami University Juan Morata Miami Dade College— Wolfson Ellyn R. Mulcahy Johnson County Community College Kimberlyn Nelson Pennsylvania State University Howard Neufeld Appalachian State University Jacalyn Newman University of Pittsburgh Margaret N. Nsofor Southern Illinois University — Carbondale Judith D. Ochrietor University of North Florida Robert O’Donnell SUNY—Geneseo Olumide Ogunmosin Texas Southern University
Nathan O. Okia Auburn University — Montgomery Stephanie Pandolfi Michigan State University Peter Pappas County College of Morris J. Payne Bergen Community College Andrew Pease Stevenson University Craig Peebles University of Pittsburgh David G. Pennock Miami University Beverly Perry Houston Community College John S. Peters College of Charleston, SC Stephanie Toering Peters Wartburg College Teresa Petrino-Lin Barry University Susan Phillips Brevard Community College—Palm Bay Paul Pillitteri Southern Utah University Thomas Pitzer Florida International University—Miami Uwe Pott University of Wisconsin— Green Bay Nimala Prabhu Edison State College Lynn Preston Tarrant County College— NW Kelli Prior Finger Lakes Community College Penny L. Ragland Auburn Montgomery Marceau Ratard Delgado Community College Michael Reagan College of St. Benedict/ St. John’s University Nancy A. Rice Western Kentucky University Linda Richardson Blinn College Amanda Rosenzweig Delgado Community College Cliff Ross University of North Florida John Roufaiel SUNY—Rockland Community College Kenneth Roux Florida State University Ann E. Rushing Baylor University
Sangha Saha Harold Washington College Eric Saliim North Carolina Central University Thomas Sasek University of Louisiana — Monroe Leena Sawant Houston Community College Emily Schmitt Nova Southeastern University Mark Schneegurt Wichita State University Brenda Schoffstall Barry University Scott Schuette Southern Illinois University Pramila Sen Houston Community College Bin Shuai Wichita State University Susan Skambis Valencia Community College Michael Smith Western Kentucky University Ramona Smith Brevard Community College Nancy G. Solomon Miami University Sally K. Sommers Smith Boston University Melissa Spitler California State University—Northridge Ashley Spring Brevard Community College Moira Van Staaden Bowling Green State University Bruce Stallsmith University of Alabama — Huntsville Susan Stamler College of DuPage Nancy Staub Gonzaga University Stanley Stevens University of Memphis Ivan Still Arkansas Tech University Gregory W. Stunz Texas A&M University — Corpus Christi Ken D. Sumida Chapman University Rema Suniga Ohio Northern University
Bradley Swanson Central Michigan University David Tam University of North Texas Franklyn Tan Te Miami Dade College— Wolfson William Terzaghi Wilkes University Melvin Thomson University of Wisconsin—Parkside Martin Tracey Florida International University James Traniello Boston University Bibit Halliday Traut City College of San Francisco Alexa Tullis University of Puget Sound Catherine Ueckert Northern Arizona University Mark VanCura Cape Fear CC/University of NC Pembroke Charles J. Venglarik Jefferson State Community College Diane Wagner University of Alaska — Fairbanks Maureen Walter Florida International University Wei Wan Texas A&M University James T. Warren, Jr. Penn State Erie Delon Washo-Krupps Arizona State University Frederick Wasserman Boston University Raymond R. White City College of San Francisco Stephen W. White Ozarks Technical Community College Kimberlyn Williams California State University-San Bernardino Martha Comstock Williams Southern Polytechnic State University David E. Wolfe American River College Amber Wyman Finger Lakes Community College Robert D. Young, Jr. Blinn College
Phillip Snider Jr. Gadsden State Community College Nancy G. Solomon Miami University David Tam University of North Texas Marty Tracey Florida International University Michael J. Wade Indiana University Jyoti R. Wagle Houston Community College System, Central Andy Wang The University of Iowa Cindy Martinez Wedig University of Texas, Pan American Elizabeth A. Weiss University of Texas, Austin C. B. Wolfe The University of North Carolina, Charlotte
Reviewers and Accuracy Checkers
Previous Edition Reviewers and Contributors Art Review Panel David K. Asch Youngstown State University Karl J. Aufderheide Texas A&M University Brian Bagatto University of Akron Andrew R. Blaustein Oregon State University Nancy Maroushek Boury Iowa State University Mark Browning Purdue University Jeff Carmichael University of North Dakota Wes Colgan III Pikes Peak Community College Karen A. Curto University of Pittsburgh Donald Deters Bowling Green State University Ernest F. DuBrul University of Toledo Ralph P. Eckerlin Northern Virginia Community College Julia Emerson Amherst College Frederick B. Essig University of South Florida Sharon Eversman Montana State University, Bozeman Barbara A. Frase Bradley University T. H. Frazzetta University of Illinois, Urbana—Champaign Douglas Gaffin University of Oklahoma John R. Geiser Western Michigan University
xviii
Gonzalo Giribet Harvard University John Graham Bowling Green State University Susan E. Hengeveld Indiana University Richard Hill Michigan State University David Julian University of Florida Pamela J. Lanford University of Maryland, College Park James B. Ludden College of DuPage Duncan S. MacKenzie Texas A&M University Patricia Mire University of Louisiana, Lafayette Janice Moore Colorado State University Jacalyn S. Newman University of Pittsburgh Robert Newman University of North Dakota Nicole S. Obert University of Illinois, Urbana-Champaign David G. Oppenheimer University of Florida Ellen Ott-Reeves Blinn College, Bryan Laurel Bridges Roberts University of Pittsburgh Deemah N. Schirf The University of Texas, San Antonio Mark A. Sheridan North Dakota State University Richard Showman University of South Carolina
End-of-Chapter Pedagogy and Inquiry Contributors Arthur Buikema Virginia Polytechnic Institute Merri Lynn Casem California State University-Fullerton Mark Lyford University of Wyoming Peter Niewiarowski University of Akron Thomas Pitzer Florida International University Laurel Roberts University of Pittsburgh Michael Windelspecht Appalachian State University
Barbara J. Abraham Hampton University Richard Adler University of Michigan, Dearborn Sylvester Allred Northern Arizona University Steven M. Aquilani Delaware County Community College Jonathan W. Armbruster Auburn University Gregory A. Armstrong The Ohio State University Jorge E. Arriagada St. Cloud State University David K. Asch Youngstown State University Brian Bagatto University of Akron Garen Baghdasarian Santa Monica College Anita Davelos Baines The University of Texas, Pan American Ronald A. Balsamo Jr. Villanova University Michael Bartlett Portland State University Vernon W. Bauer Francis Marion University James E. Baxter Ohlone College George W. Benz Middle Tennessee State University
committed to quality
rav32223_fm_AP_i-xxviii.indd xviii
11/23/09 3:01:46 PM
Gerald K. Bergtrom University of Wisconsin, Milwaukee Arlene G. Billock University of Louisiana, Lafayette Catherine S. Black Idaho State University Michael W. Black California Polytechnic State University Robert O. Blanchard University of New Hampshire Andrew R. Blaustein Oregon State University Mary A. Bober Santa Monica College Nancy Maroushek Boury Iowa State University M. Deane Bowers University of Colorado Scott A. Bowling Auburn University Benita A. Brink Adams State College Anne Bullerjahn Owens Community College Ray D. Burkett Southwest Tennessee Community College Helaine Burstein Ohio University Scott Burt Truman State University Carol T. Burton Bellevue Community College Jennifer Carr Burtwistle Northeast Community College Jorge Busciglio University of California, Irvine Pat Calie Eastern Kentucky University Christy A. Carello The Metropolitan State College of Denver Michael Carey University of Scranton Jeff Carmichael University of North Dakota Michael J. Carlisle Trinity Valley Community College John H. Caruso University of New Orleans Thomas T. Chen University of Connecticut Cynthia Church The Metropolitan State College of Denver Linda T. Collins University of Tennessee, Chattanooga Scott T. Cooper University of Wisconsin, La Crosse Joe R. Cowles Virginia Tech Nigel M. Crawford University of California, San Diego James Crowder Brookdale Community College Karen A. Curto University of Pittsburgh Bela Dadhich Delaware County Community College Lydia B. Daniels University of Pittsburgh Terry Davin Penn Valley Community College Joseph S. Davis University of Florida Neta Dean Stony Brook University Kevin W. Dees Wharton County Junior College D. Michael Denbow Virginia Tech Donald Deters Bowling Green State University Hudson DeYoe University of Texas, Pan American Randy DiDomenico University of Colorado Nd Dikeocha College of the Mainland Robert S. Dill Bergen Community College Diane M. Dixon Southeastern Oklahoma State University Kevin Dixon University of Illinois John S. Doctor Duquesne University Ernest F. DuBrul University of Toledo Charles Duggins Jr. University of South Carolina
Richard P. Elinson Duquesne University Johnny El-Rady University of South Florida Frederick B. Essig University of South Florida David H. Evans University of Florida Guy E. Farish Adams State College Daphne G. Fautin University of Kansas Bruce E. Felgenhauer University of Louisiana, Lafayette Carolyn J. Ferguson Kansas State University Teresa G. Fischer Indian River Community College Irwin Forseth University of Maryland Gail Fraizer Kent State University Barbara A. Frase Bradley University Sylvia Fromherz University of Northern Colorado Phillip E. Funk DePaul University Caitlin R. Gabor Texas State University, San Marcos Purti P. Gadkari Wharton County Junior College John R. Geiser Western Michigan University Frank S. Gilliam Marshall University Miriam S. Golbert College of the Canyons Scott A. Gordon University of Southern Indiana John S. Graham Bowling Green State University David A. Gray California State University, Northridge William F. Hanna Massasoit Community College Kyle E. Harms Louisiana State University Kerry D. Heafner University of Louisiana, Monroe Susan E. Hengeveld Indiana University Charles Henry University of Connecticut, Storrs Peter Heywood Brown University Juliana G. Hinton McNeese State University Margaret L. Horton University of North Carolina, Greensboro James Horwitz Palm Beach Community College Laura A. Houston Montgomery College Feng Sheng Hu University of Illinois Allen N. Hunt Elizabethtown Community and Technical College David C. Jarrell University of Mary Washington Jennifer L. Jeffery Wharton County Junior College William Jeffery University of Maryland, College Park Lee Johnson The Ohio State University Craig T. Jordan The University of Texas, San Antonio Ronald L. Jones Eastern Kentucky University Robyn Jordan University of Louisiana, Monroe Walter S. Judd University of Florida David Julian University of Florida Daniel Kainer Montgomery College Ronald C. Kaltreider York College of Pennsylvania Thomas C. Kane University of Cincinnati Donald A. Kangas Truman State University William J. Katembe Delta State University Steven J. Kaye Red Rocks Community College
Stephen R. Kelso University of Illinois, Chicago Nancy S. Kirkpatrick Lake Superior State University John Z. Kiss Miami University John C. Krenetsky The Metropolitan State College of Denver Karin E. Krieger University of Wisconsin, Green Bay David T. Kurjiaka University of Arizona Arlene T. Larson University of Colorado, Denver Peter Lavrentyev University of Akron Laura G. Leff Kent State University Michael R. Lentz University of North Florida Harvey Liftin Broward Community College Yue J. Lin St. John’s University Amy Litt New York Botanical Garden Christopher R. Little The University of Texas, Pan American James Long Boise State University James O. Luken Coastal Carolina University Dennis J. Lye Northern Kentucky University P. T. Magee University of Minnesota, Minneapolis Richard Malkin University of California, Berkeley Mark D. Mamrack Wright State University Kathleen A. Marrs Indiana University Purdue University, Indianapolis Diane L. Marshall University of New Mexico Paul B. Martin St. Philip’s College Peter J. Martinat Xavier University, Los Angeles Joel Maruniak University of Missouri Patricia Matthews Grand Valley State University Robin G. Maxwell The University of North Carolina, Greensboro Brenda S. McAdory Tennessee State University Nael A. McCarty Georgia Institute of Technology Brock R. McMillan Minnesota State University, Mankato Kay McMurry The University of Texas, Austin Elizabeth McPartlan De Anza College Brad Mehrtens University of Illinois, Urbana—Champaign Michael Meighan University of California, Berkeley Douglas Meikle Miami University Allen F. Mensinger University of Minnesota, Duluth Wayne B. Merkley Drake University Catherine E. Merovich West Virginia University Frank J. Messina Utah State University Brian T. Miller Middle Tennessee State University Sarah L. Milton Florida Atlantic University Subhash Minocha University of New Hampshire Hector C. Miranda Jr. Texas Southern University Patricia Mire University of Louisiana, Lafayette Robert W. Morris Widener University Satyanarayana Swamy Mruthinti State University of West Georgia
Richard L. Myers Southwest Missouri State University Monica Marquez Nelson Joliet Junior College Jacalyn S. Newman University of Pittsburgh Harry Nickla Creighton University Richard A. Niesenbaum Muhlenberg College Kris M. Norenberg Xavier University, Louisiana Deborah A. O’Dell University of Mary Washington Sharman D. O’Neill University of California, Davis Cynthia P. Paul University of Michigan, Dearborn John S. Peters College of Charleston Jay Phelan University of California, Los Angeles Gregory W. Phillips Blinn College Thomas R. Pitzer Florida International University Gregory J. Podgorski Utah State University Alan Prather Michigan State University Mitch Price The Pennsylvania State University Carl Quertermus State University of West Georgia Shana Rapoport California State University, Northridge Kim Raun Wharton County Junior College Robert S. Rawding Gannon University Jill D. Reid Virginia Commonwealth University Linda R. Richardson Blinn College Robin K. Richardson Winona State University Carolyn Roberson Roane State Community College Kenneth R. Robinson Purdue University Kenneth H. Roux Florida State University Charles L. Rutherford Virginia Tech University Margaret Saha College of William and Mary Thomas Sasek University of Louisiana, Monroe Bruce M. Saul Augusta State University Deemah N. Schirf The University of Texas, San Antonio Christopher J. Schneider Boston University Timothy E. Shannon Francis Marion University Rebecca Sheller Southwestern University Mark A. Sheridan North Dakota State University Richard Showman University of South Carolina Michéle Shuster New Mexico State University William Simcik Tomball College, a North Harris Community College Rebecca B. Simmons University of North Dakota Phillip Snider Jr. Gadsden State Community College Thomas E. Snowden Florida Memorial College Dianne Snyder Augusta State University Farah Sogo Orange Coast College Nancy G. Solomon Miami University Kathryn H. Sorensen American River College Kevin N. Sorensen Snow College committed to quality
rav32223_fm_AP_i-xxviii.indd xix
xix
11/23/09 3:01:46 PM
Bruce Stallsmith University of Alabama, Huntsville Patricia Steinke San Jacinto College Jacqueline J. Stevens Jackson State University John W. Stiller East Carolina University Antony Stretton University of Wisconsin, Madison Brett W. Strong Palm Beach Community College Gregory W. Stunz Texas A&M University, Corpus Christi Cynthia A. Surmacz Bloomsburg University Yves S. H. Tan Cabrillo College Sharon Thoma University of Wisconsin, Madison Anne M. S. Tokazewski Burlington County College Marty Tracey Florida International University
Terry M. Trier Grand Valley State University Marsha R. Turell Houston Community College Linda Tyson Santa Fe Community College Rani Vajravelu University of Central Florida Jim Van Brunt Rogue Community College Judith B. Varelas University of Northern Colorado Neal J. Voelz St. Cloud State University Janice Voltzow University of Scranton Jyoti R. Wagle Houston Community College System, Central Charles Walcott Cornell University Randall Walikonis University of Connecticut Eileen Walsh Westchester Community College
Steven A. Wasserman University of California, San Diego R. Douglas Watson University of Alabama, Birmingham Cindy Martinez Wedig University of Texas, Pan American Richard Weinstein Southern New Hampshire University Elizabeth A. Weiss University of Texas, Austin William R. Wellnitz Augusta State University Jonathan F. Wendel Iowa State University Sue Simon Westendorf Ohio University Vernon Lee Wiersema Houston Community College, Southwest Judy Williams Southeastern Oklahoma State University Lawrence R. Williams University of Houston
Robert Winning Eastern Michigan University C. B. Wolfe The University of North Carolina, Charlotte Clarence C. Wolfe Northern Virginia Community College Eric Vivien Wong University of Louisville Gene K. Wong Quinnipiac University Denise Woodward The Pennsylvania State University Richard P. Wunderlin University of South Florida Douglas A. Wymer The University of West Alabama Lan Xu South Dakota State University H. Randall Yoder Lamar University Kathryn G. Zeiler Red Rocks Community College Scott D. Zimmerman Missouri State University Henry G. Zot University of West Georgia
Logan Donaldson York University Theo Elzenga University of Groningen Neil Haave University of Alberta, Augustana Louise M. Hafner QUT Clare Hasenkampf University of Toronto, Scarborough Annika F. M. Haywood Memorial University of Newfoundland Rong-Nan Huang National Central University William Huddleston University of Calgary Wendy J. Keenleyside University of Guelph Chris Kennedy Simon Fraser University
Alex Law Nanyang Technical University, Singapore Richard C. Leegood University of Sheffield R. W. Longair University of Calgary Thomas H. MacRae Dalhousie University Rolf W. Matthewes Simon Fraser University R. Ian Menz Flinders University Todd C. Nickle Mount Royal College Kirsten Poling University of Windsor Jim Provan Queen’s University Belfast Roberto Quinlan York University Elsa I. Colón Reyes University of Puerto Rico, Aguadilla Campus Richard Roy McGill University
Liliane Schoofs Katholicke Universiteit Leuren Joan Sharp Simon Fraser University Julie Smit University of Windsor Nguan Soon Tan Nanyang Technological University Fleur Tiver University of South Australia Llinil Torres-Ojeda University of Puerto Rico, Aguadilla Campus Han A. B. Wösten University of Utrecht H. H. Yeoh National University of Singapore Dr. Khaled Abou-Aisha German University in Cairo
International Reviewers Mari L. Acevedo University of Puerto Rico, Arecibo Heather Addy University of Calgary Heather E. Allison University of Liverpool David Backhouse University of New England Andrew Bendall University of Guelph Tony Bradshaw Oxford Brookes University D. Bruce Campbell Okanagan College Clara E. Carrasco University of Puerto Rico, Ponce Ian Cock Griffith University Margaret Cooley University of New South Wales R. S. Currah University of Alberta
A Note From the Authors A revision of this scope relies on the talents and efforts of many people working behind the scenes and we have benefited greatly from their assistance.
of the pressures of getting this revision completed. They have adapted to the many hours this book draws us away from them, and, even more than us, looked forward to its completion.
Jody Larson, our developmental copyeditor, labored many hours and provided countless suggestions for improving the organization and clarity of the text. She has made a tremendous contribution to the quality of the final product.
As with every edition, acknowledgments would not be complete without thanking the generations of students who have used the many editions of this text. They have taught us as least as much as we have taught them, and their questions and suggestions continue to improve the text and supplementary materials.
We were fortunate to again work with Electronic Publishing Services to update the art program and improve the layout of the pages. Our close collaboration resulted in a text that is pedagogically effective as well as more beautiful than any other biology text on the market. We have the continued support of our McGraw-Hill team. Developmental editors Rose Koos and Lisa Bruflodt kept the authors on track during the development process. Sheila Frank, project manager, and David Hash, designer, ensured our text was on time and elegantly designed. Patrick Reidy, marketing manager and many more people behind the scenes have all contributed to the success or our text. Throughout this edition we have had the support of spouses and children, who have seen less of us than they might have liked because xx
Finally, we need to thank our reviewers and contributors. Instructors from across the country are continually invited to share their knowledge and experience with us through reviews and focus groups. The feedback we received shaped this edition, resulting in new chapters, reorganization of the table of contents, and expanded coverage in key areas. Several faculty members were asked to provide preliminary drafts of chapters to ensure that the content was as up to date and accurate as possible, and still others were asked to provide chapter outlines and assessment questions. All of these people took time out of their already busy lives to help us build a better edition of Biology for the next generation of introductory biology students, and they have our heartfelt thanks.
committed to quality
rav32223_fm_AP_i-xxviii.indd xx
11/23/09 3:01:46 PM
Contents
5 Membranes 88 Part
I
The Molecular Basis of Life
1 The Science of Biology 1 1.1 The Science of Life 1 1.2 The Nature of Science 4 1.3 An Example of Scientific Inquiry: Darwin and Evolution 8 1.4 Unifying Themes in Biology 12
2 The Nature of Molecules and the Properties of Water 17 2.1 2.2 2.3 2.4 2.5 2.6
The Nature of Atoms 18 Elements Found in Living Systems 22 The Nature of Chemical Bonds 23 Water: A Vital Compound 25 Properties of Water 28 Acids and Bases 29
3 The Chemical Building Blocks of Life 33 3.1 Carbon: The Framework of Biological Molecules 34 3.2 Carbohydrates: Energy Storage and Structural Molecules 38 3.3 Nucleic Acids: Information Molecules 41 3.4 Proteins: Molecules with Diverse Structures and Functions 44 3.5 Lipids: Hydrophobic Molecules 53
Part
II Biology of the Cell
4 Cell Structure 59 4.1 4.2 4.3 4.4 4.5
Cell Theory 59 Prokaryotic Cells 63 Eukaryotic Cells 65 The Endomembrane System 69 Mitochondria and Chloroplasts: Cellular Generators 73 4.6 The Cytoskeleton 75 4.7 Extracellular Structures and Cell Movement 79 4.8 Cell-to-Cell Interactions 82
5.1 5.2 5.3 5.4 5.5 5.6
The Structure of Membranes 88 Phospholipids: The Membrane’s Foundation 92 Proteins: Multifunctional Components 93 Passive Transport Across Membranes 96 Active Transport Across Membranes 99 Bulk Transport by Endocytosis and Exocytosis 102
6 Energy and Metabolism 107 6.1 6.2 6.3 6.4 6.5
The Flow of Energy in Living Systems 108 The Laws of Thermodynamics and Free Energy 109 ATP: The Energy Currency of Cells 112 Enzymes: Biological Catalysts 113 Metabolism: The Chemical Description of Cell Function 117
7 How Cells Harvest Energy 122 7.1 Overview of Respiration 123 7.2 Glycolysis: Splitting Glucose 127 7.3 The Oxidation of Pyruvate to Produce Acetyl-CoA 130 7.4 The Krebs Cycle 131 7.5 The Electron Transport Chain and Chemiosmosis 134 7.6 Energy Yield of Aerobic Respiration 137 7.7 Regulation of Aerobic Respiration 138 7.8 Oxidation Without O2 139 7.9 Catabolism of Proteins and Fats 140 7.10 Evolution of Metabolism 142
8 Photosynthesis 147 8.1 8.2 8.3 8.4 8.5 8.6 8.7
Overview of Photosynthesis 147 The Discovery of Photosynthetic Processes 149 Pigments 151 Photosystem Organization 154 The Light-Dependent Reactions 156 Carbon Fixation: The Calvin Cycle 160 Photorespiration 163
9 Cell Communication 168 9.1 9.2 9.3 9.4 9.5
Overview of Cell Communication 168 Receptor Types 171 Intracellular Receptors 173 Signal Transduction Through Receptor Kinases 174 Signal Transduction Through G Protein-Coupled Receptors 179 xxi
rav32223_fm_AP_i-xxviii.indd xxi
11/23/09 3:01:46 PM
15.5 15.6 15.7 15.8 15.9
10 How Cells Divide 186 10.1 10.2 10.3 10.4 10.5
Bacterial Cell Division 187 Eukaryotic Chromosomes 189 Overview of the Eukaryotic Cell Cycle 192 Interphase: Preparation for Mitosis 193 M Phase: Chromosome Segregation and the Division of Cytoplasmic Contents 194 10.6 Control of the Cell Cycle 198
Part
16 Control of Gene Expression 304 16.1 16.2 16.3 16.4 16.5 16.6 16.7
III Genetic and
Molecular Biology 11 Sexual Reproduction and Meiosis 207 11.1 11.2 11.3 11.4
17.1 17.2 17.3 17.4 17.5 17.6
12 Patterns of Inheritance 221
13 Chromosomes, Mapping, and the Meiosis–Inheritance Connection 239
18.1 18.2 18.3 18.4 18.5
15 Genes and How They Work 278 15.1 15.2 15.3 15.4 xxii
The Nature of Genes 278 The Genetic Code 282 Prokaryotic Transcription 284 Eukaryotic Transcription 287
Mapping Genomes 352 Whole-Genome Sequencing 356 Characterizing Genomes 358 Genomics and Proteomics 362 Applications of Genomics 367
19 Cellular Mechanisms of Development 372 19.1 19.2 19.3 19.4 19.5 19.6
14 DNA: The Genetic Material 256 The Nature of the Genetic Material 256 DNA Structure 259 Basic Characteristics of DNA Replication 263 Prokaryotic Replication 266 Eukaryotic Replication 271 DNA Repair 273
DNA Manipulation 327 Molecular Cloning 330 DNA Analysis 335 Genetic Engineering 341 Medical Applications 343 Agricultural Applications 346
18 Genomics 352
13.1 Sex Linkage and the Chromosomal Theory of Inheritance 240 13.2 Sex Chromosomes and Sex Determination 241 13.3 Exceptions to the Chromosomal Theory of Inheritance 244 13.4 Genetic Mapping 244 13.5 Selected Human Genetic Disorders 249
14.1 14.2 14.3 14.4 14.5 14.6
Control of Gene Expression 304 Regulatory Proteins 305 Prokaryotic Regulation 308 Eukaryotic Regulation 312 Eukaryotic Chromatin Structure 316 Eukaryotic Posttranscriptional Regulation 317 Protein Degradation 322
17 Biotechnology 327
Sexual Reproduction Requires Meiosis 207 Features of Meiosis 209 The Process of Meiosis 210 Summing Up: Meiosis Versus Mitosis 215
12.1 The Mystery of Heredity 221 12.2 Monohybrid Crosses: The Principle of Segregation 224 12.3 Dihybrid Crosses: The Principle of Independent Assortment 228 12.4 Probability: Predicting the Results of Crosses 230 12.5 The Testcross: Revealing Unknown Genotypes 231 12.6 Extensions to Mendel 232
Eukaryotic pre-mRNA Splicing 289 The Structure of tRNA and Ribosomes 291 The Process of Translation 293 Summarizing Gene Expression 297 Mutation: Altered Genes 299
Part
The Process of Development 372 Cell Division 373 Cell Differentiation 375 Nuclear Reprogramming 380 Pattern Formation 383 Morphogenesis 390
IV Evolution
20 Genes Within Populations 396 20.1 20.2 20.3 20.4 20.5 20.6 20.7
Genetic Variation and Evolution 396 Changes in Allele Frequency 398 Five Agents of Evolutionary Change 401 Fitness and Its Measurement 405 Interactions Among Evolutionary Forces 406 Maintenance of Variation 407 Selection Acting on Traits Affected by Multiple Genes 409 20.8 Experimental Studies of Natural Selection 411 20.9 The Limits of Selection 413
table of contents
rav32223_fm_AP_i-xxviii.indd xxii
11/23/09 3:01:47 PM
21 The Evidence for Evolution 417 21.1 The Beaks of Darwin’s Finches: Evidence of Natural Selection 418 21.2 Peppered Moths and Industrial Melanism: More Evidence of Selection 420 21.3 Artificial Selection: Human-Initiated Change 422 21.4 Fossil Evidence of Evolution 424 21.5 Anatomical Evidence for Evolution 428 21.6 Convergent Evolution and the Biogeographical Record 430 21.7 Darwin’s Critics 432
22 The Origin of Species 436 22.1 The Nature of Species and the Biological Species Concept 437 22.2 Natural Selection and Reproductive Isolation 441 22.3 The Role of Genetic Drift and Natural Selection in Speciation 443 22.4 The Geography of Speciation 444 22.5 Adaptive Radiation and Biological Diversity 446 22.6 The Pace of Evolution 451 22.7 Speciation and Extinction Through Time 452
23 Systematics and the Phylogenetic Revolution 456 23.1 23.2 23.3 23.4 23.5
Systematics 456 Cladistics 458 Systematics and Classification 461 Phylogenetics and Comparative Biology 464 Phylogenetics and Disease Evolution 470
24 Genome Evolution 474 24.1 24.2 24.3 24.4 24.5
Comparative Genomics 474 Whole-Genome Duplications 477 Evolution Within Genomes 481 Gene Function and Expression Patterns 484 Nonprotein-Coding DNA and Regulatory Function 485 24.6 Genome Size and Gene Number 486 24.7 Genome Analysis and Disease Prevention and Treatment 487 24.8 Crop Improvement Through Genome Analysis 489
25 Evolution of Development 492 25.1 Overview of Evolutionary Developmental Biology 492 25.2 One or Two Gene Mutations, New Form 495 25.3 Same Gene, New Function 496 25.4 Different Genes, Convergent Function 498 25.5 Gene Duplication and Divergence 499 25.6 Functional Analysis of Genes Across Species 500 25.7 Diversity of Eyes in the Natural World: A Case Study 501
Part
V The Diversity of Life
26 The Tree of Life 507 26.1 26.2 26.3 26.4 26.5 26.6
Origins of Life 508 Classification of Organisms 512 Grouping Organisms 514 Making Sense of the Protists 520 Origin of Plants 520 Sorting out the Animals 522
27 Viruses 528 27.1 27.2 27.3 27.4 27.5
The Nature of Viruses 529 Bacteriophages: Bacterial Viruses 533 Human Immunodeficiency Virus (HIV) 535 Other Viral Diseases 539 Prions and Viroids: Subviral Particles 541
28 Prokaryotes 545 28.1 28.2 28.3 28.4 28.5 28.6 28.7
The First Cells 546 Prokaryotic Diversity 547 Prokaryotic Cell Structure 551 Prokaryotic Genetics 554 Prokaryotic Metabolism 559 Human Bacterial Disease 560 Beneficial Prokaryotes 563
29 Protists 567 29.1 Eukaryotic Origins and Endosymbiosis 568 29.2 Defining Protists 571 29.3 Diplomonads and Parabasalids: Flagellated Protists Lacking Mitochondria 572 29.4 Euglenozoa: A Diverse Group in Which Some Members Have Chloroplasts 573 29.5 Alveolata: Protists with Submembrane Vesicles 576 29.6 Stramenopila: Protists with Fine Hairs 580 29.7 Rhodophyta: Red Algae 582 29.8 Choanoflagellida: Possible Animal Ancestors 583 29.9 Protists Without a Clade 583
30 Green Plants 588 30.1 Defining Plants 588 30.2 Chlorophytes and Charophytes: Green Algae 591 30.3 Bryophytes: Dominant Gametophyte Generation 593 30.4 Tracheophyte Plants: Roots, Stems, and Leaves 596 30.5 Lycophytes: Dominant Sporophyte Generation and Vascular Tissue 598 30.6 Pterophytes: Ferns and Their Relatives 598 30.7 The Evolution of Seed Plants 602 30.8 Gymnosperms: Plants with “Naked Seeds” 603 30.9 Angiosperms: The Flowering Plants 606 table of contents
rav32223_fm_AP_i-xxviii.indd xxiii
xxiii
11/23/09 3:01:48 PM
31 Fungi 614 31.1 Defining Fungi 614 31.2 Microsporidia: Unicellular Parasites 618 31.3 Chytridiomycota and Relatives: Fungi with Flagellated Zoospores 619 31.4 Zygomycota: Fungi that Produce Zygotes 620 31.5 Glomeromycota: Asexual Plant Symbionts 622 31.6 Basidiomycota: The Club (Basidium) Fungi 622 31.7 Ascomycota: The Sac (Ascus) Fungi 623 31.8 Ecology of Fungi 625 31.9 Fungal Parasites and Pathogens 629
37 Vegetative Plant Development 753 37.1 37.2 37.3 37.4
38 Transport in Plants 769 38.1 38.2 38.3 38.4 38.5 38.6
32 Overview of Animal Diversity 633 32.1 32.2 32.3 32.4
Some General Features of Animals 634 Evolution of the Animal Body Plan 636 The Classification of Animals 640 The Roots of the Animal Tree of Life 645
39.1 39.2 39.3 39.4 39.5
Phylum Mollusca: The Mollusks 666 Phylum Nemertea: The Ribbon Worms 672 Phylum Annelida: The Annelids 673 The Lophophorates: Bryozoa and Brachiopoda 676 Phylum Arthropoda: The Arthropods 678 Phylum Echinodermata: The Echinoderms 687
40.1 40.2 40.3 40.4
Part
The Chordates 694 The Nonvertebrate Chordates 695 The Vertebrate Chordates 696 Fishes 698 Amphibians 703 Reptiles 706 Birds 712 Mammals 716 Evolution of the Primates 721
VI Plant Form and Function
36 Plant Form 729 36.1 36.2 36.3 36.4 36.5 xxiv
Organization of the Plant Body: An Overview 730 Plant Tissues 733 Roots: Anchoring and Absorption Structures 739 Stems: Support for Above-Ground Organs 743 Leaves: Photosynthetic Organs 747
Physical Defenses 802 Chemical Defenses 805 Animals that Protect Plants 809 Systemic Responses to Invaders 810
41 Sensory Systems in Plants 814 41.1 41.2 41.3 41.4 41.5
35 Vertebrates 693 35.1 35.2 35.3 35.4 35.5 35.6 35.7 35.8 35.9
Soils: The Substrates on Which Plants Depend 787 Plant Nutrients 790 Special Nutritional Strategies 792 Carbon–Nitrogen Balance and Global Change 795 Phytoremediation 797
40 Plant Defense Responses 802
34 Coelomate Invertebrates 666 34.1 34.2 34.3 34.4 34.5 34.6
Transport Mechanisms 770 Water and Mineral Absorption 773 Xylem Transport 776 The Rate of Transpiration 778 Water-Stress Responses 780 Phloem Transport 781
39 Plant Nutrition and Soils 786
33 Noncoelomate Invertebrates 649 33.1 Parazoa: Animals That Lack Specialized Tissues 650 33.2 Eumetazoa: Animals with True Tissues 652 33.3 The Bilaterian Acoelomates 656 33.4 The Pseudocoelomates 661
Embryo Development 754 Seeds 760 Fruits 761 Germination 764
Responses to Light 815 Responses to Gravity 819 Responses to Mechanical Stimuli 821 Responses to Water and Temperature 823 Hormones and Sensory Systems 825
42 Plant Reproduction 839 42.1 42.2 42.3 42.4 42.5 42.6
Part
Reproductive Development 840 Flower Production 842 Structure and Evolution of Flowers 848 Pollination and Fertilization 851 Asexual Reproduction 857 Plant Life Spans 859
VII Animal Form
and Function 43 The Animal Body and Principles of Regulation 863 43.1 Organization of the Vertebrate Body 864 43.2 Epithelial Tissue 865 43.3 Connective Tissue 868
table of contents
rav32223_fm_AP_i-xxviii.indd xxiv
11/23/09 3:01:49 PM
43.4 43.5 43.6 43.7 43.8
Muscle Tissue 870 Nerve Tissue 872 Overview of Vertebrate Organ Systems 872 Homeostasis 876 Regulating Body Temperature 878
44 The Nervous System 887 44.1 Nervous System Organization 888 44.2 The Mechanism of Nerve Impulse Transmission 890 44.3 Synapses: Where Neurons Communicate with Other Cells 896 44.4 The Central Nervous System: Brain and Spinal Cord 901 44.5 The Peripheral Nervous System: Sensory and Motor Neurons 909
45 Sensory Systems 915 45.1 Overview of Sensory Receptors 916 45.2 Mechanoreceptors: Touch and Pressure 917 45.3 Hearing, Vibration, and Detection of Body Position 920 45.4 Chemoreceptors: Taste, Smell, and pH 925 45.5 Vision 928 45.6 The Diversity of Sensory Experiences 933
46 The Endocrine System 937 46.1 Regulation of Body Processes by Chemical Messengers 938 46.2 Actions of Lipophilic Versus Hydrophilic Hormones 943 46.3 The Pituitary and Hypothalamus: The Body’s Control Centers 946 46.4 The Major Peripheral Endocrine Glands 951 46.5 Other Hormones and Their Effects 955
47 The Musculoskeletal System 961 47.1 47.2 47.3 47.4 47.5
Types of Skeletal Systems 962 A Closer Look at Bone 963 Joints and Skeletal Movement 967 Muscle Contraction 969 Modes of Animal Locomotion 975
48 The Digestive System 981 48.1 Types of Digestive Systems 982 48.2 The Mouth and Teeth: Food Capture and Bulk Processing 984 48.3 The Esophagus and the Stomach: The Early Stages of Digestion 985 48.4 The Intestines: Breakdown, Absorption, and Elimination 987 48.5 Variations in Vertebrate Digestive Systems 990 48.6 Neural and Hormonal Regulation of the Digestive Tract 993 48.7 Accessory Organ Function 994 48.8 Food Energy, Energy Expenditure, and Essential Nutrients 995
49 The Respiratory System 1001 49.1 Gas Exchange Across Respiratory Surfaces 1002 49.2 Gills, Cutaneous Respiration, and Tracheal Systems 1004 49.3 Lungs 1006 49.4 Structures and Mechanisms of Ventilation in Mammals 1009 49.5 Transport of Gases in Body Fluids 1012
50 The Circulatory System 1018 50.1 50.2 50.3 50.4
The Components of Blood 1018 Invertebrate Circulatory Systems 1022 Vertebrate Circulatory Systems 1023 The Four-Chambered Heart and the Blood Vessels 1026 50.5 Characteristics of Blood Vessels 1030 50.6 Regulation of Blood Flow and Blood Pressure 1034
51 Osmotic Regulation and the Urinary System 1038 51.1 51.2 51.3 51.4
Osmolarity and Osmotic Balance 1038 Osmoregulatory Organs 1040 Evolution of the Vertebrate Kidney 1042 Nitrogenous Wastes: Ammonia, Urea, and Uric Acid 1044 51.5 The Mammalian Kidney 1045 51.6 Hormonal Control of Osmoregulatory Functions 1050
52 The Immune System 1055 52.1 52.2 52.3 52.4 52.5 52.6 52.7
Innate Immunity 1055 Adaptive Immunity 1061 Cell-Mediated Immunity 1066 Humoral Immunity and Antibody Production 1068 Autoimmunity and Hypersensitivity 1075 Antibodies in Medical Treatment and Diagnosis 1077 Pathogens That Evade the Immune System 1079
53 The Reproductive System 1084 53.1 Animal Reproductive Strategies 1084 53.2 Vertebrate Fertilization and Development 1087 53.3 Structure and Function of the Human Male Reproductive System 1091 53.4 Structure and Function of the Human Female Reproductive System 1094 53.5 Contraception and Infertility Treatments 1098
54 Animal Development 1105 54.1 54.2 54.3 54.4 54.5 54.6
Fertilization 1106 Cleavage and the Blastula Stage 1110 Gastrulation 1112 Organogenesis 1116 Vertebrate Axis Formation 1122 Human Development 1125
table of contents
rav32223_fm_AP_i-xxviii.indd xxv
xxv
11/23/09 3:01:49 PM
Part
VIII Ecology and Behavior
55 Behavioral Biology 1132
55.1 The Natural History of Behavior 1133 55.2 Nerve Cells, Neurotransmitters, Hormones, and Behavior 1134 55.3 Behavioral Genetics 1135 55.4 Learning 1137 55.5 The Development of Behavior 1139 55.6 Animal Cognition 1141 55.7 Orientation and Migratory Behavior 1142 55.8 Animal Communication 1144 55.9 Behavioral Ecology 1147 55.10 Reproductive Strategies and Sexual Selection 1150 55.11 Altruism 1154 55.12 The Evolution of Group Living and Animal Societies 1157
56 Ecology of Individuals and Populations 1162 56.1 The Environmental Challenges 1162 56.2 Populations: Groups of a Single Species in One Place 1165 56.3 Population Demography and Dynamics 1168 56.4 Life History and the Cost of Reproduction 1171 56.5 Environmental Limits to Population Growth 1173 56.6 Factors That Regulate Populations 1175 56.7 Human Population Growth 1178
57 Community Ecology 1185
57.3 Predator–Prey Relationships 1192 57.4 The Many Types of Species Interactions 1196 57.5 Ecological Succession, Disturbance, and Species Richness 1202
58 Dynamics of Ecosystems 1207 58.1 58.2 58.3 58.4 58.5
Biogeochemical Cycles 1208 The Flow of Energy in Ecosystems 1214 Trophic-Level Interactions 1219 Biodiversity and Ecosystem Stability 1223 Island Biogeography 1226
59 The Biosphere 1230 59.1 59.2 59.3 59.4 59.5
Ecosystem Effects of Sun, Wind, and Water 1230 Earth’s Biomes 1235 Freshwater Habitats 1238 Marine Habitats 1241 Human Impacts on the Biosphere: Pollution and Resource Depletion 1245 59.6 Human Impacts on the Biosphere: Climate Change 1250
60 Conservation Biology 1256 60.1 60.2 60.3 60.4
Overview of the Biodiversity Crisis 1257 The Value of Biodiversity 1261 Factors Responsible for Extinction 1264 Approaches for Preserving Endangered Species and Ecosystems 1275
Appendix A A-1 Glossary G-1 Credits C-1 Index I-1
57.1 Biological Communities: Species Living Together 1186 57.2 The Ecological Niche Concept 1188
xxvi
table of contents
rav32223_fm_AP_i-xxviii.indd xxvi
11/23/09 3:01:50 PM
Biology
rav32223_fm_AP_i-xxviii.indd xxvii
11/23/09 3:01:50 PM
This page intentionally left blank
CHAPTER
Chapter
1
The Science of Biology
1.2
The Nature of Science
1.3
An Example of Scientific Inquiry: Darwin and Evolution
1.4
Unifying Themes in Biology
Y
Introduction
You are about to embark on a journey—a journey of discovery about the nature of life. Nearly 180 years ago, a young English naturalist named Charles Darwin set sail on a similar journey on board H.M.S. Beagle; a replica of this ship is pictured here. What Darwin learned on his five-year voyage led directly to his development of the theory of evolution by natural selection, a theory that has become the core of the science of biology. Darwin’s voyage seems a fitting place to begin our exploration of biology—the scientific study of living organisms and how they have evolved. Before we begin, however, let’s take a moment to think about what biology is and why it’s important.
1.1
The Science of Life
Learning Outcomes 1. 2. 3.
Explain the importance of biology as a science. Describe the characteristics of living systems. Recognize the hierarchical organization of living systems.
rav32223_ch01_001-016.indd 1
I
The Science of Life
Part
1.1
The Molecular Basis of Life
Chapter Outline
This is the most exciting time to be studying biology in the history of the field. The amount of data available about the natural world has exploded in the last 25 years, and we are now in a position to ask and answer questions that previously were only dreamed of. We have determined the entire sequence of the human genome and are in the process of sequencing the genomes of other species at an ever-increasing pace. We are closing in on a description of the molecular workings of the cell in unprecedented detail, and we are in the process of finally unveiling the mystery of how a single cell can give rise to the complex organization seen in multicellular organisms. With robotics, advanced imaging,
11/5/09 3:06:31 PM
and analytical techniques, we have tools available that were formerly the stuff of science fiction. In this text, we attempt to draw a contemporary picture of the science of biology, as well as provide some history and experimental perspective on this exciting time in the discipline. In this introductory chapter, we examine the nature of biology and the foundations of science in general to put into context the information presented in the rest of the text.
The way we do science is changing to grapple with increasingly difficult modern problems. Science is becoming more interdisciplinary, combining the expertise from a variety of exciting new fields such as nanotechnology. Biology is at the heart of this multidisciplinary approach because biological problems often require many different approaches to arrive at solutions.
Life defies simple definition Biology unifies much of natural science The study of biology is a point of convergence for the information and tools from all of the natural sciences. Biological systems are the most complex chemical systems on Earth, and their many functions are both determined and constrained by the principles of chemistry and physics. Put another way, no new laws of nature can be gleaned from the study of biology— but that study does illuminate and illustrate the workings of those natural laws. The intricate chemical workings of cells are based on everything we have learned from the study of chemistry. And every level of biological organization is governed by the nature of energy transactions learned from the study of thermodynamics. Biological systems do not represent any new forms of matter, and yet they are the most complex organization of matter known. The complexity of living systems is made possible by a constant source of energy—the Sun. The conversion of this energy source into organic molecules by photosynthesis is one of the most beautiful and complex reactions known in chemistry and physics.
In its broadest sense, biology is the study of living things—the science of life. Living things come in an astounding variety of shapes and forms, and biologists study life in many different ways. They live with gorillas, collect fossils, and listen to whales. They read the messages encoded in the long molecules of heredity and count how many times a hummingbird’s wings beat each second. What makes something “alive”? Anyone could deduce that a galloping horse is alive and a car is not, but why? We cannot say, “If it moves, it’s alive,” because a car can move, and gelatin can wiggle in a bowl. They certainly are not alive. Although we cannot define life with a single simple sentence, we can come up with a series of seven characteristics shared by living systems: ■
■
Cellular organization. All organisms consist of one or more cells. Often too tiny to see, cells carry out the basic activities of living. Each cell is bounded by a membrane that separates it from its surroundings. Ordered complexity. All living things are both complex and highly ordered. Your body is composed of many different kinds of cells, each containing many complex
CELLULAR LEVEL Atoms
Molecule
Macromolecule
Organelle
Cell
Tissue
Organ
O C H N O H N C O 0.2 µm
2
part
0.5 µm
100 µm
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 2
11/5/09 3:06:36 PM
■
■
■
■
■
molecular structures. Many nonliving things may also be complex, but they do not exhibit this degree of ordered complexity. Sensitivity. All organisms respond to stimuli. Plants grow toward a source of light, and the pupils of your eyes dilate when you walk into a dark room. Growth, development, and reproduction. All organisms are capable of growing and reproducing, and they all possess hereditary molecules that are passed to their offspring, ensuring that the offspring are of the same species. Energy utilization. All organisms take in energy and use it to perform many kinds of work. Every muscle in your body is powered with energy you obtain from the food you eat. Homeostasis. All organisms maintain relatively constant internal conditions that are different from their environment, a process called homeostasis. Evolutionary adaptation. All organisms interact with other organisms and the nonliving environment in ways that influence their survival, and as a consequence, organisms evolve adaptations to their environments.
Living systems show hierarchical organization The organization of the biological world is hierarchical—that is, each level builds on the level below it. 1. The Cellular Level. At the cellular level (figure 1.1), atoms, the fundamental elements of matter, are joined together into clusters called molecules. Complex
Organism
www.ravenbiology.com
rav32223_ch01_001-016.indd 3
Figure 1.1 Hierarchical organization of living systems. Life is highly organized from the simplest atoms to complex multicellular organisms. Along this hierarchy of structure, atoms form molecules that are used to form organelles, which in turn form the functional subsystems within cells. Cells are organized into tissues, and then into organs and organ systems such as the nervous system pictured. This organization extends beyond individual organisms to populations, communities, ecosystems, and fi nally the entire biosphere. POPULATIONAL LEVEL
ORGANISMAL LEVEL Organ system
biological molecules are assembled into tiny structures called organelles within membrane-bounded units we call cells. The cell is the basic unit of life. Many independent organisms are composed only of single cells. Bacteria are single cells, for example. All animals and plants, as well as most fungi and algae, are multicellular— composed of more than one cell. 2. The Organismal Level. Cells in complex multicellular organisms exhibit three levels of organization. The most basic level is that of tissues, which are groups of similar cells that act as a functional unit. Tissues, in turn, are grouped into organs—body structures composed of several different tissues that act as a structural and functional unit. Your brain is an organ composed of nerve cells and a variety of associated tissues that form protective coverings and contribute blood. At the third level of organization, organs are grouped into organ systems. The nervous system, for example, consists of sensory organs, the brain and spinal cord, and neurons that convey signals.
Population
Species
Community
Ecosystem
chapter
Biosphere
1 The Science of Biology
3
11/5/09 3:07:01 PM
3. The Populational Level. Individual organisms can be categorized into several hierarchical levels within the living world. The most basic of these is the population—a group of organisms of the same species living in the same place. All populations of a particular kind of organism together form a species, its members similar in appearance and able to interbreed. At a higher level of biological organization, a biological community consists of all the populations of different species living together in one place. 4. Ecosystem Level. At the highest tier of biological organization, a biological community and the physical habitat within which it lives together constitute an ecological system, or ecosystem. For example, the soil, water, and atmosphere of a mountain ecosystem interact with the biological community of a mountain meadow in many important ways. 5. The Biosphere. The entire planet can be thought of as an ecosystem that we call the biosphere. As you move up this hierarchy, novel properties emerge. These emergent properties result from the way in which components interact, and they often cannot be deduced just from looking at the parts themselves. Examining individual cells, for example, gives little hint about the whole animal. You, and all humans, have the same array of cell types as a giraffe. It is because the living world exhibits many emergent properties that it is difficult to define “life.” The previous descriptions of the common features and organization of living systems begins to get at the nature of what it is to be alive. The rest of this book illustrates and expands on these basic ideas to try to provide a more complete account of living systems.
Learning Outcomes Review 1.1 Biology is a unifying science that brings together other natural sciences, such as chemistry and physics, to study living systems. Life does not have a simple definition, but living systems share a number of properties that together describe life. Living systems can also be organized hierarchically, from the cellular level to the entire biosphere, with emerging properties that may exceed the sum of the parts. ■
Can you study biology without studying other sciences?
tific method” as though there is a single way of doing science. This oversimplification has contributed to confusion on the part of nonscientists about the nature of science. At its core, science is concerned with developing an increasingly accurate understanding of the world around us using observation and reasoning. To begin with, we assume that natural forces acting now have always acted, that the fundamental nature of the universe has not changed since its inception, and that it is not changing now. A number of complementary approaches allow understanding of natural phenomena—there is no one “right way.” Scientists also attempt to be as objective as possible in the interpretation of the data and observations they have collected. Because scientists themselves are human, this is not completely possible, but because science is a collective endeavor subject to scrutiny, it is self-correcting. One person’s results are verified by others, and if the results cannot be repeated, they are rejected.
Much of science is descriptive The classic vision of the scientific method is that observations lead to hypotheses that in turn make experimentally testable predictions. In this way, we dispassionately evaluate new ideas to arrive at an increasingly accurate view of nature. We discuss this way of doing science later in this chapter, but it is important to understand that much of science is purely descriptive: In order to understand anything, the first step is to describe it completely. Much of biology is concerned with arriving at an increasingly accurate description of nature. The study of biodiversity is an example of descriptive science that has implications for other aspects of biology in addition to societal implications. Efforts are currently underway to classify all life on Earth. This ambitious project is purely descriptive, but it will lead to a much greater understanding of biodiversity as well as the effect our species has on biodiversity. One of the most important accomplishments of molecular biology at the dawn of the 21st century was the completion of the sequence of the human genome. Many new hypotheses about human biology will be generated by this knowledge, and many experiments will be needed to test these hypotheses, but the determination of the sequence itself was descriptive science.
Science uses both deductive and inductive reasoning
1.2
The Nature of Science
Learning Outcomes 1. 2.
Describe the types of reasoning used by biologists. Demonstrate how to formulate a hypothesis.
Much like life itself, the nature of science defies simple description. For many years scientists have written about the “scien4
part
The study of logic recognizes two opposite ways of arriving at logical conclusions: deductive and inductive reasoning. Science makes use of both of these methods, although induction is the primary way of reasoning in hypothesis-driven science.
Deductive reasoning Deductive reasoning applies general principles to predict specific results. More than 2200 years ago, the Greek scientist Eratosthenes used Euclidean geometry and deductive reasoning to accurately estimate the circumference of the Earth (figure 1.2). Deductive reasoning is the reasoning of mathematics and
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 4
11/5/09 3:07:08 PM
Sunlight at midday
Height of obelisk
Well
Light rays parallel
a Distance between cities = 800 km Length of shadow
a
Figure 1.2 Deductive reasoning: how Eratosthenes estimated the circumference of the earth using deductive reasoning. 1. On a day when sunlight shone straight down a deep well at Syene in Egypt, Eratosthenes measured the length of the shadow cast by a tall obelisk in the city of Alexandria, about 800 kilometers (km) away. 2. The shadow’s length and the obelisk’s height formed two sides of a triangle. Using the recently developed principles of Euclidean geometry, Eratosthenes calculated the angle, a, to be 7° and 12´, exactly 0 of a circle (360°). 3. If angle a is 0 of a circle, then the distance between the obelisk (in Alexandria) and the well (in Syene) must be equal to 0 the circumference of the Earth. 4. Eratosthenes had heard that it was a 50-day camel trip from Alexandria to Syene. Assuming that a camel travels about 18.5 km per day, he estimated the distance between obelisk and well as 925 km (using different units of measure, of course). 5. Eratosthenes thus deduced the circumference of the Earth to be 50 × 925 = 46,250 km. Modern measurements put the distance from the well to the obelisk at just over 800 km. Employing a distance of 800 km, Eratosthenes’s value would have been 50 × 800 = 40,000 km. The actual circumference is 40,075 km.
philosophy, and it is used to test the validity of general ideas in all branches of knowledge. For example, if all mammals by definition have hair, and you find an animal that does not have hair, then you may conclude that this animal is not a mammal. A biologist uses deductive reasoning to infer the species of a specimen from its characteristics.
Inductive reasoning In inductive reasoning, the logic flows in the opposite direction, from the specific to the general. Inductive reasoning uses specific observations to construct general scientific principles. For example, if poodles have hair, and terriers have hair, and every dog that you observe has hair, then you may conclude that all dogs have hair. Inductive reasoning leads to generalizations that can then be tested. Inductive reasoning first became important to science in the 1600s in Europe, when Francis Bacon, Isaac Newton, and others began to use the results of particular experiments to infer general principles about how the world operates. An example from modern biology is the role of homeobox genes in development. Studies in the fruit fly, Drosophila melanogaster, identified genes that could cause dramatic changes in developmental fate, such as a leg appearing in the place of an antenna. When the genes themselves were isolated and their DNA sequence determined, it was found that similar genes were found in many animals, including humans. This led to the general idea that the homeobox genes act as switches to control developmental fate.
Hypothesis-driven science makes and tests predictions Scientists establish which general principles are true from among the many that might be true through the process of systematically testing alternative proposals. If these proposals prove inconsistent with experimental observations, they are rejected as untrue. Figure 1.3 illustrates the process. www.ravenbiology.com
rav32223_ch01_001-016.indd 5
Observation Question
Potential hypotheses
Hypothesis 1 Hypothesis 2 Hypothesis 3 Hypothesis 4 Hypothesis 5
Experiment
Reject hypotheses 1 and 4
Remaining possible hypotheses
Hypothesis 2 Hypothesis 3 Hypothesis 5
Experiment
Reject hypotheses 2 and 3
Last remaining possible hypothesis
Hypothesis 5 Modify hypothesis Predictions
Experiment Experiment 1
Experiment 2
Experiment 3
Experiment 4
Predictions confirmed
Figure 1.3 How science is done. This diagram illustrates how scientific investigations proceed. First, scientists make observations that raise a particular question. They develop a number of potential explanations (hypotheses) to answer the question. Next, they carry out experiments in an attempt to eliminate one or more of these hypotheses. Then, predictions are made based on the remaining hypotheses, and further experiments are carried out to test these predictions. The process can also be iterative. As experimental results are performed, the information can be used to modify the original hypothesis to fit each new observation.
chapter
1 The Science of Biology
5
11/5/09 3:07:10 PM
After making careful observations, scientists construct a hypothesis, which is a suggested explanation that accounts for those observations. A hypothesis is a proposition that might be true. Those hypotheses that have not yet been disproved are retained. They are useful because they fit the known facts, but they are always subject to future rejection if, in the light of new information, they are found to be incorrect. This process can also be iterative, that is, a hypothesis can be changed and refined with new data. For instance, geneticists George Beadle and Edward Tatum studied the nature of genetic information to arrive at their “one-gene/one-enzyme” hypothesis (see chapter 15). This hypothesis states that a gene represents the genetic information necessary to make a single enzyme. As investigators learned more about the molecular nature of genetic information, the hypothesis was refined to “onegene/one-polypeptide” because enzymes can be made up of more than one polypeptide. With still more information about the nature of genetic information, other investigators found that a single gene can specify more than one polypeptide, and the hypothesis was refined again.
Testing hypotheses We call the test of a hypothesis an experiment. Suppose that a room appears dark to you. To understand why it appears dark, you propose several hypotheses. The first might be, “There is no light in the room because the light switch is turned off.” An alternative hypothesis might be, “There is no light in the room because the lightbulb is burned out.” And yet another hypothesis might be, “I am going blind.” To evaluate these hypotheses, you would conduct an experiment designed to eliminate one or more of the hypotheses. For example, you might test your hypotheses by flipping the light switch. If you do so and the room is still dark, you have disproved the first hypothesis: Something other than the setting of the light switch must be the reason for the darkness. Note that a test such as this does not prove that any of the other hypotheses are true; it merely demonstrates that the one being tested is not. A successful experiment is one in which one or more of the alternative hypotheses is demonstrated to be inconsistent with the results and is thus rejected. As you proceed through this text, you will encounter many hypotheses that have withstood the test of experiment. Many will continue to do so; others will be revised as new observations are made by biologists. Biology, like all science, is in a constant state of change, with new ideas appearing and replacing or refining old ones.
Using predictions A successful scientific hypothesis needs to be not only valid but also useful—it needs to tell us something we want to know. A hypothesis is most useful when it makes predictions because those predictions provide a way to test the validity of the hypothesis. If an experiment produces results inconsistent with the predictions, the hypothesis must be rejected or modified. In contrast, if the predictions are supported by experimental testing, the hypothesis is supported. The more experimentally supported predictions a hypothesis makes, the more valid the hypothesis is. As an example, in the early history of microbiology it was known that nutrient broth left sitting exposed to air becomes contaminated. Two hypotheses were proposed to explain this observation: spontaneous generation and the germ hypothesis. Spontaneous generation held that there was an inherent property in organic molecules that could lead to the spontaneous generation of life. The germ hypothesis proposed that preexisting microorganisms that were present in the air could contaminate the nutrient broth. These competing hypotheses were tested by a number of experiments that involved filtering air and boiling the broth to kill any contaminating germs. The definitive experiment was performed by Louis Pasteur, who constructed flasks with curved necks that could be exposed to air, but that would trap any contaminating germs. When such flasks were boiled to sterilize them, they remained sterile, but if the curved neck was broken off, they became contaminated (figure 1.4). SCIENTIFIC THINKING Question: What is the source of contamination that occurs in a flask of nutrient broth left exposed to the air? Germ Hypothesis: Preexisting microorganisms present in the air contaminate nutrient broth. Prediction: Sterilized broth will remain sterile if microorganisms are prevented from entering flask. Spontaneous Generation Hypothesis: Living organisms will spontaneously generate from nonliving organic molecules in broth. Prediction: Organisms will spontaneously generate from organic molecules in broth after sterilization. Test: Use swan-necked flasks to prevent entry of microorganisms. To ensure that broth can still support life, break swan-neck after sterilization. Broken neck of flask
Establishing controls Often scientists are interested in learning about processes that are influenced by many factors, or variables. To evaluate alternative hypotheses about one variable, all other variables must be kept constant. This is done by carrying out two experiments in parallel: a test experiment and a control experiment. In the test experiment, one variable is altered in a known way to test a particular hypothesis. In the control experiment, that variable is left unaltered. In all other respects the two experiments are identical, so any difference in the outcomes of the two experiments must result from the influence of the variable that was changed. Much of the challenge of experimental science lies in designing control experiments that isolate a particular variable from other factors that might influence a process. 6
part
Flask is sterilized by boiling the broth.
Unbroken flask remains sterile.
Broken flask becomes contaminated after exposure to germ-laden air.
Result: No growth occurs in sterile swan-necked flasks. When the neck is broken off, and the broth is exposed to air, growth occurs. Conclusion: Growth in broth is of preexisting microorganisms.
Figure 1.4 Experiment to test spontaneous generation versus germ hypothesis.
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 6
11/5/09 3:07:13 PM
This result was predicted by the germ hypothesis—that when the sterile flask is exposed to air, airborne germs are deposited in the broth and grow. The spontaneous generation hypothesis predicted no difference in results with exposure to air. This experiment disproved the hypothesis of spontaneous generation and supported the hypothesis of airborne germs under the conditions tested.
Reductionism breaks larger systems into their component parts Scientists often use the philosophical approach of reductionism to understand a complex system by reducing it to its working parts. Reductionism has been the general approach of biochemistry, which has been enormously successful at unraveling the complexity of cellular metabolism by concentrating on individual pathways and specific enzymes. By analyzing all of the pathways and their components, scientists now have an overall picture of the metabolism of cells. Reductionism has limits when applied to living systems, however—one of which is that enzymes do not always behave exactly the same in isolation as they do in their normal cellular context. A larger problem is that the complex interworking of many interconnected functions leads to emergent properties that cannot be predicted based on the workings of the parts. For example, an examination of all of the proteins and RNAs in a ribosome in isolation would not lead to predictions about the nature of protein synthesis. On a higher level, understanding the physiology of a single Canada goose, would not lead to predictions about flocking behavior. Biologists are just beginning to come to grips with this problem and to think about ways of dealing with the whole as well as the workings of the parts. The emerging field of systems biology focuses on this different approach.
Biologists construct models to explain living systems Biologists construct models in many different ways for a variety of uses. Geneticists construct models of interacting networks of proteins that control gene expression, often even drawing cartoon figures to represent that which we cannot see. Population biologists build models of how evolutionary change occurs. Cell biologists build models of signal transduction pathways and the events leading from an external signal to internal events. Structural biologists build actual models of the structure of proteins and macromolecular complexes in cells. Models provide a way to organize how we think about a problem. Models can also get us closer to the larger picture and away from the extreme reductionist approach. The working parts are provided by the reductionist analysis, but the model shows how they fit together. Often these models suggest other experiments that can be performed to refine or test the model. As researchers gain more knowledge about the actual flow of molecules in living systems, more sophisticated kinetic models can be used to apply information about isolated enzymes to their cellular context. In systems biology, this www.ravenbiology.com
rav32223_ch01_001-016.indd 7
modeling is being applied on a large scale to regulatory networks during development, and even to modeling an entire bacterial cell.
The nature of scientific theories Scientists use the word theory in two main ways. The first meaning of theory is a proposed explanation for some natural phenomenon, often based on some general principle. Thus, we speak of the principle first proposed by Newton as the “theory of gravity.” Such theories often bring together concepts that were previously thought to be unrelated. The second meaning of theory is the body of interconnected concepts, supported by scientific reasoning and experimental evidence, that explains the facts in some area of study. Such a theory provides an indispensable framework for organizing a body of knowledge. For example, quantum theory in physics brings together a set of ideas about the nature of the universe, explains experimental facts, and serves as a guide to further questions and experiments. To a scientist, theories are the solid ground of science, expressing ideas of which we are most certain. In contrast, to the general public, the word theory usually implies the opposite—a lack of knowledge, or a guess. Not surprisingly, this difference often results in confusion. In this text, theory will always be used in its scientific sense, in reference to an accepted general principle or body of knowledge. Some critics outside of science attempt to discredit evolution by saying it is “just a theory.” The hypothesis that evolution has occurred, however, is an accepted scientific fact—it is supported by overwhelming evidence. Modern evolutionary theory is a complex body of ideas, the importance of which spreads far beyond explaining evolution. Its ramifications permeate all areas of biology, and it provides the conceptual framework that unifies biology as a science. Again, the key is how well a hypothesis fits the observations. Evolutionary theory fits the observations very well.
Research can be basic or applied In the past it was fashionable to speak of the “scientific method” as consisting of an orderly sequence of logical, either–or steps. Each step would reject one of two mutually incompatible alternatives, as though trial-and-error testing would inevitably lead a researcher through the maze of uncertainty to the ultimate scientific answer. If this were the case, a computer would make a good scientist. But science is not done this way. As the British philosopher Karl Popper has pointed out, successful scientists without exception design their experiments with a pretty fair idea of how the results are going to come out. They have what Popper calls an “imaginative preconception” of what the truth might be. Because insight and imagination play such a large role in scientific progress, some scientists are better at science than others—just as Bruce Springsteen stands out among songwriters or Claude Monet stands out among Impressionist painters. Some scientists perform basic research, which is intended to extend the boundaries of what we know. These individuals typically work at universities, and their research is usually supported by grants from various agencies and foundations. chapter
1 The Science of Biology
7
11/5/09 3:07:14 PM
The information generated by basic research contributes to the growing body of scientific knowledge, and it provides the scientific foundation utilized by applied research. Scientists who conduct applied research are often employed in some kind of industry. Their work may involve the manufacture of food additives, the creation of new drugs, or the testing of environmental quality. Research results are written up and submitted for publication in scientific journals, where the experiments and conclusions are reviewed by other scientists. This process of careful evaluation, called peer review, lies at the heart of modern science. It helps to ensure that faulty research or false claims are not given the authority of scientific fact. It also provides other scientists with a starting point for testing the reproducibility of experimental results. Results that cannot be reproduced are not taken seriously for long.
Figure 1.5 Charles Darwin. This newly rediscovered photograph taken in 1881, the year before Darwin died, appears to be the last ever taken of the great biologist.
Learning Outcomes Review 1.2 Much of science is descriptive, amassing observations to gain an accurate view. Both deductive reasoning and inductive reasoning are used in science. Scientific hypotheses are suggested explanations for observed phenomena. When a hypothesis has been extensively tested and no contradictory information has been found, it becomes an accepted theory. Theories are coherent explanations of observed data, but they may be modified by new information. ■
How does a scientific theory differ from a hypothesis?
1.3
An Example of Scientific Inquiry: Darwin and Evolution
Learning Outcomes 1. 2.
Describe Darwin’s theory of evolution by natural selection. List evidence that supports the theory of evolution.
Darwin’s theory of evolution explains and describes how organisms on Earth have changed over time and acquired a diversity of new forms. This famous theory provides a good example of how a scientist develops a hypothesis and how a scientific theory grows and wins acceptance. Charles Robert Darwin (1809–1882; figure 1.5) was an English naturalist who, after 30 years of study and observation, wrote one of the most famous and influential books of all time. This book, On the Origin of Species by Means of Natural Selection, created a sensation when it was published, and the ideas Darwin expressed in it have played a central role in the development of human thought ever since.
The idea of evolution existed prior to Darwin In Darwin’s time, most people believed that the different kinds of organisms and their individual structures resulted from di8
part
rect actions of a Creator (many people still believe this). Species were thought to have been specially created and to be unchangeable over the course of time. In contrast to these ideas, a number of earlier naturalists and philosophers had presented the view that living things must have changed during the history of life on Earth. That is, evolution has occurred, and living things are now different from how they began. Darwin’s contribution was a concept he called natural selection, which he proposed as a coherent, logical explanation for this process, and he brought his ideas to wide public attention.
Darwin observed differences in related organisms The story of Darwin and his theory begins in 1831, when he was 22 years old. He was part of a five-year navigational mapping expedition around the coasts of South America (figure 1.6), aboard H.M.S. Beagle. During this long voyage, Darwin had the chance to study a wide variety of plants and animals on continents and islands and in distant seas. Darwin observed a number of phenomena that were of central importance to his reaching his ultimate conclusion. Repeatedly, Darwin saw that the characteristics of similar species varied somewhat from place to place. These geographical patterns suggested to him that lineages change gradually as species migrate from one area to another. On the Galápagos Islands, 960 km (600 miles) off the coast of Ecuador, Darwin encountered a variety of different finches on the various islands. The 14 species, although related, differed slightly in appearance, particularly in their beaks (figure 1.7). Darwin thought it was reasonable to assume that all these birds had descended from a common ancestor arriving from the South American mainland several million years ago. Eating different foods on different islands, the finches’ beaks had changed during their descent—“descent with modification,” or evolution. (These finches are discussed in more detail in chapters 21 and 22.)
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 8
11/5/09 3:07:14 PM
British Isles
NORTH PA C I F I C OCEAN
NORTH AMERICA
EUROPE
Western Isles
ASIA
NORTH AT L A N T I C OCEAN Cape Verde Islands
Galápagos Islands
SOUTH AMERICA
NORTH PA C I F I C OCEAN Philippine Islands
Canary Islands AFRICA
INDIAN O C E A N Keeling Islands Madagascar
Ascension
Equator
Bahia
Marquesas
St. Helena Rio de Janeiro
Valparaiso
Mauritius Bourbon Island
Friendly Islands AU S T R A L I A
Sydney
Society Islands
Montevideo Buenos Aires Port Desire Straits of Magellan Cape Horn
Falkland Islands Tierra del Fuego
Cape of Good Hope
King George’s Sound
Hobart
SOUTH AT L A N T I C OCEAN
New Zealand
Figure 1.6 The five-year voyage of H.M.S. Beagle. Most of the time was spent exploring the coasts and coastal islands of South America, such as the Galápagos Islands. Darwin’s studies of the animals of the Galápagos Islands played a key role in his eventual development of the concept of evolution by means of natural selection.
In a more general sense, Darwin was struck by the fact that the plants and animals on these relatively young volcanic islands resembled those on the nearby coast of South America. If each one of these plants and animals had been created independently and simply placed on the Galápagos Islands, why didn’t they resemble the plants and animals of islands with similar climates— such as those off the coast of Africa, for example? Why did they resemble those of the adjacent South American coast instead?
Woodpecker Finch (Cactospiza pallida)
Darwin proposed natural selection as a mechanism for evolution It is one thing to observe the results of evolution, but quite another to understand how it happens. Darwin’s great achievement lies in his ability to move beyond all the individual observations to formulate the hypothesis that evolution occurs because of natural selection.
Large Ground Finch (Geospiza magnirostris)
Cactus Finch (Geospiza scandens)
Figure 1.7 Three Galápagos finches and what they eat. On the Galápagos Islands, Darwin observed 14 different species of finches differing mainly in their beaks and feeding habits. These three fi nches eat very different food items, and Darwin surmised that the different shapes of their bills represented evolutionary adaptations that improved their ability to eat the foods available in their specific habitats. www.ravenbiology.com
rav32223_ch01_001-016.indd 9
chapter
1 The Science of Biology
9
11/5/09 3:07:15 PM
Darwin and Malthus Of key importance to the development of Darwin’s insight was his study of Thomas Malthus’s An Essay on the Principle of Population (1798). In this book, Malthus stated that populations of plants and animals (including human beings) tend to increase geometrically, while humans are able to increase their food supply only arithmetically. Put another way, population increases by a multiplying factor—for example, in the series 2, 6, 18, 54, the starting number is multiplied by 3. Food supply increases by an additive factor—for example, the series 2, 4, 6, 8 adds 2 to each starting number. Figure 1.8 shows the difference that these two types of relationships produce over time. Because populations increase geometrically, virtually any kind of animal or plant, if it could reproduce unchecked, would cover the entire surface of the world surprisingly quickly. Instead, populations of species remain fairly constant year after year, because death limits population numbers. Sparked by Malthus’s ideas, Darwin saw that although every organism has the potential to produce more offspring than can survive, only a limited number actually do survive and produce further offspring. Combining this observation with what he had seen on the voyage of the Beagle, as well as with his own experiences in breeding domestic animals, Darwin made an important association: Individuals possessing physical, behavioral, or
geometric progression arithmetic progression
54
18
6 2
4
6
8
Figure 1.8 Geometric and arithmetic progressions. A geometric progression increases by a constant factor (for example, the curve shown increases ×3 for each step), whereas an arithmetic progression increases by a constant difference (for example, the line shown increases +2 for each step). Malthus contended that the human growth curve was geometric, but the human food production curve was only arithmetic.
? 10
Inquiry In n question What is the effect of reducing the constant factor by which the geometric progression increases? Might this effect be achieved with humans? How? part
other attributes that give them an advantage in their environment are more likely to survive and reproduce than those with less advantageous traits. By surviving, these individuals gain the opportunity to pass on their favorable characteristics to their offspring. As the frequency of these characteristics increases in the population, the nature of the population as a whole will gradually change. Darwin called this process selection.
Natural selection Darwin was thoroughly familiar with variation in domesticated animals, and he began On the Origin of Species with a detailed discussion of pigeon breeding. He knew that animal breeders selected certain varieties of pigeons and other animals, such as dogs, to produce certain characteristics, a process Darwin called artificial selection. Artificial selection often produces a great variation in traits. Domestic pigeon breeds, for example, show much greater variety than all of the wild species found throughout the world. Darwin thought that this type of change could occur in nature, too. Surely if pigeon breeders could foster variation by artificial selection, nature could do the same—a process Darwin called natural selection.
Darwin drafts his argument Darwin drafted the overall argument for evolution by natural selection in a preliminary manuscript in 1842. After showing the manuscript to a few of his closest scientific friends, however, Darwin put it in a drawer, and for 16 years turned to other research. No one knows for sure why Darwin did not publish his initial manuscript—it is very thorough and outlines his ideas in detail. The stimulus that finally brought Darwin’s hypothesis into print was an essay he received in 1858. A young English naturalist named Alfred Russel Wallace (1823–1913) sent the essay to Darwin from Indonesia; it concisely set forth the hypothesis of evolution by means of natural selection, a hypothesis Wallace had developed independently of Darwin. After receiving Wallace’s essay, friends of Darwin arranged for a joint presentation of their ideas at a seminar in London. Darwin then completed his own book, expanding the 1842 manuscript he had written so long ago, and submitted it for publication.
The predictions of natural selection have been tested More than 120 years have elapsed since Darwin’s death in 1882. During this period, the evidence supporting his theory has grown progressively stronger. We briefly explore some of this evidence here; in chapter 22, we will return to the theory of evolution by natural selection and examine the evidence in more detail.
The fossil record Darwin predicted that the fossil record would yield intermediate links between the great groups of organisms—for example, between fishes and the amphibians thought to have arisen from them, and between reptiles and birds. Furthermore, natural selection predicts the relative positions in time of such transitional forms. We now know the fossil record to a degree that was unthinkable in the 19th century, and although truly “intermediate”
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 10
11/5/09 3:07:20 PM
Figure 1.9 Homology among vertebrate limbs. The forelimbs of these five vertebrates show the ways in which the relative proportions of the forelimb bones have changed in relation to the particular way of life of each organism.
Human
Cat
Bat
organisms are hard to determine, paleontologists have found what appear to be transitional forms and found them at the predicted positions in time. Recent discoveries of microscopic fossils have extended the known history of life on Earth back to about 3.5 billion years ago (bya). The discovery of other fossils has supported Darwin’s predictions and has shed light on how organisms have, over this enormous time span, evolved from the simple to the complex. For vertebrate animals especially, the fossil record is rich and exhibits a graded series of changes in form, with the evolutionary sequence visible for all to see.
The age of the Earth Darwin’s theory predicted the Earth must be very old, but some physicists argued that the Earth was only a few thousand years old. This bothered Darwin, because the evolution of all living things from some single original ancestor would have required a great deal more time. Using evidence obtained by studying the rates of radioactive decay, we now know that the physicists of Darwin’s time were very wrong: The Earth was formed about 4.5 bya.
Porpoise
Horse
analogous structures, such as the wings of birds and butterflies, which have similar function but different evolutionary origins.
Molecular evidence Evolutionary patterns are also revealed at the molecular level. By comparing the genomes (that is, the sequences of all the genes) of different groups of animals or plants, we can more precisely specify the degree of relationship among the groups. A series of evolutionary changes over time should involve a continual accumulation of genetic changes in the DNA. This difference can be seen clearly in the protein hemoglobin (figure 1.10). Rhesus monkeys, which like humans
Human
Rhesus
Dog
Bird
Frog
The mechanism of heredity Darwin received some of his sharpest criticism in the area of heredity. At that time, no one had any concept of genes or how heredity works, so it was not possible for Darwin to explain completely how evolution occurs. Even though Gregor Mendel was performing his experiments with pea plants in Brünn, Austria (now Brno, the Czech Republic), during roughly the same period, genetics was established as a science only at the start of the 20th century. When scientists began to understand the laws of inheritance (discussed in chapters 12 and 13), this problem with Darwin’s theory vanished. 0 10 20 30 40 50 60 70 Number of Amino Acid Differences in a Hemoglobin Polypeptide
Comparative anatomy Comparative studies of animals have provided strong evidence for Darwin’s theory. In many different types of vertebrates, for example, the same bones are present, indicating their evolutionary past. Thus, the forelimbs shown in figure 1.9 are all constructed from the same basic array of bones, modified for different purposes. These bones are said to be homologous in the different vertebrates; that is, they have the same evolutionary origin, but they now differ in structure and function. They are contrasted with www.ravenbiology.com
rav32223_ch01_001-016.indd 11
Figure 1.10 Molecules reflect evolutionary patterns. Vertebrates that are more distantly related to humans have a greater number of amino acid differences in the hemoglobin polypeptide.
?
Inquiry In n question Where do you imagine a snake might fall on the graph? Why?
chapter
1 The Science of Biology
11
11/5/09 3:07:21 PM
are primates, have fewer differences from humans in the 146-amino-acid hemoglobin β-chain than do more distantly related mammals, such as dogs. Nonmammalian vertebrates, such as birds and frogs, differ even more. The sequences of some genes, such as the ones specifying the hemoglobin proteins, have been determined in many organisms, and the entire time course of their evolution can be laid out with confidence by tracing the origins of particular nucleotide changes in the gene sequence. The pattern of descent obtained is called a phylogenetic tree. It represents the evolutionary history of the gene, its “family tree.” Molecular phylogenetic trees agree well with those derived from the fossil record, which is strong direct evidence of evolution. The pattern of accumulating DNA changes represents, in a real sense, the footprints of evolutionary history.
Learning Outcomes Review 1.3 Darwin observed differences in related organisms and proposed the hypothesis of evolution by natural selection to explain these differences. The predictions generated by natural selection have been tested and continue to be tested by analysis of the fossil record, genetics, comparative anatomy, and even the DNA of living organisms. ■
Does Darwin’s theory of evolution by natural selection explain the origin of life?
1.4
Unifying Themes in Biology
a.
60 μm
b.
568 μm
Learning Outcomes 1. 2.
Describe the unifying themes in biology. Contrast living and nonliving systems.
The study of biology encompasses a large number of different subdisciplines, ranging from biochemistry to ecology. In all of these, however, unifying themes can be identified. Among these are cell theory, the molecular basis of inheritance, the relationship between structure and function, evolution, and the emergence of novel properties.
Cell theory describes the organization of living systems As was stated at the beginning of this chapter, all organisms are composed of cells, life’s basic units (figure 1.11). Cells were discovered by Robert Hooke in England in 1665, using one of the first microscopes, one that magnified 30 times. Not long after that, the Dutch scientist Anton van Leeuwenhoek used microscopes capable of magnifying 300 times and discovered an amazing world of single-celled life in a drop of pond water. In 1839, the German biologists Matthias Schleiden and Theodor Schwann, summarizing a large number of observations by themselves and others, concluded that all living organ12
part
Figure 1.11 Cellular basis of life. All organisms are composed of cells. Some organisms, including the protists, shown in part (a) are single-celled. Others, such as the plant shown in cross section in part (b) consist of many cells. isms consist of cells. Their conclusion has come to be known as the cell theory. Later, biologists added the idea that all cells come from preexisting cells. The cell theory, one of the basic ideas in biology, is the foundation for understanding the reproduction and growth of all organisms.
The molecular basis of inheritance explains the continuity of life Even the simplest cell is incredibly complex—more intricate than any computer. The information that specifies what a cell is like—its detailed plan—is encoded in deoxyribonucleic acid (DNA), a long, cablelike molecule. Each DNA molecule is
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 12
11/9/09 10:43:31 AM
formed from two long chains of building blocks, called nucleotides, wound around each other (see chapter 14). Four different nucleotides are found in DNA, and the sequence in which they occur encodes the cell’s information. Specific sequences of several hundred to many thousand nucleotides make up a gene, a discrete unit of information. The continuity of life from one generation to the next— heredity—depends on the faithful copying of a cell’s DNA into daughter cells. The entire set of DNA instructions that specifies a cell is called its genome. The sequence of the human genome, 3 billion nucleotides long, was decoded in rough draft form in 2001, a triumph of scientific investigation.
Within Eukarya are four main groups called kingdoms (figure 1.12). Kingdom Protista consists of all the unicellular eukaryotes except yeasts (which are fungi), as well as the multicellular algae. Because of the great diversity among the protists, many biologists feel kingdom Protista should be split into several kingdoms. Kingdom Plantae consists of organisms that have cell walls of cellulose and obtain energy by photosynthesis. Organisms in the kingdom Fungi have cell walls of chitin and obtain energy by secreting digestive enzymes and then absorbing the products they release from the external environment. Kingdom Animalia contains organisms that lack cell walls and obtain energy by first ingesting other organisms and then digesting them internally.
The relationship between structure and function underlies living systems One of the unifying themes of molecular biology is the relationship between structure and function. Function in molecules, and larger macromolecular complexes, is dependent on their structure. Although this observation may seem trivial, it has farreaching implications. We study the structure of molecules and macromolecular complexes to learn about their function. When we know the function of a particular structure, we can infer the function of similar structures found in different contexts, such as in different organisms. Biologists study both aspects, looking for the relationships between structure and function. On the one hand, this allows similar structures to be used to infer possible similar functions. On the other hand, this knowledge also gives clues as to what kinds of structures may be involved in a process if we know about the functionality. For example, suppose that we know the structure of a human cell’s surface receptor for insulin, the hormone that controls uptake of glucose. We then find a similar molecule in the membrane of a cell from a different species—perhaps even a very different organism, such as a worm. We might conclude that this membrane molecule acts as a receptor for an insulinlike molecule produced by the worm. In this way, we might be able to discern the evolutionary relationship between glucose uptake in worms and in humans.
Plantae
Fungi
Eukarya
Animalia
Protista
Archaea
The diversity of life arises by evolutionary change The unity of life that we see in certain key characteristics shared by many related life-forms contrasts with the incredible diversity of living things in the varied environments of Earth. The underlying unity of biochemistry and genetics argues that all life has evolved from the same origin event. The diversity of life arises by evolutionary change leading to the present biodiversity we see. Biologists divide life’s great diversity into three great groups, called domains: Bacteria, Archaea, and Eukarya (figure 1.12). The domains Bacteria and Archaea are composed of single-celled organisms (prokaryotes) with little internal structure, and the domain Eukarya is made up of organisms (eukaryotes) composed of a complex, organized cell or multiple complex cells. www.ravenbiology.com
rav32223_ch01_001-016.indd 13
Bacteria
Figure 1.12 The diversity of life. Biologists categorize all living things into three overarching groups called domains: Bacteria, Archaea, and Eukarya. Domain Eukarya is composed of four kingdoms: Plantae, Fungi, Animalia, and Protista. chapter
1 The Science of Biology
13
11/5/09 3:07:25 PM
Evolutionary conservation explains the unity of living systems Biologists agree that all organisms alive today have descended from some simple cellular creature that arose about 3.5 bya. Some of the characteristics of that earliest organism have been preserved. The storage of hereditary information in DNA, for example, is common to all living things. The retention of these conserved characteristics in a long line of descent usually reflects that they have a fundamental role in the biology of the organism—one not easily changed once adopted. A good example is provided by the homeodomain proteins, which play critical roles in early development in eukaryotes. Conserved characteristics can be seen in approximately 1850 homeodomain proteins, distributed among three different kingdoms of organisms (figure 1.13). The homeodomain proteins are powerful developmental tools that evolved early, and for which no better alternative has arisen.
Cells are information-processing systems One way to think about cells is as highly complex nanomachines that process information. The information stored in DNA is used to direct the synthesis of cellular components, and the particular set of components can differ from cell to cell. The way that proteins fold in space is a form of information that is three-dimensional, and interesting properties emerge from the interaction of these shapes in macromolecular complexes. The control of gene expression allows differentiation of
Mus musculus (animal)
Saccharomyces cerevisiae (fungus)
MEIS
MATa2
PHO2 HB8
KN
HAT BEL1 Arabidopsis thaliana (plant)
GL2 MATa1
PEM
PAX6
Arabidopsis thaliana (plant)
cell types in time and space, leading to changes over developmental time into different tissue types—even though all cells in an organism carry the same genetic information. Cells also process information that they receive about the environment. Cells sense their environment through proteins in their membranes, and this information is transmitted across the membrane to elaborate signal-transduction chemical pathways that can change the functioning of a cell. This ability of cells to sense and respond to their environment is critical to the function of tissues and organs in multicellular organisms. A multicellular organism can regulate its internal environment, maintaining constant temperature, pH, and concentrations of vital ions. This homeostasis is possible because of elaborate signaling networks that coordinate the activities of different cells in different tissues.
Living systems exist in a nonequilibrium state A key feature of living systems is that they are open systems that function far from thermodynamic equilibrium. This has a number of implications for their behavior. A constant supply of energy is necessary to maintain a stable nonequilibrium state. Consider the state of the nucleic acids, and proteins in all of your cells: at equilibrium they are not polymers, they would all be hydrolyzed to monomer nucleotides and amino acids. Second, nonequilibrium systems exhibit self-organizing properties not seen in equilibrium systems. These self-organizing properties of living systems show up at different levels of the hierarchical organization. At the cellular level, macromolecular complexes such as the spindle necessary for chromosome separatation can self-organize. At the population level, a flock of birds, a school of fish, or the bacteria in a biofilm are all also self-organizing. This kind of interacting behavior of individual units leads to emergent properties that are not predictable from the nature of the units themselves. Emergent properties are properties of collections of molecules, cells, individuals, that are distinct from the categorical properties that can be described by such statistics as mean and standard deviation. The mathematics necessary to describe these kind of interacting systems is nonlinear dynamics. The emerging field of systems biology is beginning to model biological systems in this way. The kinds of feedback and feedforward loops that exist between molecules in cells, or neurons in a nervous system, lead to emergent behaviors like human consciousness.
Learning Outcomes Review 1.4 Saccharomyces cerevisiae (fungus)
Mus musculus (animal)
Figure 1.13 Tree of homeodomain proteins. Homeodomain proteins are found in fungi (brown), plants (green), and animals (blue). Based on their sequence similarities, these 11 different homeodomain proteins (uppercase letters at the ends of branches) fall into two groups, with representatives from each kingdom in each group. That means, for example, the mouse homeodomain protein PAX6 is more closely related to fungal and flowering plant proteins, such as PHO2 and GL2, than it is to the mouse protein MEIS. 14
part
Biology is a broad and complex field, but we can identify unifying themes in this complexity. Cells are the basic unit of life, and they are information-processing machines. The structures of molecules, macromolecular complexes, cells, and even higher levels of organization are related to their functions. The diversity of life can be classified and organized based on similar features; biologists identify three large domains that encompass six kingdoms. Living organisms are able to use energy to construct complex molecules from simple ones, and are thus not in a state of thermodynamic equilibrium. ■
How do viruses fit into our definitions of living systems?
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 14
11/5/09 3:07:28 PM
Chapter Review 1.1 The Science of Life Biology unifies much of the natural sciences. The study of biological systems is interdisciplinary because solutions require many different approaches to solve a problem. Life defies simple definition. Although life is difficult to define, living systems have seven characteristics in common. They are composed of one or more cells; are complex and highly ordered; can respond to stimuli; can grow, reproduce, and transmit genetic information to their offspring; need energy to accomplish work; can maintain relatively constant internal conditions (homeostasis); and are capable of evolutionary adaptation to the environment. Living systems show hierarchical organization. The hierarchical organization of living systems progresses from atoms to the biosphere. At each higher level, emergent properties arise that are greater than the sum of the parts.
1.2 The Nature of Science At its core, science is concerned with understanding the nature of the world by using observation and reasoning. Much of science is descriptive. Science is concerned with developing an increasingly accurate description of nature through observation and experimentation. Science uses both deductive and inductive reasoning. Deductive reasoning applies general principles to predict specific results. Inductive reasoning uses specific observations to construct general scientific principles. Hypothesis-driven science makes and tests predictions. A hypothesis is constructed based on observations, and it must generate experimentally testable predictions. Experiments involve a test in which a variable is manipulated, and a control in which the variable is not manipulated. Hypotheses are rejected if their predictions cannot be verified by observation or experiment. Reductionism breaks larger systems into their component parts. Reductionism attempts to understand a complex system by breaking it down into its component parts. It is limited because parts may act differently when isolated from the larger system. Biologists construct models to explain living systems. A model provides a way of organizing our thinking about a problem; models may also suggest experimental approaches. The nature of scientific theories. Scientists use the word theory in two main ways: as a proposed explanation for some natural phenomenon and as a body of concepts that explains facts in an area of study. Research can be basic or applied. Basic research extends the boundaries of what we know; applied research seeks to use scientific findings in practical areas such as agriculture, medicine, and industry.
1.3 An Example of Scientific Inquiry Darwin’s theory of evolution shows how a scientist develops a hypothesis and sets forth evidence, as well as how a scientific theory grows and gains acceptance. www.ravenbiology.com
rav32223_ch01_001-016.indd 15
The idea of evolution existed prior to Darwin. A number of naturalists and philosophers had suggested living things had changed during Earth’s history. Darwin’s contribution was the concept of natural selection. Darwin observed differences in related organisms. During the voyage of the H.M.S. Beagle, Darwin had an opportunity to observe worldwide patterns of diversity. Darwin proposed natural selection as a mechanism for evolution. Darwin noted that species produce many offspring, but only a limited number survive and reproduce. He observed that the traits of offspring can be changed by artificial selection. Darwin proposed that individuals possessing traits that increase survival and reproductive success become more numerous in populations over time. This is the essence of descent with modification (natural selection). Alfred Russel Wallace independently came to the same conclusions from his own studies. The predictions of natural selection have been tested. Natural selection has been tested using data from many fields. Among these are the fossil record; the age of the Earth, determined by rates of radioactive decay to be 4.5 billion years; genetic experiments such as those of Gregor Mendel, showing that traits can be inherited as discrete units; comparative anatomy and the study of homologous structures; and molecular data that provides evidence for changes in DNA and proteins over time. Taken together, these findings strongly support evolution by natural selection. No data to conclusively disprove evolution has been found.
1.4 Unifying Themes in Biology Cell theory describes the organization of living systems. The cell is the basic unit of life and is the foundation for understanding growth and reproduction in all organisms. The molecular basis of inheritance explains the continuity of life. Hereditary information, encoded in genes found in the DNA molecule, is passed on from one generation to the next. The relationship between structure and function underlies living systems. The function of macromolecules and their complexes is dictated by and dependent on their structure. Similarity of structure and function from one life form to another may indicate an evolutionary relationship. The diversity of life arises by evolutionary change. Living organisms appear to have had a common origin from which a diversity of life arose by evolutionary change. They can be grouped into three domains comprising six kingdoms based on their differences. Evolutionary conservation explains the unity of living systems. The underlying similarities in biochemistry and genetics support the contention that all life evolved from a single source. Cells are information-processing systems. Cells can sense and respond to environmental changes through proteins located on their cell membranes. Differential expression of stored genetic information is the basis for different cell types. Living systems exist in a nonequilibrium state. Organisms are open systems that need a constant supply of energy to maintain their stable nonequilibrium state. Living things are able to self-organize, creating levels of complexity that may exhibit emergent properties. chapter
1 The Science of Biology
15
11/5/09 3:07:29 PM
Review Questions b.
U N D E R S TA N D 1. Which of the following is NOT a property of life? a. b.
Energy utilization Movement
c. d.
Order Homeostasis
2. The process of inductive reasoning involves a. b. c. d.
the use of general principles to predict a specific result. the generation of specific predictions based on a belief system. the use of specific observations to develop general principles. the use of general principles to support a hypothesis.
3. A hypothesis in biology is best described as a. b. c. d.
a possible explanation of an observation. an observation that supports a theory. a general principle that explains some aspect of life. an unchanging statement that correctly predicts some aspect of life.
4. A scientific theory is a. b. c. d.
a guess about how things work in the world. a statement of how the world works that is supported by experimental data. a belief held by many scientists. both a and c.
5. The cell theory states that a. b. c. d.
cells are small. cells are highly organized. there is only one basic type of cell. all living things are made up of cells.
6. The molecule DNA is important to biological systems because a. b. c. d.
it can be replicated. it encodes the information for making a new individual. it forms a complex, double-helical structure. nucleotides form genes.
7. The organization of living systems is a. b. c. d.
linear with cells at one end and the biosphere at the other. circular with cells in the center. hierarchical with cells at the base, and the biosphere at the top. chaotic and beyond description.
8. The idea of evolution a. b. c. d.
was original to Darwin. was original to Wallace. predated Darwin and Wallace. both a and b.
A P P LY 1. What is the significance of Pasteur’s experiment to test the germ hypothesis? a. b. c. d.
It proved that heat can sterilize a broth. It demonstrated that cells can arise spontaneously. It demonstrated that some cells are germs. It demonstrated that cells can only arise from other cells.
2. Which of the following is NOT an example of reductionism? a. 16
part
Analysis of an isolated enzyme’s function in an experimental assay
c. d.
Investigation of the effect of a hormone on cell growth in a Petri dish Observation of the change in gene expression in response to specific stimulus An evaluation of the overall behavior of a cell
3. How is the process of natural selection different from that of artificial selection? a. b. c. d.
Natural selection produces more variation. Natural selection makes an individual better adapted. Artificial selection is a result of human intervention. Artificial selection results in better adaptations.
4. How does the fossil record help support the theory of evolution by natural selection? a. b. c. d.
It demonstrates that simple organisms predate more complex organisms. It provides evidence of change in the form of organisms over time. It shows that diversity existed millions of years ago. Both a and b.
5. The theory of evolution by natural selection is a good example of how science proceeds because a. b. c. d.
it rationalizes a large body of observations. it makes predictions that have been tested by a variety of approaches. it represents Darwin’s belief of how life has changed over time. both a and b.
6. In which domain of life would you find only single-celled organisms? a. b.
Eukarya Bacteria
c. d.
Archaea Both b and c
7. Evolutionary conservation occurs when a characteristic is a. b. c. d.
important to the life of the organism. not influenced by evolution. reduced to its least complex form. found in more primitive organisms.
SYNTHESIZE 1. Exobiology is the study of life on other planets. In recent years, scientists have sent various spacecraft out into the galaxy in search for extraterrestrial life. Assuming that all life shares common properties, what should exobiologists be looking for as they explore other worlds? 2. The classic experiment by Pasteur (see figure 1.4) tested the hypothesis that cells arise from other cells. In this experiment cell growth was measured following sterilization of broth in a swan-neck flask or in a flask with a broken neck. a. b. c. d.
Which variables were kept the same in these two experiments? How does the shape of the flask affect the experiment? Predict the outcome of each experiment based on the two hypotheses. Some bacteria (germs) are capable of producing heatresistant spores that protect the cell and allow it to continue to grow after the environment cools. How would the outcome of this experiment have been affected if sporeforming bacteria were present in the broth?
I The Molecular Basis of Life
rav32223_ch01_001-016.indd 16
11/5/09 3:07:29 PM
CHAPTER
Chapter
2
The Nature of Molecules and the Properties of Water Chapter Outline 2.1
The Nature of Atoms
2.2
Elements Found in Living Systems
2.3
The Nature of Chemical Bonds
2.4
Water: A Vital Compound
2.5
Properties of Water
2.6
Acids and Bases
A
Introduction
About 12.5 billion years ago, an enormous explosion probably signalled the beginning of the universe. This explosion started a process of star building and planetary formation that eventually led to the formation of Earth, about 4.5 billion years ago (BYA). Around 3.5 BYA , life began on Earth and started to diversify. To understand the nature of life on Earth, we first need to understand the nature of the matter that forms the building blocks of all life. The earliest speculations about the world around us included this most basic question, “What is it made of?” The ancient Greeks recognized that larger things may be built of smaller parts. This concept was formed into a solid experimental scientific idea in the early 20th century, when physicists began trying to break atoms apart. From those humble beginnings to the huge particle accelerators used by the modern physicists of today, the picture of the atomic world emerges as fundamentally different from the tangible, macroscopic world around us. To understand how living systems are assembled, we must first understand a little about atomic structure, about how atoms can be linked together by chemical bonds to make molecules, and about the ways in which these small molecules are joined together to make larger molecules, until finally we arrive at the structures of cells and then of organisms. Our study of life on Earth therefore begins with physics and chemistry. For many of you, this chapter will be a review of material encountered in other courses.
rav32223_ch02_017-032.indd 17
11/9/09 12:02:18 PM
out the first experiments revealing the physical nature of atoms (figure 2.1).
The Nature of Atoms
2.1
Atomic structure includes a central nucleus and orbiting electrons
Learning Outcomes 1. 2.
3.
Define element, atomic number, atomic mass, and isotope. Describe atomic structure, the relationships of subatomic particles, and how these relationships determine chemical properties. Explain the discrete energy levels in which electrons orbit the nucleus of an atom.
Any substance in the universe that has mass and occupies space is defined as matter. All matter is composed of extremely small particles called atoms. Because of their size, atoms are difficult to study. Not until early in the 20th century did scientists carry SCIENTIFIC THINKING Hypothesis: Atoms are composed of diffuse positive charge with embedded negative charge (electrons). Prediction: If alpha particles (a), which are helium nuclei, are shot at a thin foil of gold, the a-particles will not be deflected much by the diffuse positive charge or by the light electrons. Test: a-Particles are shot at a thin sheet of gold foil surrounded by a detector screen, which shows flashes of light when hit by the particles. 2. Most a-particles pass through foil with little or no deflection.
1. a-Particles are fired at gold foil target.
Atomic number and the elements Within the nucleus, the cluster of protons and neutrons is held together by a force that works only over short, subatomic distances. Each proton carries a positive (+) charge, and each neutron has no charge. Each electron carries a negative (–) charge. Typically, an atom has one electron for each proton and is, thus, electrically neutral. Different atoms are defined by the number of protons, a quantity called the atomic number. The chemical behavior of an atom is due to the number and configuration of electrons, as we will see later in this chapter. Atoms with the same atomic number (that is, the same number of protons) have the same chemical properties and are said to belong to the same element. Formally speaking, an element is any substance that cannot be broken down to any other substance by ordinary chemical means.
Atomic mass
Gold foil
a-Particle source
Objects as small as atoms can be “seen” only indirectly, by using complex technology such as tunneling microscopy (figure 2.2). We now know a great deal about the complexities of atomic structure, but the simple view put forth in 1913 by the Danish physicist Niels Bohr provides a good starting point for understanding atomic theory. Bohr proposed that every atom possesses an orbiting cloud of tiny subatomic particles called electrons whizzing around a core, like the planets of a miniature solar system. At the center of each atom is a small, very dense nucleus formed of two other kinds of subatomic particles: protons and neutrons (figure 2.3).
Detector screen
The terms mass and weight are often used interchangeably, but they have slightly different meanings. Mass refers to the amount of a substance, but weight refers to the force gravity exerts on a substance. An object has the same mass whether it is on the Earth or the Moon, but its weight will be greater on the Earth because the Earth’s gravitational force is greater than the Moon’s. The atomic mass of an atom is equal to the sum of the masses of
3. Some a-particles are deflected by more than 90°. Result: Most particles are not deflected at all, but a small percentage of particles are deflected at angles of 90° or more. Conclusion: The hypothesis is not supported. The large deflections observed led to a view of the atom as composed of a very small central region containing positive charge (the nucleus) surrounded by electrons. Further Experiments: How does the Bohr atom with its quantized energy for electrons extend this model?
Figure 2.1 Rutherford scattering experiment. Large-angle scattering of α particles led Rutherford to propose the existence of the nucleus. 18
part
Figure 2.2 Scanning tunneling microscope image. The scanning tunneling microscope is a nonoptical way of imaging that allows atoms to be visualized. This image shows a lattice of oxygen atoms (dark blue) on a rhodium crystal (light blue).
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 18
11/9/09 3:30:01 PM
Hydrogen
Oxygen
1 Proton 1 Electron
8 Protons 8 Neutrons 8 Electrons
a.
Electrons The positive charges in the nucleus of an atom are neutralized, or counterbalanced, by negatively charged electrons, which are located in regions called orbitals that lie at varying distances around the nucleus. Atoms with the same number of protons and electrons are electrically neutral; that is, they have no net charge, and are therefore called neutral atoms. Electrons are maintained in their orbitals by their attraction to the positively charged nucleus. Sometimes other forces overcome this attraction, and an atom loses one or more electrons. In other cases, atoms gain additional electrons. Atoms in which the number of electrons does not equal the number of protons are known as ions, and they are charged particles. An atom having more protons than electrons has a net positive charge and is called a cation. For example, an atom of sodium (Na) that has lost one electron becomes a sodium ion (Na+), with a charge of +1. An atom having fewer protons than electrons carries a net negative charge and is called an anion. A chlorine atom (Cl) that has gained one electron becomes a chloride ion (Cl–), with a charge of –1.
Isotopes
b. proton (positive charge)
electron (negative charge)
neutron (no charge)
Figure 2.3 Basic structure of atoms. All atoms have a nucleus consisting of protons and neutrons, except hydrogen, the smallest atom, which usually has only one proton and no neutrons in its nucleus. Oxygen typically has eight protons and eight neutrons in its nucleus. In the simple “Bohr model” of atoms pictured here, electrons spin around the nucleus at a relatively far distance. a. Atoms are depicted as a nucleus with a cloud of electrons (not shown to scale). b. The electrons are shown in discrete energy levels. These are described in greater detail in the text.
its protons and neutrons. Atoms that occur naturally on Earth contain from 1 to 92 protons and up to 146 neutrons. The mass of atoms and subatomic particles is measured in units called daltons. To give you an idea of just how small these units are, note that it takes 602 million million billion (6.02 × 1023) daltons to make 1 gram (g). A proton weighs approximately 1 dalton (actually 1.007 daltons), as does a neutron (1.009 dal-
Carbon-12 6 Protons 6 Neutrons 6 Electrons
www.ravenbiology.com
rav32223_ch02_017-032.indd 19
tons). In contrast, electrons weigh only 1/1840 of a dalton, so they contribute almost nothing to the overall mass of an atom.
Carbon-13 6 Protons 7 Neutrons 6 Electrons
Although all atoms of an element have the same number of protons, they may not all have the same number of neutrons. Atoms of a single element that possess different numbers of neutrons are called isotopes of that element. Most elements in nature exist as mixtures of different isotopes. Carbon (C), for example, has three isotopes, all containing six protons (figure 2.4). Over 99% of the carbon found in nature exists as an isotope that also contains six neutrons. Because the total mass of this isotope is 12 daltons (6 from protons plus 6 from neutrons), it is referred to as carbon-12 and is symbolized 12C. Most of the rest of the naturally occurring carbon is carbon-13, an isotope with seven neutrons. The rarest carbon isotope is carbon-14, with eight neutrons. Unlike the other two isotopes, carbon-14 is unstable: This means that its nucleus tends to break up into elements with lower atomic numbers. This nuclear breakup, which emits a significant amount of energy, is called radioactive decay, and isotopes that decay in this fashion are radioactive isotopes. Some radioactive isotopes are more unstable than others, and therefore they decay more readily. For any given isotope, however, the rate of decay is constant. The decay time is usually expressed as the half-life, the time it takes for one-half of the
Carbon-14 6 Protons 8 Neutrons 6 Electrons
chapter
Figure 2.4 The three most abundant isotopes of carbon. Isotopes of a particular element have different numbers of neutrons.
2 The Nature of Molecules and the Properties of Water
19
11/5/09 4:07:27 PM
atoms in a sample to decay. Carbon-14, for example, often used in the carbon dating of fossils and other materials, has a halflife of 5730 years. A sample of carbon containing 1 g of carbon-14 today would contain 0.5 g of carbon-14 after 5730 years, 0.25 g 11,460 years from now, 0.125 g 17,190 years from now, and so on. By determining the ratios of the different isotopes of carbon and other elements in biological samples and in rocks, scientists are able to accurately determine when these materials formed. Radioactivity has many useful applications in modern biology. Radioactive isotopes are one way to label, or “tag,” a specific molecule and then follow its progress, either in a chemical reaction or in living cells and tissue. The downside, however, is that the energetic subatomic particles emitted by radioactive substances have the potential to severely damage living cells, producing genetic mutations and, at high doses, cell death. Consequently, exposure to radiation is carefully controlled and regulated. Scientists who work with radioactivity follow strict handling protocols and wear radiation-sensitive badges to monitor their exposure over time to help ensure a safe level of exposure.
Electron Shell Diagram
Corresponding Electron Orbital
Energy level K
One spherical orbital (1s)
Electrons determine the chemical behavior of atoms The key to the chemical behavior of an atom lies in the number and arrangement of its electrons in their orbitals. The Bohr model of the atom shows individual electrons as following discrete, or distinct, circular orbits around a central nucleus. The trouble with this simple picture is that it doesn’t reflect reality. Modern physics indicates that we cannot pinpoint the position of any individual electron at any given time. In fact, an electron could be anywhere, from close to the nucleus to infinitely far away from it. A particular electron, however, is more likely to be in some areas than in others. An orbital is defined as the area around a nucleus where an electron is most likely to be found. These orbitals represent probability distributions for electrons, that is, regions more likely to contain an electron. Some electron orbitals near the nucleus are spherical (s orbitals), while others are dumbbell-shaped (p orbitals) (figure 2.5). Still other orbitals, farther away from the nucleus, may have different shapes. Regardless of its shape, no orbital can contain more than two electrons. Almost all of the volume of an atom is empty space. This is because the electrons are usually far away from the nucleus, relative to its size. If the nucleus of an atom were the size of a golf ball, the orbit of the nearest electron would be a mile away. Consequently, the nuclei of two atoms never come close enough in nature to interact with each other. It is for this reason that an atom’s electrons, not its protons or neutrons, determine its chemical behavior, and it also explains why the isotopes of an element, all of which have the same arrangement of electrons, behave the same way chemically.
a. Electron Shell Diagram
Corresponding Electron Orbitals y
z
Energy level L x
One spherical orbital (2s)
Three dumbbell-shaped orbitals (2p)
b. Electron Shell Diagram
Electron Orbitals
Figure 2.5 Electron orbitals. a. The lowest energy level, or
y z
x
Neon
c. 20
part
electron shell—the one nearest the nucleus—is level K. It is occupied by a single s orbital, referred to as 1s. b. The next highest energy level, L, is occupied by four orbitals: one s orbital (referred to as the 2s orbital) and three p orbitals (each referred to as a 2p orbital). Each orbital holds two paired electrons with opposite spin. Thus, the K level is populated by two electrons, and the L level is populated by a total of eight electrons. c. The neon atom shown has the L and K energy levels completely filled with electrons and is thus unreactive.
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 20
11/5/09 4:07:27 PM
Atoms contain discrete energy levels Because electrons are attracted to the positively charged nucleus, it takes work to keep them in their orbitals, just as it takes work to hold a grapefruit in your hand against the pull of gravity. The formal definition of energy is the ability to do work. The grapefruit held above the ground is said to possess potential energy because of its position. If you release it, the grapefruit falls, and its potential energy is reduced. On the other hand, if you carried the grapefruit to the top of a building, you would increase its potential energy. Electrons also have a potential energy that is related to their position. To oppose the attraction of the nucleus and move the electron to a more distant orbital requires an input of energy, which results in an electron with greater potential energy. The chlorophyll that makes plants green captures energy from light during photosynthesis in this way. As you’ll see in chapter 8—light energy excites electrons in the chlorophyll molecule. Moving an electron closer to the nucleus has the opposite effect: Energy is released, usually as radiant energy (heat or light), and the electron ends up with less potential energy (figure 2.6). One of the initially surprising aspects of atomic structure is that electrons within the atom have discrete energy levels. These discrete levels correspond to quanta (sing., quantum), which means specific amount of energy. To use the grapefruit analogy again, it is as though a grapefruit could only be raised to particular floors of a building. Every atom exhibits a ladder of potential energy values, a discrete set of orbitals at particular energetic “distances” from the nucleus. Because the amount of energy an electron possesses is related to its distance from the nucleus, electrons that are the same distance from the nucleus have the same energy, even if they occupy different orbitals. Such electrons are said to occupy the same energy level. The energy levels are denoted with letters K, L, M, and so on (see figure 2.6). Be careful not to confuse energy levels, which are drawn as rings to indicate an electron’s energy, with orbitals, which have a variety of threedimensional shapes and indicate an electron’s most likely location. Electron orbitals are arranged so that as they are filled, this fills each energy level in successive order. This filling of orbitals
Energy released
and energy levels is what is responsible for the chemical reactivity of elements. During some chemical reactions, electrons are transferred from one atom to another. In such reactions, the loss of an electron is called oxidation, and the gain of an electron is called reduction. : ;
;
Oxidation
Reduction
Notice that when an electron is transferred in this way, it keeps its energy of position. In organisms, chemical energy is stored in high-energy electrons that are transferred from one atom to another in reactions involving oxidation and reduction (described in chapter 7). When the processes of oxidation and reduction are coupled, which often happens, one atom or molecule is oxidized while another is reduced in the same reaction. We call these combinations redox reactions.
Learning Outcomes Review 2.1 An atom consists of a nucleus of protons and neutrons surrounded by a cloud of electrons. For each atom, the number of protons is the atomic number; atoms with the same atomic number constitute an element. Atoms of a single element that have different numbers of neutrons are called isotopes. Electrons, which determine the chemical behavior of an element, are located about a nucleus in orbitals representing discrete energy levels. No orbital can contain more than two electrons, but many orbitals may have the same energy level, and thus contain electrons with the same energy. ■
If the number of protons exceeds the number of neutrons, is the charge on the atom positive or negative? ■ If the number of protons exceeds electrons?
Energy absorbed
Nucleus
K L M N
N M L K
Nucleus
Figure 2.6 Atomic energy levels. Electrons have energy of position. When an atom absorbs energy, an electron moves to a higher energy level, farther from the nucleus. When an electron falls to lower energy levels, closer to the nucleus, energy is released. The first two energy levels are the same as shown in the previous figure. www.ravenbiology.com
rav32223_ch02_017-032.indd 21
chapter
2 The Nature of Molecules and the Properties of Water
21
11/5/09 4:07:28 PM
possessing all eight electrons in their outer energy level (two for helium) are inert, or nonreactive. These elements, which include helium (He), neon (Ne), argon (Ar), and so on, are termed the noble gases. In sharp contrast, elements with seven electrons (one fewer than the maximum number of eight) in their outer energy level, such as fluorine (F), chlorine (Cl), and bromine (Br), are highly reactive. They tend to gain the extra electron needed to fill the energy level. Elements with only one electron in their outer energy level, such as lithium (Li), sodium (Na), and potassium (K), are also very reactive. They tend to lose the single electron in their outer level. Mendeleev’s periodic table leads to a useful generalization, the octet rule, or rule of eight (Latin octo, “eight”): Atoms tend to establish completely full outer energy levels. For the main group elements of the periodic table, the rule of eight is accomplished by one filled s orbital and three filled p orbitals (figure 2.8). The exception to this is He, in the first row, which needs only two electrons to fill the 1s orbital. Most chemical behavior of biological interest can be predicted quite accurately from this simple rule, combined with the tendency of atoms to balance positive and negative charges. For instance, you read earlier that sodium ion (Na+) has lost an electron, and chloride ion (Cl–) has gained an electron. In the following section, we describe how these ions react to form table salt. Of the 90 naturally occurring elements on Earth, only 12 (C, H, O, N, P, S, Na, K, Ca, Mg, Fe, Cl) are found in living systems in more than trace amounts (0.01% or higher). These elements all have atomic numbers less than 21, and thus, have low atomic masses. Of these 12, the first 4 elements (carbon, hydrogen, oxygen, and nitrogen) constitute 96.3% of the weight of your body. The majority of molecules that make up your body are compounds of carbon, which we call organic compounds.
Elements Found in Living Systems
2.2
Learning Outcomes 1.
Relate atomic structure to the periodic table of the elements. List the important elements found in living systems.
2.
Ninety elements occur naturally, each with a different number of protons and a different arrangement of electrons. When the 19th-century Russian chemist Dmitri Mendeleev arranged the known elements in a table according to their atomic number, he discovered one of the great generalizations of science: The elements exhibit a pattern of chemical properties that repeats itself in groups of eight. This periodically repeating pattern lent the table its name: the periodic table of elements (figure 2.7).
The periodic table displays elements according to atomic number and properties The eight-element periodicity that Mendeleev found is based on the interactions of the electrons in the outermost energy level of the different elements. These electrons are called valence electrons, and their interactions are the basis for the elements’ differing chemical properties. For most of the atoms important to life, the outermost energy level can contain no more than eight electrons; the chemical behavior of an element reflects how many of the eight positions are filled. Elements 1
8
Key
H 3
4
Li
Be
2
O
1
atomic number
H
chemical symbol
6
5
B
11
12
13
Na
Mg
Al
19
20
K
Ca
C
14
9
7
22
23
24
25
Sc
Ti
V
Cr
Mn
Fe
F
N
Si
10
Ne
15
16
P
17
18
Carbon (C)
O
Oxygen (O)
H
Hydrogen (H)
N
Nitrogen (N)
S
Cl
Ar
28
29
30
31
32
33
34
35
36
Co
Ni
Cu
Zn
Ga
Ge
As
Se
Br
Kr
Na Sodium (Na) Cl Chlorine (Cl)
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
Rb
Sr
Y
Zr
Nb
Mo
Tc
Ru
Rh
Pd
Ag
Cd
In
Sn
Sb
Te
I
Xe
55
56
57
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
Cs
Ba
La
Hf
Ta
W
Re
Os
Ir
Pt
Au
Hg
Tl
Pb
Bi
Po
At
Rn
87
88
89
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
Fr
Ra
Ac
Rf
Ob
Sg
Bh
Hs
Mt
Ds Uuu Uub Uut Uuq Uup Uuh
58
59
60
61
62
(Lanthanide series)
Ce
Pr
90
91
92
93
(Actinide series)
Th
Pa
U
Np
a.
C
27
26 21
He
Nd Pm Sm 94
63
64
65
66
67
68
69
70
71
Eu
Gd
Tb
Dy
Ho
Er
Tm
Yb
Lu
95
96
97
100
101
102
103
Fm Md
No
Lr
Pu Am Cm Bk
98
99
Cf
Es
Ca Calcium (Ca) P
Phosphorus (P)
K
Potassium (K)
S
Sulfur (S)
Fe Iron (Fe) Mg Magnesium (Mg)
b.
Figure 2.7 Periodic table of the elements. a. In this representation, the frequency of elements that occur in the Earth’s crust is indicated by the height of the block. Elements shaded in green are found in living systems in more than trace amounts. b. Common elements found in living systems are shown in colors that will be used throughout the text. 22
part
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 22
11/5/09 4:07:29 PM
Nonreactive
Reactive
2 protons 2 neutrons 2 electrons
7 protons 7 neutrons 7 electrons
TA B L E 2 .1 Name
Bonds and Interactions Basis of Interaction
Strength
Covalent bond
Sharing of electron pairs
Strong
Ionic bond
Attraction of opposite charges
Hydrogen bond
Sharing of H atom
Hydrophobic interaction
Forcing of hydrophobic portions of molecules together in presence of polar substances
van der Waals attraction
Weak attractions between atoms due to oppositely polarized electron clouds
K K
L 2;
Helium
7;
Nitrogen
Figure 2.8 Electron energy levels for helium and nitrogen. Green balls represent electrons, blue ball represents the nucleus with number of protons indicated by number of (+) charges. Note that the helium atom has a filled K shell and is thus unreactive, whereas the nitrogen atom has five electrons in the L shell, three of which are unpaired, making it reactive.
These organic compounds contain primarily these four elements (CHON), explaining their prevalence in living systems. Some trace elements, such as zinc (Zn) and iodine (I), play crucial roles in living processes even though they are present in tiny amounts. Iodine deficiency, for example, can lead to enlargement of the thyroid gland, causing a bulge at the neck called a goiter.
Weak
(covalent bonds), or when atoms interact in other ways (table 2.1). We will start by examining ionic bonds, which form when atoms with opposite electrical charges (ions) attract.
Ionic bonds form crystals Common table salt, the molecule sodium chloride (NaCl), is a lattice of ions in which the atoms are held together by ionic bonds (figure 2.9). Sodium has 11 electrons: 2 in the inner
Learning Outcomes Review 2.2 The periodic table shows the elements in terms of atomic number and repeating chemical properties. Only 12 elements are found in significant amounts in living organisms: C, H, O, N, P, S, Na, K, Ca, Mg, Fe, and Cl. ■
Why are the noble gases more stable than other elements in the periodic table?
2.3
The Nature of Chemical Bonds
Learning Outcomes 1. 2. 3.
Na+
Na
Relate position in the periodic table to the formation of ions. Explain how complex molecules can be built from many atoms by covalent bonds. Contrast polar and nonpolar covalent bonds.
A group of atoms held together by energy in a stable association is called a molecule. When a molecule contains atoms of more than one element, it is called a compound. The atoms in a molecule are joined by chemical bonds; these bonds can result when atoms with opposite charges attract each other (ionic bonds), when two atoms share one or more pairs of electrons www.ravenbiology.com
rav32223_ch02_017-032.indd 23
Sodium atom
Sodium ion (;)
Cl
Cl-
Chlorine atom
Chloride ion (:)
a.
Figure 2.9 The formation of ionic bonds by sodium chloride. a. When a sodium atom donates an electron to a chlorine atom, the sodium atom becomes a positively charged sodium ion, and the chlorine atom becomes a negatively charged chloride ion. b. The electrostatic attraction of oppositely charged ions leads to the formation of a lattice of Na+ and Cl–. chapter
Cl-
Na+
Cl-
Na+
Cl-
Na+
Cl-
Na+
Cl-
b. NaCl crystal
2 The Nature of Molecules and the Properties of Water
23
11/5/09 4:07:29 PM
energy level (K), 8 in the next level (L), and 1 in the outer (valence) level (M). The single, unpaired valence electron has a strong tendency to join with another unpaired electron in another atom. A stable configuration can be achieved if the valence electron is lost to another atom that also has an unpaired electron. The loss of this electron results in the formation of a positively charged sodium ion, Na+. The chlorine atom has 17 electrons: 2 in the K level, 8 in the L level, and 7 in the M level. As you can see in the figure, one of the orbitals in the outer energy level has an unpaired electron (red circle). The addition of another electron fills that level and causes a negatively charged chloride ion, Cl–, to form. When placed together, metallic sodium and gaseous chlorine react swiftly and explosively, as the sodium atoms donate electrons to chlorine to form Na+ and Cl– ions. Because opposite charges attract, the Na+ and Cl– remain associated in an ionic compound, NaCl, which is electrically neutral. The electrical attractive force holding NaCl together, however, is not directed specifically between individual Na+ and Cl– ions, and no individual sodium chloride molecules form. Instead, the force exists between any one ion and all neighboring ions of the opposite charge. The ions aggregate in a crystal matrix with a precise geometry. Such aggregations are what we know as salt crystals. If a salt such as NaCl is placed in water, the electrical attraction of the water molecules, for reasons we will point out later in this chapter, disrupts the forces holding the ions in their crystal matrix, causing the salt to dissolve into a roughly equal mixture of free Na+ and Cl– ions. Because living systems always include water, ions are more important than ionic crystals. Important ions in biological systems include Ca2+, which is involved in cell signaling, K+ and Na+, which are involved in the conduction of nerve impulses.
The strength of covalent bonds The strength of a covalent bond depends on the number of shared electrons. Thus double bonds, which satisfy the octet rule by allowing two atoms to share two pairs of electrons, are stronger than single bonds, in which only one electron pair is shared. In practical terms, more energy is required to break a double bond than a single bond. The strongest covalent bonds are triple bonds, such as those that link the two nitrogen atoms of nitrogen gas molecules (N2). Covalent bonds are represented in chemical formulas as lines connecting atomic symbols. Each line between two bonded atoms represents the sharing of one pair of electrons. The structural formulas of hydrogen gas and oxygen gas are H–H and O=O, respectively, and their molecular formulas are H2 and O2. The structural formula for N2 is N≡N.
covalent bond Single covalent bond hydrogen gas HJH
H
Double covalent bond oxygen gas OKO
O
O
N
N
O2
Triple covalent bond nitrogen gas
JN NK
H
H2
N2
Covalent bonds build stable molecules Covalent bonds form when two atoms share one or more pairs of valence electrons. Consider gaseous hydrogen (H2) as an example. Each hydrogen atom has an unpaired electron and an unfilled outer energy level; for these reasons, the hydrogen atom is unstable. However, when two hydrogen atoms are in close association, each atom’s electron is attracted to both nuclei. In effect, the nuclei are able to share their electrons. The result is a diatomic (two-atom) molecule of hydrogen gas. The molecule formed by the two hydrogen atoms is stable for three reasons: 1. It has no net charge. The diatomic molecule formed as a result of this sharing of electrons is not charged because it still contains two protons and two electrons. 2. The octet rule is satisfied. Each of the two hydrogen atoms can be considered to have two orbiting electrons in its outer energy level. This state satisfies the octet rule, because each shared electron orbits both nuclei and is included in the outer energy level of both atoms. 3. It has no unpaired electrons. The bond between the two atoms also pairs the two free electrons. Unlike ionic bonds, covalent bonds are formed between two individual atoms, giving rise to true, discrete molecules. 24
part
Molecules with several covalent bonds A vast number of biological compounds are composed of more than two atoms. An atom that requires two, three, or four additional electrons to fill its outer energy level completely may acquire them by sharing its electrons with two or more other atoms. For example, the carbon atom (C) contains six electrons, four of which are in its outer energy level and are unpaired. To satisfy the octet rule, a carbon atom must form four covalent bonds. Because four covalent bonds may form in many ways, carbon atoms are found in many different kinds of molecules. CO2 (carbon dioxide), CH4 (methane), and C2H5OH (ethanol) are just a few examples.
Polar and nonpolar covalent bonds Atoms differ in their affinity for electrons, a property called electronegativity. In general, electronegativity increases left to right across a row of the periodic table and decreases down the column. Thus the elements in the upper-right corner have the highest electronegativity. For bonds between identical atoms, for example, between two hydrogen or two oxygen atoms, the affinity for electrons is obviously the same, and the electrons are equally shared. Such
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 24
11/5/09 4:07:30 PM
bonds are termed nonpolar. The resulting compounds (H2 or O2) are also referred to as nonpolar. For atoms that differ greatly in electronegativity, electrons are not shared equally. The shared electrons are more likely to be closer to the atom with greater electronegativity, and less likely to be near the atom of lower electronegativity. In this case, although the molecule is still electrically neutral (same number of protons as electrons), the distribution of charge is not uniform. This unequal distribution results in regions of partial negative charge near the more electronegative atom, and regions of partial positive charge near the less electronegative atom. Such bonds are termed polar covalent bonds, and the molecules polar molecules. When drawing polar molecules, these partial charges are usually symbolized by the lowercase Greek letter delta (δ). The partial charge seen in a polar covalent bond is relatively small—far less than the unit charge of an ion. For biological molecules, we can predict polarity of bonds by knowing the relative electronegativity of a small number of important atoms (table 2.2). Notice that although C and H differ slightly in electronegativity, this small difference is negligible, and C–H bonds are considered nonpolar. Because of its importance in the chemistry of water, we will explore the nature of polar and nonpolar molecules in the following section on water. Water (H2O) is a polar molecule with electrons more concentrated around the oxygen atom.
Chemical reactions alter bonds The formation and breaking of chemical bonds, which is the essence of chemistry, is termed a chemical reaction. All chemical reactions involve the shifting of atoms from one molecule or ionic compound to another, without any change in the number or identity of the atoms. For convenience, we refer to the original molecules before the reaction starts as reactants, and the molecules resulting from the chemical reaction as products. For example: 6H2O + 6CO2 → C6H12O6 + 6O2 reactants
→
The extent to which chemical reactions occur is influenced by three important factors: 1. Temperature. Heating the reactants increases the rate of a reaction because the reactants collide with one another more often. (Care must be taken that the temperature is not so high that it destroys the molecules.) 2. Concentration of reactants and products. Reactions proceed more quickly when more reactants are available, allowing more frequent collisions. An accumulation of products typically slows the reaction and, in reversible reactions, may speed the reaction in the reverse direction. 3. Catalysts. A catalyst is a substance that increases the rate of a reaction. It doesn’t alter the reaction’s equilibrium between reactants and products, but it does shorten the time needed to reach equilibrium, often dramatically. In living systems, proteins called enzymes catalyze almost every chemical reaction. Many reactions in nature are reversible. This means that the products may themselves be reactants, allowing the reaction to proceed in reverse. We can write the preceding reaction in the reverse order: C6H12O6 + 6O2 → 6H2O + 6CO2 reactants
Learning Outcomes Review 2.3 An ionic bond is an attraction between ions of opposite charge in an ionic compound. A covalent bond is formed when two atoms share one or more pairs of electrons. Complex biological compounds are formed in large part by atoms that can form one or more covalent bonds: C, H, O, and N. A polar covalent bond is formed by unequal sharing of electrons. Nonpolar bonds exhibit equal sharing of electrons.
products
Relative Electronegativities of Some Important Atoms
■
How is a polar covalent bond different from an ionic bond?
2.4
Atom
Electronegativity
O
3.5
1.
N
3.0
2.
C
2.5
H
2.1
www.ravenbiology.com
rav32223_ch02_017-032.indd 25
products
This reaction is a simplified version of the oxidation of glucose by cellular respiration, in which glucose is broken down into water and carbon dioxide in the presence of oxygen. Virtually all organisms carry out forms of glucose oxidation; details are covered later, in chapter 7.
You may recognize this reaction as a simplified form of the photosynthesis reaction, in which water and carbon dioxide are combined to produce glucose and oxygen. Most animal life ultimately depends on this reaction, which takes place in plants. (Photosynthetic reactions will be discussed in detail in chapter 8.)
TA B L E 2 . 2
→
Water: A Vital Compound
Learning Outcomes Relate how the structure of water leads to hydrogen bonds. Describe water’s cohesive and adhesive properties.
Of all the common molecules, only water exists as a liquid at the relatively low temperatures that prevail on the Earth’s surface. Three-fourths of the Earth is covered by liquid water chapter
2 The Nature of Molecules and the Properties of Water
25
11/5/09 4:07:30 PM
a. Solid
b. Liquid
c. Gas
Figure 2.10 Water takes many forms. a. When water cools below 0°C, it forms beautiful crystals, familiar to us as snow and ice. b. Ice turns to liquid when the temperature is above 0°C. c. Liquid water becomes steam when the temperature rises above 100°C, as seen in this hot spring at Yellowstone National Park.
(figure 2.10). When life was beginning, water provided a medium in which other molecules could move around and interact, without being held in place by strong covalent or ionic bonds. Life evolved in water for 2 billion years before spreading to land. And even today, life is inextricably tied to water. About two-thirds of any organism’s body is composed of water, and all organisms require a water-rich environment, either inside or outside it, for growth and reproduction. It is no accident that tropical rain forests are bursting with life, while dry deserts appear almost lifeless except when water becomes temporarily plentiful, such as after a rainstorm.
Water’s structure facilitates hydrogen bonding Water has a simple molecular structure, consisting of an oxygen atom bound to two hydrogen atoms by two single covalent bonds (figure 2.11). The resulting molecule is stable: It satisfies the octet rule, has no unpaired electrons, and carries no net electrical charge.
Bohr Model
Ball-and-Stick Model
d; ;
d;
d:
104.5
8p 8n ;
d; d:
d: d:
d;
a.
b.
Figure 2.11 Water has a simple molecular structure.
Space-Filling Model
a. Each water molecule is d; composed of one oxygen atom d: and two hydrogen atoms. The ; d oxygen atom shares one electron with each hydrogen atom. c. b. The greater electronegativity of the oxygen atom makes the water molecule polar: Water carries two partial negative charges (δ –) near the oxygen atom and two partial positive charges (δ+), one on each hydrogen atom. c. Space-filling model shows what the molecule would look like if it were visible. 26
part
The single most outstanding chemical property of water is its ability to form weak chemical associations, called hydrogen bonds. These bonds form between the partially negative O atoms and the partially positive H atoms of two water molecules. Although these bonds have only 5–10% of the strength of covalent bonds, they are important to DNA and protein structure, and thus responsible for much of the chemical organization of living systems. The electronegativity of O is much greater than that of H (see table 2.2), and so the bonds between these atoms are highly polar. The polarity of water underlies water’s chemistry and the chemistry of life. If we consider the shape of a water molecule, we see that its two covalent bonds have a partial charge at each end: δ– at the oxygen end and δ+ at the hydrogen end. The most stable arrangement of these charges is a tetrahedron (a pyramid with a triangle as its base), in which the two negative and two positive charges are approximately equidistant from one another. The oxygen atom lies at the center of the tetrahedron, the hydrogen atoms occupy two of the apexes (corners), and the partial negative charges occupy the other two apexes (figure 2.11b). The bond angle between the two covalent oxygen–hydrogen bonds is 104.5°. This value is slightly less than the bond angle of a regular tetrahedron, which would be 109.5°. In water, the partial negative charges occupy more space than the partial positive regions, so the oxygen–hydrogen bond angle is slightly compressed.
Water molecules are cohesive The polarity of water allows water molecules to be attracted to one another: that is, water is cohesive. The oxygen end of each water molecule, which is δ–, is attracted to the hydrogen end, which is δ+, of other molecules. The attraction produces hydrogen bonds among water molecules (figure 2.12). Each hydrogen bond is individually very weak and transient, lasting on average only a hundred-billionth (10–11) of a second. The cumulative effects of large numbers of these bonds, however, can be enormous. Water forms an abundance of hydrogen bonds, which are responsible for many of its important physical properties (table 2.3). Water’s cohesion is responsible for its being a liquid, not a gas, at moderate temperatures. The cohesion of liquid water is also responsible for its surface tension. Small insects can walk on water (figure 2.13) because at the air–water interface, all the surface water molecules are hydrogen-bonded to molecules below them.
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 26
11/5/09 4:07:31 PM
Hydrogen atom Water molecule
d:;
Hydrogen bond
δ-
Oxygen atom
a.
Hydrogen atom Hydrogen bond
δ; δAn organic molecule
b.
Oxygen atom
Figure 2.12 Structure of a hydrogen bond. a. Hydrogen bond between two water molecules. b. Hydrogen bond between an organic molecule (n-butanol) and water. H in n-butanol forms a hydrogen bond with oxygen in water. This kind of hydrogen bond is possible any time H is bound to a more electronegative atom (see table 2.2).
Figure 2.13 Cohesion. Some insects, such as this water strider, literally walk on water. Because the surface tension of the water is greater than the force of one foot, the strider glides atop the surface of the water rather than sinking. The high surface tension of water is due to hydrogen bonding between water molecules.
because the adhesion of water to the glass surface, drawing it upward, is stronger than the force of gravity, pulling it downward. The narrower the tube, the greater the electrostatic forces between the water and the glass, and the higher the water rises (figure 2.14).
Water molecules are adhesive The polarity of water causes it to be attracted to other polar molecules as well. This attraction for other polar substances is called adhesion. Water adheres to any substance with which it can form hydrogen bonds. This property explains why substances containing polar molecules get “wet” when they are immersed in water, but those that are composed of nonpolar molecules (such as oils) do not. The attraction of water to substances that have electrical charges on their surface is responsible for capillary action. If a glass tube with a narrow diameter is lowered into a beaker of water, the water will rise in the tube above the level of the water in the beaker,
TA B L E 2 . 3 Property
Figure 2.14 Adhesion. Capillary action causes the water within a narrow tube to rise above the surrounding water level; the adhesion of the water to the glass surface, which draws water upward, is stronger than the force of gravity, which tends to pull it down. The narrower the tube, the greater the surface area available for adhesion for a given volume of water, and the higher the water rises in the tube.
The Properties of Water Explanation
Example of Benefit to Life
Cohesion
Hydrogen bonds hold water molecules together.
Leaves pull water upward from the roots; seeds swell and germinate.
High specific heat
Hydrogen bonds absorb heat when they break and release heat when they form, minimizing temperature changes.
Water stabilizes the temperature of organisms and the environment.
High heat of vaporization
Many hydrogen bonds must be broken for water to evaporate.
Evaporation of water cools body surfaces.
Lower density of ice
Water molecules in an ice crystal are spaced relatively far apart because of hydrogen bonding.
Because ice is less dense than water, lakes do not freeze solid, allowing fish and other life in lakes to survive the winter.
Solubility
Polar water molecules are attracted to ions and polar compounds, making these compounds soluble.
Many kinds of molecules can move freely in cells, permitting a diverse array of chemical reactions.
www.ravenbiology.com
rav32223_ch02_017-032.indd 27
chapter
2 The Nature of Molecules and the Properties of Water
27
11/5/09 4:07:32 PM
Learning Outcomes Review 2.4 Because of its polar covalent bonds, water can form hydrogen bonds with itself and with other polar molecules. Hydrogen bonding is responsible for water’s cohesion, the force that holds water molecules together, and its adhesion, which is its ability to “stick” to other polar molecules. Capillary action results from both of these properties. ■
If water were made of C and H instead of H and O, would it still be cohesive and adhesive?
2.5
Properties of Water
Learning Outcomes 1. 2. 3.
Describe how hydrogen bonding determines many properties of water. Explain the relevance of water’s unusual properties for living systems. Understand the dissociation products of water.
Water moderates temperature through two properties: its high specific heat and its high heat of vaporization. Water also has the unusual property of being less dense in its solid form, ice, than as a liquid. Water acts as a solvent for polar molecules and exerts an organizing effect on nonpolar molecules. All these properties result from its polar nature.
Water’s high specific heat helps maintain temperature The temperature of any substance is a measure of how rapidly its individual molecules are moving. In the case of water, a large input of thermal energy is required to break the many hydrogen bonds that keep individual water molecules from moving about. Therefore, water is said to have a high specific heat, which is defined as the amount of heat 1 g of a substance must absorb or lose to change its temperature by 1 degree Celsius (°C). Specific heat measures the extent to which a substance resists changing its temperature when it absorbs or loses heat. Because polar substances tend to form hydrogen bonds, the more polar it is, the higher is its specific heat. The specific heat of water (1 calorie/ g/°C) is twice that of most carbon compounds and nine times that of iron. Only ammonia, which is more polar than water and forms very strong hydrogen bonds, has a higher specific heat than water (1.23 cal/g/°C). Still, only 20% of the hydrogen bonds are broken as water heats from 0° to 100°C. Because of its high specific heat, water heats up more slowly than almost any other compound and holds its temperature longer. Because organisms have a high water content, water’s high specific heat allows them to maintain a relatively constant internal temperature. The heat generated by the chemical reactions inside cells would destroy the cells if not for the absorption of this heat by the water within them. 28
part
Water’s high heat of vaporization facilitates cooling The heat of vaporization is defined as the amount of energy required to change 1 g of a substance from a liquid to a gas. A considerable amount of heat energy (586 cal) is required to accomplish this change in water. As water changes from a liquid to a gas it requires energy (in the form of heat) to break its many hydrogen bonds. The evaporation of water from a surface cools that surface. Many organisms dispose of excess body heat by evaporative cooling, for example, through sweating in humans and many other vertebrates.
Solid water is less dense than liquid water At low temperatures, water molecules are locked into a crystal-like lattice of hydrogen bonds, forming solid ice (see figure 2.10a). Interestingly, ice is less dense than liquid water because the hydrogen bonds in ice space the water molecules relatively far apart. This unusual feature enables icebergs to float. If water did not have this property, nearly all bodies of water would be ice, with only the shallow surface melting every year. The buoyancy of ice is important ecologically because it means bodies of water freeze from the top down and not the bottom up. Because ice floats on the surface of lakes in the winter and the water beneath the ice remains liquid, fish and other animals keep from freezing.
The solvent properties of water help move ions and polar molecules Water molecules gather closely around any substance that bears an electrical charge, whether that substance carries a full charge (ion) or a charge separation (polar molecule). For example, sucrose (table sugar) is composed of molecules that contain polar hydroxyl (OH) groups. A sugar crystal dissolves rapidly in water because water molecules can form hydrogen bonds with individual hydroxyl groups of the sucrose molecules. Therefore, sucrose is said to be soluble in water. Water is termed the solvent, and sugar is called the solute. Every time a sucrose molecule dissociates, or breaks away, from a solid sugar crystal, water molecules surround it in a cloud, forming a hydration shell that prevents it from associating with other sucrose molecules. Hydration shells also form around ions such as Na+ and Cl– (figure 2.15).
Water organizes nonpolar molecules Water molecules always tend to form the maximum possible number of hydrogen bonds. When nonpolar molecules such as oils, which do not form hydrogen bonds, are placed in water, the water molecules act to exclude them. The nonpolar molecules aggregate, or clump together, thus minimizing their disruption of the hydrogen bonding of water. In effect, they shrink from contact with water, and for this reason they are referred to as hydrophobic (Greek hydros, “water,” and phobos, “fearing”). In contrast, polar molecules, which readily form hydrogen bonds with water, are said to be hydrophilic (“water-loving”). The tendency of nonpolar molecules to aggregate in water is known as hydrophobic exclusion. By forcing the hydrophobic portions of molecules together, water causes these molecules to
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 28
11/5/09 4:07:33 PM
Learning Outcomes Review 2.5 d:
d: Water molecules
d:
Na+ d: d: Hydration shells
Water has a high specific heat so it does not change temperature rapidly, which helps living systems maintain a near-constant temperature. Water’s high heat of vaporization allows cooling by evaporation. Solid water is less dense than liquid water because the hydrogen bonds space the molecules farther apart. Polar molecules are soluble in a water solution, but water tends to exclude nonpolar molecules. Water dissociates to form H+ and OH–. ■
Na+
How does the fact that ice floats affect life in a lake?
Cld; d;
Cl-
d;
d;
2.6
Acids and Bases
d;
Learning Outcomes Salt crystal
1.
Figure 2.15 Why salt dissolves in water. When a crystal Na+
Cl–
of table salt dissolves in water, individual and ions break away from the salt lattice and become surrounded by water molecules. Water molecules orient around Na+ so that their partial negative poles face toward the positive Na+; water molecules surrounding Cl– orient in the opposite way, with their partial positive poles facing the negative Cl–. Surrounded by hydration shells, Na+ and Cl– never reenter the salt lattice.
assume particular shapes. This property can also affect the structure of proteins, DNA, and biological membranes. In fact, the interaction of nonpolar molecules and water is critical to living systems.
Water can form ions The covalent bonds of a water molecule sometimes break spontaneously. In pure water at 25°C, only 1 out of every 550 million water molecules undergoes this process. When it happens, a proton (hydrogen atom nucleus) dissociates from the molecule. Because the dissociated proton lacks the negatively charged electron it was sharing, its positive charge is no longer counterbalanced, and it becomes a hydrogen ion, H+. The rest of the dissociated water molecule, which has retained the shared electron from the covalent bond, is negatively charged and forms a hydroxide ion, OH–. This process of spontaneous ion formation is called ionization: H2O → water
OH– hydroxide ion
+
H+ hydrogen ion (proton)
At 25°C, 1 liter (L) of water contains one ten-millionth (or 10–7) mole of H+ ions. A mole (mol) is defined as the weight of a substance in grams that corresponds to the atomic masses of all of the atoms in a molecule of that substance. In the case of H+, the atomic mass is 1, and a mole of H+ ions would weigh 1 g. One mole of any substance always contains 6.02 × 1023 molecules of the substance. Therefore, the molar concentration of hydrogen ions in pure water, represented as [H+], is 10–7 mol/L. (In reality, the H+ usually associates with another water molecule to form a hydronium ion, H3O+.) www.ravenbiology.com
rav32223_ch02_017-032.indd 29
2.
Explain the nature of acids and bases, and their relationship to the pH scale. Relate changes in pH to changes in [H+].
The concentration of hydrogen ions, and concurrently of hydroxide ions, in a solution is described by the terms acidity and basicity, respectively. Pure water, having an [H+] of 10–7 mol/L, is considered to be neutral, that is, neither acidic nor basic. Recall that for every H+ ion formed when water dissociates, an OH– ion is also formed, meaning that the dissociation of water produces H+ and OH– in equal amounts.
The pH scale measures hydrogen ion concentration The pH scale (figure 2.16) is a more convenient way to express the hydrogen ion concentration of a solution. This scale defines pH, which stands for “partial hydrogen,” as the negative logarithm of the hydrogen ion concentration in the solution: pH = –log [H+] Because the logarithm of the hydrogen ion concentration is simply the exponent of the molar concentration of H+, the pH equals the exponent times –1. For water, therefore, an [H+] of 10–7 mol/L corresponds to a pH value of 7. This is the neutral point—a balance between H+ and OH–—on the pH scale. This balance occurs because the dissociation of water produces equal amounts of H+ and OH–. Note that, because the pH scale is logarithmic, a difference of 1 on the scale represents a 10-fold change in [H+]. A solution with a pH of 4 therefore has 10 times the [H+] of a solution with a pH of 5 and 100 times the [H+] of a solution with a pH of 6.
Acids Any substance that dissociates in water to increase the [H+] (and lower the pH) is called an acid. The stronger an acid is, the more hydrogen ions it produces and the lower its pH. For example, hydrochloric acid (HCl), which is abundant in your stomach, ionizes completely in water. A dilution of 10–1 mol/L of HCl dissociates to form 10–1 mol/L of H+, giving the solution chapter
2 The Nature of Molecules and the Properties of Water
29
11/5/09 4:07:34 PM
pH Value
100 10 :1
0 1
Hydrochloric acid
10 :2 10 :3
2 3
Stomach acid, lemon juice Vinegar, cola, beer
10 :4 10 :5
4
Tomatoes
5
Black coffee
10 :6
6
Urine
:7
10 10 :8
7
Pure water
8
Seawater
10 :9
9
Baking soda
10 :10
10
Great Salt Lake
10 :11
11
Household ammonia
10 :12
12
10 :13
13
10 :14
14
Acidic
Household bleach Basic
indicates its concentration of hydrogen ions. Solutions with a pH less than 7 are acidic, whereas those with a pH greater than 7 are basic. The scale is logarithmic, which means that a pH change of 1 represents a 10-fold change in the concentration of hydrogen ions. Thus, lemon juice is 100 times more acidic than tomato juice, and seawater is 10 times more basic than pure water, which has a pH of 7.
a pH of 1. The pH of champagne, which bubbles because of the carbonic acid dissolved in it, is about 2.
Bases A substance that combines with H+ when dissolved in water, and thus lowers the [H+], is called a base. Therefore, basic (or alkaline) solutions have pH values above 7. Very strong bases, such as sodium hydroxide (NaOH), have pH values of 12 or more. Many common cleaning substances, such as ammonia and bleach, accomplish their action because of their high pH.
Buffers help stabilize pH The pH inside almost all living cells, and in the fluid surrounding cells in multicellular organisms, is fairly close to neutral, 7. Most of the enzymes in living systems are extremely sensitive to pH. Often even a small change in pH will alter their shape, thereby disrupting their activities. For this reason, it is important that a cell maintain a constant pH level. But the chemical reactions of life constantly produce acids and bases within cells. Furthermore, many animals eat substances that are acidic or basic. Cola drinks, for example, are moderately strong (although dilute) acidic solutions. Despite such variations in the concentrations of H+ and OH–, the pH of an organism is kept at a relatively constant level by buffers (figure 2.17). A buffer is a substance that resists changes in pH. Buffers act by releasing hydrogen ions when a base is added and absorbing hydrogen ions when acid is added, with the overall effect of keeping [H+] relatively constant. Within organisms, most buffers consist of pairs of substances, one an acid and the other a base. The key buffer in human blood is an acid–base pair consisting of carbonic acid part
Buffering range
0
1X
2X 3X 4X Amount of base added
5X
Figure 2.17 Buffers minimize changes in pH. Adding a base to a solution neutralizes some of the acid present, and so raises the pH. Thus, as the curve moves to the right, reflecting more and more base, it also rises to higher pH values. A buffer makes the curve rise or fall very slowly over a portion of the pH scale, called the “buffering range” of that buffer.
Sodium hydroxide
Figure 2.16 The pH scale. The pH value of a solution
30
9 8 7 6 5 4 3 2 1 0
Examples of Solutions
pH
Hydrogen Ion Concentration [H+]
?
Inquiry question For this buffer, adding base raises pH more rapidly below pH 4 than above it. What might account for this behavior?
(acid) and bicarbonate (base). These two substances interact in a pair of reversible reactions. First, carbon dioxide (CO2) and H2O join to form carbonic acid (H2CO3), which in a second reaction dissociates to yield bicarbonate ion (HCO3–) and H+. If some acid or other substance adds H+ to the blood, the HCO3– acts as a base and removes the excess H+ by forming H2CO3. Similarly, if a basic substance removes H+ from the blood, H2CO3 dissociates, releasing more H+ into the blood. The forward and reverse reactions that interconvert H2CO3 and HCO3– thus stabilize the blood’s pH. -
+
Carbon Water (H2O) + dioxide (CO2)
+
Carbonic acid (H2CO3)
+
Bicarbonate Hydrogen + ion ion (HCO3:) (H;)
The reaction of carbon dioxide and water to form carbonic acid is a crucial one because it permits carbon, essential to life, to enter water from the air. The Earth’s oceans are rich in carbon because of the reaction of carbon dioxide with water. In a condition called blood acidosis, human blood, which normally has a pH of about 7.4, drops to a pH of about 7.1. This condition is fatal if not treated immediately. The reverse condition, blood alkalosis, involves an increase in blood pH of a similar magnitude and is just as serious.
Learning Outcomes Review 2.6 Acid solutions have a high [H+] , and basic solutions have a low [H+] (and therefore a high [OH–]). The pH of a solution is the negative logarithm of its [H+]. Low pH values indicate acids, and high pH values indicate bases. Even small changes in pH can be harmful to life. Buffer systems in organisms help to maintain pH within a narrow range. ■
A change of 2 pH units indicates what change in [H +]?
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 30
11/5/09 4:07:35 PM
Chapter Review 2.1 The Nature of Atoms
2.4 Water: A Vital Compound
All matter is composed of atoms (see figure 2.3).
Water’s structure facilitates hydrogen bonding. Hydrogen bonds are weak interactions between a partially positive H in one molecule and a partially negative O in another molecule (see figure 2.11).
Atomic structure includes a central nucleus and orbiting electrons. Electrically neutral atoms have the same number of protons as electrons. Atoms that gain or lose electrons are called ions. Each element is defined by its atomic number, the number of protons in the nucleus. Atomic mass is the sum of the mass of protons and neutrons in an atom. Isotopes are forms of a single element with different numbers of neutrons, and thus different atomic mass. Radioactive isotopes are unstable. Electrons determine the chemical behavior of atoms. The potential energy of electrons increases as distance from the nucleus increases. Electron orbitals are probability distributions. S-orbitals are spherical; other orbitals have different shapes, such as the dumbbell-shaped p-orbitals. Atoms contain discrete energy levels. Energy levels correspond to quanta (sing. quantum) of energy, a “ladder” of energy levels that an electron may have. The loss of electrons from an atom is called oxidation. The gain of electrons is called reduction. Electrons can be transferred from one atom to another in coupled redox reactions.
2.2 Elements Found in Living Systems The periodic table displays elements according to atomic number and properties. Atoms tend to establish completely full outer energy levels (the octet rule). Elements with filled outermost orbitals are inert. Ninety elements occur naturally in the Earth’s crust. Twelve of these elements are found in living organisms in greater than trace amounts: C, H, O, N, P, S, Na, K, Ca, Mg, Fe, and Cl. Compounds of carbon are called organic compounds. The majority of molecules in living systems are composed of C bound to H, O, and N.
Water molecules are cohesive. Cohesion is the tendency of water molecules to adhere to one another due to hydrogen bonding. The cohesion of water is responsible for its surface tension. Water molecules are adhesive. Adhesion occurs when water molecules adhere to other polar molecules. Capillary action results from water’s adhesion to the sides of narrow tubes, combined with its cohesion.
2.5 Properties of Water Water’s high specific heat helps maintain temperature. The specific heat of water is high because it takes a considerable amount of energy to disrupt hydrogen bonds. Water’s high heat of vaporization facilitates cooling. Breaking hydrogen bonds to turn liquid water into vapor takes a lot of energy. Many organisms lose excess heat through evaporative cooling, such as sweating. Solid water is less dense than liquid water. Hydrogen bonds are spaced farther apart in the solid phase of water than in the liquid phase. As a result, ice floats. The solvent properties of water help move ions and polar molecules. Water’s polarity makes it a good solvent for polar substances and ions. Polar molecules or portions of molecules are attracted to water (hydrophilic). Molecules that are nonpolar are repelled by water (hydrophobic). Water makes nonpolar molecules clump together.
Molecules contain two or more atoms joined by chemical bonds. Compounds contain two or more different elements.
Water organizes nonpolar molecules. Nonpolar molecules will aggregate to avoid water. This maximizes the hydrogen bonds that water can make. This hydrophobic exclusion can affect the structure of DNA, proteins and biological membranes.
Ionic bonds form crystals. Ions with opposite electrical charges form ionic bonds, such as NaCl (see figure 2.9b).
Water can form ions. Water dissociates into H+ and OH–. The concentration of H+, shown as [H+], in pure water is 10–7 mol/L.
Covalent bonds build stable molecules. A molecule formed by a covalent bond is stable because it has no net charge, the octet rule is satisfied, and it has no unpaired electrons. Covalent bonds may be single, double, or triple, depending on the number of pairs of electrons shared. Nonpolar covalent bonds involve equal sharing of electrons between atoms. Polar covalent bonds involve unequal sharing of electrons.
2.6 Acids and Bases (see figure 2.16)
2.3 The Nature of Chemical Bonds
Chemical reactions alter bonds. Temperature, reactant concentration, and the presence of catalysts affect reaction rates. Most biological reactions are reversible, such as the conversion of carbon dioxide and water into carbohydrates.
www.ravenbiology.com
rav32223_ch02_017-032.indd 31
The pH scale measures hydrogen ion concentration. pH is defined as the negative logarithm of [H+]. Pure water has a pH of 7. A difference of 1 pH unit means a 10-fold change in [H+]. Acids have a greater [H+] and therefore a lower pH; bases have a lower [H+] and therefore a higher pH. Buffers help stabilize pH. Carbon dioxide and water react reversibly to form carbonic acid. A buffer resists changes in pH by absorbing or releasing H+. The key buffer in the human blood is the carbonic acid/bicarbonate pair.
chapter
2 The Nature of Molecules and the Properties of Water
31
11/9/09 12:02:40 PM
Review Questions 3. A molecule with polar covalent bonds would
U N D E R S TA N D 1. The property that distinguishes an atom of one element (carbon, for example) from an atom of another element (oxygen, for example) is a. b. c. d.
the number of electrons. the number of protons. the number of neutrons. the combined number of protons and neutrons.
2. If an atom has one valence electron, that is, a single electron in its outer energy level, it will most likely form a. b. c. d.
one polar, covalent bond. two nonpolar, covalent bonds. two covalent bonds. an ionic bond.
3. An atom with a net positive charge must have more a. b. c. d.
protons than neutrons. protons than electrons. electrons than neutrons. electrons than protons.
a. b. c. d.
be soluble in water. not be soluble in water. contain atoms with very similar electronegativity. contain atoms that have gained or lost electrons.
4. Hydrogen bonds are formed a. b. c. d.
between any molecules that contain hydrogen. only between water molecules. when hydrogen is part of a polar bond. when two atoms of hydrogen share an electron.
5. Which of the following properties of water is NOT a consequence of its ability to form hydrogen bonds? a. b. c. d.
Cohesiveness High specific heat Ability to function as a solvent Neutral pH
6. The decay of radioactive isotopes involves changes to the nucleus of atoms. Explain how this differs from the changes in atoms that occur during chemical reactions.
4. The isotopes carbon-12 and carbon-14 differ in a. b. c. d.
SYNTHESIZE
the number of neutrons. the number of protons. the number of electrons. both b and c.
5. Which of the following is NOT a property of the elements most commonly found in living organisms? a. b. c. d.
The elements have a low atomic mass. The elements have an atomic number less than 21. The elements possess eight electrons in their outer energy level. The elements are lacking one or more electrons from their outer energy level.
6. Ionic bonds arise from a. b. c. d.
shared valence electrons. attractions between valence electrons. charge attractions between valence electrons. attractions between ions of opposite charge.
1. Elements that form ions are important for a range of biological processes. You have learned something about the cations sodium (Na+), calcium (Ca2+) and potassium (K+) in this chapter. Use your knowledge of the definition of a cation to identify other examples from the periodic table. 2. A popular theme in science fiction literature has been the idea of silicon-based life-forms in contrast to our carbon-based life. Evaluate the possibility of silicon-based life based on the chemical structure and potential for chemical bonding of a silicon atom. 3. Recent efforts by NASA to search for signs of life on Mars have focused on the search for evidence of liquid water rather than looking directly for biological organisms (living or fossilized). Use your knowledge of the influence of water on life on Earth to construct an argument justifying this approach.
7. A substance with a high concentration of hydrogen ions a. b.
is called a base. is called an acid.
c. d.
has a high pH. both b and c.
A P P LY 1. Using the periodic table on page 22, which of the following atoms would you predict could form a positively charged ion (cation)? a. b.
Fluorine (F) Neon (Ne)
c. d.
Potassium (K) Sulfur (S)
2. Refer to the element pictured. How many covalent bonds could this atom form? a. b. c. d.
32
part
Two Three Four None
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
I The Molecular Basis of Life
rav32223_ch02_017-032.indd 32
11/9/09 12:02:41 PM
CHAPTER
Chapter
3
The Chemical Building Blocks of Life
Chapter Outline 3.1
Carbon: The Framework of Biological Molecules
3.2
Carbohydrates: Energy Storage and Structural Molecules
3.3
Nucleic Acids: Information Molecules
3.4
Proteins: Molecules with Diverse Structures and Functions
3.5
Lipids: Hydrophobic Molecules
A
Introduction A cup of water contains more molecules than there are stars in the sky. But many molecules are much larger than water molecules. Many thousands of distinct biological molecules are long chains made of thousands or even billions of atoms. These enormous assemblages, which are almost always synthesized by living things, are macromolecules . As you may know, biological macromolecules can be divided into four categories: carbohydrates, nucleic acids, proteins, and lipids, and they are the basic chemical building blocks from which all organisms are composed. We take the existence of these classes of macromolecules for granted now, but as late as the 19th century many theories of “vital forces” were associated with living systems. One such theory held that cells contained a substance, protoplasm, that was responsible for the chemical reactions in living systems. Any disruption of cells was thought to disturb the protoplasm. Such a view makes studying the chemical reactions of cells in the lab (in vitro) impossible. The demonstration of fermentation in a cell-free system marked the beginning of modern biochemistry (figure 3.1). This approach involves studying biological molecules outside of cells to infer their role inside cells. Because these biological macromolecules all involve carbon-containing compounds, we begin with a brief summary of carbon and its chemistry.
rav32223_ch03_033-058.indd 33
11/6/09 12:43:19 PM
SCIENTIFIC THINKING Hypothesis: Chemical reactions, such as the fermentation reaction in yeast, are controlled by enzymes and do not require living cells. Prediction: If yeast cells are broken open, these enzymes should function outside of the cell. Test: Yeast is mixed with quartz sand and diatomaceous earth and then ground in a mortar and pestle. The resulting paste is wrapped in canvas and subjected to 400–500 atm pressure in a press. Fermentable and nonfermentable substrates are added to the resulting fluid, with fermentation being measured by the production of CO2. Yeast
Quartz sand
Diatomaceous earth
Grind in mortar/pestle.
Cane sugar
400–500 atm pressure
Glucose
Lactose, mannose
Wrap in canvas and apply pressure in a press.
Result: When a fermentable substrate (cane sugar, glucose) is used, CO2 is produced, when a nonfermentable substrate (lactose, mannose) is used, no CO2 is produced. In addition, visual inspection of the fluid shows no visible yeast cells. Conclusion: The hypothesis is supported. The fermentation reaction can occur in the absence of live yeast. Historical Significance: Although this is not precisely the intent of the original experiment, it represents the first use of a cell-free system. Such systems allow for the study of biochemical reactions in vitro and the purification of proteins involved. We now know that the “fermentation reaction” is actually a complex series of reactions. Would such a series of reactions be your first choice for this kind of demonstration?
Figure 3.1 The demonstration of cell-free fermentation. Eduard Buchner’s (1860–1917) demonstration of fermentation by fluid produced from yeast, but not containing any live cells both argued against the protoplasm theory and provided a method for future biochemists to examine the chemistry of life outside of cells.
Carbon: The Framework of Biological Molecules
3.1
Learning Outcomes 1. 2. 3.
Describe the relationship between functional groups and macromolecules. Recognize the different kinds of isomers. List the different kinds of biological macromolecules.
In chapter 2, we reviewed the basics of chemistry. Biological systems obey all the laws of chemistry. Thus, chemistry forms the basis of living systems. The framework of biological molecules consists predominantly of carbon atoms bonded to other carbon atoms or to atoms of oxygen, nitrogen, sulfur, phosphorus, or hydrogen. Because carbon atoms can form up to four covalent bonds, molecules containing carbon can form straight chains, branches, or even rings, balls, tubes, and coils. Molecules consisting only of carbon and hydrogen are called hydrocarbons. Because carbon–hydrogen covalent bonds store considerable energy, hydrocarbons make good fuels. Gasoline, for example, is rich in hydrocarbons, and propane gas, an34
part
other hydrocarbon, consists of a chain of three carbon atoms, with eight hydrogen atoms bound to it. The chemical formula for propane is C3H8. Its structural formula is H H H ⎪ ⎪ ⎪ H—C—C—C—H ⎪ ⎪ ⎪ H H H
Propane structural formula
Theoretically speaking, the length of a chain of carbon atoms is unlimited. As described in the rest of this chapter, the four main types of biological molecules often consist of huge chains of carbon-containing compounds.
Functional groups account for differences in molecular properties Carbon and hydrogen atoms both have very similar electronegativities. Electrons in C—C and C—H bonds are therefore evenly distributed, with no significant differences in charge over the molecular surface. For this reason, hydrocarbons are nonpolar. Most biological molecules produced by cells, however, also contain other atoms. Because these other atoms frequently have different electronegativities, molecules containing them exhibit regions of partial positive or negative charge. They are polar. These molecules can be thought of as a C—H
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 34
11/6/09 12:43:25 PM
core to which specific molecular groups, called functional groups, are attached. One such common functional group is —OH, called a hydroxyl group. Functional groups have definite chemical properties that they retain no matter where they occur. Both the hydroxyl and carbonyl (C==O) groups, for example, are polar because of the Functional Group
Structural Formula
OH
Hydroxyl
Found In
Example
H
H
H
C
C
OH
carbohydrates, proteins, nucleic acids, lipids
H
carbohydrates, nucleic acids
H H Ethanol
O
Carbonyl
H
C
C
C
H
C
H
O proteins, lipids
C
C
OH
OH H Acetic acid
H N
Amino
O
H Acetaldehyde O
Carboxyl
H
HO
O
H
C
C
H
H
proteins, nucleic acids
N H
CH3 Alanine COOH
S
Sulfhydryl
H
H
S
CH2
C
electronegativity of the oxygen atoms (see chapter 2). Other common functional groups are the acidic carboxyl (COOH), phosphate (PO4), and the basic amino (NH2) group. Many of these functional groups can also participate in hydrogen bonding. Hydrogen bond donors and acceptors can be predicted based on their electronegativities shown in table 2.2. Figure 3.2 illustrates these biologically important functional groups and lists the macromolecules in which they are found.
H
Isomers have the same molecular formulas but different structures Organic molecules having the same molecular or empirical formula can exist in different forms called isomers. If there are differences in the actual structure of their carbon skeleton, we call them structural isomers. Later you will see that glucose and fructose are structural isomers of C6H12O6. Another form of isomers, called stereoisomers, have the same carbon skeleton but differ in how the groups attached to this skeleton are arranged in space. Enzymes in biological systems usually recognize only a single, specific stereoisomer. A subcategory of stereoisomers, called enantiomers, are actually mirror images of each other. A molecule that has mirror-image versions is called a chiral molecule. When carbon is bound to four different molecules, this inherent asymmetry exists (figure 3.3). Chiral compounds are characterized by their effect on polarized light. Polarized light has a single plane, and chiral molecules rotate this plane either to the right (Latin, dextro) or left (Latin, levo). We therefore call the two chiral forms D for dextrorotatory and L for levorotatory. Living systems tend to produce only a single enantiomer of the two possible forms; for example, in most organisms we find primarily d-sugars and l-amino acids.
proteins
NH2
X
W
Cysteine
X
C O– Phosphate
O–
O
H
C
C
C
H
H
H
C
O
OH OH H
P
O
W
O
P
O–
nucleic acids
Z
Y
Y
Z
O–
Glycerol phosphate H Methyl
C H
H
HO
O
H
C
C
NH2
H
C
H
proteins
H Alanine
Figure 3.2 The primary functional chemical groups. These groups tend to act as units during chemical reactions and give specific chemical properties to the molecules that possess them. Amino groups, for example, make a molecule more basic, and carboxyl groups make a molecule more acidic. These functional groups are also not limited to the examples in the “Found In” column but are widely distributed in biological molecules. www.ravenbiology.com
rav32223_ch03_033-058.indd 35
Mirror
Figure 3.3 Chiral molecules. When carbon is bound to four different groups, the resulting molecule is said to be chiral (from Greek cheir, meaning “hand.”). A chiral molecule will have stereoisomers that are mirror images. The two molecules shown have the same four groups but cannot be superimposed, much like your two hands cannot be superimposed but must be fl ipped to match. These types of stereoisomers are called enantiomers. chapter
3 The Chemical Building Blocks of Life
35
11/9/09 1:00:30 PM
Cellular Structure
Polymer
Monomer
Carbohydrate
CH2OH H HO
Starch grains in a chloroplast
Starch
O
H
H OH
H
H
OH
OH
Monosaccharide
P
P G
P
Nucleic Acid
A
P
T
T
P
Nitrogenous base
G A
C
P
P
P P
P
A
C
P P
A
T
C
P
O
Phosphate group
G
P
Chromosome
OH
P
P
DNA strand
Nucleotide
H Protein
Ala Ala
Val Val
Intermediate filament
Ser
Polypeptide
5-carbon sugar
CH3 N C
H
C
OH
H O
Amino acid
Lipid
O H HHH H H H H HH H HO C C C C C C C C C C C C H H HHH H H H H HH H
Adipose cell with fat droplets
Triglyceride
Fatty acid
Figure 3.4 Polymer macromolecules. The four major biological macromolecules are shown. Carbohydrates, nucleic acids, and proteins all form polymers and are shown with the monomers used to make them. Lipids do not fit this simple monomer–polymer relationship, however, because they are constructed from glycerol and fatty acids. All four types of macromolecules are also shown in their cellular context.
36
part
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 36
11/6/09 12:43:27 PM
TA B L E 3 .1
Macromolecules
Macromolecule
Subunit
Function
Example
C A R B O H Y D R A T E S Starch, glycogen
Glucose
Energy storage
Potatoes
Cellulose
Glucose
Structural support in plant cell walls
Paper; strings of celery
Chitin
Modified glucose
Structural support
Crab shells
N U C L E I C
A C I D S
DNA
Nucleotides
Encodes genes
Chromosomes
RNA
Nucleotides
Needed for gene expression
Messenger RNA
P R O T E I N S Functional
Amino acids
Catalysis; transport
Hemoglobin
Structural
Amino acids
Support
Hair; silk
L I P I D S Fats
Glycerol and three fatty acids
Energy storage
Butter; corn oil; soap
Phospholipids
Glycerol, two fatty acids, phosphate, and polar R groups
Cell membranes
Phosphatidylcholine
Prostaglandins
Five-carbon rings with two nonpolar tails
Chemical messengers
Prostaglandin E (PGE)
Steroids
Four fused carbon rings
Membranes; hormones
Cholesterol; estrogen
Terpenes
Long carbon chains
Pigments; structural support
Carotene; rubber
Biological macromolecules include carbohydrates, nucleic acids, proteins, and lipids Remember that biological macromolecules are traditionally grouped into carbohydrates, nucleic acids, proteins, and lipids (table 3.1). In many cases, these macromolecules are polymers. A polymer is a long molecule built by linking together a large number of small, similar chemical subunits called monomers. They are like railroad cars coupled to form a train. The nature of a polymer is determined by the monomers used to build the polymer. Here are some examples. Complex carbohydrates such as starch are polymers composed of simple ring-shaped sugars. Nucleic acids (DNA and RNA) are polymers of nucleotides (figure 3.4). Proteins are polymers of amino acids, and lipids are polymers of fatty acids (see figure 3.4). These long chains are built via chemical reactions termed dehydration reactions and are broken down by hydrolysis reactions.
of a molecule of water (H2O). For every subunit added to a macromolecule, one water molecule is removed. These and other biochemical reactions require that the reacting substances are held close together and that the correct chemical bonds are stressed and broken. This process of positioning and stressing, termed catalysis, is carried out within cells by enzymes.
The hydrolysis reaction Cells disassemble macromolecules into their constituent subunits through reactions that are the reverse of dehydration—a molecule of water is added instead of removed (figure 3.5b). In this process, called hydrolysis, a hydrogen atom is attached to one subunit and a hydroxyl group to the other, breaking a specific covalent bond in the macromolecule.
H2O HO
H
HO
H
H2 O HO
H
The dehydration reaction Despite the differences between monomers of these major polymers, the basic chemistry of their synthesis is similar: To form a covalent bond between two monomers, an —OH group is removed from one monomer, and a hydrogen atom (H) is removed from the other (figure 3.5a). For example, this simple chemistry is the same for linking amino acids together to make a protein or assembling glucose units together to make starch. This reaction is also used to link fatty acids to glycerol in lipids. This chemical reaction is called condensation, or a dehydration reaction, because the removal of —OH and —H is the same as the removal
www.ravenbiology.com
rav32223_ch03_033-058.indd 37
HO
H
HO
a. Dehydration reaction
H
HO
H
b. Hydrolysis reaction
Figure 3.5 Making and breaking macromolecules. a. Biological macromolecules are polymers formed by linking monomers together through dehydration reactions. This process releases a water molecule for every bond formed. b. Breaking the bond between subunits involves hydrolysis, which reverses the loss of a water molecule by dehydration.
chapter
3 The Chemical Building Blocks of Life
37
11/6/09 12:43:29 PM
Six-carbon sugars can exist in a straight-chain form, but dissolved in water (an aqueous environment) they almost always form rings. The most important of the six-carbon monosaccharides for energy storage is glucose, which you first encountered in the examples of chemical reactions in chapter 2. Glucose has seven energy-storing C—H bonds (figure 3.7). Depending on the orientation of the carbonyl group (C=O) when the ring is closed, glucose can exist in two different forms: alpha (α) or beta (β).
Learning Outcomes Review 3.1 Functional groups account for differences in chemical properties in organic molecules. Isomers are compounds with the same empirical formula but different structures. This difference may affect biological function. Macromolecules are polymers consisting of long chains of similar subunits that are joined by dehydration reactions and are broken down by hydrolysis reactions. ■
What is the relationship between dehydration and hydrolysis?
Sugar isomers have structural differences Glucose is not the only sugar with the formula C6H12O6. Both structural isomers and stereoisomers of this simple six-carbon skeleton exist in nature. Fructose is a structural isomer that differs in the position of the carbonyl carbon (C==O); galactose is a stereoisomer that differs in the position of —OH and —H groups relative to the ring (figure 3.8). These differences often account for substantial functional differences between the isomers. Your taste buds can discern them: Fructose tastes much sweeter than glucose, despite the fact that both sugars have identical chemical composition. Enzymes that act on different sugars can distinguish both the structural and stereoisomers of this basic six-carbon skeleton. The different stereoisomers of glucose are also important in the polymers that can be made using glucose as a monomer, as you will see later in this chapter.
Carbohydrates: Energy Storage and Structural Molecules
3.2
Learning Outcomes 1. 2. 3.
Describe the structure of a sugar. Name the different forms of carbohydrate molecules. Relate the structure of polysaccharides to their functions
Monosaccharides are simple sugars
Disaccharides serve as transport molecules in plants and provide nutrition in animals
Carbohydrates are a loosely defined group of molecules that all contain carbon, hydrogen, and oxygen in the molar ratio 1:2:1. Their empirical formula (which lists the number of atoms in the molecule with subscripts) is (CH2O)n, where n is the number of carbon atoms. Because they contain many carbon– hydrogen (C—H) bonds, which release energy when oxidation occurs, carbohydrates are well suited for energy storage. Sugars are among the most important energy-storage molecules, and they exist in several different forms. The simplest of the carbohydrates are the monosaccharides (Greek mono, “single,” and Latin saccharum, “sugar”). Simple sugars contain as few as three carbon atoms, but those that play the central role in energy storage have six (figure 3.6). The empirical formula of six-carbon sugars is: C6H12O6
or
(CH2O)6
J
J J
3-carbon Sugar H
5-carbon Sugars 5
CH2OH
C
J J J
1
O
HJCJOH 2
HJCJOH 3
H Glyceraldehyde
Most organisms transport sugars within their bodies. In humans, the glucose that circulates in the blood does so as a simple monosaccharide. In plants and many other organisms, however, glucose is converted into a transport form before it is moved from place to place within the organism. In such a form, it is less readily metabolized during transport. Transport forms of sugars are commonly made by linking two monosaccharides together to form a disaccharide (Greek di, “two”). Disaccharides serve as effective reservoirs of glucose because the enzymes that normally use glucose in the organism cannot break the bond linking the two monosaccharide subunits. Enzymes that can do so are typically present only in the tissue that uses glucose.
5
O
1
H
H
H
3
H 2
OH
CH2OH
OH
Ribose
6
O
OH
4
6-carbon Sugars
1
H
H
H
3
H 2
OH
5
OH
4
H
Deoxyribose
CH2OH
H 4
HO
H OH 3
6
O H OH
Glucose
6
O
H
2
H
CH2OH
1
5
OH
HO
H 4
OH
H 2
OH CH OH 2 3
H
Fructose
1
CH2OH 5
OH 4
H
H OH 3
O
OH 1
H
H 2
H
OH
Galactose
Figure 3.6 Monosaccharides. Monosaccharides, or simple sugars, can contain as few as three carbon atoms and are often used as building blocks to form larger molecules. The five-carbon sugars ribose and deoxyribose are components of nucleic acids (see figure 3.15). The carbons are conventionally numbered from the more oxidized end. 38
part
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 38
11/6/09 12:43:29 PM
Transport forms differ depending on which monosaccharides are linked to form the disaccharide. Glucose forms transport disaccharides with itself and with many other monosaccharides, including fructose and galactose. When glucose forms a disaccharide with the structural isomer fructose, the resulting disaccharide is sucrose, or table sugar (figure 3.9a). Sucrose is the form most plants use to transport glucose and is the sugar that most humans and other animals eat. Sugarcane and sugar beets are rich in sucrose. When glucose is linked to the stereoisomer galactose, the resulting disaccharide is lactose, or milk sugar. Many mammals supply energy to their young in the form of lactose. Adults often have greatly reduced levels of lactase, the enzyme required to cleave lactose into its two monosaccharide components, and thus they cannot metabolize lactose efficiently. This can result in lactose intolerance in humans. Most of the energy that is channeled into lactose production is therefore reserved for offspring. For this reason, lactose as an energy source is primarily for offspring in mammals.
J
CH2OH
5
C H OH C
O
OH
4
J
J J
OH
HJCJH
H
HOJCJH
C
3
4
OH
J
3
4
OH
a-glucose or b-glucose
C 1 2
OH
H
CH2OH
OH
5
5
H
HJCJOH 6
C
H
4
H C
OH
C 1 2
J
3
O
J
OH
C H OH C
J
J J
H
H C
H
O
1 2
J
HJCJOH
O
J
HJCJOH
C H OH C
J J
J
5
H
2
J
6
HJCJOH
3
H C
H C
J
CJH
J
1
C
O
J
H
H
H
OH
Figure 3.7 Structure of the glucose molecule. Glucose is a linear, six-carbon molecule that forms a six-membered ring in solution. Ring closure occurs such that two forms can result: α-glucose and β-glucose. These structures differ only in the position of the —OH bound to carbon 1. The structure of the ring can be represented in many ways; shown here are the most common, with the carbons conventionally numbered (in blue) so that the forms can be compared easily. The heavy lines in the ring structures represent portions of the molecule that are projecting out of the page toward you.
HOJCJH
J J J J J J J
J J J J J J J
CJO
CJO
CJ O
HJCJOH Structural isomer
Polysaccharides provide energy storage and structural components
H
H
J J J J J J J
H
HJCJOH HOJCJH
Stereoisomer
HJCJOH HOJCJH HOJCJH
HJCJOH
HJCJOH
HJCJOH
HJCJOH
HJCJOH
HJCJOH
HJCJOH
HJCJOH
H Fructose
Polysaccharides are longer polymers made up of monosaccharides that have been joined through dehydration reactions. Starch, a storage polysaccharide, consists entirely of α-glucose molecules linked in long chains. Cellulose, a structural polysaccharide, also consists of glucose molecules linked in chains, but these molecules are β-glucose. Because starch is built from α-glucose we call the linkages α linkages; cellulose has β linkages.
H Galactose
H Glucose
Starches and Glycogen Organisms store the metabolic energy contained in monosaccharides by converting them into disaccharides, such as maltose (figure 3.9b). These are then linked together into the insoluble polysaccharides called starches. These polysaccharides differ mainly in how the polymers branch. The starch with the simplest structure is amylose. It is composed of many hundreds of α-glucose molecules linked together in long, unbranched chains. Each linkage occurs between the carbon 1
Figure 3.8 Isomers and stereoisomers. Glucose, fructose, and galactose are isomers with the empirical formula C6H12O6. A structural isomer of glucose, such as fructose, has identical chemical groups bonded to different carbon atoms. Notice that this results in a five-membered ring in solution (see figure 3.6). A stereoisomer of glucose, such as galactose, has identical chemical groups bonded to the same carbon atoms but in different orientations (the —OH at carbon 4). CH2OH H HO
O H OH
H
CH2OH H
+
OH HO
OH H a-glucose
a.
CH2OH
O H
H OH
OH H Fructose
H
CH2OH
HO H2O
O H OH
H
H
OH
CH2OH
CH2OH O
H O
H OH
H OH CH OH 2
H HO
O H OH H
H
Sucrose
H
CH2OH H
H O
OH
O H OH
H
H
OH
H OH
Maltose
b.
Figure 3.9 How disaccharides form. Some disaccharides are used to transport glucose from one part of an organism’s body to another; one example is sucrose (a), which is found in sugarcane. Other disaccharides, such as maltose (b), are used in grain for storage. www.ravenbiology.com
rav32223_ch03_033-058.indd 39
chapter
3 The Chemical Building Blocks of Life
39
11/6/09 12:43:30 PM
CH2OH H 4
HO
O H OH
H
H
H
1
OH
H OH a-glucose
CH2OH O
H
CH2OH O OH
H
OH
H
O
H
OH
H OH a-1→4 linkages
CH2OH O H H H OH H O H
O
OH
H
H
OH
H
Amylose
+
Amylopectin
7.5 μm
b. a-1→6 linkage
OH
CH2OH CH2 O H H H H H OH OH H O H
H
CH2OH O
H
OH
O H H OH
a-1→4 linkage
Glycogen
a.
3.3 μm
c.
Figure 3.10 Polymers of glucose: Starch and glycogen. a. Starch chains consist of polymers of α-glucose subunits joined by α-(1→4) glycosidic linkages. These chains can be branched by forming similar α-(1→6) glycosidic bonds. These storage polymers then differ primarily in their degree of branching. b. Starch is found in plants and is composed of amylose and amylopectin, which are unbranched and branched, respectively. The branched form is insoluble and forms starch granules in plant cells. c. Glycogen is found in animal cells and is highly branched and also insoluble, forming glycogen granules. (C-1) of one glucose molecule and the C-4 of another, making them α-(1→4) linkages (figure 3.10a). The long chains of amylose tend to coil up in water, a property that renders amylose insoluble. Potato starch is about 20% amylose (figure 3.10b). Most plant starch, including the remaining 80% of potato starch, is a somewhat more complicated variant of amylose called amylopectin. Pectins are branched polysaccharides with the branches occurring due to bonds between the C-1 of one molecule and the C-6 of another [α-(1→6) linkages]. These short amylose branches consist of 20 to 30 glucose subunits (figure 3.10b).
The comparable molecule to starch in animals is glycogen. Like amylopectin, glycogen is an insoluble polysaccharide containing branched amylose chains. Glycogen has a much longer average chain length and more branches than plant starch (figure 3.10c).
Cellulose Although some chains of sugars store energy, others serve as structural material for cells. For two glucose molecules to link together, the glucose subunits must be of the same form. Cellulose is a polymer of β-glucose (figure 3.11). The bonds between
Figure 3.11 Polymers CH2OH
of glucose: Cellulose. Starch chains consist of α-glucose subunits, and cellulose chains consist of β-glucose subunits. a. Thus the bonds between adjacent glucose molecules in cellulose are β-(1→4) glycosidic linkages. b. Cellulose is unbranched and forms long fibers. Cellulose fibers can be very strong and are quite resistant to metabolic breakdown, which is one reason wood is such a good building material.
H 4
HO
part
H OH H
H OH
CH2OH OH
H
1
H
O
O H OH H
H OH
O H
H
H
OH
OH H
H O
CH2OH H
H O
CH2OH
O H OH
H
H
OH
O H
b-1→4 linkages
b-glucose
a.
b. 40
O
500 μm
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 40
11/6/09 12:43:31 PM
adjacent glucose molecules still exist between the C-1 of the first glucose and the C-4 of the next glucose, but these are β-(1→4) linkages. The properties of a chain of glucose molecules consisting of all β-glucose are very different from those of starch. These long, unbranched β-linked chains make tough fibers. Cellulose is the chief component of plant cell walls (see figure 3.11b). It is chemically similar to amylose, with one important difference: The starch-hydrolyzing enzymes that occur in most organisms cannot break the bond between two β-glucose units because they only recognize α linkages. Because cellulose cannot be broken down readily by most creatures, it works well as a biological structural material. But some animals, such as cows, are able to break down cellulose by means of symbiotic bacteria and protists in their digestive tracts. These organisms provide the necessary enzymes for cleaving the β-(1→4) linkages, thus enabling access to a rich source of energy.
Chitin Chitin, the structural material found in arthropods and many fungi, is a polymer of N-acetylglucosamine, a substituted version of glucose. When cross-linked by proteins, it forms a tough, resistant surface material that serves as the hard exoskeleton of insects and crustaceans (figure 3.12; see chapter 34). Few organisms are able to digest chitin, but most possess a chitinase enzyme, probably to protect against fungi.
Learning Outcomes Review 3.2 Monosaccharides have three to six or more carbon atoms typically arranged in a ring form. Disaccharides consist of two linked monosaccharides; polysaccharides are long chains of monosaccharides. Structural differences between sugar isomers can lead to functional differences. Starches are branched polymers of α-glucose used for energy storage. Cellulose in plants consists of unbranched chains of β-glucose that are not easily digested. ■
3.3
Nucleic Acids: Information Molecules
Learning Outcomes 1. 2. 3. 4.
Describe the structure of nucleotides. Compare and contrast the structures of DNA and RNA. Explain the functions of DNA and RNA. Recognize other nucleotides involved in energy metabolism.
The biochemical activity of a cell depends on production of a large number of proteins, each with a specific sequence. The information necessary to produce the correct proteins is passed through generations of organisms, even though the protein molecules themselves are not. Nucleic acids carry information inside cells, just as disks contain the information in a computer or road maps display information needed by travelers. Two main varieties of nucleic acids are deoxyribonucleic acid (DNA; figure 3.13) and ribonucleic acid (RNA). DNA encodes the genetic information used to assemble proteins (as discussed in detail in chapter 15) similar to the way the letters on this page encode information. Unique among macromolecules, nucleic acids are able to serve as templates to produce precise copies of themselves. This characteristic allows genetic information to be preserved during cell division and
How do the structures of starch, glycogen, and cellulose affect their function?
a.
Figure 3.12 Chitin. Chitin is the principal structural element in the external skeletons of many invertebrates, such as this lobster. www.ravenbiology.com
rav32223_ch03_033-058.indd 41
2 nm
b.
Figure 3.13 Images of DNA. a. A scanning-tunneling micrograph of DNA (false color; 2,000,000×) showing approximately three turns of the DNA double helix. b. A spacefilling model for comparison to the image of actual DNA in (a). chapter
3 The Chemical Building Blocks of Life
41
11/6/09 12:43:32 PM
during the reproduction of organisms. DNA, found primarily in the nuclear region of cells, contains the genetic information necessary to build specific organisms. Cells use a type of RNA called messenger RNA (mRNA) to direct the synthesis of proteins. mRNA consists of transcribed single-stranded copies of portions of the DNA. These transcripts serve as blueprints specifying the amino acid sequences of proteins. This process will be described in detail in chapter 15.
Nitrogenous base NH2 7N
1
2
O
J J J
N
1„
3„
Sugar
5„
1„
4„ 3„
DNA and RNA), thymine (T, in DNA only), and uracil (U, in RNA only).
DNA carries the genetic code Organisms use sequences of nucleotides in DNA to encode the information specifying the amino acid sequences of their proteins. This method of encoding information is very similar to the way in which sequences of letters encode information in a sentence.
Purines
N C
Phosphodiester bonds
4„
1„ 3„
P
2„
C H
N C C N H N C
H
C
H
C
C N
H Guanine O
O
N C
C NH2
N
O
H Cytosine (both DNA and RNA)
H3C
C
H
C
C N
N H
H
C
C
H
C
H Thymine (DNA only)
O
C N
N H C
O
H Uracil (RNA only)
b.
5„
O 1„
4„ 3„
5-carbon sugar
2„
P
5„
O 1„
4„ 3„
OH
a.
N
H C
NH2 Pyrimidines
5„
O
42
O
N C C N
2„
P
H in DNA
subunits of DNA and RNA are made up of three elements: a fivecarbon sugar (ribose or deoxyribose), an organic nitrogenous base (adenine is shown here), and a phosphate group. Notice that all the numbers on the sugar are given as “primes” (1´, 2´, etc.) to distinguish them from the numbering on the rings of the bases.
H Adenine
O
OH in RNA
Figure 3.14 Structure of a nucleotide. The nucleotide
NH2
P
2„
OH
59 H C
3
O 4„
Phosphate group
N
5„
O-
Nucleic acids are long polymers of repeating subunits called nucleotides. Each nucleotide consists of three components: a pentose, or five-carbon sugar (ribose in RNA and deoxyribose in DNA); a phosphate (—PO4) group; and an organic nitrogenous (nitrogen-containing) base (figure 3.14). When a nucleic acid polymer forms, the phosphate group of one nucleotide binds to the hydroxyl group from the pentose sugar of another, releasing water and forming a phosphodiester bond by a dehydration reaction. A nucleic acid, then, is simply a chain of fivecarbon sugars linked together by phosphodiester bonds with a nitrogenous base protruding from each sugar (see figure 3.15a). These chains of nucleotides, polynucleotides, have different ends: a phosphate on one end and an —OH from a sugar on the other end. We conventionally refer to these ends as 5´ (“fiveprime,” —PO4) and 3´ (“three-prime,” —OH) taken from the carbon numbering of the sugar (figure 3.15a). Two types of nitrogenous bases occur in nucleotides (3.15b). The first type, purines, are large, double-ring molecules found in both DNA and RNA; the two types of purines are adenine (A) and guanine (G). The second type, pyrimidines, are smaller, single-ring molecules; they include cytosine (C, in both
4
9
JP JOJCH2
Nucleic acids are nucleotide polymers
N
8
Phosphate group
-O
6 5
2„
Figure 3.15 The structure of a nucleic acid and the organic nitrogenous bases. a. In a nucleic acid, nucleotides are linked to one another via phosphodiester bonds formed between the Nitrogenous base phosphate of one nucleotide and the sugar of the next nucleotide. We call this the sugar-phosphate backbone, and the organic bases protrude from this chain. The backbone also has different ends: a 5´ phosphate end and a 3´ hydroxyl end (the numbers come from the numbers in the sugars). b. The organic nitrogenous bases can be either purines or pyrimidines. The base thymine is found in DNA. The base uracil is found in RNA.
39 part
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 42
11/6/09 12:43:37 PM
group is replaced by a hydrogen atom.) Second, RNA molecules use uracil in place of thymine. Uracil has the same structure as thymine, except that one of its carbons lacks a methyl (—CH3) group. Transcribing the DNA message into a chemically different molecule such as RNA allows the cell to distinguish between the original information-storage molecule and the transcript. DNA molecules are always double-stranded (except for a few single-stranded DNA viruses), whereas the RNA molecules transcribed from DNA are typically single-stranded (figure 3.17). These differences allow DNA to store hereditary information and RNA to use this information to specify the sequence of amino acids in proteins.
Sugar–phosphate “backbone”
P
A P
T G C T
P Phosphodiester bonds
OH 3„ end
A P
Hydrogen bonds between nitrogenous bases
Other nucleotides are vital components of energy reactions In addition to serving as subunits of DNA and RNA, nucleotide bases play other critical roles in the life of a cell. For example, adenine is a key component of the molecule adenosine
P
P
5„ end
Figure 3.16 The structure of DNA. DNA consists of two polynucleotide chains running in opposite directions wrapped about a single helical axis. Hydrogen bond formation (dashed lines) between the nitrogenous bases, called base-pairing, causes the two chains of DNA to bind to each other and form a double helix.
P
P
T
T
G
P
A
G A
C
RNA is a transcript of a DNA strand RNA is similar to DNA, but with two major chemical differences. First, RNA molecules contain ribose sugars, in which the C-2 is bonded to a hydroxyl group. (In DNA, this hydroxyl www.ravenbiology.com
rav32223_ch03_033-058.indd 43
P
P
P P
A sentence written in English consists of a combination of the 26 different letters of the alphabet in a certain order; the code of a DNA molecule consists of different combinations of the four types of nucleotides in specific sequences, such as CGCTTACG. The information encoded in DNA is used in the everyday functioning of the organism and is passed on to the organism’s descendants. DNA molecules in organisms exist not as single chains folded into complex shapes, like proteins, but rather as two chains wrapped about each other in a long linear molecule in eukaryotes, and a circular molecule in most prokaryotes. The two strands of a DNA polymer wind around each other like the outside and inside rails of a spiral staircase. Such a spiral shape is called a helix, and a helix composed of two chains is called a double helix. Each step of DNA’s helical staircase is composed of a basepair. The pair consists of a base in one chain attracted by hydrogen bonds to a base opposite it on the other chain (figure 3.16). The base-pairing rules are rigid: Adenine can pair only with thymine (in DNA) or with uracil (in RNA), and cytosine can pair only with guanine. The bases that participate in basepairing are said to be complementary to each other. Additional details of the structure of DNA and how it interacts with RNA in the production of proteins are presented in chapters 14 and 15.
Deoxyribosephosphate backbone
P
A
C
P Bases
P
G
A
T
P
DNA
P
Hydrogen bonding occurs between base-pairs P
P
P
P
C
P A
P
Ribose-phosphate backbone
G P
U A Bases
U
P
P G
RNA
Figure 3.17 DNA versus RNA. DNA forms a double helix, uses deoxyribose as the sugar in its sugar–phosphate backbone, and uses thymine among its nitrogenous bases. RNA is usually singlestranded, uses ribose as the sugar in its sugar–phosphate backbone, and uses uracil in place of thymine. chapter
3 The Chemical Building Blocks of Life
43
11/6/09 12:43:37 PM
Nitrogenous base (adenine) NH2 Triphosphate group
J
J
J
O:
CH2
O:
Figure 3.18 ATP. Adenosine triphosphate (ATP) contains adenine, a five-carbon sugar, and three phosphate groups.
6 5
N1 2
5„
:OJPJOJPJOJPJOJ
O:
N
8
O
K
O
K
K
O
7
9
N
4
N
3
O 4„
1„
3„
2„
OH OH 5-carbon sugar
triphosphate (ATP; figure 3.18)—the energy currency of the cell. Cells use ATP as energy in a variety of transactions, the way we use money in society. ATP is used to drive energetically unfavorable chemical reactions, to power transport across membranes, and to power the movement of cells. Two other important nucleotide-containing molecules are nicotinamide adenine dinucleotide (NAD+) and flavin adenine dinucleotide (FAD). These molecules function as electron carriers in a variety of cellular processes. You will see the action of these molecules in detail when we discuss photosynthesis and respiration (chapters 7–8).
Learning Outcomes Review 3.3 A nucleic acid is a polymer composed of alternating phosphate and fivecarbon sugar groups with a nitrogenous base protruding from each sugar. In DNA, this sugar is deoxyribose. In RNA, the sugar is ribose. RNA also contains the base uracil instead of thymine. DNA is a double-stranded helix that stores hereditary information as a specific sequence of nucleotide bases. RNA is a single-stranded molecule consisting of a transcript of a DNA sequence that directs protein synthesis. ■
Proteins are the most diverse group of biological macromolecules, both chemically and functionally. Because proteins have so many different functions in cells we could not begin to list them all. We can, however, group these functions into the following seven categories. This list is a summary only, however; details are covered in later chapters.
If an RNA molecule is copied from a DNA strand, what is the relationship between the sequence of bases in RNA and each DNA strand?
1. Enzyme catalysis. Enzymes are biological catalysts that facilitate specific chemical reactions. Because of this property, the appearance of enzymes was one of the most important events in the evolution of life. Enzymes are three-dimensional globular proteins that fit snugly around the molecules they act on. This fit facilitates chemical reactions by stressing particular chemical bonds. 2. Defense. Other globular proteins use their shapes to “recognize” foreign microbes and cancer cells. These cell-surface receptors form the core of the body’s endocrine and immune systems. 3. Transport. A variety of globular proteins transport small molecules and ions. The transport protein hemoglobin, for example, transports oxygen in the blood. Membrane transport proteins help move ions and molecules across the membrane. 4. Support. Protein fibers play structural roles. These fibers include keratin in hair, fibrin in blood clots, and collagen. The last one, collagen, forms the matrix of skin, ligaments, tendons, and bones and is the most abundant protein in a vertebrate body. 5. Motion. Muscles contract through the sliding motion of two kinds of protein filaments: actin and myosin. Contractile proteins also play key roles in the cell’s cytoskeleton and in moving materials within cells. 6. Regulation. Small proteins called hormones serve as intercellular messengers in animals. Proteins also play many regulatory roles within the cell—turning on and shutting off genes during development, for example. In addition, proteins receive information, acting as cell-surface receptors. 7. Storage. Calcium and iron are stored in the body by binding as ions to storage proteins. Table 3.2 summarizes these functions and includes examples of the proteins that carry them out in the human body.
Proteins are polymers of amino acids
3.4
Proteins: Molecules with Diverse Structures and Functions
Learning Outcomes 1. 2. 3.
44
Describe the possible levels of protein structure. Explain how motifs and domains contribute to protein structure. Understand the relationship between amino acid sequence and their three-dimensional structure.
part
Proteins are linear polymers made with 20 different amino acids. Amino acids, as their name suggests, contain an amino group (—NH2) and an acidic carboxyl group (—COOH). The specific order of amino acids determines the protein’s structure and function. Many scientists believe amino acids were among the first molecules formed on the early Earth. It seems highly likely that the oceans that existed early in the history of the Earth contained a wide variety of amino acids.
Amino acid structure The generalized structure of an amino acid is shown here as amino and carboxyl groups bonded to a central carbon atom, with an additional hydrogen and a functional side group
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 44
11/6/09 12:43:39 PM
TA B L E 3 . 2
The Many Functions of Protein
Function
Class of Protein
Examples
Examples of Use
Enzyme catalysis
Enzymes
Glycosidases
Cleave polysaccharides
Proteases
Break down proteins
Polymerases
Synthesize nucleic acids
Defense
Transport
Kinases
Phosphorylate sugars and proteins
Immunoglobulins
Antibodies
Mark foreign proteins for elimination
Toxins
Snake venom
Blocks nerve function
Cell-surface antigens
MHC* proteins
“Self” recognition
Circulating transporters
Hemoglobin
Carries O2 and CO2 in blood
Myoglobin
Carries O2 and CO2 in muscle
Cytochromes
Electron transport
Sodium–potassium pump
Excitable membranes
Proton pump
Chemiosmosis
Membrane transporters
Support
Fibers
Motion
Storage
Transports glucose into cells Forms cartilage
Keratin
Forms hair, nails
Fibrin
Forms blood clots
Actin
Contraction of muscle fibers
Myosin
Contraction of muscle fibers
Osmotic proteins
Serum albumin
Maintains osmotic concentration of blood
Gene regulators
lac Repressor
Regulates transcription
Hormones
Insulin
Controls blood glucose levels
Vasopressin
Increases water retention by kidneys
Oxytocin
Regulates uterine contractions and milk production
Ferritin
Stores iron, especially in spleen
Casein
Stores ions in milk
Calmodulin
Binds calcium ions
Muscle
Regulation
Glucose transporter Collagen
Ion-binding
*MHC, major histocompatibility complex.
indicated by R. These components completely fill the bonds of the central carbon: R | H2N—C—COOH | H The unique character of each amino acid is determined by the nature of the R group. Notice that unless the R group is an H atom, as in glycine, amino acids are chiral and can exist as two enantiomeric forms: d or l. In living systems, only the l-amino acids are found in proteins, and d-amino acids are rare. The R group also determines the chemistry of amino acids. Serine, in which the R group is —CH2OH, is a polar molecule. Alanine, which has —CH3 as its R group, is nonpolar. www.ravenbiology.com
rav32223_ch03_033-058.indd 45
The 20 common amino acids are grouped into five chemical classes, based on their R group: 1. Nonpolar amino acids, such as leucine, often have R groups that contain —CH2 or —CH3. 2. Polar uncharged amino acids, such as threonine, have R groups that contain oxygen (or —OH). 3. Charged amino acids, such as glutamic acid, have R groups that contain acids or bases that can ionize. 4. Aromatic amino acids, such as phenylalanine, have R groups that contain an organic (carbon) ring with alternating single and double bonds. These are also nonpolar. 5. Amino acids that have special functions have unique properties. Some examples are methionine, which is often the first amino acid in a chain of amino acids; proline, which causes kinks in chains; and cysteine, which links chains together. chapter
3 The Chemical Building Blocks of Life
45
11/9/09 4:22:59 PM
Each amino acid affects the shape of a protein differently, depending on the chemical nature of its side group. For example, portions of a protein chain with numerous nonpolar amino acids tend to fold into the interior of the protein by hydrophobic exclusion.
the solution. Although many different amino acids occur in nature, only 20 commonly occur in proteins. Figure 3.20 illustrates these 20 amino acids and their side groups.
Peptide bonds
The shape of a protein determines its function. One way to study the shape of something as small as a protein is to look at it with very short wavelength energy—in other words, with Xrays. X-rays can be passed through a crystal of protein to produce a diffraction pattern. This pattern can then be analyzed by a painstaking procedure that allows the investigator to build up a three-dimensional picture of the position of each atom. The first protein to be analyzed in this way was myoglobin, and the related protein hemoglobin was analyzed soon thereafter. As more and more proteins were studied, a general principle became evident: In every protein studied, essentially all the internal amino acids are nonpolar ones—amino acids such as leucine, valine, and phenylalanine. Water’s tendency to hydrophobically exclude nonpolar molecules literally shoves the nonpolar portions of the amino acid chain into the protein’s interior (figure 3.21). This tendency forces the nonpolar amino acids into close contact with one another, leaving little empty space inside. Polar and charged amino acids are restricted to the surface of the protein, except for the few that play key functional roles. The structure of proteins is usually discussed in terms of a hierarchy of four levels: primary, secondary, tertiary, and quaternary (figure 3.22). We will examine this view and then integrate it with a more modern approach arising from our increasing knowledge of protein structure.
In addition to its R group, each amino acid, when ionized, has a positive amino (NH3+) group at one end and a negative carboxyl (COO–) group at the other. The amino and carboxyl groups on a pair of amino acids can undergo a dehydration reaction to form a covalent bond. The covalent bond that links two amino acids is called a peptide bond (figure 3.19). The two amino acids linked by such a bond are not free to rotate around the N—C linkage because the peptide bond has a partial doublebond character. This is different from the N—C and C—C bonds to the central carbon of the amino acid. This lack of rotation about the peptide bond is one factor that determines the structural character of the coils and other regular shapes formed by chains of amino acids. A protein is composed of one or more long unbranched chains. Each chain is called a polypeptide and is composed of amino acids linked by peptide bonds. The terms protein and polypeptide tend to be used loosely and may be confusing. For proteins that include only a single polypeptide chain, the two terms are synonymous. The pioneering work of Frederick Sanger in the early 1950s provided the evidence that each kind of protein has a specific amino acid sequence. Using chemical methods to remove successive amino acids and then identify them, Sanger succeeded in determining the amino acid sequence of insulin. In so doing he demonstrated clearly that this protein had a defined sequence, which was the same for all insulin molecules in
O
HJNJCJCJOH
R
J J
H
J
J J
H
J J
R
J J
J
H
H
O
HJNJCJCJOH
Amino acid
Amino acid H2O
J
H
R
J J
R
J J
J
H
O
H
J J
H
J J
HJNJCJCJNJCJCJOH O
Dipeptide
Proteins have levels of structure
Primary structure: amino acid sequence The primary structure of a protein is its amino acid sequence. Because the R groups that distinguish the amino acids play no role in the peptide backbone of proteins, a protein can consist of any sequence of amino acids. Thus, because any of 20 different amino acids might appear at any position, a protein containing 100 amino acids could form any of 20100 different amino acid sequences (that’s the same as 10130, or 1 followed by 130 zeros— more than the number of atoms known in the universe). This important property of proteins permits great diversity. Consider the protein hemoglobin, the protein your blood uses to transport oxygen. Hemoglobin is composed of two α-globin peptide chains and two β-globin peptide chains. The α-globin chains differ from the β-globin ones in the sequence of amino acids. Furthermore, any alteration in the normal sequence of either of the types of globin proteins, even by a single amino acid, can have drastic effects on how the protein functions.
Figure 3.19 The peptide bond. A peptide bond forms when
Secondary structure: Hydrogen bonding patterns
the amino end of one amino acid joins to the carboxyl end of another. Reacting amino and carboxyl groups are shown in red and nonreacting groups are highlighted in green. Notice that the resulting dipeptide still has an amino end and a carboxyl end. Because of the partial double-bond nature of peptide bonds, the resulting peptide chain cannot rotate freely around these bonds.
The amino acid side groups are not the only portions of proteins that form hydrogen bonds. The peptide groups of the main chain can also do so. These hydrogen bonds can be with water or with other peptide groups. If the peptide groups formed too many hydrogen bonds with water, the proteins would tend to behave like a random coil and wouldn’t produce
46
part
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 46
11/6/09 12:43:40 PM
Polar uncharged OH
C
H3N;JCJCJO:
O
H
CH3
CH2
O
CH3
H3N;JCJCJO:
J
J J
HJCJCH3
NH2
H3N;JCJCJO:
NH2
C
Asparagine (Asn)
HCJNH;
O
CJ N H CH2
Aspartic acid (Asp)
H
CH2
H O Leucine (Leu)
O
Glutamine (Gln)
Glycine (Gly)
CH2JNH3;
J J J J J
H
O
Histidine (His)
H3N;JCJCJO:
O
CH
H3N;JCJCJO:
CH2
J J
J J
J J J J
J J
H3N;JCJCJO:
O
J J
H3N;JCJCJO:
O
J J
J J J
H
CH2
H
H3N;JCJCJO:
J J
J
CH
H
J
CH3
J
CH3
K J J J J J J J
CH2
H O Isoleucine (Ile)
CH2
J J
J J
J J J
C
H3N;JCJCJO:
C
J J J
O
O:
O
J J
H O Threonine (Thr)
CH2
O
Glutamic acid (Glu)
H3N;JCJCJO:
J J
J J J J
Nonaromatic
J J
H O Valine (Val)
CH3
H
HJCJOH
J J
H3N;JCJCJO:
J J J
J J
CH
J
J
Serine (Ser)
J
CH3
CH2
J J
Alanine (Ala)
H
J J J J
CH2
J J
H
J
H3N;JCJCJO:
O:
O
J J
J J J
J J
CH3
Charged
J
Nonpolar
CH2
CH2
—
J J O
— —
Aromatic
— —
O
H3N;JCJCJO:
J
Proline (Pro)
www.ravenbiology.com
H
O
Methionine (Met)
NH3;JCJCJO: H
J J
O
J J
NH2;
rav32223_ch03_033-058.indd 47
CH2
CHJCJO: H3N;JCJCJO:
J J
J2 CH
CH2
J
J
Special function
S
CH2
CH2
J J J J
J J J J J
H
S
J
H3N;JCJCJO: H O Arginine (Arg)
Figure 3.20 The 20 common amino acids. Each
CH3
CH2
CH2
CH2
H O Tyrosine (Tyr)
Tryptophan (Trp)
NH
J J
H
CJ JNH2;
CH2
J J
J J
H3N;JCJCJO:
O
Lysine (Lys)
CH2
CH2
J
Phenylalanine (Phe)
C
J J J
JCJCJO:
H3
J
J J J H
CH2
N;
H
NH
J J
H3N;JCJCJO:
OH
J J J J J J J
NH2
CH2
O
Cysteine (Cys)
amino acid has the same chemical backbone, but differs in the side, or R, group. Seven of the amino acids are nonpolar because they have —CH 2 or —CH3 in their R groups. Two of the seven contain ring structures with alternating double and single bonds, which classifies them also as aromatic. Another five are polar because they have oxygen or a hydroxyl group in their R groups. Five others are capable of ionizing to a charged form. The remaining three special-function amino acids have chemical properties that allow them to help form links between protein chains or kinks in proteins. chapter
3 The Chemical Building Blocks of Life
47
11/6/09 12:43:41 PM
J
O
CJ
RJ
N
H
Ionic bond
SJCJC H
OJC
NH3;
O CJ
OJC
Disulfide bridge
N
CJCH3
O:
CH3JC
N
van der Waals attraction
CH2
J J
HJ
JO
N
J J
J J
CJNJ
CJCJS
H
J J J
C C J C JN J
JO
HJ
(CH2)4
H
J J
O JC
J J
C JC
RJ
J J
JR
CJN
C JO
CJC NJ
J
Hydrogen bond
O
a.
b.
J
J CH3
c.
CH3
JCJCH3 CH3
CH3
J J
J J
H
Hydrophobic exclusion
CH2
CH3JCJCH3
d.
Figure 3.21 Interactions that contribute to a protein’s shape. Aside from the bonds that link together the amino acids in a protein, several other weaker forces and interactions determine how a protein will fold. a. Hydrogen bonds can form between the different amino acids. b. Covalent disulfide bridges can form between two cysteine side chains. c. Ionic bonds can form between groups with opposite charge. d. van der Waals attractions, which are weak attractions between atoms due to oppositely polarized electron clouds, can occur. e. Polar portions of the protein tend to gather on the outside of the protein and interact with water, whereas the hydrophobic portions of the protein, including nonpolar amino acid chains, are shoved toward the interior of the protein.
e. the kinds of globular structures that are common in proteins. Linus Pauling suggested that the peptide groups could interact with one another if the peptide was coiled into a spiral that he called the α helix. We now call this sort of regular interaction of groups in the peptide backbone secondary structure. Another form of secondary structure can occur between regions of peptide aligned next to each other to form a planar structure called a β sheet. These can be either parallel or antiparallel depending on whether the adjacent sections of peptide are oriented in the same direction, or opposite direction. These two kinds of secondary structure create regions of the protein that are cylindrical (α helices) and planar (β sheets). A protein’s final structure can include regions of each type of secondary structure. For example, DNA-binding proteins usually have regions of α helix that can lay across DNA and interact directly with the bases of DNA. Porin proteins that form holes in membranes are composed of β sheets arranged to form a pore in the membrane. Finally in hemoglobin, the αand β-globin peptide chains that make up the final molecule each have characteristic regions of secondary structure.
Tertiary structure: Folds and links The final folded shape of a globular protein is called its tertiary structure. This tertiary structure contains regions that have secondary structure and determines how these are further arranged in space to produce the overall structure. A protein is initially driven into its tertiary structure by hydrophobic exclusion from water. Ionic bonds between oppositely charged 48
part
R groups bring regions into close proximity, and disulfide bonds (covalent links between two cysteine R groups) lock particular regions together. The final folding of a protein is determined by its primary structure—the chemical nature of its side groups (see figure 3.21 and 3.22). Many small proteins can be fully unfolded (“denatured”) and will spontaneously refold into their characteristic shape. Other larger proteins tend to associate together and form insoluble clumps when denatured, such as the film that can form when you heat milk for hot chocolate. The tertiary structure is stabilized by a number of forces including hydrogen bonding between R groups of different amino acids, electrostatic attraction between R groups with opposite charge (also called salt bridges), hydrophobic exclusion of nonpolar R groups, and covalent bonds in the form of disulfides. The stability of a protein, once it has folded into its tertiary shape, is strongly influenced by how well its interior fits together. When two nonpolar chains in the interior are very close together, they experience a form of molecular attraction called van der Waals forces. Individually quite weak, these forces can add up to a strong attraction when many of them come into play, like the combined strength of hundreds of hooks and loops on a strip of Velcro. These forces are effective only over short distances, however. No “holes” or cavities exist in the interior of proteins. The variety of different nonpolar amino acids, with a different-sized R group with its own distinctive shape, allows nonpolar chains to fit very precisely within the protein interior. It is therefore not surprising that changing a single amino acid can drastically alter the structure, and thus the function of a
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 48
11/9/09 12:29:31 PM
Primary Structure
R
R
H
J J
H
J
J J
O
J J
J J
H
J
J J
H
H
R
H
J J
O
J
H
J J
JCJCJNJ CJ CJNJCJCJNJC O
R
The primary structure can fold into a pleated sheet, or turn into a helix
Secondary Structure
Figure 3.22 Levels of protein structure. The primary structure of a protein is its amino acid sequence. Secondary structure results from hydrogen bonds forming between nearby amino acids. This produces two different kinds of structures: beta (β)-pleated sheets, and coils called alpha (α)-helices. The tertiary structure is the fi nal 3-D shape of the protein. This determines how regions of secondary structure are then further folded in space to form the fi nal shape of the protein. Quaternary structure is only found in proteins with multiple polypeptides. In this case the fi nal structure of the protein is the arrangement of the multiple polypeptides in space. Secondary Structure
• • •
• • •
• • •
• • •
• • •
• • • • • •
• • •
• • • • • •
• • •
• • •
• • •
β-pleated sheet
Tertiary Structure
protein. The sickle cell version of hemoglobin (HbS), for example, is a change of a single glutamic acid for a valine in the β-globin chain. This change substitutes a charged amino acid for a nonpolar one on the surface of the protein, leading the protein to become sticky and form clumps. Another variant of hemoglobin called HbE, actually the most common in human populations, causes a change from glutamic acid to lysine at a different site in the β-globin chain. In this case the structural change is not as dramatic, but it still impairs function, resulting in blood disorders called anemia and thalassemia. More than 700 structural variants of hemoglobin are known, with up to 7% of the world’s population being carriers of forms that are medically important.
Quaternary structure: Subunit arrangements When two or more polypeptide chains associate to form a functional protein, the individual chains are referred to as subunits of www.ravenbiology.com
rav32223_ch03_033-058.indd 49
α-helix
Quaternary Structure
the protein. The arrangement of these subunits is termed its quaternary structure. In proteins composed of subunits, the interfaces where the subunits touch one another are often nonpolar, and they play a key role in transmitting information between the subunits about individual subunit activities. Remember that the protein hemoglobin is composed of two α-chain subunits and two β-chain subunits. Each α- and β-globin chain has a primary structure consisting of a specific sequence of amino acids. This then assumes a characteristic secondary structure consisting of α helices and β sheets that are then arranged into a specific tertiary structure for each α- and β-globin subunit. Lastly, these subunits are then arranged into their final quaternary structure. This is the final structure of the protein. For proteins that consist of only a single peptide chain, the enzyme lysozyme for example, the tertiary structure is the final structure of the protein. chapter
3 The Chemical Building Blocks of Life
49
11/6/09 12:43:42 PM
Motifs and domains are additional structural characteristics To directly determine the sequence of amino acids in a protein is a laborious task. Although the process has been automated, it remains slow and difficult. The ability to sequence DNA changed this situation rather suddenly. Sequencing DNA was a much simpler process, and even before it was automated, the number of known sequences rose quickly. With the advent of automation, the known sequences increased even more dramatically. Today the entire sequence of hundreds of bacterial genomes and more than a dozen animal genomes, including that of humans, has been determined. Because the DNA sequence is directly related to amino acid sequence in proteins, biologists now have a large database of protein sequences to compare and analyze. This new information has also stimulated thought about the logic of the genetic code and whether underlying patterns exist in protein structure. Our view of protein structure has evolved with this new information. Researchers still view the four-part hierarchical structure as important, but two new terms have entered the biologist’s vocabulary: motif and domain.
Motifs As biologists discovered the 3-D structure of proteins (an even more laborious task than determining the sequence), they noticed similarities between otherwise dissimilar proteins. These similar structures are called motifs, or sometimes “supersecondary structure.” The term motif is borrowed from the arts and refers to a recurring thematic element in music or design. One very common protein motif is the β-α-β motif, which creates a fold or crease; the so-called “Rossmann fold” at the core of nucleotide-binding sites in a wide variety of proteins. A second motif that occurs in many proteins is the β barrel, which is a β sheet folded around to form a tube. A third type
of motif, the helix-turn-helix, consists of two α helices separated by a bend. This motif is important because many proteins use it to bind to the DNA double helix (figure 3.23; see also chapter 16). Motifs indicate a logic to structure that investigators still do not understand. Do they simply represent a reuse by evolution of something that already works, or are they an optimal solution to a problem, such as how to bind a nucleotide? One way to think about it is that if amino acids are letters in the language of proteins, then motifs represent repeated words or phrases. Motifs have been useful in determining the function of unknown proteins. Databases of protein motifs are used to search new unknown proteins. Finding motifs with known functions may allow an investigator to infer the function of a new protein.
Domains Domains of proteins are functional units within a larger structure. They can be thought of as substructure within the tertiary structure of a protein (see figure 3.23). To continue the metaphor: Amino acids are letters in the protein language, motifs are words or phrases, and domains are paragraphs. Most proteins are made up of multiple domains that perform different parts of the protein’s function. In many cases, these domains can be physically separated. For example, transcription factors (discussed in chapter 16) are proteins that bind to DNA and initiate its transcription. If the DNAbinding region is exchanged with a different transcription factor, then the specificity of the factor for DNA can be changed without changing its ability to stimulate transcription. Such “domain-swapping” experiments have been performed with many transcription factors, and they indicate, among other things, that the DNA-binding and activation domains are functionally separate. These functional domains of proteins may also help the protein to fold into its proper shape. As a polypeptide chain
Motifs
Domains
Domain 1
b-a-b motif
Helix-turn-Helix motif
Figure 3.23 Motifs and domains. The elements of secondary structure can combine, fold, or crease to form motifs. These motifs are found in different proteins and can be used to predict function. Proteins also are made of larger domains, which are functionally distinct parts of a protein. The arrangement of these domains in space is the tertiary structure of a protein. Domain 3
50
part
Domain 2
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 50
11/6/09 12:43:43 PM
folds, the domains take their proper shape, each more or less independently of the others. This action can be demonstrated experimentally by artificially producing the fragment of a polypeptide that forms the domain in the intact protein, and showing that the fragment folds to form the same structure as it exhibits in the intact protein. A single polypeptide chain connects the domains of a protein, like a rope tied into several adjacent knots. Domains can also correspond to the structure of the genes that encode them. Later, in chapter 15, you will see that genes in eukaryotes are often in pieces within the genome, and these pieces, called exons, sometimes encode the functional domains of a protein. This finding led to the idea of evolution acting by shuffling protein-encoding domains.
The process of folding relies on chaperone proteins Until recently, scientific investigators thought that newly made proteins fold spontaneously, randomly trying out different configurations as hydrophobic interactions with water shoved nonpolar amino acids into the protein’s interior until the final structure was arrived at. We now know this view is too simple. Protein chains can fold in so many different ways that trial and error would simply take too long. In addition, as the open chain folds its way toward its final form, nonpolar “sticky” interior portions are exposed during intermediate stages. If these intermediate forms are placed in a test tube in an environment identical to that inside a cell, they stick to other, unwanted protein partners, forming a gluey mess. How do cells avoid having their proteins clump into a mass? A vital clue came in studies of unusual mutations that prevent viruses from replicating in bacterial cells. It turns out that the virus proteins produced inside the cells could not fold properly. Further study revealed that normal cells contain chaperone proteins, which help other proteins to fold correctly. Molecular biologists have now identified many proteins that act as molecular chaperones. This class of proteins has
multiple subclasses, and representatives have been found in essentially every organism that has been examined. Furthermore, these proteins seem to be essential for viability as well, illustrating their fundamental importance. Many are heat shock proteins, produced in greatly increased amounts when cells are exposed to elevated temperature. High temperatures cause proteins to unfold, and heat shock chaperone proteins help the cell’s proteins to refold properly. One class of these proteins, called chaperonins, has been extensively studied. In the bacterium Escherichia coli (E. coli), one example is the essential protein GroE chaperonin. In mutants in which the GroE chaperonin is inactivated, fully 30% of the bacterial proteins fail to fold properly. Chaperonins associate to form a large macromolecular complex that resembles a cylindrical container. Proteins can move into the container, and the container itself can change its shape considerably (figure 3.24). Experiments have shown that an improperly folded protein can enter the chaperonin and be refolded. Although we don’t know exactly how this happens, it seems to involve changes in the hydrophobicity of the interior of the chamber. The flexibility of the structure of chaperonins is amazing. We tend to think of proteins as being fixed structures, but this is clearly not the case for chaperonins and this flexibility is necessary for their function. It also illustrates that even domains that may be very widely separated in a very large protein are still functionally connected. The folding process within a chaperonin harnesses the hydrolysis of ATP to power these changes in structure necessary for function. This entire process can occur in a cyclic manner until the appropriate structure is achieved. Cells use these chaperonins both to accomplish the original folding of some proteins and to restore the structure of incorrectly folded ones.
Some diseases may result from improper folding Chaperone protein deficiencies may be implicated in certain diseases in which key proteins are improperly folded. Cystic fibrosis
Misfolded protein Cap
Chaperone protein
ATP ADP + P
Correctly folded protein
Chance for protein to refold
Figure 3.24 How one type of chaperone protein works. This barrel-shaped chaperonin is from the GroE family of chaperone proteins. It is composed of two identical rings each with seven identical subunits, each of which has three distinct domains. An incorrectly folded protein enters one chamber of the barrel, and a cap seals the chamber. Energy from the hydrolysis of ATP fuels structural alterations to the chamber, changing it from hydrophobic to hydrophilic. This change allows the protein to refold. After a short time, the protein is ejected, either folded or unfolded, and the cycle can repeat itself. www.ravenbiology.com
rav32223_ch03_033-058.indd 51
chapter
3 The Chemical Building Blocks of Life
51
11/6/09 12:43:44 PM
is a hereditary disorder in which a mutation disables a vital protein that moves ions across cell membranes. As a result, people with cystic fibrosis have thicker than normal mucus. This results in breathing problems, lung disease, and digestive difficulties, among other things. One interesting feature of the molecular analysis of this disease has been the number of different mutations found in human populations. One diverse class of mutations all result in problems with protein folding. The number of different mutations that can result in improperly folded proteins may be related to the fact that the native protein often fails to fold properly.
Properly folded protein
Denaturation
Denaturation inactivates proteins If a protein’s environment is altered, the protein may change its shape or even unfold completely. This process is called denaturation (figure 3.25). Proteins can be denatured when the pH, temperature, or ionic concentration of the surrounding solution changes. Denatured proteins are usually biologically inactive. This action is particularly significant in the case of enzymes. Because practically every chemical reaction in a living organism is catalyzed by a specific enzyme, it is vital that a cell’s enzymes work properly. The traditional methods of food preservation, salt curing and pickling, involve denaturation of proteins. Prior to the general availability of refrigerators and freezers, the only practical
Denatured protein
Figure 3.25 Protein denaturation. Changes in a protein’s environment, such as variations in temperature or pH, can cause a protein to unfold and lose its shape in a process called denaturation. In this denatured state, proteins are biologically inactive.
SCIENTIFIC THINKING Hypothesis: The 3-D structure of a protein is the thermodynamically stable structure. It depends only on the primary structure of the protein and the solution conditions. Prediction: If a protein is denatured and allowed to renature under native conditions, it will refold into the native structure. Test: Ribonuclease is treated with a reducing agent to break disulfide bonds and is then treated with urea to completely unfold the protein. The disulfide bonds are reformed under nondenaturing conditions to see if the protein refolds properly. Native ribonuclease
Unfolded ribonuclease
Reduced ribonuclease
Reducing agents
Heating or addition of urea
Oxidizing agents
Cooling or removal of urea
S-S disulfide bonds
Broken disulfide bonds (SH)
Result: Denatured Ribonuclease refolds properly under nondenaturing conditions. Conclusion: The hypothesis is supported. The information in the primary structure (amino acid sequence) is sufficient for refolding to occur. This implies that protein folding results in the thermodynamically stable structure. Further Experiments: If the disulfide bonds were allowed to reform under denaturing conditions, would we get the same result? How can we rule out that the protein had not been completely denatured and therefore retained some structure?
Figure 3.26 Primary structure determines tertiary structure. 52
part
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 52
11/9/09 4:23:22 PM
way to keep microorganisms from growing in food was to keep the food in a solution containing a high concentration of salt or vinegar, which denatured the enzymes of most microorganisms and prevented them from growing on the food. Most enzymes function within a very narrow range of environmental conditions. Blood-borne enzymes that course through a human body at a pH of about 7.4 would rapidly become denatured in the highly acidic environment of the stomach. Conversely, the protein-degrading enzymes that function at a pH of 2 or less in the stomach would be denatured in the relatively basic pH of the blood. Similarly, organisms that live near oceanic hydrothermal vents have enzymes that work well at these extremes of temperature (over 100°C). They cannot survive in cooler waters, because their enzymes do not function properly at lower temperatures. Any given organism usually has a tolerance range of pH, temperature, and salt concentration. Within that range, its enzymes maintain the proper shape to carry out their biological functions. When a protein’s normal environment is reestablished after denaturation, a small protein may spontaneously refold into its natural shape, driven by the interactions between its nonpolar amino acids and water (figure 3.26). This process is termed renaturation, and it was first established for the enzyme ribonuclease (RNase). The renaturation of RNase led to the doctrine that primary structure determines tertiary structure. Larger proteins can rarely refold spontaneously, however, because of the complex nature of their final shape, so this simple idea needs to be qualified. The fact that some proteins can spontaneously renature implies that tertiary structure is strongly influenced by primary structure. In an extreme example, the E. coli ribosome can be taken apart and put back together experimentally. Although this process requires temperature and ion concentration shifts, it indicates an amazing degree of self-assembly. That complex structures can arise by self-assembly is a key idea in the study of modern biology. It is important to distinguish denaturation from dissociation. For proteins with quaternary structure, the subunits may be dissociated without losing their individual tertiary structure. For example, the four subunits of hemoglobin may dissociate into four individual molecules (two α-globins and two β-globins) without denaturation of the folded globin proteins. They readily reassume their foursubunit quaternary structure.
Learning Outcomes Review 3.4 Proteins are molecules with diverse functions. They are constructed from 20 different kinds of amino acids. Protein structure can be viewed at four levels: (1) the amino acid sequence, or primary structure; (2) coils and sheets, called secondary structure; (3) the three-dimensional shape, called tertiary structure; and (4) individual polypeptide subunits associated in a quaternary structure. Different proteins often have similar substructures called motifs and can be broken down into functional domains. Proteins have a narrow range of conditions in which they fold properly; outside that range, proteins tend to unfold (denaturation). Under some conditions, denatured proteins can refold and become functional again (renaturation). ■
How does our knowledge of protein structure help us to predict the function of unknown proteins?
www.ravenbiology.com
rav32223_ch03_033-058.indd 53
3.5
Lipids: Hydrophobic Molecules
Learning Outcomes 1. 2. 3.
Understand the structure of triglycerides. Explain how fats function as energy-storage molecules. Apply knowledge of the structure of phospholipids to the formation of membranes.
Lipids are a somewhat loosely defined group of molecules with one main chemical characteristic: They are insoluble in water. Storage fats such as animal fat are one kind of lipid. Oils such as those from olives, corn, and coconut are also lipids, as are waxes such as beeswax and earwax. Even some vitamins are lipids! Lipids have a very high proportion of nonpolar carbon– hydrogen (C—H) bonds, and so long-chain lipids cannot fold up like a protein to confine their nonpolar portions away from the surrounding aqueous environment. Instead, when they are placed in water, many lipid molecules spontaneously cluster together and expose what polar (hydrophilic) groups they have to the surrounding water, while confining the nonpolar (hydrophobic) parts of the molecules together within the cluster. You may have noticed this effect when you add oil to a pan containing water, and the oil beads up into cohesive drops on the water’s surface. This spontaneous assembly of lipids is of paramount importance to cells, as it underlies the structure of cellular membranes.
Fats consist of complex polymers of fatty acids attached to glycerol Many lipids are built from a simple skeleton made up of two main kinds of molecules: fatty acids and glycerol. Fatty acids are long-chain hydrocarbons with a carboxylic acid (COOH) at one end. Glycerol is a three-carbon polyalcohol (three —OH groups). Many lipid molecules consist of a glycerol molecule with three fatty acids attached, one to each carbon of the glycerol backbone. Because it contains three fatty acids, a fat molecule is commonly called a triglyceride (the more accurate chemical name is triacylglycerol). This basic structure is depicted in figure 3.27. The three fatty acids of a triglyceride need not be identical, and often they are very different from one another. The hydrocarbon chains of fatty acids vary in length. The most common are even-numbered chains of 14 to 20 carbons. The many C—H bonds of fats serve as a form of long-term energy storage. If all of the internal carbon atoms in the fatty acid chains are bonded to at least two hydrogen atoms, the fatty acid is said to be saturated, which refers to its having all the hydrogen atoms possible (see figure 3.27). A fatty acid that has double bonds between one or more pairs of successive carbon atoms is said to be unsaturated. Fatty acids with one double bond are called monounsaturated, and those with more than one double bond are termed polyunsaturated. Most naturally occurring unsaturated fatty acids have double bonds with a cis configuration where the carbon chain is on the same side before and after the double bond (double bonds in fatty acids in 3.27b are all cis). chapter
3 The Chemical Building Blocks of Life
53
11/6/09 12:43:47 PM
Structural Formula H
Structural Formula H
O H H H H H H H H H H H H H H H H H
H C O C C C C C C C C C C C C C C C C C C H
O H H H H H H H
O H H H H H H H H H H H H H H H H H
H H H H H H H H
H H H H H H H H H H H H H H H H H O H H H H H H H
O H H H H H H H H H H H H H H H H H H
H H H H H
H C O C C C C C C C C C C C C C C C C C C H
H H H H H H H H H H H H H H H H H
H C O C C C C C C C C C C C C C C C C C C H
H
H H H H H H H H H H H H H H H H H
H H H H H H H H H H H H H H H H H
H C O C C C C C C C C C C C C C C C C C C H
O H H H H H H H
H C O C C C C C C C C C C C C C C C C C C H
H
H
H H
H C O C C C C C C C C C C C C C C C C C C H H
H H H H H H H H H H H H H H H H H
Space-Filling Model
H H H H H H H H H H H H H H H H H
Space-Filling Model
b.
a.
Figure 3.27 Saturated and unsaturated fats. a. A saturated fat is composed of triglycerides that contain three saturated fatty acids (the kind that have no double bonds). A saturated fat therefore has the maximum number of hydrogen atoms bonded to its carbon chain. Most animal fats are saturated. b. Unsaturated fat is composed of triglycerides that contain three unsaturated fatty acids (the kind that have one or more double bonds). These have fewer than the maximum number of hydrogen atoms bonded to the carbon chain. This example includes both a monounsaturated and two polyunsaturated fatty acids. Plant fats are typically unsaturated. The many kinks of the double bonds prevent the triglyceride from closely aligning, which makes them liquid oils at room temperature. When fats are partially hydrogenated industrially, this can produce double bonds with a trans configuration where the carbon chain is on opposite sides before and after the double bond. These are the so called trans fats. These have been linked to elevated levels of low-density lipoprotein (LDL) “bad cholesterol” and lowered levels of high-density lipoprotein (HDL) “good cholesterol.” This condition is thought to be associated with an increased risk for coronary heart disease. Having double bonds changes the behavior of the molecule because free rotation cannot occur about a C=C double bond as it can with a C—C single bond. This characteristic mainly affects melting point: that is, whether the fatty acid is a solid fat or a liquid oil at room temperature. Fats containing polyunsaturated fatty acids have low melting points because their fatty acid chains bend at the double bonds, preventing the fat molecules from aligning closely with one another. Most saturated fats, such as animal fat or those in butter, are solid at room temperature. Placed in water, triglycerides spontaneously associate together, forming fat globules that can be very large relative to the size of the individual molecules. Because fats are insoluble in water, they can be deposited at specific locations within an organism, such as in vesicles of adipose tissue. 54
part
Organisms contain many other kinds of lipids besides fats (figure 3.28). Terpenes are long-chain lipids that are components of many biologically important pigments, such as chlorophyll and the visual pigment retinal. Rubber is also a terpene. Steroids, another class of lipid, are composed of four carbon rings. Most animal cell membranes contain the steroid cholesterol. Other steroids, such as testosterone and estrogen, function as hormones in multicellular animals. Prostaglandins are a group of about 20 lipids that are modified fatty acids, with two nonpolar “tails” attached to a five-carbon ring. Prostaglandins act as local chemical messengers in many vertebrate tissues. Later chapters explore the effects of some of these complex fatty acids.
Fats are excellent energy-storage molecules Most fats contain over 40 carbon atoms. The ratio of energystoring C—H bonds in fats is more than twice that of carbohydrates (see section 3.2), making fats much more efficient molecules for storing chemical energy. On average, fats yield about 9 kilocalories (kcal) of chemical energy per gram, as compared with about 4 kcal/g for carbohydrates. Most fats produced by animals are saturated (except some fish oils), whereas most plant fats are unsaturated (see
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 54
11/6/09 12:43:48 PM
J
J
J
CH2
CH
CH3
Phospholipids form membranes
CH2
J
J
J
CH
CH2
J
J J
J
CH H 3C
CH3
CH3
J
H3C
they grow older is that the amount of energy they need decreases with age, but their intake of food does not. Thus, an increasing proportion of the carbohydrates they ingest is converted into fat. A diet heavy in fats is one of several factors thought to contribute to heart disease, particularly atherosclerosis. In atherosclerosis, sometimes referred to as “hardening of the arteries,” fatty substances called plaque adhere to the lining of blood vessels, blocking the flow of blood. Fragments of a plaque can break off from a deposit and clog arteries to the brain, causing a stroke.
OH
CH2
CH
J
CH3
J
J
CH2
CH2
J
CH2
CH
J
J
H3C
J
a. Terpene (citronellol)
CH3
Complex lipid molecules called phospholipids are among the most important molecules of the cell because they form the core of all biological membranes. An individual phospholipid can be thought of as a substituted triglyceride, that is, a triglyceride with a phosphate replacing one of the fatty acids. The basic structure of a phospholipid includes three kinds of subunits:
HO
b. Steroid (cholesterol)
Figure 3.28 Other kinds of lipids. a. Terpenes are found in biological pigments, such as chlorophyll and retinal, and (b) steroids play important roles in membranes and as the basis for a class of hormones involved in chemical signaling.
J J J J J
Phospholipids. The phospholipid phosphatidylcholine is shown as (a) a schematic, (b) a formula, (c) a space-filling model, and (d) an icon used in depictions of biological membranes.
O
O JP J O:
Choline Phosphate
O
H
H2C J C J CH2
Glycerol
F a t t y a c i d
O
O
C JO C JO CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH CH2 CH CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH3 CH3
F a t t y a c i d
www.ravenbiology.com
J J J
Nonpolar Hydrophobic Tails
Figure 3.29
CH2
a.
rav32223_ch03_033-058.indd 55
The phospholipid molecule can be thought of as having a polar “head” at one end (the phosphate group) and two long, very nonpolar “tails” at the other (figure 3.29). This structure is essential for how these molecules function, although it first
CH2JN;(CH3)3
J J
Polar Hydrophilic Heads
figure 3.27). The exceptions are the tropical plant oils (palm oil and coconut oil), which are saturated even though they are liquid at room temperature. An oil may be converted into a solid fat by chemically adding hydrogen. Most peanut butter is usually artificially hydrogenated to make the peanut fats solidify, preventing them from separating out as oils while the jar sits on the store shelf. However, artificially hydrogenating unsaturated fats produces the trans-fatty acids described above. When an organism consumes excess carbohydrate, it is converted into starch, glycogen, or fats reserved for future use. The reason that many humans in developed countries gain weight as
1. Glycerol, a three-carbon alcohol, in which each carbon bears a hydroxyl group. Glycerol forms the backbone of the phospholipid molecule. 2. Fatty acids, long chains of —CH2 groups (hydrocarbon chains) ending in a carboxyl (—COOH) group. Two fatty acids are attached to the glycerol backbone in a phospholipid molecule. 3. A phosphate group (—PO42–) attached to one end of the glycerol. The charged phosphate group usually has a charged organic molecule linked to it, such as choline, ethanolamine, or the amino acid serine.
b.
c.
d. chapter
3 The Chemical Building Blocks of Life
55
11/6/09 12:43:49 PM
appears paradoxical. Why would a molecule need to be soluble in water, but also not soluble in water? The formation of a membrane shows the unique properties of such a structure. In water, the nonpolar tails of nearby lipid molecules aggregate away from the water, forming spherical micelles, with the tails facing inward (figure 3.30a). This is actually how detergent molecules work to make grease soluble in water. The grease is soluble within the nonpolar interior of the micelle and the polar surface of the micelle is soluble in water. With phospholipids, a more complex structure forms in which two layers of molecules line up, with the hydrophobic tails of each layer pointing toward one another, or inward, leaving the hydrophilic heads oriented outward, forming a bilayer (figure 3.30b). Lipid bilayers are the basic framework of biological membranes, discussed in detail in chapter 5.
Learning Outcomes Review 3.5 Triglycerides are made of fatty acids linked to glycerol. Fats can contain twice as many C—H bonds as carbohydrates and thus they store energy efficiently. Because the C—H bonds in lipids are nonpolar, they are not water-soluble and aggregate together in water. Phospholipids replace one fatty acid with a hydrophilic phosphate group. This allows them to spontaneously form bilayers, which are the basis of biological membranes. ■
Why do phospholipids form membranes while triglycerides form insoluble droplets?
Water Lipid head (hydrophilic) Lipid tail (hydrophobic)
a. Water
Water
b.
Figure 3.30 Lipids spontaneously form micelles or lipid bilayers in water. In an aqueous environment, lipid molecules orient so that their polar (hydrophilic) heads are in the polar medium, water, and their nonpolar (hydrophobic) tails are held away from the water. a. Droplets called micelles can form, or (b) phospholipid molecules can arrange themselves into two layers; in both structures, the hydrophilic heads extend outward and the hydrophobic tails inward. This second example is called a phospholipid bilayer.
Chapter Review 3.1
Carbon: The Framework of Biological Molecules
Carbon, the backbone of all biological molecules, can form four covalent bonds and make long chains. Hydrocarbons consist of carbon and hydrogen, and their bonds store considerable energy. Functional groups account for differences in molecular properties. Functional groups are small molecular entities that confer specific chemical characteristics when attached to a hydrocarbon. Carbon and hydrogen have similar electronegativity so C—H bonds are not polar. Oxygen and nitrogen have greater electronegativity, leading to polar bonds. Isomers have the same molecular formulas but different structures. Structural isomers are molecules with the same formula but different structures; stereoisomers differ in how groups are attached. Enantiomers are mirror-image stereoisomers. Biological macromolecules include carbohydrates, nucleic acids, proteins, and lipids. Most important biological macromolecules are polymers—long chains of monomer units. Biological polymers are formed by elimination of water (H and OH) from two monomers (dehydration reaction). They are broken down by adding water (hydrolysis). 56
part
3.2
Carbohydrates: Energy Storage and Structural Molecules
The empirical formula of a carbohydrate is (CH2O)n. Carbohydrates are used for energy storage and as structural molecules. Monosaccharides are simple sugars. Simple sugars contain three to six or more carbon atoms. Examples are glyceraldehyde (3 carbons), deoxyribose (5 carbons), and glucose (6 carbons). Sugar isomers have structural differences. The general formula for six-carbon sugars is C6H12O6, and many isomeric forms are possible. Living systems often have enzymes for converting isomers from one to the other. Disaccharides serve as transport molecules in plants and provide nutrition in animals. Plants convert glucose into the disaccharide sucrose for transport within their bodies. Female mammals produce the disaccharide lactose to nourish their young. Polysaccharides provide energy storage and structural components. Glucose is used to make three important polymers: glycogen (in animals), and starch and cellulose (in plants). Chitin is a related structural material found in arthropods and many fungi.
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 56
11/6/09 12:43:51 PM
3.3
Nucleic Acids: Information Molecules
Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are polymers composed of nucleotide monomers. Cells use nucleic acids for information storage and transfer. Nucleic acids are nucleotide polymers. Nucleic acids contain four different nucleotide bases. In DNA these are adenine, guanine, cytosine, and thymine. In RNA, thymine is replaced by uracil. DNA carries the genetic code. DNA exists as a double helix held together by specific base pairs: adenine with thymine and guanine with cytosine. The nucleic acid sequence constitutes the genetic code. RNA is a transcript of a DNA strand. RNA is made by copying DNA. This transcript is then used as a template to make proteins. Other nucleotides are vital components of energy reactions. Adenosine triphosphate (ATP) provides energy in cells; NAD+ and FAD transport electrons in cellular processes.
3.4
Proteins: Molecules with Diverse Structures and Functions
Most enzymes are proteins. Proteins also provide defense, transport, motion, and regulation, among many other roles. Proteins are polymers of amino acids. Amino acids are joined by peptide bonds to make polypeptides. The 20 common amino acids are characterized by R groups that determine their properties. Proteins have levels of structure. Protein structure is defined by the following hierarchy: primary (amino acid sequence), secondary (hydrogen bonding patterns), tertiary (three-dimensional folding), and quaternary (associations between two or more polypeptides).
Motifs and domains are additional structural characteristics. Motifs are similar structural elements found in dissimilar proteins. They can create folds, creases, or barrel shapes. Domains are functional subunits or sites within a tertiary structure. The process of folding relies on chaperone proteins. Chaperone proteins assist in the folding of proteins. Heat shock proteins are an example of chaperone proteins. Some diseases may result from improper folding. Some forms of cystic fibrosis and Alzheimer disease are associated with misfolded proteins. Denaturation inactivates proteins. Denaturation refers to an unfolding of tertiary structure, which usually destroys function. Some denatured proteins may recover function when conditions are returned to normal. This implies that primary structure strongly influences tertiary structure. Disassociation refers to separation of quaternary subunits with no changes to their tertiary structure.
3.5
Lipids: Hydrophobic Molecules
Lipids are insoluble in water because they have a high proportion of nonpolar C—H bonds. Fats consist of complex polymers of fatty acids attached to glycerol. Many lipids exist as triglycerides, three fatty acids connected to a glycerol molecule. Saturated fatty acids contain the maximum number of hydrogen atoms. Unsaturated fatty acids contain one or more double bonds between carbon atoms. Fats are excellent energy-storage molecules. The energy stored in the C—H bonds of fats is more than twice that of carbohydrates: 9 kcal/g compared with 4 kcal/g. For this reason, excess carbohydrate is converted to fat for storage. Phospholipids form membranes Phospholipids contain two fatty acids and one phosphate attached to glycerol. In phospholipid-bilayer membranes, the phosphate heads are hydrophilic and cluster on the two faces of the membrane, and the hydrophobic tails are in the center.
Review Questions U N D E R S TA N D 1. How is a polymer formed from multiple monomers? a. b. c. d.
From the growth of the chain of carbon atoms By the removal of an —OH group and a hydrogen atom By the addition of an —OH group and a hydrogen atom Through hydrogen bonding
2. Why are carbohydrates important molecules for energy storage? a. b. c. d.
The C—H bonds found in carbohydrates store energy. The double bonds between carbon and oxygen are very strong. The electronegativity of the oxygen atoms means that a carbohydrate is made up of many polar bonds. They can form ring structures in the aqueous environment of a cell.
www.ravenbiology.com
rav32223_ch03_033-058.indd 57
3. Plant cells store energy in the form of _________, and animal cells store energy in the form of ___________. a. b. c. d.
fructose; glucose disaccharides; monosaccharides cellulose; chitin starch; glycogen
4. Which carbohydrate would you find as part of a molecule of RNA? a. b. c. d.
Galactose Deoxyribose Ribose Glucose
5. A molecule of DNA or RNA is a polymer of a. b.
monosaccharides. nucleotides.
c. d. chapter
amino acids. fatty acids.
3 The Chemical Building Blocks of Life
57
11/6/09 12:43:53 PM
6. What makes cellulose different from starch? a. b. c. d.
Starch is produced by plant cells, and cellulose is produced by animal cells. Cellulose forms long filaments, and starch is highly branched. Starch is insoluble, and cellulose is soluble. All of the above.
7. What monomers make up a protein? a. b.
Monosaccharides Nucleotides
c. d.
Amino acids Fatty acids
8. A triglyceride is a form of _______ composed of ___________. a. b. c. d.
lipid; fatty acids and glucose lipid; fatty acids and glycerol carbohydrate; fatty acids lipid; cholesterol
A P P LY 1. Amino acids are linked together to form a protein by a. b. c. d.
phosphodiester bonds. β-(1→4) linkages. peptide bonds. hydrogen bonds.
2. Which of the following is NOT a difference between DNA and RNA? a. b. c. d.
Deoxyribose sugar versus ribose sugar Thymine versus uracil Double-stranded versus single-stranded Phosphodiester versus hydrogen bonds
3. Which part of an amino acid has the greatest influence on the overall structure of a protein? a. b. c. d.
The (—NH2) amino group The R group The (—COOH) carboxyl group Both a and c
c. d.
very different functions. the same primary structure but different function.
6. What chemical property of lipids accounts for their insolubility in water? a. b. c. d.
The COOH group of fatty acids The large number of nonpolar C—H bonds The branching of saturated fatty acids The C==C bonds found in unsaturated fatty acids
7. The spontaneous formation of a lipid bilayer in an aqueous environment occurs because a. b. c. d.
the polar head groups of the phospholipids can interact with water. the long fatty acid tails of the phospholipids can interact with water. the fatty acid tails of the phospholipids are hydrophobic. both a and c.
SYNTHESIZE 1. How do the four biological macromolecules differ from one another? How does the structure of each relate to its function? 2. Hydrogen bonds and hydrophobic interactions each play an important role in stabilizing and organizing biological macromolecules. Consider the four macromolecules discussed in this chapter. Describe how these affect the form and function of each type of macromolecule. Would a disruption in the hydrogen bonds affect form and function? Hydrophobic interactions? 3. Plants make both starch and cellulose. Would you predict that the enzymes involved in starch synthesis could also be used by the plant for cellulose synthesis? Construct an argument to explain this based on the structure and function of the enzymes and the polymers synthesized.
4. A mutation that alters a single amino acid within a protein can alter a. b. c. d.
the primary level of protein structure. the secondary level of protein structure. the tertiary level of protein structure. all of the above.
5. Two different proteins have the same domain in their structure. From this we can infer that they have
58
a. b.
the same primary structure. similar function.
part
I The Molecular Basis of Life
rav32223_ch03_033-058.indd 58
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
11/9/09 12:29:43 PM
CHAPTER
Chapter
4
Cell Structure
4.2
Prokaryotic Cells
4.3
Eukaryotic Cells
4.4
The Endomembrane System
4.5
Mitochondria and Chloroplasts: Cellular Generators
4.6
The Cytoskeleton
4.7
Extracellular Structures and Cell Movement
4.8
Cell-to-Cell Interactions
1.25 μm
A
Introduction
All organisms are composed of cells. The gossamer wing of a butterfly is a thin sheet of cells and so is the glistening outer layer of your eyes. The hamburger or tomato you eat is composed of cells, and its contents soon become part of your cells. Some organisms consist of a single cell too small to see with the unaided eye. Others, such as humans, are composed of many specialized cells, such as the fibroblast cell shown in the striking fluorescence micrograph on this page. Cells are so much a part of life that we cannot imagine an organism that is not cellular in nature. In this chapter, we take a close look at the internal structure of cells. In chapters 4 to 10, we will focus on cells in action—how they communicate with their environment, grow, and reproduce.
4.1
Cell Theory
Learning Outcomes 1. 2. 3.
Explain the cell theory. Describe the factors that limit cell size. Categorize structural and functional similarities in cells.
rav32223_ch04_059-087.indd 59
II
Cell Theory
Part
4.1
Biology of the Cell
Chapter Outline
Cells are characteristically microscopic in size. Although there are exceptions, a typical eukaryotic cell is 10 to 100 micrometers (μm) (10 to 100 millionths of a meter) in diameter, while most prokaryotic cells are only 1 to 10 μm in diameter. Because cells are so small, they were not discovered until the invention of the microscope in the 17th century. Robert Hooke was the first to observe cells in 1665, naming the shapes he saw in cork cellulae (Latin, “small rooms”). This is known to us as cells. Another early microscopist, Anton van Leeuwenhoek first observed living cells, which he termed “animalcules,” or little animals. After these early efforts, a century and a half
11/6/09 12:23:11 PM
passed before biologists fully recognized the importance of cells. In 1838, botanist Matthias Schleiden stated that all plants “are aggregates of fully individualized, independent, separate beings, namely the cells themselves.” In 1839, Theodor Schwann reported that all animal tissues also consist of individual cells. Thus, the cell theory was born.
Cell theory is the unifying foundation of cell biology The cell theory was proposed to explain the observation that all organisms are composed of cells. It sounds simple, but it is a far-reaching statement about the organization of life. In its modern form, the cell theory includes the following three principles: 1. All organisms are composed of one or more cells, and the life processes of metabolism and heredity occur within these cells. 2. Cells are the smallest living things, the basic units of organization of all organisms. 3. Cells arise only by division of a previously existing cell. Although life likely evolved spontaneously in the environment of early Earth, biologists have concluded that no additional cells are originating spontaneously at present. Rather, life on Earth represents a continuous line of descent from those early cells.
Cell size is limited Most cells are relatively small for reasons related to the diffusion of substances into and out of cells. The rate of diffusion is affected by a number of variables, including (1) surface area available for diffusion, (2) temperature, (3) concentration gradient of diffusing substance, and (4) the distance over which diffusion must occur. As the size of a cell increases, the length of time for diffusion from the outside membrane to the interior of the cell increases as well. Larger cells need to synthesize more macromolecules, have correspondingly higher energy requirements, and produce a greater quantity of waste. Molecules used for energy and biosynthesis must be transported through the membrane. Any metabolic waste produced must be removed, also passing through the membrane. The rate at which this transport occurs depends on both the distance to the membrane and the area of membrane available. For this reason, an organism made up of many relatively small cells has an advantage over one composed of fewer, larger cells. The advantage of small cell size is readily apparent in terms of the surface area-to-volume ratio. As a cell’s size increases, its volume increases much more rapidly than its surface area. For a spherical cell, the surface area is proportional to the square of the radius, whereas the volume is proportional to the cube of the radius. Thus, if the radii of two cells differ by a factor of 10, the larger cell will have 102, or 100 times, the surface area, but 103, or 1000 times, the volume of the smaller cell (figure 4.1). The cell surface provides the only opportunity for interaction with the environment, because all substances enter and exit a cell via this surface. The membrane surrounding the cell 60
part
Figure 4.1 Surface area-tovolume ratio. As a cell gets larger, its volume increases at a faster rate than its surface area. If the cell radius increases by 10 times, the surface area increases by 100 times, but the volume increases by 1000 times. A cell’s surface area must be large enough to meet the metabolic needs of its volume.
Cell radius (r)
1 unit
10 unit
Surface area (4pr 2)
12.57 unit2
1257 unit2
Volume (4–pr 3)
4.189 unit3
4189 unit3
3
0.3
3
Surface Area / Volume
plays a key role in controlling cell function. Because small cells have more surface area per unit of volume than large ones, control over cell contents is more effective when cells are relatively small. Although most cells are small, some quite large cells do exist. These cells have apparently overcome the surface areato-volume problem by one or more adaptive mechanisms. For example, some cells, such as skeletal muscle cells, have more than one nucleus, allowing genetic information to be spread around a large cell. Some other large cells, such as neurons, are long and skinny, so that any given point within the cell is close to the plasma membrane. This permits diffusion between the inside and outside of the cell to still be rapid.
Microscopes allow visualization of cells and components Other than egg cells, not many cells are visible to the naked eye (figure 4.2). Most are less than 50 μm in diameter, far smaller than the period at the end of this sentence. So, to visualize cells we need the aid of technology. The development of microscopes and their refinement over the centuries has allowed us to continually explore cells in greater detail.
The resolution problem How do we study cells if they are too small to see? The key is to understand why we can’t see them. The reason we can’t see such small objects is the limited resolution of the human eye. Resolution is the minimum distance two points can be apart and still be distinguished as two separate points. When two objects are closer together than about 100 μm, the light reflected from each strikes the same photoreceptor cell at the rear of the eye. Only when the objects are farther than 100 μm apart can the light from each strike different cells, allowing your eye to resolve them as two distinct objects rather than one.
II Biology of the Cell
rav32223_ch04_059-087.indd 60
11/6/09 12:23:18 PM
100 m
Types of microscopes 10 m
Human Eye
1m
Adult human
10 cm
Chicken egg 1 cm
1 mm
Frog egg Paramecium
Light Microscope
100 μm
10 μm
Human egg
Human red blood cell
Electron Microscope
Prokaryote
1 μm
100 nm
Chloroplast Mitochondrion
Large virus (HIV)
Ribosome 10 nm Protein
One way to overcome the limitations of our eyes is to increase magnification so that small objects appear larger. The first microscopists used glass lenses to magnify small cells and cause them to appear larger than the 100-μm limit imposed by the human eye. The glass lens increases focusing power. Because the glass lens makes the object appear closer, the image on the back of the eye is bigger than it would be without the lens. Modern light microscopes, which operate with visible light, use two magnifying lenses (and a variety of correcting lenses) to achieve very high magnification and clarity (table 4.1).The first lens focuses the image of the object on the second lens, which magnifies it again and focuses it on the back of the eye. Microscopes that magnify in stages using several lenses are called compound microscopes. They can resolve structures that are separated by at least 200 nanometers (nm). Light microscopes, even compound ones, are not powerful enough to resolve many of the structures within cells. For example, a cell membrane is only 5 nm thick. Why not just add another magnifying stage to the microscope to increase its resolving power? This doesn’t work because when two objects are closer than a few hundred nanometers, the light beams reflecting from the two images start to overlap each other. The only way two light beams can get closer together and still be resolved is if their wavelengths are shorter. One way to avoid overlap is by using a beam of electrons rather than a beam of light. Electrons have a much shorter wavelength, and an electron microscope, employing electron beams, has 1000 times the resolving power of a light microscope. Transmission electron microscopes, so called because the electrons used to visualize the specimens are transmitted through the material, are capable of resolving objects only 0.2 nm apart—which is only twice the diameter of a hydrogen atom! A second kind of electron microscope, the scanning electron microscope, beams electrons onto the surface of the specimen. The electrons reflected back from the surface, together with other electrons that the specimen itself emits as a result of the bombardment, are amplified and transmitted to a screen, where the image can be viewed and photographed. Scanning electron microscopy yields striking three-dimensional images. This technique has improved our understanding of many biological and physical phenomena (see table 4.1).
Using stains to view cell structure 1 nm
0.1 nm (1 Å)
Amino acid
Hydrogen atom
Logarithmic scale
Figure 4.2 The size of cells and their contents. Except for vertebrate eggs, which can typically be seen with the unaided eye, most cells are microscopic in size. Prokaryotic cells are generally 1 to 10 μm across. 1 m = 102 cm = 103 mm = 106 μm = 109 nm www.ravenbiology.com
rav32223_ch04_059-087.indd 61
Although resolution remains a physical limit, we can improve the images we see by altering the sample. Certain chemical stains increase the contrast between different cellular components. Structures within the cell absorb or exclude the stain differentially, producing contrast that aids resolution. Stains that bind to specific types of molecules have made these techniques even more powerful. This method uses antibodies that bind, for example, to a particular protein. This process, called immunohistochemistry, uses antibodies generated in animals such as rabbits or mice. When these animals are injected with specific proteins, they produce antibodies that bind to the injected protein. The antibodies are then purified and chemically bonded to enzymes, to stains, or to fluorescent molecules. When cells are incubated in a solution containing the antibodies, the antibodies chapter
4 Cell Structure
61
11/6/09 12:23:19 PM
L I G H T
bind to cellular structures that contain the target molecule and can be seen with light microscopy. This approach has been used extensively in the analysis of cell structure and function.
Microscopes
TA B L E 4 .1
M I C R O S C O P E S
Bright-field microscope: Light is transmitted through a specimen, giving little contrast. Staining specimens improves contrast but requires that cells be fixed (not alive), which can distort or alter components. Dark-field microscope: Light is directed at an angle toward the specimen. A condenser lens transmits only light reflected off the specimen. The field is dark, and the specimen is light against this dark background.
All cells exhibit basic structural similarities 28.4 μm
67.7 μm
Phase-contrast microscope: Components of the microscope bring light waves out of phase, which produces differences in contrast and brightness when the light waves recombine.
32.8 μm
Differential-interference–contrast microscope: Polarized light is split into two beams that have slightly different paths through the sample. Combining these two beams produces greater contrast, especially at the edges of structures.
26.6 μm
Fluorescence microscope: Fluorescent stains absorb light at one wavelength, then emit it at another. Filters transmit only the emitted light.
10.2 μm
Confocal microscope: Light from a laser is focused to a point and scanned across the fluorescently stained specimen in two directions. This produces clear images of one plane of the specimen. Other planes of the specimen are excluded to prevent the blurring of the image. Multiple planes can be used to reconstruct a 3-D image.
M I C R O S C O P E S
Transmission electron microscope: A beam of electrons is passed through the specimen. Electrons that pass through are used to expose film. Areas of the specimen that scatter electrons appear dark. False coloring enhances the image. Scanning electron microscope: An electron beam is scanned across the surface of the specimen, and electrons are knocked off the surface. Thus, the topography of the specimen determines the contrast and the content of the image. False coloring enhances the image.
62
part
Centrally located genetic material Every cell contains DNA, the hereditary molecule. In prokaryotes, the simplest organisms, most of the genetic material lies in a single circular molecule of DNA. It typically resides near the center of the cell in an area called the nucleoid. This area is not segregated, however, from the rest of the cell’s interior by membranes. By contrast, the DNA of eukaryotes, which are more complex organisms, is contained in the nucleus, which is surrounded by a double-membrane structure called the nuclear envelope. In both types of organisms, the DNA contains the genes that code for the proteins synthesized by the cell. (Details of nucleus structure are described later in the chapter.)
The cytoplasm A semifluid matrix called the cytoplasm fills the interior of the cell. The cytoplasm contains all of the sugars, amino acids, and proteins the cell uses to carry out its everyday activities. Although it is an aqueous medium, cytoplasm is more like jello than water due to the high concentration of proteins and other macromolecules. We call any discrete macromolecular structure in the cytoplasm specialized for a particular function an organelle. The part of the cytoplasm that contains organic molecules and ions in solution is called the cytosol to distinguish it from the larger organelles suspended in this fluid.
The plasma membrane 25.0 μm
E L E C T R O N
The general plan of cellular organization varies between different organisms, but despite these modifications, all cells resemble one another in certain fundamental ways. Before we begin a detailed examination of cell structure, let’s first summarize four major features all cells have in common: (1) a nucleoid or nucleus where genetic material is located, (2) cytoplasm, (3) ribosomes to synthesize proteins, and (4) a plasma membrane.
The plasma membrane encloses a cell and separates its contents from its surroundings. The plasma membrane is a phospholipid bilayer about 5 to 10 nm (5 to 10 billionths of a meter) thick, with proteins embedded in it. Viewed in cross section with the electron microscope, such membranes appear as two dark lines separated by a lighter area. This distinctive appearance arises from the tail-to-tail packing of the phospholipid molecules that make up the membrane (see chapter 5).
2.56 μm
Protein Plasma membrane
Cell interior 6.76 μm
0.054 μm
II Biology of the Cell
rav32223_ch04_059-087.indd 62
11/6/09 12:23:19 PM
The proteins of the plasma membrane are generally responsible for a cell’s ability to interact with the environment. Transport proteins help molecules and ions move across the plasma membrane, either from the environment to the interior of the cell or vice versa. Receptor proteins induce changes within the cell when they come in contact with specific molecules in the environment, such as hormones, or with molecules on the surface of neighboring cells. These molecules can function as markers that identify the cell as a particular type. This interaction between cell surface molecules is especially important in multicellular organisms, whose cells must be able to recognize one another as they form tissues. We’ll examine the structure and function of cell membranes more thoroughly in chapter 5.
Learning Outcomes Review 4.1 All organisms are single cells or aggregates of cells, and all cells arise from preexisting cells. Cell size is limited primarily by the efficiency of diffusion across the plasma membrane. As a cell becomes larger, its volume increases more quickly than its surface area. Past a certain point, diffusion cannot support the cell’s needs. All cells are bounded by a plasma membrane and filled with cytoplasm. The genetic material is found in the central portion of the cell; and in eukaryotic cells, it is contained in a membrane-bounded nucleus. ■
Would finding life on Mars change our view of cell theory?
4.2
Prokaryotic Cells
brane and are encased within a rigid cell wall. They have no distinct interior compartments (figure 4.3). A prokaryotic cell is like a one-room cabin in which eating, sleeping, and watching TV all occur. Prokaryotes are very important in the ecology of living organisms. Some harvest light by photosynthesis, others break down dead organisms and recycle their components. Still others cause disease or have uses in many important industrial processes. There are two main domains of prokaryotes: archaea and bacteria. Chapter 28 covers prokaryotic diversity in more detail. Although prokaryotic cells do contain organelles like ribosomes, which carry out protein synthesis, most lack the membrane-bounded organelles characteristic of eukaryotic cells. It was long thought that prokaryotes also lack the elaborate cytoskeleton found in eukaryotes, but we have now found they have molecules related to both actin and tubulin, which form two of the cytoskeletal elements described later in the chapter. The actin-like proteins form supporting fibrils near the surface of the cell, but the cytoplasm of a prokaryotic cell does not appear to have an extensive internal support structure. Consequently, the strength of the cell comes primarily from its rigid cell wall (see figure 4.3). The plasma membrane of a prokaryotic cell carries out some of the functions organelles perform in eukaryotic cells. For example, some photosynthetic bacteria, such as the
Pilus
Figure 4.3 Structure of a prokaryotic cell.
Learning Outcomes 1. 2.
Describe the organization of prokaryotic cells. Distinguish between bacterial and archaeal cell types.
Cytoplasm Ribosomes
When cells were visualized with microscopes, two basic cellular architectures were recognized: eukaryotic and prokaryotic. These terms refer to the presence or absence, respectively, of a membrane-bounded nucleus that contains genetic material. We have already mentioned that in addition to lacking a nucleus, prokaryotic cells do not have an internal membrane system or numerous membranebounded organelles.
Prokaryote cells have relatively simple organization
Nucleoid (DNA)
Plasma membrane Cell wall Capsule
Generalized cell organization of a prokaryote. The nucleoid is visible as a dense central region segregated from the cytoplasm. Some prokaryotes have hairlike growths (called pili [singular, pilus]) on the outside of the cell.
Pili
Flagellum
Prokaryotes are the simplest organisms. Prokaryotic cells are small. They consist of cytoplasm surrounded by a plasma memwww.ravenbiology.com
rav32223_ch04_059-087.indd 63
0.3 μm chapter
4 Cell Structure
63
11/6/09 12:23:26 PM
talized as they are in eukaryotic cells, and the whole prokaryote operates as a single unit.
Bacterial cell walls consist of peptidoglycan Nucleoid Cytoplasm
Cell wall Plasma membrane 0.6 μm Photosynthetic membranes
Figure 4.4 Electron micrograph of a photosynthetic bacterial cell. Extensive folded photosynthetic membranes are shown in green in this false color electron micrograph of a Prochloron cell.
?
Inquiry question What modifications would you include if you wanted to make a cell as large as possible?
cyanobacterium Prochloron (figure 4.4), have an extensively folded plasma membrane, with the folds extending into the cell’s interior. These membrane folds contain the bacterial pigments connected with photosynthesis. In eukaryotic plant cells, photosynthetic pigments are found in the inner membrane of the chloroplast. Because a prokaryotic cell contains no membrane-bounded organelles, the DNA, enzymes, and other cytoplasmic constituents have access to all parts of the cell. Reactions are not compartmen-
Most bacterial cells are encased by a strong cell wall. This cell wall is composed of peptidoglycan, which consists of a carbohydrate matrix (polymers of sugars) that is cross-linked by short polypeptide units. Details about the structure of this cell wall are discussed in chapter 28. Cell walls protect the cell, maintain its shape, and prevent excessive uptake or loss of water. The exception is the class Mollicutes, which includes the common genus Mycoplasma, which lack a cell wall. Plants, fungi, and most protists also have cell walls but with a chemical structure different from peptidoglycan. The susceptibility of bacteria to antibiotics often depends on the structure of their cell walls. The drugs penicillin and vancomycin, for example, interfere with the ability of bacteria to cross-link the peptides in their peptidoglycan cell wall. Like removing all the nails from a wooden house, this destroys the integrity of the structural matrix, which can no longer prevent water from rushing in and swelling the cell to bursting. Some bacteria also secrete a jelly-like protective capsule of polysaccharide around the cell. Many disease-causing bacteria have such a capsule, which enables them to adhere to teeth, skin, food—or to practically any surface that will support their growth.
Archaea lack peptidoglycan We are still learning about the physiology and structure of archaea. Many of these organisms are difficult to culture in the laboratory, and so this group has not yet been studied in detail. More is known about their genetic makeup than about any other feature. The cell walls of archaea are composed of various chemical compounds, including polysaccharides and proteins, and possibly even inorganic components. A common feature
Figure 4.5 Some prokaryotes move by rotating their flagella. a. The photograph shows Vibrio cholerae, the microbe that causes the serious disease cholera. b. The bacterial flagellum is a complex structure. The motor proteins, powered by a proton gradient, are anchored in the plasma membrane. Two rings are found in the cell wall. The motor proteins cause the entire structure to rotate. c. As the flagellum rotates it creates a spiral wave down the structure. This powers the cell forward.
0.5 μm
Hook
Filament Outer membrane Peptidoglycan portion of cell wall
Outer protein ring
Plasma membrane
Inner protein ring H+
a. 64
part
b.
H+
c.
II Biology of the Cell
rav32223_ch04_059-087.indd 64
11/6/09 12:23:29 PM
distinguishing archaea from bacteria is the nature of their membrane lipids. The chemical structure of archaeal lipids is distinctly different from that of lipids in bacteria and can include saturated hydrocarbons that are covalently attached to glycerol at both ends, such that their membrane is a monolayer. These features seem to confer greater thermal stability to archaeal membranes, although the tradeoff seems to be an inability to alter the degree of saturation of the hydrocarbons—meaning that archaea with this characteristic cannot adapt to changing environmental temperatures. The cellular machinery that replicates DNA and synthesized proteins in archaea is more closely related to eukaryotic systems than to bacterial systems. Even though they share a similar overall cellular architecture with prokaryotes, archaea appear to be more closely related on a molecular basis to eukaryotes.
Some prokaryotes move by means of rotating flagella Flagella (singular, flagellum) are long, threadlike structures protruding from the surface of a cell that are used in locomotion. Prokaryotic flagella are protein fibers that extend out from the cell. There may be one or more per cell, or none, depending on the species. Bacteria can swim at speeds of up to 70 cell lengths per second by rotating their flagella like screws (figure 4.5). The rotary motor uses the energy stored in a gradient that transfers protons across the plasma membrane to power the movement of the flagellum. Interestingly, the same principle, in which a proton gradient powers the rotation of a molecule, is used in eukaryotic mitochondria and chloroplasts by an enzyme that synthesizes ATP (see chapters 7 and 8).
Learning Outcomes Review 4.2 Prokaryotes are small cells that lack complex interior organization. The two domains of prokaryotes are archaea and bacteria. The cell wall of bacteria is composed of peptidoglycan, which is not found in archaea. Archaea have cell walls made from a variety of polysaccharides and peptides, as well as membranes containing unusual lipids. Some bacteria move using a rotating flagellum. ■
What features do bacteria and archaea share?
4.3
Eukaryotic Cells
Learning Outcomes 1. 2. 3.
Compare the organization of eukaryotic and prokaryotic cells. Discuss the role of the nucleus in eukaryotic cells. Describe the role of ribosomes in protein synthesis.
www.ravenbiology.com
rav32223_ch04_059-087.indd 65
Eukaryotic cells (figures 4.6 and 4.7) are far more complex than prokaryotic cells. The hallmark of the eukaryotic cell is compartmentalization. This is achieved through a combination of an extensive endomembrane system that weaves through the cell interior and by numerous organelles. These organelles include membrane-bounded structures that form compartments within which multiple biochemical processes can proceed simultaneously and independently. Plant cells often have a large, membrane-bounded sac called a central vacuole, which stores proteins, pigments, and waste materials. Both plant and animal cells contain vesicles— smaller sacs that store and transport a variety of materials. Inside the nucleus, the DNA is wound tightly around proteins and packaged into compact units called chromosomes. All eukaryotic cells are supported by an internal protein scaffold, the cytoskeleton. Although the cells of animals and some protists lack cell walls, the cells of fungi, plants, and many protists have strong cell walls composed of cellulose or chitin fibers embedded in a matrix of other polysaccharides and proteins. Through the rest of this chapter, we will examine the internal components of eukaryotic cells in more detail.
The nucleus acts as the information center The largest and most easily seen organelle within a eukaryotic cell is the nucleus (Latin, “kernel” or “nut”), first described by the botanist Robert Brown in 1831. Nuclei are roughly spherical in shape, and in animal cells, they are typically located in the central region of the cell (figure 4.8a). In some cells, a network of fine cytoplasmic filaments seems to cradle the nucleus in this position. The nucleus is the repository of the genetic information that enables the synthesis of nearly all proteins of a living eukaryotic cell. Most eukaryotic cells possess a single nucleus, although the cells of fungi and some other groups may have several to many nuclei. Mammalian erythrocytes (red blood cells) lose their nuclei when they mature. Many nuclei exhibit a dark-staining zone called the nucleolus, which is a region where intensive synthesis of ribosomal RNA is taking place.
The nuclear envelope The surface of the nucleus is bounded by two phospholipid bilayer membranes, which together make up the nuclear envelope (see figure 4.8). The outer membrane of the nuclear envelope is continuous with the cytoplasm’s interior membrane system, called the endoplasmic reticulum (described later). Scattered over the surface of the nuclear envelope are what appear as shallow depressions in the electron micrograph but are in fact structures called nuclear pores (see figure 4.8b, c). These pores form 50 to 80 nm apart at locations where the two membrane layers of the nuclear envelope pinch together. They have a complex structure with a cytoplasmic face, a nuclear face, and a central ring embedded in the membrane. The proteins that make up this nuclear pore complex are arranged in a circle with a large central hole. The complex allows small molecules to diffuse freely between nucleoplasm and cytoplasm while controlling the passage of proteins and RNA– protein complexes. Passage is restricted primarily to two kinds chapter
4 Cell Structure
65
11/6/09 12:23:30 PM
Figure 4.6 Structure of an animal cell. In this generalized diagram of an animal cell, the plasma membrane encases the cell, which contains the cytoskeleton and various cell organelles and interior structures suspended in a semifluid matrix called the cytoplasm. Some kinds of animal cells possess finger-like projections called microvilli. Other types of eukaryotic cells—for example, many protist cells—may possess flagella, which aid in movement, or cilia, which can have many different functions. Nucleus Ribosomes
Nuclear envelope
Rough endoplasmic reticulum
Nucleolus
Smooth endoplasmic reticulum
Nuclear pore Intermediate filament
Microvilli
Cytoskeleton Actin filament (microfilament) Microtubule Ribosomes
Intermediate filament
Centriole
Cytoplasm Lysosome
Exocytosis Vesicle
Golgi apparatus
Plasma membrane Peroxisome
66
part
Mitochondrion
II Biology of the Cell
rav32223_ch04_059-087.indd 66
11/6/09 12:23:31 PM
Figure 4.7 Structure of a plant cell. Most mature plant cells contain a large central vacuole, which occupies a major portion of the internal volume of the cell, and organelles called chloroplasts, within which photosynthesis takes place. The cells of plants, fungi, and some protists have cell walls, although the composition of the walls varies among the groups. Plant cells have cytoplasmic connections to one another through openings in the cell wall called plasmodesmata. Flagella occur in sperm of a few plant species, but are otherwise absent from plant and fungal cells. Centrioles are also usually absent.
Rough endoplasmic reticulum
Nucleus
Smooth endoplasmic reticulum
Nuclear envelope
Ribosome
Nuclear pore Nucleolus Intermediate filament Central vacuole Cytoskeleton Intermediate filament Microtubule Actin filament (microfilament) Peroxisome Mitochondrion
Golgi apparatus
Cytoplasm
Vesicle Chloroplast
Adjacent cell wall Cell wall Plasma membrane
www.ravenbiology.com
rav32223_ch04_059-087.indd 67
Plasmodesmata
chapter
4 Cell Structure
67
11/6/09 12:23:35 PM
of molecules: (1) proteins moving into the nucleus to be incorporated into nuclear structures or to catalyze nuclear activities and (2) RNA and RNA–protein complexes formed in the nucleus and exported to the cytoplasm. The inner surface of the nuclear envelope is covered with a network of fibers that make up the nuclear lamina (see figure 4.8d). This is composed of intermediate filament fibers called nuclear lamins. This structure gives the nucleus its shape and is also involved in the deconstruction and reconstruction of the nuclear envelope that accompanies cell division.
Nuclear pores Nuclear envelope Nucleolus Chromatin Nucleoplasm Nuclear lamina
Chromatin: DNA packaging In both prokaryotes and eukaryotes, DNA contains the hereditary information specifying cell structure and function. In most prokaryotes, the DNA is organized into a single circular chromosome. In eukaryotes, the DNA is divided into multiple linear chromosomes. The DNA in these chromosomes is organized with proteins into a complex structure called chromatin. Chromatin is usually in a more extended form that allows regulatory proteins to attach to specific nucleotide sequences along the DNA and regulate gene expression. Without this access, DNA could not direct the day-to-day activities of the cell. When cells divide, the chromatin must be further compacted into a more highly condensed form.
Inner membrane Outer membrane Nuclear pore
a. Nuclear pores Cytoplasm
The nucleolus: Ribosomal subunit manufacturing Before cells can synthesize proteins in large quantity, they must first construct a large number of ribosomes to carry out this synthesis. Hundreds of copies of the genes encoding the ribosomal RNAs are clustered together on the chromosome, facilitating ribsosome construction. By transcribing RNA molecules from this cluster, the cell rapidly generates large numbers of the molecules needed to produce ribosomes. The clusters of ribosomal RNA genes, the RNAs they produce, and the ribosomal proteins all come together within the nucleus during ribosome production. These ribosomal assembly areas are easily visible within the nucleus as one or more dark-staining regions called nucleoli (singular, nucleolus). Nucleoli can be seen under the light microscope even when the chromosomes are uncoiled.
Ribosomes are the cell’s protein synthesis machinery Although the DNA in a cell’s nucleus encodes the amino acid sequence of each protein in the cell, the proteins are not assembled there. A simple experiment demonstrates this: If a brief pulse of radioactive amino acid is administered to a cell, the radioactivity shows up associated with newly made protein in the cytoplasm, not in the nucleus. When investigators first carried out these experiments, they found that protein synthesis is associated with large RNA–protein complexes (called ribosomes) outside the nucleus. Ribosomes are among the most complex molecular assemblies found in cells. Each ribosome is composed of two
68
part
Pore
Nucleus
b.
0.1 μm
c.
d.
0.069 μm
1 μm
Figure 4.8 The nucleus. a. The nucleus is composed of a double membrane called the nuclear envelope, enclosing a fluid-filled interior containing chromatin. The individual nuclear pores extend through the two membrane layers of the envelope. b. A freeze-fracture electron micrograph (see figure 5.3) of a cell nucleus, showing many nuclear pores. c. A transmission electron micrograph of the nuclear membrane showing a single nuclear pore. The dark material within the pore is protein, which acts to control access through the pore. d. The nuclear lamina is visible as a dense network of fibers made of intermediate filaments. The nucleus has been colored purple in the micrographs. (b): © Dr. Richard Kessel & Dr. Gene Shih/Visuals Unlimited
II Biology of the Cell
rav32223_ch04_059-087.indd 68
11/6/09 12:23:38 PM
Large subunit
4.4
The Endomembrane System
Learning Outcomes Ribosome Small subunit
Figure 4.9 A ribosome. Ribosomes consist of a large and a small subunit composed of rRNA and protein. The individual subunits are synthesized in the nucleolus and then move through the nuclear pores to the cytoplasm, where they assemble to translate mRNA. Ribosomes serve as sites of protein synthesis.
subunits (figure 4.9), and each subunit is composed of a combination of RNA, called ribosomal RNA (rRNA), and proteins. The subunits join to form a functional ribosome only when they are actively synthesizing proteins. This complicated process requires the two other main forms of RNA: messenger RNA (mRNA), which carries coding information from DNA, and transfer RNA (tRNA), which carries amino acids. Ribosomes use the information in mRNA to direct the synthesis of a protein. This process will be described in more detail in chapter 15. Ribosomes are found either free in the cytoplasm or associated with internal membranes, as described in the following section. Free ribosomes synthesize proteins that are found in the cytoplasm, nuclear proteins, mitochondrial proteins, and proteins found in other organelles not derived from the endomembrane system. Membrane-associated ribosomes synthesize membrane proteins, proteins found in the endomembrane system, and proteins destined for export from the cell. Ribosomes can be thought of as “universal organelles” because they are found in all cell types from all three domains of life. As we build a picture of the minimal essential functions for cellular life, ribosomes will be on the short list. Life is protein-based, and ribosomes are the factories that make proteins.
Learning Outcomes Review 4.3 In contrast to prokaryotic cells, eukaryotic cells exhibit compartmentalization. Eukaryotic cells contain an endomembrane system and organelles that carry out specialized functions. The nucleus, composed of a double membrane connected to the endomembrane system, contains the cell’s genetic information. Material moves between the nucleus and cytoplasm through nuclear pores. Ribosomes translate mRNA, which is transcribed from DNA in the nucleus, into polypeptides that make up proteins. Ribosomes are a universal organelle found in all known cells. ■
Would you expect cells in different organs in complex animals to have the same structure?
www.ravenbiology.com
rav32223_ch04_059-087.indd 69
1. 2. 3.
Identify the different parts of the endomembrane system. Contrast the different functions of internal membranes and compartments. Evaluate the importance of each step in the protein processing pathway.
The interior of a eukaryotic cell is packed with membranes so thin that they are invisible under the low resolving power of light microscopes. This endomembrane system fills the cell, dividing it into compartments, channeling the passage of molecules through the interior of the cell, and providing surfaces for the synthesis of lipids and some proteins. The presence of these membranes in eukaryotic cells marks one of the fundamental distinctions between eukaryotes and prokaryotes. The largest of the internal membranes is called the endoplasmic reticulum (ER). Endoplasmic means “within the cytoplasm,” and reticulum is Latin for “a little net.” Like the plasma membrane, the ER is composed of a phospholipid bilayer embedded with proteins. It weaves in sheets through the interior of the cell, creating a series of channels between its folds (figure 4.10). Of the many compartments in eukaryotic cells, the two largest are the inner region of the ER, called the cisternal space or lumen, and the region exterior to it, the cytosol, which is the fluid component of the cytoplasm containing dissolved organic molecules such as proteins and ions.
The rough ER is a site of protein synthesis The rough ER (RER) gets its name from its surface appearance, which is pebbly due to the presence of ribosomes. The RER is not easily visible with a light microscope, but it can be seen using the electron microscope. It appears to be composed of flattened sacs, the surfaces of which are bumpy with ribosomes (see figure 4.10). The proteins synthesized on the surface of the RER are destined to be exported from the cell, sent to lysosomes or vacuoles (described in a later section), or embedded in the plasma membrane. These proteins enter the cisternal space as a first step in the pathway that will sort proteins to their eventual destinations. This pathway also involves vesicles and the Golgi apparatus, described later. The sequence of the protein being synthesized determines whether the ribosome will become associated with the ER or remain a cytoplasmic ribosome. In the ER, newly synthesized proteins can be modified by the addition of short-chain carbohydrates to form glycoproteins. Those proteins destined for secretion are separated from other products and later packaged into vesicles. The ER also manufactures membranes by producing membrane proteins and phospholipid molecules. The membrane
chapter
4 Cell Structure
69
11/6/09 12:23:43 PM
Ribosomes Rough endoplasmic reticulum
The Golgi apparatus sorts and packages proteins
Figure 4.10 The endoplasmic reticulum. Rough ER (RER), blue in the drawing, is composed more of flattened sacs and forms a compartment throughout the cytoplasm. Ribosomes associated with the cytoplasmic face of the RER extrude newly made proteins into the interior, or lumen. The smooth ER (SER), green in the drawing, is a more tubelike structure connected to the RER. The micrograph has been colored to match the drawing.
remove them. Liver cells have extensive SER as well as enzymes that can process a variety of substances by chemically modifying them.
Smooth endoplasmic reticulum
Rough endoplasmic reticulum
Smooth endoplasmic reticulum 0.08 μm
proteins are inserted into the ER’s own membrane, which can then expand and pinch off in the form of vesicles to be transferred to other locations.
Flattened stacks of membranes, often interconnected with one another, form a complex called the Golgi body. These structures are named for Camillo Golgi, the 19th-century physician who first identified them. The number of stacked membranes within the Golgi body ranges from 1 or a few in protists, to 20 or more in animal cells and to several hundred in plant cells. They are especially abundant in glandular cells, which manufacture and secrete substances. The Golgi body is often referred to as the Golgi apparatus (figure 4.11). The Golgi apparatus functions in the collection, packaging, and distribution of molecules synthesized at one location and used at another within the cell or even outside of it. A Golgi body has a front and a back, with distinctly different membrane compositions at these opposite ends. The front, or receiving end, is called the cis face and is usually located near ER. Materials move to the cis face in transport vesicles that bud off the ER. These vesicles fuse with the cis face, emptying their contents into the interior, or lumen, of the Golgi apparatus. The ERsynthesized molecules then pass through the channels of the Golgi apparatus until they reach the back, or discharging end,
The smooth ER has multiple roles Regions of the ER with relatively few bound ribosomes are referred to as smooth ER (SER). The SER appears more like a network of tubules than the flattened sacs of the RER. The membranes of the SER contain many embedded enzymes. Enzymes anchored within the ER, for example, catalyze the synthesis of a variety of carbohydrates and lipids. Steroid hormones are synthesized in the SER as well. The majority of membrane lipids are assembled in the SER and then sent to whatever parts of the cell need membrane components. The SER is used to store Ca2+ in cells. This keeps the cytoplasmic level low, allowing Ca2+ to be used as a signaling molecule. In muscle cells, for example, Ca2+ is used to trigger muscle contraction. In other cells, Ca2+ release from SER stores is involved in diverse signaling pathways. The ratio of SER to RER depends on a cell’s function. In multicellular animals such as ourselves, great variation exists in this ratio. Cells that carry out extensive lipid synthesis, such as those in the testes, intestine, and brain, have abundant SER. Cells that synthesize proteins that are secreted, such as antibodies, have much more extensive RER. Another role of the SER is the modification of foreign substances to make them less toxic. In the liver, the enzymes of the SER carry out this detoxification. This action can include neutralizing substances that we have taken for a therapeutic reason, such as penicillin. Thus, relatively high doses are prescribed for some drugs to offset our body’s efforts to 70
part
Transport vesicle
cis face
Fusing vesicle
Forming vesicle trans face Secretory vesicle
0.9 μm
Figure 4.11 The Golgi apparatus. The Golgi apparatus is a smooth, concave, membranous structure. It receives material for processing in transport vesicles on the cis face and sends the material packaged in transport or secretory vesicles off the trans face. The substance in a vesicle could be for export out of the cell or for distribution to another region within the same cell.
II Biology of the Cell
rav32223_ch04_059-087.indd 70
11/6/09 12:23:44 PM
called the trans face, where they are discharged in secretory vesicles (figure 4.12). Proteins and lipids manufactured on the rough and smooth ER membranes are transported into the Golgi apparatus and modified as they pass through it. The most common alteration is the addition or modification of short sugar chains, forming glycoproteins and glycolipids. In many instances, enzymes in the Golgi apparatus modify existing glycoproteins and glycolipids made in the ER by cleaving a sugar from a chain or by modifying one or more of the sugars. The newly formed or altered glycoproteins and glycolipids collect at the ends of the Golgi bodies in flattened, stacked membrane folds called cisternae (Latin, “collecting vessels”). Periodically, the membranes of the cisternae push together, pinching off small, membrane-bounded secretory vesicles containing the glycoprotein and glycolipid molecules. These vesicles then diffuse to other locations in the cell, distributing the newly synthesized molecules to their appropriate destinations. Another function of the Golgi apparatus is the synthesis of cell wall components. Noncellulose polysaccharides that form part of the cell wall of plants are synthesized in the Golgi apparatus and sent to the plasma membrane where they can be added to the cellulose that is assembled on the exterior of the cell. Other polysaccharides secreted by plants are also synthesized in the Golgi apparatus.
Nucleus Nuclear pore
Ribosome
Rough endoplasmic reticulum Membrane protein Newly synthesized protein 1. Vesicle containing proteins buds from the rough endoplasmic reticulum, diffuses through the cell, and fuses to the cis face of the Golgi apparatus.
Transport vesicle
cis face
Golgi membrane protein
Lysosomes contain digestive enzymes Membrane-bounded digestive vesicles, called lysosomes, are also components of the endomembrane system. They arise from the Golgi apparatus. They contain high levels of degrading enzymes, which catalyze the rapid breakdown of proteins, nucleic acids, lipids, and carbohydrates. Throughout the lives of eukaryotic cells, lysosomal enzymes break down old organelles and recycle their component molecules. This makes room for newly formed organelles. For example, mitochondria are replaced in some tissues every 10 days. The digestive enzymes in the lysosome are optimally active at acid pH. Lysosomes are activated by fusing with a food vesicle produced by phagocytosis (a specific type of endocytosis; see chapter 5) or by fusing with an old or worn-out organelle. The fusion event activates proton pumps in the lysosomal membrane, resulting in a lower internal pH. As the interior pH falls, the arsenal of digestive enzymes contained in the lysosome is activated. This leads to the degradation of macromolecules in the food vesicle or the destruction of the old organelle. A number of human genetic disorders, collectively called lysosomal storage disorders, affect lysosomes. For example, the genetic abnormality called Tay–Sachs disease is caused by the loss of function of a single lysosomal enzyme. This enzyme is necessary to break down a membrane glycolipid found in nerve cells. Accumulation of glycolipid in lysosomes affects nerve cell function, leading to a variety of clinical symptoms such as seizures and muscle rigidity. In addition to breaking down organelles and other structures within cells, lysosomes eliminate other cells that www.ravenbiology.com
rav32223_ch04_059-087.indd 71
Smooth endoplasmic reticulum
Cisternae
Golgi Apparatus trans face 2. The proteins are modified and packaged into vesicles for transport.
Secretory vesicle
Secreted protein
Cell membrane
3. The vesicle may travel to the plasma membrane, releasing its contents to the extracellular environment.
Extracellular fluid
Figure 4.12 Protein transport through the endomembrane system. Proteins synthesized by ribosomes on the RER are translocated into the internal compartment of the ER. These proteins may be used at a distant location within the cell or secreted from the cell. They are transported within vesicles that bud off the rough ER. These transport vesicles travel to the cis face of the Golgi apparatus. There they can be modified and packaged into vesicles that bud off the trans face of the Golgi apparatus. Vesicles leaving the trans face transport proteins to other locations in the cell, or fuse with the plasma membrane, releasing their contents to the extracellular environment. chapter
4 Cell Structure
71
11/6/09 12:23:47 PM
the cell has engulfed by phagocytosis. When a white blood cell, for example, phagocytizes a passing pathogen, lysosomes fuse with the resulting “food vesicle,” releasing their enzymes into the vesicle and degrading the material within (figure 4.13).
Nucleus Nuclear pore Ribosome
Rough endoplasmic reticulum
Membrane protein Hydrolytic enzyme
Transport vesicle cis face
Golgi membrane protein Smooth endoplasmic reticulum
Microbodies are a diverse category of organelles Eukaryotic cells contain a variety of enzyme-bearing, membraneenclosed vesicles called microbodies. These are found in the cells of plants, animals, fungi, and protists. The distribution of enzymes into microbodies is one of the principal ways eukaryotic cells organize their metabolism.
Peroxisomes: Peroxide utilization An important type of microbody is the peroxisome (figure 4.14), which contains enzymes involved in the oxidation of fatty acids. If these oxidative enzymes were not isolated within microbodies, they would tend to short-circuit the metabolism of the cytoplasm, which often involves adding hydrogen atoms to oxygen. Because many peroxisomal proteins are synthesized by cytoplasmic ribosomes, the organelles themselves were long thought to form by the addition of lipids and proteins, leading to growth. As they grow larger, they divide to produce new peroxisomes. Although division of peroxisomes still appears to occur, it is now clear that peroxisomes can form from the fusion of ER-derived vesicles. These vesicles then import peroxisomal proteins to form a mature peroxisome. Genetic screens have isolated some 32 genes that encode proteins involved in biogenesis and maintenance of peroxisomes. The human genetic diseases called peroxisome biogenesis disorders (PBDs) appear to be caused by mutations in some of these genes. Peroxisomes get their name from the hydrogen peroxide produced as a by-product of the activities of oxidative enzymes. Hydrogen peroxide is dangerous to cells because of its violent
Cisternae
Golgi Apparatus
trans face
Lysosome
Old or damaged organelle
Lysosome
Digestion
Food vesicle
Breakdown of organelle Phagocytosis Lysosome aiding in the breakdown of an old organelle
Lysosome aiding in the digestion of phagocytized particles
0.21 μm
Figure 4.14 A peroxisome. Peroxisomes are spherical Figure 4.13 Lysosomes. Lysosomes are formed from vesicles budding off the Golgi. They contain hydrolytic enzymes that digest particles or cells taken into the cell by phagocytosis, and break down old organelles. 72
part
organelles that may contain a large crystal structure composed of protein. Peroxisomes contain digestive and detoxifying enzymes that produce hydrogen peroxide as a by-product. A peroxisome has been colored green in the electron micrograph.
II Biology of the Cell
rav32223_ch04_059-087.indd 72
11/6/09 12:23:51 PM
chemical reactivity. However, peroxisomes also contain the enzyme catalase, which breaks down hydrogen peroxide into its harmless constituents—water and oxygen.
Plants use vacuoles for storage and water balance Plant cells have specialized membrane-bounded structures called vacuoles. The most conspicuous example is the large central vacuole seen in most plant cells (figure 4.15). In fact, vacuole actually means blank space, referring to its appearance in the light microscope. The membrane surrounding this vacuole is called the tonoplast because it contains channels for water that are used to help the cell maintain its tonicity, or osmotic balance (see osmosis in chapter 5). For many years biologists assumed that only one type of vacuole existed and that it served multiple functions. The functions assigned to this vacuole included water balance and storage of both useful molecules (such as sugars, ions and pigments) and waste products. The vacuole was also thought to store enzymes involved in the breakdown of macromolecules and those used in detoxifying foreign substances. Old textbooks of plant physiology referred to vacuoles as the attic of the cell for the variety of substances thought to be stored there. Studies of tonoplast transporters and the isolation of vacuoles from a variety of cell types have led to a more complex view of vacuoles. These studies have made it clear that different vacuolar types can be found in different cells. These vacuoles are specialized, depending on the function of the cell. The central vacuole is clearly important for a number of roles in all plant cells. The central vacuole and the water
channels of the tonoplast maintain the tonicity of the cell, allowing the cell to expand and contract depending on conditions. The central vacuole is also involved in cell growth by occupying most of the volume of the cell. Plant cells grow by expanding the vacuole, rather than by increasing cytoplasmic volume. Vacuoles with a variety of functions are also found in some types of fungi and protists. One form is the contractile vacuole, found in some protists, which can pump water and is used to maintain water balance in the cell. Other vacuoles are used for storage or to segregate toxic materials from the rest of the cytoplasm. The number and kind of vacuoles found in a cell depends on the needs of the particular cell type.
Learning Outcomes Review 4.4 The endoplasmic reticulum (ER) is an extensive system of folded membranes that spatially organize the cell’s biosynthetic activities. Smooth ER (SER) is the site of lipid and membrane synthesis and is used to store Ca2+. Rough ER (RER) is covered with ribosomes and is a site of protein synthesis. Proteins from the RER are transported by vesicles to the Golgi apparatus where they are modified, packaged, and distributed to their final location. Lysosomes are vesicles that contain digestive enzymes used to degrade materials such as invaders or worn-out components. Peroxisomes carry out oxidative metabolism that generates peroxides. Vacuoles are membrane-bounded structures that have roles ranging from storage to cell growth in plants. They are also found in some fungi and protists. ■
How do ribosomes on the RER differ from cytoplasmic ribosomes?
4.5 Nucleus
Central vacuole
Learning Outcomes
Chloroplast
1. 2. 3.
Tonoplast
Cell wall 0.9 μm
Figure 4.15 The central vacuole. A plant’s central vacuole stores dissolved substances and can expand in size to increase the tonicity of a plant cell. Micrograph shown with false color. www.ravenbiology.com
rav32223_ch04_059-087.indd 73
Mitochondria and Chloroplasts: Cellular Generators
Describe the structure of mitochondria and chloroplasts. Compare the function of mitochondria and chloroplasts. Explain the probable origin of mitochondria and chloroplasts.
Mitochondria and chloroplasts share structural and functional similarities. Structurally, they are both surrounded by a double membrane, and both contain their own DNA and protein synthesis machinery. Functionally, they are both involved in energy metabolism, as we will explore in detail in later chapters on energy metabolism and photosynthesis. chapter
4 Cell Structure
73
11/6/09 12:23:56 PM
Ribosome Matrix DNA Crista
Intermembrane space Inner membrane Outer membrane
0.2 μm
Figure 4.16 Mitochondria. The inner membrane of a mitochondrion is shaped into folds called cristae that greatly increase the surface area for oxidative metabolism. A mitochondrion in cross section and cut lengthwise is shown colored red in the micrograph.
Mitochondria metabolize sugar to generate ATP Mitochondria (singular, mitochondrion) are typically tubular or sausage-shaped organelles about the size of bacteria that are found in all types of eukaryotic cells (figure 4.16). Mitochondria are bounded by two membranes: a smooth outer membrane, and an inner folded membrane with numerous contiguous layers called cristae (singular, crista). The cristae partition the mitochondrion into two compartments: a matrix, lying inside the inner membrane; and an outer compartment, or intermembrane space, lying between the two mitochondrial membranes. On the surface of the inner membrane, and also embedded within it, are proteins that carry out oxidative metabolism, the oxygen-requiring process by which energy in macromolecules is used to produce ATP (chapter 7). Mitochondria have their own DNA; this DNA contains several genes that produce proteins essential to the mitochondrion’s role in oxidative metabolism. Thus, the mitochondrion, in many respects, acts as a cell within a cell, containing its own genetic information specifying proteins for its unique functions. The mitochondria are not fully autonomous, however, because most of the genes that encode the enzymes used in oxidative metabolism are located in the cell nucleus. A eukaryotic cell does not produce brand-new mitochondria each time the cell divides. Instead, the mitochondria themselves divide in two, doubling in number, and these are partitioned between the new cells. Most of the components required for mitochondrial division are encoded by genes in the nucleus and are translated into proteins by cytoplasmic ribosomes. Mitochondrial replication is, therefore, impossible without nuclear participation, and mitochondria thus cannot be grown in a cell-free culture. 74
part
Chloroplasts use light to generate ATP and sugars Plant cells and cells of other eukaryotic organisms that carry out photosynthesis typically contain from one to several hundred chloroplasts. Chloroplasts bestow an obvious advantage on the organisms that possess them: They can manufacture their own food. Chloroplasts contain the photosynthetic pigment chlorophyll that gives most plants their green color. The chloroplast, like the mitochondrion, is surrounded by two membranes (figure 4.17). However, chloroplasts are larger and more complex than mitochondria. In addition to the outer and inner membranes, which lie in close association with each other, chloroplasts have closed compartments of stacked membranes called grana (singular, granum), which lie inside the inner membrane. A chloroplast may contain a hundred or more grana, and each granum may contain from a few to several dozen diskshaped structures called thylakoids. On the surface of the thylakoids are the light-capturing photosynthetic pigments, to be discussed in depth in chapter 8. Surrounding the thylakoid is a fluid matrix called the stroma. The enzymes used to synthesize glucose during photosynthesis are found in the stroma. Like mitochondria, chloroplasts contain DNA, but many of the genes that specify chloroplast components are also located in the nucleus. Some of the elements used in photosynthesis, including the specific protein components necessary to accomplish the reaction, are synthesized entirely within the chloroplast.
Ribosome
DNA
Thylakoid membrane Outer membrane Inner membrane Thylakoid disk
Granum
Stroma
Stroma Granum
1.5 μm
Figure 4.17 Chloroplast structure. The inner membrane of a chloroplast surrounds a membrane system of stacks of closed chlorophyll-containing vesicles called thylakoids, within which photosynthesis occurs. Thylakoids are typically stacked one on top of the other in columns called grana. The chloroplast has been colored green in the micrograph.
II Biology of the Cell
rav32223_ch04_059-087.indd 74
11/6/09 12:23:57 PM
Other DNA-containing organelles in plants, called leucoplasts, lack pigment and a complex internal structure. In root cells and some other plant cells, leucoplasts may serve as starch storage sites. A leucoplast that stores starch (amylose) is sometimes termed an amyloplast. These organelles—chloroplasts, leucoplasts, and amyloplasts—are collectively called plastids. All plastids are produced by the division of existing plastids.
?
Inquiry question Mitochondria and chloroplasts both generate ATP. What structural features do they share?
Mitochondria and chloroplasts arose by endosymbiosis
were each free-living. One cell, a prokaryote, was engulfed by and became part of another cell, which was the precursor of modern eukaryotes (figure 4.18). According to the endosymbiont theory, the engulfed prokaryotes provided their hosts with certain advantages associated with their special metabolic abilities. Two key eukaryotic organelles are believed to be the descendants of these endosymbiotic prokaryotes: mitochondria, which are thought to have originated as bacteria capable of carrying out oxidative metabolism, and chloroplasts, which apparently arose from photosynthetic bacteria. This is discussed in detail in chapter 29.
Learning Outcomes Review 4.5
Symbiosis is a close relationship between organisms of different species that live together. As noted in chapter 29, the theory of endosymbiosis proposes that some of today’s eukaryotic organelles evolved by a symbiosis arising between two cells that
Mitochondria and chloroplasts have similar structures, with an outer membrane and an extensive inner membrane compartment. Both mitochondria and chloroplasts have their own DNA, but both also depend on nuclear genes for some functions. Mitochondria and chloroplasts are both involved in energy conversion: Mitochondria metabolize sugar to produce ATP, whereas chloroplasts harness light energy to produce ATP and synthesize sugars. Endosymbiosis theory proposes that both mitochondria and chloroplasts arose as prokaryotic cells engulfed by a eukaryotic precursor.
Nucleus
■
Many proteins in mitochondria and chloroplasts are encoded by nuclear genes. In light of the endosymbiont hypothesis, how might this come about?
Unknown Archaeon
Mitochondrion Protobacterium Chloroplast Cyanobacterium Modern Eukaryote
4.6
The Cytoskeleton
Learning Outcomes 1.
Unknown Bacterium Nucleus
2.
Contrast the structure and function of different fibers in the cytoskeleton. Illustrate the role of microtubules in intracellular transport.
Unknown Archaeon Mitochondrion
Protobacterium
Cyanobacterium
Chloroplast
Modern Eukaryote
Figure 4.18 Possible origins of eukaryotic cells. Both mitochondria and chloroplasts are thought to have arisen by endosymbiosis where a free-living cell is taken up but not digested. The nature of the engulfing cell is unknown. Two possibilities are The engulfing cell (top) is an archaeon that gave rise to the nuclear genome and cytoplasmic contents. The engulfing cell (bottom) consists of a nucleus derived from an archaeon in a bacterial cell. This could arise by a fusion event or by engulfment of the archaeon by the bacterium. www.ravenbiology.com
rav32223_ch04_059-087.indd 75
The cytoplasm of all eukaryotic cells is crisscrossed by a network of protein fibers that supports the shape of the cell and anchors organelles to fixed locations. This network, called the cytoskeleton, is a dynamic system, constantly assembling and disassembling. Individual fibers consist of polymers of identical protein subunits that attract one another and spontaneously assemble into long chains. Fibers disassemble in the same way, as one subunit after another breaks away from one end of the chain.
Three types of fibers compose the cytoskeleton Eukaryotic cells may contain the following three types of cytoskeletal fibers, each formed from a different kind of subunit: (1) actin filaments, sometimes called microfilaments, (2) microtubules, and (3) intermediate filaments. chapter
4 Cell Structure
75
11/6/09 12:24:01 PM
Actin filaments (microfilaments) Actin filaments are long fibers about 7 nm in diameter. Each filament is composed of two protein chains loosely twined together like two strands of pearls (figure 4.19). Each “pearl,” or subunit, on the chain is the globular protein actin. Actin filaments exhibit polarity, that is, they have plus (+) and minus (–) ends. These designate the direction of growth of the filaments.
Actin molecules spontaneously form these filaments, even in a test tube. Cells regulate the rate of actin polymerization through other proteins that act as switches, turning on polymerization when appropriate. Actin filaments are responsible for cellular movements such as contraction, crawling, “pinching” during division, and formation of cellular extensions.
Microtubule
Microtubule
Intermediate filament Actin filament Cell membrane
a. Actin filaments
b. Microtubules
c. Intermediate filament
Microtubules, the largest of the cytoskeletal elements, are hollow tubes about 25 nm in diameter, each composed of a ring of 13 protein protofilaments (see figure 4.19). Globular proteins consisting of dimers of α- and β-tubulin subunits polymerize to form the 13 protofilaments. The protofilaments are arrayed side by side around a central core, giving the microtubule its characteristic tube shape. In many cells, microtubules form from nucleation centers near the center of the cell and radiate toward the periphery. They are in a constant state of flux, continually polymerizing and depolymerizing. The average half-life of a microtubule ranges from as long as 10 minutes in a nondividing animal cell to as short as 20 seconds in a dividing animal cell. The ends of the microtubule are designated as plus (+) (away from the nucleation center) or minus (–) (toward the nucleation center). Along with facilitating cellular movement, microtubules organize the cytoplasm and are responsible for moving materials within the cell itself, as described shortly.
Intermediate filaments The most durable element of the cytoskeleton in animal cells is a system of tough, fibrous protein molecules twined together in an overlapping arrangement (see figure 4.19). These intermediate filaments are characteristically 8 to 10 nm in diameter—between the size of actin filaments and microtubules. Once formed, intermediate filaments are stable and usually do not break down. Intermediate filaments constitute a mixed group of cytoskeletal fibers. The most common type, composed of protein subunits called vimentin, provides structural stability for many kinds of cells. Keratin, another class of intermediate filament, is found in epithelial cells (cells that line organs and body cavities) and associated structures such as hair and fingernails. The intermediate filaments of nerve cells are called neurofilaments.
Figure 4.19 Molecules that make up the cytoskeleton. a. Actin filaments: Actin filaments, also called microfilaments, are made of two strands of the globular protein actin twisted together. They are often found in bundles or in a branching network. Actin filaments in many cells are concentrated below the plasma membrane in bundles known as stress fibers, which may have a contractile function. b. Microtubules: Microtubules are composed of α- and β-tubulin protein subunits arranged side by side to form a tube. Microtubules are comparatively stiff cytoskeletal elements and have many functions in the cell including intracellular transport and the separation of chromosomes during mitosis. c. Intermediate filaments: Intermediate filaments are composed of overlapping staggered tetramers of protein. These tetramers are then bundled into cables. This molecular arrangement allows for a ropelike structure that imparts tremendous mechanical strength to the cell. 76
part
Centrosomes are microtubuleorganizing centers Centrioles are barrel-shaped organelles found in the cells of animals and most protists. They occur in pairs, usually located at right angles to each other near the nuclear membranes (figure 4.20). The region surrounding the pair in almost all animal cells is referred to as a centrosome. Surrounding the centrioles in the centrosome is the pericentriolar material, which contains ring-shaped structures composed of tubulin. The pericentriolar material can nucleate the assembly of microtubules in animal cells. Structures with this function are called microtubule-organizing centers. The centrosome is also responsible for the reorganization of microtubules that occurs during
II Biology of the Cell
rav32223_ch04_059-087.indd 76
11/6/09 12:24:02 PM
Vesicle
Dynactin complex
Dynein
Microtubule triplet
Figure 4.20 Centrioles. Each centriole is composed of nine triplets of microtubules. Centrioles are usually not found in plant cells. In animal cells they help to organize microtubules. cell division. The centrosomes of plants and fungi lack centrioles, but still contain microtubule-organizing centers. You will learn more about the actions of the centrosomes when we describe the process of cell division in chapter 10.
The cytoskeleton helps move materials within cells Actin filaments and microtubules often orchestrate their activities to affect cellular processes. For example, during cell reproduction (see chapter 10), newly replicated chromosomes move to opposite sides of a dividing cell because they are attached to shortening microtubules. Then, in animal cells, a belt of actin pinches the cell in two by contracting like a purse string. Muscle cells also use actin filaments, which slide along filaments of the motor protein myosin when a muscle contracts. The fluttering of an eyelash, the flight of an eagle, and the awkward crawling of a baby all depend on these cytoskeletal movements within muscle cells. Not only is the cytoskeleton responsible for the cell’s shape and movement, but it also provides a scaffold that holds certain enzymes and other macromolecules in defined areas of the cytoplasm. For example, many of the enzymes involved in cell metabolism bind to actin filaments, as do ribosomes. By moving and anchoring particular enzymes near one another, the cytoskeleton, like the endoplasmic reticulum, helps organize the cell’s activities.
Microtubule
Figure 4.21 Molecular motors. Vesicles can be transported along microtubules using motor proteins that use ATP to generate force. The vesicles are attached to motor proteins by connector molecules, such as the dynactin complex shown here. The motor protein dynein moves the connected vesicle along microtubules.
The direction a vesicle is moved depends on the type of motor protein involved and the fact that microtubules are organized with their plus ends toward the periphery of the cell. In one case, a protein called kinectin binds vesicles to the motor protein kinesin. Kinesin uses ATP to power its movement toward the cell periphery, dragging the vesicle with it as it travels along the microtubule toward the plus end (figure 4.22). As nature’s tiniest motors, these proteins pull the transport vesicles along the microtubular tracks. Another set of vesicle proteins, called the dynactin complex, binds vesicles to the motor protein dynein (see figure 4.22), which directs movement in the opposite SCIENTIFIC THINKING Hypothesis: Kinesin molecules can act as molecular motors and move along microtubules using energy from ATP. Test: A microscope slide is covered with purified kinesin. Purified microtubules are added in a buffer containing ATP. The microtubules are monitored under a microscope using a video recorder to capture any movement.
Molecular motors All eukaryotic cells must move materials from one place to another in the cytoplasm. One way cells do this is by using the channels of the endoplasmic reticulum as an intracellular highway. Material can also be moved using vesicles loaded with cargo that can move along the cytoskeleton like a railroad track. For example, in a nerve cell with an axon that may extend far from the cell body, vesicles can be moved along tracks of microtubules from the cell body to the end of the axon. Four components are required to move material along microtubules: (1) a vesicle or organelle that is to be transported, (2) a motor protein that provides the energy-driven motion, (3) a connector molecule that connects the vesicle to the motor molecule, and (4) microtubules on which the vesicle will ride like a train on a rail (figure 4.21). www.ravenbiology.com
rav32223_ch04_059-087.indd 77
Frame 1
Frame 2
Frame 3
Result: Over time, the movement of individual microtubules can be observed in the microscope. This is shown schematically in the figure by the movement of specific microtubules shown in color. Conclusion: Kinesin acts as a molecular motor moving along (in this case actually moving) microtubules. Further Experiments: Are there any further controls that are not shown in this experiment? What additional conclusions could be drawn by varying the amount of kinesin sticking to the slide?
Figure 4.22 Demonstration of kinesin as molecular motor. Microtubules can be observed moving over a slide coated with kinesin. chapter
4 Cell Structure
77
11/6/09 12:24:04 PM
TA B L E 4 . 2 Structure
Eukaryotic Cell Structures and their Functions Description
Function
Plasma membrane
Phospholipid bilayer with embedded proteins
Regulates what passes into and out of cell; cell-to-cell recognition; connection and adhesion; cell communication
Nucleus
Structure (usually spherical) that contains chromosomes and is surrounded by double membrane
Instructions for protein synthesis and cell reproduction; contains genetic information
Chromosomes
Long threads of DNA that form a complex with protein
Contain hereditary information used to direct synthesis of proteins
Nucleolus
Site of genes for rRNA synthesis
Synthesis of rRNA and ribosome assembly
Ribosomes
Small, complex assemblies of protein and RNA, often bound to ER
Sites of protein synthesis
Endoplasmic reticulum (ER)
Network of internal membranes
Intracellular compartment forms transport vesicles; participates in lipid synthesis and synthesis of membrane or secreted proteins
Golgi apparatus
Stacks of flattened vesicles
Packages proteins for export from cell; forms secretory vesicles
Lysosomes
Vesicles derived from Golgi apparatus that contain hydrolytic digestive enzymes
Digest worn-out organelles and cell debris; digest material taken up by endocytosis
Microbodies
Vesicles that are formed from incorporation of lipids and proteins and that contain oxidative and other enzymes
Isolate particular chemical activities from rest of cell
Mitochondria
Bacteria-like elements with double membrane
“Power plants” of the cell; sites of oxidative metabolism
Chloroplasts
Bacteria-like elements with double membrane surrounding a third, thylakoid membrane containing chlorophyll, a photosynthetic pigment
Sites of photosynthesis
Cytoskeleton
Network of protein filaments
Structural support; cell movement; movement of vesicles within cells
Flagella (cilia)
Cellular extensions with 9 + 2 arrangement of pairs of microtubles
Motility or moving fluids over surfaces
Cell wall
Outer layer of cellulose or chitin; or absent
Protection; support
78
part
II Biology of the Cell
rav32223_ch04_059-087.indd 78
11/6/09 12:24:05 PM
direction along microtubules toward the minus end, inward toward the cell’s center. (Dynein is also involved in the movement of eukaryotic flagella, as discussed later.) The destination of a particular transport vesicle and its content is thus determined by the nature of the linking protein embedded within the vesicle’s membrane. The major eukaryotic cell structures and their respective functions are summarized in table 4.2.
Learning Outcomes Review 4.6 The three principal fibers of the cytoskeleton are actin filaments (microfilaments), microtubules, and intermediate filaments. These fibers interact to modulate cell shape and permit cell movement. They also act to move materials within the cytoplasm. Material is also moved in large cells using vesicles and molecular motors. The motor proteins move vesicles along tracks of microtubules. ■
What advantage does the cytoskeleton give to large eukaryotic cells?
4.7
Extracellular Structures and Cell Movement
forward. This extended region is stabilized when microtubules polymerize into the newly formed region. Overall forward movement of the cell is then achieved through the action of the protein myosin, which is best known for its role in muscle contraction. Myosin motors along the actin filaments contract, pulling the contents of the cell toward the newly extended front edge. Cells crawl when these steps occur continuously, with a leading edge extending and stabilizing, and then motors contracting to pull the remaining cell contents along. Receptors on the cell surface can detect molecules outside the cell and stimulate extension in specific directions, allowing cells to move toward particular targets.
Flagella and cilia aid movement Earlier in this chapter, we described the structure of prokaryotic flagella. Eukaryotic cells have a completely different kind of flagellum, consisting of a circle of nine microtubule pairs surrounding two central microtubules. This arrangement is referred to as the 9 + 2 structure (figure 4.23). As pairs of microtubules move past each other using arms composed of the motor protein dynein, the eukaryotic flagellum undulates, rather than rotates. When examined carefully, each flagellum proves to be an outward projection of the cell’s interior, containing cytoplasm and enclosed by the plasma membrane. The microtubules of the flagellum are derived from a basal body, situated just below the point where the flagellum protrudes from the surface of the cell. The flagellum’s complex microtubular apparatus evolved early in the history of eukaryotes. Today the cells of many
Learning Outcomes 1. 2. 3.
Describe how cells move. Identify the different cytoskeletal elements involved in cell movement. Classify the elements of extracellular matrix in animal cells.
Outer microtubule pair
Flagellum
Radial spoke
Essentially all cell motion is tied to the movement of actin filaments, microtubules, or both. Intermediate filaments act as intracellular tendons, preventing excessive stretching of cells. Actin filaments play a major role in determining the shape of cells. Because actin filaments can form and dissolve so readily, they enable some cells to change shape quickly.
Dynein arm Plasma membrane Basal body
0.1 μm Central microtubule pair
Some cells crawl The arrangement of actin filaments within the cell cytoplasm allows cells to crawl, literally! Crawling is a significant cellular phenomenon, essential to such diverse processes as inflammation, clotting, wound healing, and the spread of cancer. White blood cells in particular exhibit this ability. Produced in the bone marrow, these cells are released into the circulatory system and then eventually crawl out of venules and into the tissues to destroy potential pathogens. At the leading edge of a crawling cell, actin filaments rapidly polymerize, and their extension forces the edge of the cell www.ravenbiology.com
rav32223_ch04_059-087.indd 79
Microtubule triplet 0.1 μm
Figure 4.23 Flagella and cilia. A eukaryotic flagellum originates directly from a basal body. The flagellum has two microtubules in its core connected by radial spokes to an outer ring of nine paired microtubules with dynein arms (9 + 2 structure). The basal body consists of nine microtubule triplets connected by short protein segments. The structure of cilia is similar to that of flagella, but cilia are usually shorter. chapter
4 Cell Structure
79
11/6/09 12:24:06 PM
multicellular and some unicellular eukaryotes no longer possess flagella and are nonmotile. Other structures, called cilia (singular, cilium), with an organization similar to the 9 + 2 arrangement of microtubules can still be found within them. Cilia are short cellular projections that are often organized in rows. They are more numerous than flagella on the cell surface, but have the same internal structure. In many multicellular organisms, cilia carry out tasks far removed from their original function of propelling cells through water. In several kinds of vertebrate tissues, for example, the beating of rows of cilia move water over the tissue surface. The sensory cells of the vertebrate ear also contain conventional cilia surrounded by actin-based stereocilia; sound waves bend these structures and provide the initial sensory input for hearing. Thus, the 9 + 2 structure of flagella and cilia appears to be a fundamental component of eukaryotic cells (figure 4.24).
Plant cell walls provide protection and support The cells of plants, fungi, and many types of protists have cell walls, which protect and support the cells. The cell walls of these eukaryotes are chemically and structurally different from prokaryotic cell walls. In plants and protists, the cell walls are composed of fibers of the polysaccharide cellulose, whereas in fungi, the cell walls are composed of chitin. In plants, primary walls are laid down when the cell is still growing. Between the walls of adjacent cells a sticky substance, called the middle lamella, glues the cells together (figure 4.25). Some plant cells produce strong secondary walls, which are deposited inside the primary walls of fully expanded cells.
Animal cells secrete an extracellular matrix Animal cells lack the cell walls that encase plants, fungi, and most protists. Instead, animal cells secrete an elaborate mixture of glycoproteins into the space around them, forming
Plasmodesmata
Primary wall Secondary wall Plant cell Plasma membrane
a.
40 μm
Middle lamella
Cell 2
Primary wall Secondary wall
Cell 1
b.
66.6 μm
Figure 4.24 Flagella and cilia. a. A green alga with numerous flagella that allow it to move through the water. b. Paramecia are covered with many cilia, which beat in unison to move the cell. The cilia can also be used to move fluid into the paramecium’s mouth to ingest material.
? 80
Inquiry question The passageways of the human trachea (the path of airflow into and out of the lungs) are known to be lined with ciliated cells. What function could these cilia perform? part
Middle lamella
Plasma membrane 0.4 μm
Figure 4.25 Cell walls in plants. Plant cell walls are thick, strong, and rigid. Primary cell walls are laid down when the cell is young. Thicker secondary cell walls may be added later when the cell is fully grown.
II Biology of the Cell
rav32223_ch04_059-087.indd 80
11/6/09 12:24:10 PM
Collagen
Elastin
Fibronectin Integrin
Proteoglycan
Actin filament Cytoplasm
Figure 4.26 The extracellular matrix. Animal cells are surrounded by an extracellular matrix composed of various glycoproteins that give the cells support, strength, and resilience.
TA B L E 4 . 3
the extracellular matrix (ECM) (figure 4.26). The fibrous protein collagen, the same protein found in cartilage, tendons, and ligaments may be abundant in the ECM. Strong fibers of collagen and another fibrous protein, elastin, are embedded within a complex web of other glycoproteins, called proteoglycans, that form a protective layer over the cell surface. The ECM of some cells is attached to the plasma membrane by a third kind of glycoprotein, fibronectin. Fibronectin molecules bind not only to ECM glycoproteins but also to proteins called integrins. Integrins are an integral part of the plasma membrane, extending into the cytoplasm, where they are attached to the microfilaments and intermediate filaments of the cytoskeleton. Linking ECM and cytoskeleton, integrins allow the ECM to influence cell behavior in important ways. They can alter gene expression and cell migration patterns by a combination of mechanical and chemical signaling pathways. In this way, the ECM can help coordinate the behavior of all the cells in a particular tissue. Table 4.3 compares and reviews the features of three types of cells.
A Comparison of Prokaryotic, Animal, and Plant Cells Prokaryote
E X T E R I O R
Animal
Plant
S T R U C T U R E S
Cell wall
Present (protein-polysaccharide)
Absent
Present (cellulose)
Cell membrane
Present
Present
Present
Flagella/cilia
Flagella may be present
May be present (9 + 2 structure)
Absent except in sperm of a few species (9 + 2 structure)
I N T E R I O R
S T R U C T U R E S
Endoplasmic reticulum
Absent
Usually present
Usually present
Ribosomes
Present
Present
Present
Microtubules
Absent
Present
Present
Centrioles
Absent
Present
Absent
Golgi apparatus
Absent
Present
Present
Nucleus
Absent
Present
Present
Mitochondria
Absent
Present
Present
Chloroplasts
Absent
Absent
Present
Chromosomes
Single; circle of DNA
Multiple; DNA–protein complex
Multiple; DNA–protein complex
Lysosomes
Absent
Usually present
Present
Vacuoles
Absent
Absent or small
Usually a large single vacuole
www.ravenbiology.com
rav32223_ch04_059-087.indd 81
chapter
4 Cell Structure
81
11/6/09 12:24:15 PM
Learning Outcomes Review 4.7 Cell movement involves proteins. These can either be internal in the case of crawling cells that use actin and myosin, or external in the case of cells powered by cilia or flagella. Eukaryotic cilia and flagella are different from prokaryotic flagella because they are composed of bundles of microtubules in a 9 + 2 array. They undulate rather than rotate. Plant cells have a cellulose-based cell wall. Animal cells lack a cell wall. In animal cells, the cytoskeleton is linked to a web of glycoproteins called the extracellular matrix. ■
What cellular roles are performed by microtubules and microfilaments and not intermediate filaments?
4.8
Cell-to-Cell Interactions
are derived from a single fertilized cell and contain the same genetic information—all of the genes found in the genome. This kind of tissue organization requires that cells have both identity and specific kinds of cell-to-cell connections. As an organism develops, the cells acquire their identities by carefully controlling the expression of those genes, turning on the specific set of genes that encode the functions of each cell type. How do cells sense where they are? How do they “know” which type of tissue they belong to? Table 4.4 provides a summary of the kinds of connections seen between cells that are explored in the following sections.
Surface proteins give cells identity One key set of genes functions to mark the surfaces of cells, identifying them as being of a particular type. When cells make contact, they “read” each other’s cell surface markers and react accordingly. Cells that are part of the same tissue type recognize each other, and they frequently respond by forming connections between their surfaces to better coordinate their functions.
Learning Outcomes
Glycolipids
1. 2.
Most tissue-specific cell surface markers are glycolipids, that is, lipids with carbohydrate heads. The glycolipids on the surface of red blood cells are also responsible for the A, B, and O blood types.
Differentiate between types of cell junctions. Describe the roles of surface proteins.
In multicellular organisms, not only must cells be able to communicate with one another, they must also be organized in specific ways. With the exception of a few primitive types of organisms, the hallmark of multicellular life is the organization of highly specialized groups of cells into tissues, such as blood and muscle. Remarkably, each cell within a tissue performs the functions of that tissue and no other, even though all cells of the body
TA B L E 4 . 4 Type of Connection
MHC proteins One example of the function of cell surface markers is the recognition of “self ” and “nonself ” cells by the immune system. This function is vital for multicellular organisms, which need to defend themselves against invading or malignant cells. The immune system of vertebrates uses a particular set of markers to distinguish self from nonself cells, encoded by genes of the
Cell-to-Cell Connections and Cell Identity Structure
Function
Example
Surface markers
Variable, integral proteins or glycolipids in plasma membrane
Identify the cell
MHC complexes, blood groups, antibodies
Tight junctions
Tightly bound, leakproof, fibrous protein seal that surrounds cell
Organizing junction; holds cells together such that materials pass through but not between the cells
Junctions between epithelial cells in the gut
Anchoring junction (Desmosome)
Intermediate filaments of cytoskeleton linked to adjoining cells through cadherins
Anchoring junction; binds cells together
Epithelium
Anchoring junction (Adherens junction)
Transmembrane fibrous proteins
Anchoring junction; connects extracellular matrix to cytoskeleton
Tissues with high mechanical stress, such as the skin
Communicating junction (Gap junction)
Six transmembrane connexon proteins creating a pore that connects cells
Communicating junction; allows passage of small molecules from cell to cell in a tissue
Excitable tissue such as heart muscle
Communicating junction (Plasmodesmata)
Cytoplasmic connections between gaps in adjoining plant cell walls
Communicating junction between plant cells
Plant tissues
82
part
II Biology of the Cell
rav32223_ch04_059-087.indd 82
11/6/09 12:24:16 PM
major histocompatibility complex (MHC ). Cell recognition in the immune system is covered in chapter 52.
Cell connections mediate cell-to-cell adhesion Most cells in a multicellular organism are in physical contact with other cells at all times, usually as members of organized tissues such as those in a leaf or those in your lungs, heart, or gut. These cells and the mass of other cells clustered around them form long-lasting or permanent connections with one another called cell junctions. The nature of the physical connections between the cells of a tissue in large measure determines what the tissue is like. Indeed, a tissue’s proper functioning often depends critically on how the individual cells are arranged within it. Just as a house
cannot maintain its structure without nails and cement, so a tissue cannot maintain its characteristic architecture without the appropriate cell junctions. Cell junctions are divided into three categories, based on their functions: tight, anchoring, and communicating junctions (figure 4.27).
Tight junctions Tight junctions connect the plasma membranes of adjacent cells in a sheet. This sheet of cells acts as a wall within the organ, keeping molecules on one side or the other (figure 4.27a). Creating sheets of cells. The cells that line an animal’s digestive tract are organized in a sheet only one cell thick. One surface of the sheet faces the inside of the tract, and the other
Tight junction Adjacent plasma membranes Tight junction proteins Intercellular space
2.5 μm
a.
Microvilli
Anchoring junction (desmosome) Intercellular space Adjacent plasma membranes
Tight junction
Cadherin Cytoplasmic protein plaque Cytoskeletal filaments anchored to plaque
b.
Anchoring junction (desmosome)
Intermediate filament
0.1 μm Communicating junction
Communicating junction
Intercellular space Connexon Two adjacent connexons forming an open channel between cells Channel (diameter 1.5 nm) Adjacent plasma membranes
c.
Basal lamina
1.4 μm
Figure 4.27 An overview of cell junction types. Here, the diagram of gut epithelial cells on the right illustrates the comparative structures and locations of common cell junctions. The detailed models on the left show the structures of the three major types of cell junctions: (a) tight junction; (b) anchoring junction, the example shown is a desmosome; (c) communicating junction, the example shown is a gap junction. www.ravenbiology.com
rav32223_ch04_059-087.indd 83
chapter
4 Cell Structure
83
11/6/09 12:24:17 PM
faces the extracellular space, where blood vessels are located. Tight junctions encircle each cell in the sheet, like a belt cinched around a person’s waist. The junctions between neighboring cells are so securely attached that there is no space between them for leakage. Hence, nutrients absorbed from the food in the digestive tract must pass directly through the cells in the sheet to enter the bloodstream because they cannot pass through spaces between cells. Partitioning the sheet. The tight junctions between the cells lining the digestive tract also partition the plasma membranes of these cells into separate compartments. Transport proteins in the membrane facing the inside of the tract carry nutrients from that side to the cytoplasm of the cells. Other proteins, located in the membrane on the opposite side of the cells, transport those nutrients from the cytoplasm to the extracellular fluid, where they can enter the bloodstream. For the sheet to absorb nutrients properly, these proteins must remain in the correct locations within the fluid membrane. Tight junctions effectively segregate the proteins on opposite sides of the sheet, preventing them from drifting within the membrane from one side of the sheet to the other. When tight junctions are experimentally disrupted, just this sort of migration occurs.
Anchoring junctions Anchoring junctions mechanically attach the cytoskeleton of a cell to the cytoskeletons of other cells or to the extracellular matrix. These junctions are most common in tissues subject to mechanical stress, such as muscle and skin epithelium. Cadherin and intermediate filaments. Desmosomes connect the cytoskeletons of adjacent cells (figure 4.27b), and hemidesmosomes anchor epithelial cells to a basement membrane. Proteins called cadherins, most of which are single-pass transmembrane glycoproteins, create the critical link. Proteins link the short cytoplasmic end of a cadherin to the intermediate filaments in the cytoskeleton. The other end of the cadherin molecule projects outward from the plasma membrane, joining directly with a cadherin protruding from an adjacent cell similar to a firm handshake, binding the cells together. Connections between proteins tethered to the intermediate filaments are much more secure than connections between free-floating membrane proteins.
β
Cytoplasm
NH2 Adjoining cell membrane
Extracellular domains of cadherin protein
Cadherin of adjoining cell
Intercellular space
Cytoplasm
Actin
Plasma membrane
COOH β Intracellular α γ attachment proteins x
0.01 μm
Figure 4.28 A cadherin-mediated junction. The cadherin molecule is anchored to actin in the cytoskeleton and passes through the membrane to interact with the cadherin of an adjoining cell. Communicating junctions Many cells communicate with adjacent cells through direct connections called communicating junctions. In these junctions, a chemical or electrical signal passes directly from one cell to an adjacent one. Communicating junctions permit small molecules or ions to pass from one cell to the other. In animals, these direct communication channels between cells are called gap junctions, and in plants, plasmodesmata.
Cadherin and actin filaments. Cadherins can also connect the actin frameworks of cells in cadherin-mediated junctions (figure 4.28). When they do, they form less stable links between cells than when they connect intermediate filaments. Many kinds of actin-linking cadherins occur in different tissues. For example, during vertebrate development, the migration of neurons in the embryo is associated with changes in the type of cadherin expressed on their plasma membranes.
Gap junctions in animals. Gap junctions are composed of structures called connexons, complexes of six identical transmembrane proteins (see figure 4.27c). The proteins in a connexon are arranged in a circle to create a channel through the plasma membrane that protrudes several nanometers from the cell surface. A gap junction forms when the connexons of two cells align perfectly, creating an open channel that spans the plasma membranes of both cells. Gap junctions provide passageways large enough to permit small substances, such as simple sugars and amino acids, to pass from one cell to the next. Yet the passages are small enough to prevent the passage of larger molecules, such as proteins. Gap junction channels are dynamic structures that can open or close in response to a variety of factors, including Ca2+ and H+ ions. This gating serves at least one important function. When a cell is damaged, its plasma membrane often becomes leaky. Ions in high concentrations outside the cell, such as Ca2+, flow into the damaged cell and close its gap junction channels. This isolates the cell and so prevents the damage from spreading to other cells.
Integrin-mediated links. Anchoring junctions called adherens junctions connect the actin fi laments of one cell with those of neighboring cells or with the extracellular matrix. The linking proteins in these junctions are members of a large superfamily of cell-surface receptors called integrins that bind to a protein component of the extracellular matrix. At least 20 different integrins exist each with a differently shaped binding domain.
Plasmodesmata in plants. In plants, cell walls separate every cell from all others. Cell–cell junctions occur only at holes or gaps in the walls, where the plasma membranes of adjacent cells can come into contact with one another. Cytoplasmic connections that form across the touching plasma membranes are called plasmodesmata (singular, plasmodesma) (figure 4.29). The majority of living cells within a higher plant are connected to their neighbors by these junctions.
84
part
II Biology of the Cell
rav32223_ch04_059-087.indd 84
11/6/09 12:24:26 PM
Primary cell wall
Middle lamella
Smooth ER
Plasma membrane
Plasmodesmata function much like gap junctions in animal cells, although their structure is more complex. Unlike gap junctions, plasmodesmata are lined with plasma membrane and contain a central tubule that connects the endoplasmic reticulum of the two cells.
Plasmodesma
Learning Outcomes Review 4.8
Central tubule Cell 1
Cell 2
Figure 4.29 Plasmodesmata. Plant cells can communicate through specialized openings in their cell walls, called plasmodesmata, where the cytoplasm of adjoining cells are connected.
Cell connections fall into three basic categories: (1) Tight junctions help to make sheets of cells that form watertight seals; (2) anchoring junctions provide strength and flexibility; and (3) communicating junctions, including gap junctions in animals and plasmodesmata in plants, allow passage of some materials between cells. Cells in multicellular organisms are usually organized into tissues, requiring that cells have distinct identity and connections. Cell identity is conferred by surface glycoproteins, which include the MHC proteins that are important in the immune system. ■
How do cell junctions help to form tissues?
Chapter Review 4.1 Cell Theory Cell theory is the unifying foundation of cell biology. All organisms are composed of one or more cells. Cells arise only by division of preexisting cells. Cell size is limited. Cell size is constrained by the diffusion distance. As cell size increases, diffusion becomes inefficient. Microscopes allow visualization of cells and components. Magnification gives better resolution than is possible with the naked eye. Staining with chemicals enhances contrast of structures. All cells exhibit basic structural similarities. All cells have centrally located DNA, a semifluid cytoplasm, and an enclosing plasma membrane.
4.2 Prokaryotic Cells (see figure 4.3) Prokaryotic cells have relatively simple organization. Prokaryotic cells contain DNA and ribosomes, but they lack a nucleus, an internal membrane system, and membrane-bounded organelles. A rigid cell wall surrounds the plasma membrane.
Some prokaryotes move by means of rotating flagella. Prokaryotic flagella rotate because of proton transfer across the plasma membrane.
4.3 Eukaryotic Cells (see figures 4.6 and 4.7) Eukaryotic cells have a membrane-bounded nucleus, an endomembrane system, and many different organelles. The nucleus acts as the information center. The nucleus is surrounded by an envelope of two phospholipid bilayers; the outer layer is contiguous with the ER. Pores allow exchange of small molecules. The nucleolus is a region of the nucleoplasm where rRNA is transcribed and ribosomes are assembled. In most prokaryotes, DNA is organized into a single circular chromosome. In eukaryotes, numerous chromosomes are present. Ribosomes are the cell’s protein synthesis machinery. Ribosomes translate mRNA to produce polypeptides. They are found in all cell types.
4.4 The Endomembrane System The endoplasmic reticulum (ER) creates channels and passages within the cytoplasm (see figure 4.10).
Bacterial cell walls consist of peptidoglycan. Peptidoglycan is composed of carbohydrate cross-linked with short peptides.
The rough ER is a site of protein synthesis. The rough ER (RER), studded with ribosomes, synthesizes and modifies proteins and manufactures membranes.
Archaea lack peptidoglycan. Archaeal cell walls do not contain peptidoglycan, and they have unique plasma membranes.
The smooth ER has multiple roles. The smooth endoplasmic reticulum (SER) lacks ribosomes; it is involved in carbohydrate and lipid synthesis and detoxification.
www.ravenbiology.com
rav32223_ch04_059-087.indd 85
chapter
4 Cell Structure
85
11/6/09 12:24:28 PM
The Golgi apparatus sorts and packages proteins. The Golgi apparatus receives vesicles from the ER, modifies and packages macromolecules, and transports them (see figure 4.11).
Centrosomes are microtubule-organizing centers. Centrosomes help assemble the nuclear division apparatus of animal cells (see figure 4.20).
Lysosomes contain digestive enzymes. Lysosomes break down macromolecules and recycle the components of old organelles (see figure 4.13).
The cytoskeleton helps move materials within cells. Molecular motors move vesicles along microtubules, like a train on a railroad track. Kinesin and dynein are two motor proteins.
Microbodies are a diverse category of organelles.
4.7
Extracellular Structures and Cell Movement
Plants use vacuoles for storage and water balance.
4.5 Mitochondria and Chloroplasts: Cellular Generators Mitochondria and chloroplasts have a double-membrane structure, contain their own DNA, and can divide independently. Mitochondria metabolize sugar to generate ATP. The inner membrane of mitochondria is extensively folded into layers called cristae. Proteins on the surface and in the inner membrane carry out metabolism to produce ATP (see figure 4.16). Chloroplasts use light to generate ATP and sugars. Chloroplasts capture light energy via thylakoid membranes arranged in stacks called grana, and use it to synthesize glucose (see figure 4.17). Mitochondria and chloroplasts arose by endosymbiosis. The endosymbiont theory proposes that mitochondria and chloroplasts were once prokaryotes engulfed by another cell.
4.6 The Cytoskeleton The cytoskeleton consists of crisscrossed protein fibers that support the shape of the cell and anchor organelles (see figure 4.19). Three types of fibers compose the cytoskeleton. Actin filaments, or microfilaments, are long, thin polymers involved in cellular movement. Microtubules are hollow structures that move materials within a cell. Intermediate filaments serve a wide variety of functions.
Some cells crawl. Cell crawling occurs as actin polymerization forces the cell membrane forward, while myosin pulls the cell body forward. Flagella and cilia aid movement. Eukaryotic flagella have a 9 + 2 structure and arise from a basal body. Cilia are shorter and more numerous than flagella. Plant cell walls provide protection and support. Plants have cell walls composed of cellulose fibers. The middle lamella, between cell walls, holds adjacent cells together. Animal cells secrete an extracellular matrix. Glycoproteins are the main component of the extracellular matrix (ECM) of animal cells.
4.8
Cell-to-Cell Interactions (see figure 4.27)
Surface proteins give cells identity. Glycolipids and MHC proteins on cell surfaces help distinguish self from nonself. Cell connections mediate cell-to-cell adhesion. Cell junctions include tight junctions, anchoring junctions, and communicating junctions. In animals, gap junctions allow the passage of small molecules between cells. In plants, plasmodesmata penetrate the cell wall and connect cells.
Review Questions U N D E R S TA N D 1. Which of the following statements is NOT part of the cell theory? a. b. c. d.
All organisms are composed of one or more cells. Cells come from other cells by division. Cells are the smallest living things. Eukaryotic cells have evolved from prokaryotic cells.
2. All cells have all of the following except a. b.
plasma membrane. genetic material.
c. d.
cytoplasm. cell wall.
3. Eukaryotic cells are more complex than prokaryotic cells. Which of the following are found only in a eukaryotic cell?
86
a. b. c. d.
Cell wall Plasma membrane Endoplasmic reticulum Ribosomes
part
II Biology of the Cell
rav32223_ch04_059-087.indd 86
4. Which of the following are differences between bacteria and archaea? a. b. c. d.
The molecular architecture of their cell walls The type of ribosomes found in each Archaea have an internal membrane system that bacteria lack. Both a and b
5. The cytoskeleton includes a. b. c. d.
microtubules made of actin filaments. microfilaments made of tubulin. intermediate filaments made of twisted fibers of vimentin and keratin. smooth endoplasmic reticulum.
6. The smooth endoplasmic reticulum is a. b. c. d.
involved in protein synthesis. a site of protein glycosylation. used to store a variety of ions. the site of lipid and membrane synthesis.
11/6/09 12:24:30 PM
7. Plasmodesmata in plants and gap junctions in animals are functionally similar in that a. b. c. d.
each is used to anchor layers of cells. they form channels between cells that allow diffusion of small molecules. they form tight junctions between cells. they are anchored to the extracellular matrix.
7. Eukaryotic cells are composed of three types of cytoskeletal filaments. How are these three filaments similar? a. b. c. d.
They contribute to the shape of the cell. They are all made of the same type of protein. They are all the same size and shape. They are all equally dynamic and flexible.
SYNTHESIZE A P P LY 1. The most important factor that limits the size of a cell is the a. b. c. d.
quantity of proteins and organelles a cell can make. rate of diffusion of small molecules. surface area-to-volume ratio of the cell. amount of DNA in the cell.
2. All eukaryotic cells possess each of the following except a. b.
mitochondria. cell wall.
c. d.
cytoskeleton. nucleus.
3. Which of these organelles is NOT associated with the production or sorting of proteins in a cell? a. b. c. d.
Ribosomes Smooth endoplasmic reticulum (SER) Rough endoplasmic reticulum (RER) Golgi apparatus
4. Different motor proteins like kinesin and myosin are similar in that they can a. b. c. d.
interact with microtubules. use energy from ATP to produce movement. interact with actin. do both a and b.
5. The protein sorting pathway involves the following organelles/ compartments in order: a. b. c. d.
SER, RER, transport vesicle, Golgi. RER, lysosome, Golgi. RER, transport vesicle, Golgi, final destination. Golgi, transport vesicle, RER, final destination.
6. Chloroplasts and mitochondria have many common features because both a. b. c. d.
are present in plant cells. arose by endosymbiosis. function to oxidize glucose. function to produce glucose.
www.ravenbiology.com
rav32223_ch04_059-087.indd 87
1. The smooth endoplasmic reticulum is the site of synthesis of the phospholipids that make up all the membranes of a cell— especially the plasma membrane. Use the diagram of an animal cell (see figure 4.6) to trace a pathway that would carry a phospholipid molecule from the SER to the plasma membrane. What endomembrane compartments would the phospholipids travel through? How can a phospholipid molecule move between membrane compartments? 2. Use the information provided in table 4.3 to develop a set of predictions about the properties of mitochondria and chloroplasts if these organelles were once free-living prokaryotic cells. How do your predictions match with the evidence for endosymbiosis? 3. In evolutionary theory, homologous traits are those with a similar structure and function derived from a common ancestor. Analogous traits represent adaptations to a similar environment, but from distantly related organisms. Consider the structure and function of the flagella found on eukaryotic and prokaryotic cells. Are the flagella an example of a homologous or analogous trait? Defend your answer. 4. The protist, Giardia intestinalis, is the organism associated with water-borne diarrheal diseases. Giardia is an unusual eukaryote because it seems to lack mitochondria. Provide two possible evolutionary scenarios for this in the context of the endosymbiotic theory.
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
chapter
4 Cell Structure
87
11/6/09 12:24:30 PM
CHAPTER
Chapter
5
Membranes
Chapter Outline 5.1
The Structure of Membranes
5.2
Phospholipids: The Membrane’s Foundation
5.3
Proteins: Multifunctional Components
5.4
Passive Transport Across Membranes
5.5
Active Transport Across Membranes
5.6
Bulk Transport by Endocytosis and Exocytosis
0.16 μm
A
Introduction A cell’s interactions with the environment are critical, a give-and-take that never ceases. Without it, life could not exist. Living cells are encased within a lipid membrane through which few water-soluble substances can pass. The membrane also contains protein passageways that permit specific substances to move into and out of the cell and allow the cell to exchange information with its environment. Eukaryotic cells also contain internal membranes like those of the mitochondrion and endoplasmic reticulum pictured here. We call the delicate skin of lipids with embedded protein molecules that encase the cell a plasma membrane. This chapter examines the structure and function of this remarkable membrane.
5.1
The Structure of Membranes
Learning Outcomes 1. 2.
Describe the components of biological membranes. Explain the fluid mosaic model of membrane structure.
rav32223_ch05_088-106.indd 88
The membranes that encase all living cells are two phospholipid sheets that are only 5–10 nanometers thick; more than 10,000 of these sheets piled on one another would just equal the thickness of this sheet of paper. Biologists established the components of membranes—not only lipids, but also proteins and other molecules—through biochemical assays, but the organization of the membrane components remained elusive. We begin by considering the theories that have been advanced about membrane structure. We then look at the individual components of membranes more closely.
11/9/09 10:29:16 AM
The fluid mosaic model shows proteins embedded in a fluid lipid bilayer
Cellular membranes consist of four component groups
The lipid layer that forms the foundation of a cell’s membranes is a bilayer formed of phospholipids (figure 5.1). For many years, biologists thought that the protein components of the cell membrane covered the inner and outer surfaces of the phospholipid bilayer like a coat of paint. An early model portrayed the membrane as a sandwich; a phospholipid bilayer between two layers of globular protein. In 1972, S. Jonathan Singer and Garth J. Nicolson revised the model in a simple but profound way: They proposed that the globular proteins are inserted into the lipid bilayer, with their nonpolar segments in contact with the nonpolar interior of the bilayer and their polar portions protruding out from the membrane surface. In this model, called the fluid mosaic model, a mosaic of proteins floats in or on the fluid lipid bilayer like boats on a pond (figure 5.2). We now recognize two categories of membrane proteins based on their association with the membrane. Integral membrane proteins are embedded in the membrane, and peripheral proteins are associated with the surface of the membrane.
A eukaryotic cell contains many membranes. Although they are not all identical, they share the same fundamental architecture. Cell membranes are assembled from four components (table 5.1): 1. Phospholipid bilayer. Every cell membrane is composed of phospholipids in a bilayer. The other components of the membrane are embedded within the bilayer, which provides a flexible matrix and, at the same time, imposes a barrier to permeability. Animal cell membranes also contain cholesterol, a steroid with a polar hydroxyl group (–OH). Plant cells have a much lower cholesterol content. 2. Transmembrane proteins. A major component of every membrane is a collection of proteins that float in the lipid bilayer. These proteins have a variety of functions, including transport and communication across the membrane. Many integral membrane proteins are not fixed in position. They can move about, just as the phospholipid molecules do. Some membranes are
O
OJ JPJO: O
H
J J J
Polar Hydrophilic Heads
CH2
J J
H2CJJCJJCH2 O
Nonpolar Hydrophobic Tails
J J J J JJJ
CH2JN;(CH3)3
O
CJ JO CJ JO CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH CH2 CH CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH2 CH3 CH3
a. Formula
b. Space-filling model
c. Icon
Figure 5.1 Different views of phospholipid structure. Phospholipids are composed of glycerol (pink) linked to two fatty acids and a phosphate group. The phosphate group ( yellow) can have additional molecules attached, such as the positively charged choline ( green) shown. Phosphatidylcholine is a common component of membranes, it is shown in (a) with its chemical formula, (b) as a space-filling model, and (c) as the icon that is used in most of the figures in this chapter. www.ravenbiology.com
rav32223_ch05_088-106.indd 89
chapter
5 Membranes
89
11/6/09 12:01:47 PM
Figure 5.2 The fluid mosaic model of cell membranes. Integral proteins protrude through the plasma membrane, with nonpolar regions that tether them to the membrane’s hydrophobic interior. Carbohydrate chains are often bound to the extracellular portion of these proteins, forming glycoproteins. Peripheral membrane proteins are associated with the surface of the membrane. Membrane phospholipids can be modified by the addition of carbohydrates to form glycolipids. Inside the cell, actin filaments and intermediate filaments interact with membrane proteins. Outside the cell, many animal cells have an elaborate extracellular matrix composed primarily of glycoproteins.
TA B L E 5 .1
Extracellular matrix protein
Glycoprotein Glycolipid Integral proteins
Glycoprotein
Cholesterol
Actin filaments of cytoskeleton
Peripheral protein Intermediate filaments of cytoskeleton
Components of the Cell Membrane
Component
Composition
Phospholipid bilayer
Phospholipid molecules
Provides permeability barrier, matrix for proteins
Excludes water-soluble molecules from nonpolar interior of bilayer and cell
Bilayer of cell is impermeable to large water-soluble molecules, such as glucose
Transmembrane proteins
Carriers
Actively or passively transport molecules across membrane
Move specific molecules through the membrane in a series of conformational changes
Glycophorin carrier for sugar transport; sodium–potassium pump
Channels
Passively transport molecules across membrane
Create a selective tunnel that acts as a passage through membrane
Sodium and potassium channels in nerve, heart, and muscle cells
Receptors
Transmit information into cell
Signal molecules bind to cellsurface portion of the receptor protein. This alters the portion of the receptor protein within the cell, inducing activity
Specific receptors bind peptide hormones and neurotransmitters
Spectrins
Determine shape of cell
Form supporting scaffold beneath membrane, anchored to both membrane and cytoskeleton
Red blood cell
Clathrins
Anchor certain proteins to specific sites, especially on the exterior plasma membrane in receptormediated endocytosis
Proteins line coated pits and facilitate binding to specific molecules
Localization of low-density lipoprotein receptor within coated pits
Glycoproteins
“Self” recognition
Create a protein/carbohydrate chain shape characteristic of individual
Major histocompatibility complex protein recognized by immune system
Glycolipid
Tissue recognition
Create a lipid/carbohydrate chain shape characteristic of tissue
A, B, O blood group markers
Interior protein network
Cell-surface markers
90
part
Function
How It Works
Example
II Biology of the Cell
rav32223_ch05_088-106.indd 90
11/6/09 12:01:47 PM
crowded with proteins, but in others, the proteins are more sparsely distributed. 3. Interior protein network. Membranes are structurally supported by intracellular proteins that reinforce the membrane’s shape. For example, a red blood cell has a characteristic biconcave shape because a scaffold made of a protein called spectrin links proteins in the plasma membrane with actin filaments in the cell’s cytoskeleton. Membranes use networks of other proteins to control the lateral movements of some key membrane proteins, anchoring them to specific sites. 4. Cell-surface markers. As you learned in the preceding chapter, membrane sections assemble in the endoplasmic reticulum, transfer to the Golgi apparatus, and then are transported to the plasma membrane. The ER adds chains of sugar molecules to membrane proteins and lipids, converting them into glycoproteins and glycolipids. Different cell types exhibit different varieties of these glycoproteins and glycolipids on their surfaces, which act as cell identity markers. Originally, it was believed that because of its fluidity, the plasma membrane was uniform, with lipids and proteins free to diffuse rapidly in the plane of the membrane. However, in the last decade evidence has accumulated suggesting the plasma membrane is not homogeneous and contains microdomains with distinct lipid and protein composition. One type of microdomain, the lipid raft, is heavily enriched with cholesterol, which fills space between the phospholipids, packing them more tightly together than the surrounding membrane. Although the distribution of membrane lipids is symmetrical in the ER where they are synthesized, this distribution is asymmetrical in the plasma membrane, Golgi apparatus, and endosomes. This is accomplished by enzymes that transport lipids across the bilayer from one face to the other.
2. The cell often fractures through the interior, hydrophobic area of the lipid bilayer, splitting the plasma membrane into two layers.
1. A cell frozen in medium is cracked with a knife blade.
Electron microscopy has provided structural evidence Electron microscopy allows biologists to examine the delicate, filmy structure of a cell membrane. We discussed two types of electron microscopes in chapter 4: the transmission electron microscope (TEM) and the scanning electron microscope (SEM). Both provide illuminating views of membrane structure. When examining cell membranes with electron microscopy, specimens must be prepared for viewing. In one method of preparing a specimen, the tissue of choice is embedded in a hard epoxy matrix. The epoxy block is then cut with a microtome, a machine with a very sharp blade that makes incredibly thin, transparent “epoxy shavings” less than 1 μm thick that peel away from the block of tissue. These shavings are placed on a grid, and a beam of electrons is directed through the grid with the TEM. At the high magnification an electron microscope provides, resolution is good enough to reveal the double layers of a membrane. False color can be added to the micrograph to enhance detail. Cell 1
Plasma membrane of cell 1
Plasma membrane of cell 2 Cell 2
0.038 µm
Freeze-fracturing a specimen is another way to visualize the inside of the membrane (figure 5.3). The tissue is embedded
3. The plasma membrane separates such that proteins and other embedded membrane structures remain within one or the other layers of the membrane.
4. The exposed membrane is coated with platinum, which forms a replica of the membrane. The underlying membrane is dissolved away, and the replica is then viewed with electron microscopy.
Medium Fractured upper half of lipid bilayer Exposed lower half of lipid bilayer
Cell Knife
0.15 µm Exposed lower half of lipid bilayer
External surface of plasma membrane
Figure 5.3 Viewing a plasma membrane with freeze-fracture microscopy. www.ravenbiology.com
rav32223_ch05_088-106.indd 91
chapter
5 Membranes
91
11/6/09 12:01:51 PM
in a medium and quick frozen with liquid nitrogen. The frozen tissue is then “tapped” with a knife, causing a crack between the phospholipid layers of membranes. Proteins, carbohydrates, pits, pores, channels, or any other structure affiliated with the membrane will pull apart (whole, usually) and stick with one or the other side of the split membrane. Next, a very thin coating of platinum is evaporated onto the fractured surface, forming a replica or “cast” of the surface. After the topography of the membrane has been preserved in the cast, the actual tissue is dissolved away, and the cast is examined with electron microscopy, creating a textured and three-dimensional view of the membrane.
Learning Outcomes Review 5.1 Cellular membranes contain four components: (1) a phospholipid bilayer, (2) transmembrane proteins, (3) an internal protein network providing structural support, and (4) cell-surface markers composed of glycoproteins and glycolipids. The fluid mosaic model of membrane structure includes both the fluid nature of the membrane and the mosaic composition of proteins floating in the phospholipid bilayer. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) have provided evidence supporting the fluid mosaic model. ■
If the plasma membrane were just a phospholipid bilayer, how would this affect its function?
Phospholipids spontaneously form bilayers The phosphate groups are charged, and other molecules attached to them are polar or charged. This creates a huge change in the molecule’s physical properties compared with a triglyceride. The strongly polar phosphate end is hydrophilic, or “waterloving,” while the fatty acid end is strongly nonpolar and hydrophobic, or “water-fearing.” The two nonpolar fatty acids extend in one direction, roughly parallel to each other, and the polar phosphate group points in the other direction. To represent this structure, phospholipids are often diagrammed as a polar head with two dangling nonpolar tails, as in figure 5.1c. What happens when a collection of phospholipid molecules is placed in water? The polar water molecules repel the long, nonpolar tails of the phospholipids while seeking partners for hydrogen bonding. Because of the polar nature of the water molecules, the nonpolar tails of the phospholipids end up packed closely together, sequestered as far as possible from water. Every phospholipid molecule is oriented with its polar head toward water and its nonpolar tails away. When two layers form with the tails facing each other, no tails ever come in contact with water. The resulting structure is the phospholipid bilayer. Phospholipid bilayers form spontaneously, driven by the tendency of water molecules to form the maximum number of hydrogen bonds. Extracellular fluid Polar hydrophilic heads
5.2
Phospholipids: The Membrane’s Foundation
Learning Outcomes 1. 2. 3.
List the different components of phospholipids. Explain how membranes form spontaneously. Describe the factors involved in membrane fluidity.
Nonpolar hydrophobic tails Polar hydrophilic heads Intracellular fluid (cytosol)
The nonpolar interior of a lipid bilayer impedes the passage of any water-soluble substances through the bilayer, just as a layer of oil impedes the passage of a drop of water. This barrier to water-soluble substances is the key biological property of the lipid bilayer.
The phospholipid bilayer is fluid Like the fat molecules (triglycerides) described in chapter 3, a phospholipid has a backbone derived from the three-carbon polyalcohol glycerol. Attached to this backbone are one to three fatty acids, long chains of carbon atoms ending in a carboxyl (–COOH) group. A triglyceride molecule has three such chains, one attached to each carbon in the backbone. Because these chains are nonpolar, they do not form hydrogen bonds with water, and triglycerides are not water-soluble. A phospholipid, by contrast, has only two fatty acid chains attached to its backbone. The third carbon of the glycerol carries a phosphate group, thus the name phospholipid. An additional polar organic molecule is often added to the phosphate group as well. From this simple molecular framework, a large variety of lipids can be constructed by varying the polar organic group attached to the phosphate and the fatty acid chains attached to the glycerol. Mammalian membranes, for example, contain hundreds of chemically distinct species of lipids. 92
part
A lipid bilayer is stable because water’s affinity for hydrogen bonding never stops. Just as surface tension holds a soap bubble together, even though it is made of a liquid, so the hydrogen bonding of water holds a membrane together. Although water continually drives phospholipid molecules into the bilayer configuration, it does not have any effect on the mobility of phospholipids relative to their lipid and nonlipid neighbors in the bilayer. Because phospholipids interact relatively weakly with one another, individual phospholipids and unanchored proteins are comparatively free to move about within the membrane. This can be demonstrated vividly by fusing cells and watching their proteins intermix with time (figure 5.4).
Membrane fluidity can change The degree of membrane fluidity changes with the composition of the membrane itself. Much like triglycerides can be solid or liquid at room temperature, depending on their fatty acid
II Biology of the Cell
rav32223_ch05_088-106.indd 92
11/6/09 12:01:53 PM
SCIENTIFIC THINKING
Learning Outcomes Review 5.2 Hypothesis: The plasma membrane is fluid, not rigid. Prediction: If the membrane is fluid, membrane proteins may diffuse laterally. Test: Fuse mouse and human cells, then observe the distribution of membrane proteins over time by labeling specific mouse and human proteins. Human cell
Biological membranes consist of a phospholipid bilayer. Each phospholipid has a hydrophilic (phosphate) head and a hydrophobic (lipid) tail. In water, phospholipid molecules spontaneously form a bilayer, with phosphate groups facing out toward the water and lipid tails facing in, where they are sequestered from water. Membrane fluidity varies with composition and conditions: unsaturated fats disturb packing of the lipid tails and make the membrane more fluid, as do higher temperatures. ■
Mouse cell
Would a phospholipid bilayer form in a nonpolar solvent?
Fuse cells
5.3 Allow time for mixing to occur
Proteins: Multifunctional Components
Learning Outcomes Intermixed membrane proteins
1. 2. 3.
List the functions of membrane proteins. Explain how proteins can associate with the membrane. Identify a transmembrane domain.
Result: Over time, hybrid cells show increasingly intermixed proteins. Conclusion: At least some membrane proteins can diffuse laterally in the membrane. Further Experiments: Can you think of any other explanation for these observations? What if newly synthesized proteins were inserted into the membrane during the experiment? How could you use this basic experimental design to rule out this or other possible explanations?
Figure 5.4 Test of membrane fluidity. composition, membrane fluidity can be altered by changing the membrane’s fatty acid composition. Saturated fats tend to make the membrane less fluid because they pack together well. Unsaturated fats make the membrane more fluid—the “kinks” introduced by the double bonds keep them from packing tightly. You saw this effect on fats and oils earlier in chapter 3. Most membranes also contain sterols such as cholesterol, which can either increase or decrease membrane fluidity, depending on the temperature. Changes in the environment can have drastic effects on the membranes of single-celled organisms such as bacteria. Increasing temperature makes a membrane more fluid, and decreasing temperature makes it less fluid. Bacteria have evolved mechanisms to maintain a constant membrane fluidity despite fluctuating temperatures. Some bacteria contain enzymes called fatty acid desaturases that can introduce double bonds into fatty acids in membranes. Genetic studies, involving either the inactivation of these enzymes or the introduction of them into cells that normally lack them, indicate that the action of these enzymes confers cold tolerance. At colder temperatures, the double bonds introduced by fatty acid desaturase make the membrane more fluid, counteracting the environmental effect of reduced temperature. www.ravenbiology.com
rav32223_ch05_088-106.indd 93
Cell membranes contain a complex assembly of proteins enmeshed in the fluid soup of phospholipid molecules. This very flexible organization permits a broad range of interactions with the environment, some directly involving membrane proteins.
Proteins and protein complexes perform key functions Although cells interact with their environment through their plasma membranes in many ways, we will focus on six key classes of membrane protein in this chapter and in chapter 9 (figure 5.5). 1. Transporters. Membranes are very selective, allowing only certain solutes to enter or leave the cell, either through channels or carriers composed of proteins. 2. Enzymes. Cells carry out many chemical reactions on the interior surface of the plasma membrane, using enzymes attached to the membrane. 3. Cell-surface receptors. Membranes are exquisitely sensitive to chemical messages, which are detected by receptor proteins on their surfaces. 4. Cell-surface identity markers. Membranes carry cell-surface markers that identify them to other cells. Most cell types carry their own ID tags, specific combinations of cell-surface proteins and protein complexes such as glycoproteins that are characteristic of that cell type. 5. Cell-to-cell adhesion proteins. Cells use specific proteins to glue themselves to one another. Some act by forming temporary interactions, and others form a more permanent bond. (See chapter 9.) 6. Attachments to the cytoskeleton. Surface proteins that interact with other cells are often anchored to the cytoskeleton by linking proteins. chapter
5 Membranes
93
11/6/09 12:01:54 PM
Outside cell
Inside cell
Transporter
Enzyme
Cell-surface receptor
Cell-surface identity marker
Cell-to-cell adhesion
Attachment to the cytoskeleton
Figure 5.5 Functions of plasma membrane proteins. Membrane proteins act as transporters, enzymes, cell-surface receptors, and cell-surface identity markers, as well as aiding in cell-to-cell adhesion and securing the cytoskeleton.
?
Inquiry question According to the fluid mosaic model, membranes are held together by hydrophobic interactions. Considering the forces that some cells may experience, why do membranes not break apart every time an animal moves?
Structural features of membrane proteins relate to function As we’ve just detailed, membrane proteins can serve a variety of functions. These diverse functions arise from the diverse structures of these proteins, yet they also have common structural features related to their role as membrane proteins.
The anchoring of proteins in the bilayer Some membrane proteins are attached to the surface of the membrane by special molecules that associate strongly with phospholipids. Like a ship tied to a floating dock, these anchored proteins are free to move about on the surface of the membrane tethered to a phospholipid. The anchoring molecules are modified lipids that have (1) nonpolar regions that insert into the internal portion of the lipid bilayer and (2) chemical bonding domains that link directly to proteins. Protein anchored to phospholipid
94
part
In contrast, other proteins actually span the lipid bilayer (transmembrane proteins). The part of the protein that extends through the lipid bilayer and that is in contact with the nonpolar interior are α-helices or β-pleated sheets (see chapter 3) that consist of nonpolar amino acids. Because water avoids nonpolar amino acids, these portions of the protein are held within the interior of the lipid bilayer. The polar ends protrude from both sides of the membrane. Any movement of the protein out of the membrane, in either direction, brings the nonpolar regions of the protein into contact with water, which “shoves” the protein back into the interior. These forces prevent the transmembrane proteins from simply popping out of the membrane and floating away.
Transmembrane domains Cell membranes contain a variety of different transmembrane proteins, which differ in the way they traverse the lipid bilayer. The primary difference lies in the number of times that the protein crosses the membrane. Each membrane-spanning region is called a transmembrane domain. These domains are composed of hydrophobic amino acids usually arranged into α helices (figure 5.6). Proteins need only a single transmembrane domain to be anchored in the membrane, but they often have more than one such domain. An example of a protein with a single transmembrane domain is the linking protein that attaches the spectrin network of the cytoskeleton to the interior of the plasma membrane.
II Biology of the Cell
rav32223_ch05_088-106.indd 94
11/6/09 12:01:55 PM
helical segments that traverse the membrane, forming a structure within the membrane through which protons pass during the light-driven pumping of protons (figure 5.7).
Pores Some transmembrane proteins have extensive nonpolar regions with secondary configurations of β-pleated sheets instead of α helices (chapter 3). The β sheets form a characteristic motif, folding back and forth in a cylinder so the sheets arrange themselves like a pipe through the membrane. This forms a polar environment in the interior of the β sheets spanning the membrane. This so-called β barrel, open on both ends, is a common feature of the porin class of proteins that are found within the outer membrane of some bacteria. The openings allow molecules to pass through the membrane (figure 5.8). a.
b.
Figure 5.6 Transmembrane domains. Integral membrane
Learning Outcomes Review 5.3
proteins have at least one hydrophobic transmembrane domain (shown in blue) to anchor them in the membrane. a. Receptor protein with seven transmembrane domains. b. Protein with single transmembrane domain.
Proteins in the membrane confer the main differences between membranes of different cells. Their functions include transport, enzymatic action, reception of extracellular signals, cell-to-cell interactions, and cell identity markers. Peripheral proteins can be anchored in the membrane by modified lipids. Integral membrane proteins span the membrane and have one or more hydrophobic regions, called transmembrane domains, that anchor them.
Biologists classify some types of receptors based on the number of transmembrane domains they have, such as G protein–coupled receptors with seven membrane-spanning domains (chapter 9). These receptors respond to external molecules, such as epinephrine, and initiate a cascade of events inside the cell. Another example is bacteriorhodopsin, one of the key transmembrane proteins that carries out photosynthesis in halophilic (salt-loving) archaea. It contains seven nonpolar
■
?
Why are transmembrane domains hydrophobic?
Inquiry question Based only on amino acid sequence, how would you recognize an integral membrane protein?
Retinal chromophore
b-pleated sheets
Figure 5.7 Bacteriorhodopsin. This transmembrane protein mediates photosynthesis in the archaean Halobacterium salinarium. The protein traverses the membrane seven times with hydrophobic helical strands that are within the hydrophobic center of the lipid bilayer. The helical regions form a structure across the bilayer through which protons are pumped by the retinal chromophore (green) using energy from light. www.ravenbiology.com
rav32223_ch05_088-106.indd 95
Figure 5.8 A pore protein. The bacterial transmembrane protein porin creates large open tunnels called pores in the outer membrane of a bacterium. Sixteen strands of β-pleated sheets run antiparallel to one another, creating a so-called β barrel in the bacterial outer cell membrane. The tunnel allows water and other materials to pass through the membrane. chapter
5 Membranes
95
11/6/09 12:01:58 PM
5.4
Passive Transport Across Membranes
Learning Outcomes 1. 2. 3.
Compare simple diffusion and facilitated diffusion. Differentiate between channel proteins and carrier proteins. Explain the movement of water by osmosis.
Many substances can move in and out of the cell without the cell’s having to expend energy. This type of movement is termed passive transport. Some ions and molecules can pass through the membrane fairly easily and do so because of a concentration gradient—a difference between the concentration on the inside of the membrane and that on the outside. Some substances also move in response to a gradient, but do so through specific channels formed by proteins in the membrane.
Transport can occur by simple diffusion Molecules and ions dissolved in water are in constant random motion. This random motion causes a net movement of these substances from regions of high concentration to regions of lower concentration, a process called diffusion (figure 5.9). Net movement driven by diffusion will continue until the concentration is the same in all regions. Consider what happens when you add a drop of colored ink to a bowl of water. Over time the ink becomes dispersed throughout the solution. This is due to diffusion of the ink molecules. In the context of cells, we are usually concerned with differences in concentration of molecules across the plasma membrane. We need to consider the relative concentrations both inside and outside the cell, as well as how readily a molecule can cross the membrane.
Figure 5.9 Diffusion. If a drop of colored ink is dropped into a beaker of water (a) its molecules dissolve (b) and diffuse (c). Eventually, diffusion results in an even distribution of ink molecules throughout the water (d).
a. 96
b. part
c.
The major barrier to crossing a biological membrane is the hydrophobic interior that repels polar molecules but not nonpolar molecules. If a concentration difference exists for a nonpolar molecule, it will move across the membrane until the concentration is equal on both sides. At this point, movement in both directions still occurs, but there is no net change in either direction. This includes molecules like O2 and nonpolar organic molecules such as steroid hormones. The plasma membrane has limited permeability to small polar molecules and very limited permeability to larger polar molecules and ions. The movement of water, one of the most important polar molecules, is discussed in its own section later on.
Proteins allow membrane diffusion to be selective Many important molecules required by cells cannot easily cross the plasma membrane. These molecules can still enter the cell by diffusion through specific channel proteins or carrier proteins embedded in the plasma membrane, provided there is a higher concentration of the molecule outside the cell than inside. We call this process of diffusion mediated by a membrane protein facilitated diffusion. Channel proteins have a hydrophilic interior that provides an aqueous channel through which polar molecules can pass when the channel is open. Carrier proteins, in contrast to channels, bind specifically to the molecule they assist, much like an enzyme binds to its substrate. These channels and carriers are usually selective for one type of molecule, and thus the cell membrane is said to be selectively permeable.
Facilitated diffusion of ions through channels You saw in chapter 2 that atoms with an unequal number of protons and electrons have an electric charge and are called ions. Those that carry a positive charge are called cations and those that carry a negative charge are called anions. Because of their charge, ions interact well with polar molecules such as water, but are repelled by nonpolar molecules such as the interior of the plasma membrane. Therefore, ions cannot move between the cytoplasm of a cell and the extracellular fluid without the assistance of membrane transport proteins. Ion channels possess a hydrated interior that spans the membrane. Ions can diffuse through the channel in either direction, depending on their relative concentration across the membrane (figure 5.10). Some channel proteins can be opened or closed in response to a stimulus. These channels are called gated channels, and depending on the nature of the channel, the stimulus can be either chemical or electrical. Three conditions determine the direction of net movement of the ions: (1) their relative concentrations on either side of the membrane, (2) the voltage difference across the membrane and for the gated channels, and d.
II Biology of the Cell
rav32223_ch05_088-106.indd 96
11/6/09 12:02:04 PM
Extracellular fluid
Cytoplasm
Extracellular fluid
Extracellular fluid
Cytoplasm
a.
Cytoplasm
b.
Figure 5.10 Facilitated diffusion. Diffusion can be facilitated by membrane proteins. a. The movement of ions through a channel is shown. On the left the concentration is higher outside the cell, so the ions move into the cell. On the right the situation is reversed. In both cases, transport continues until the concentration is equal on both sides of the membrane. At this point, ions continue to cross the membrane in both directions, but there is no net movement in either direction. b. Carrier proteins bind specifically to the molecules they transport. In this case, the concentration is higher outside the cell, so molecules bind to the carrier on the outside. The carrier’s shape changes, allowing the molecule to cross the membrane. This is reversible, so net movement continues until the concentration is equal on both sides of the membrane. (3) the state of the gate (open or closed). A voltage difference is an electrical potential difference across the membrane called a membrane potential. Changes in membrane potential form the basis for transmission of signals in the nervous system and some other tissues. (We discuss this topic in detail in chapter 45.) Each type of channel is specific for a particular ion, such as calcium (Ca2+), sodium (Na+), potassium (K+), or chloride (Cl–), or in some cases, for more than one cation or anion. Ion channels play an essential role in signaling by the nervous system.
Facilitated diffusion by carrier proteins Carrier proteins can help transport both ions and other solutes, such as some sugars and amino acids, across the membrane. Transport through a carrier is still a form of diffusion and therefore requires a concentration difference across the membrane. Carriers must bind to the molecule they transport, so the relationship between concentration and rate of transport differs from that due to simple diffusion. As concentration increases, transport by simple diffusion shows a linear increase in rate of transport. But when a carrier protein is involved, a concentration increase means that more of the carriers are bound to the transported molecule. At high enough concentrations all carriers will be occupied, and the rate of transport will be constant. This means that the carrier exhibits saturation. This situation is somewhat like that of a stadium (the cell) where a crowd must pass through turnstiles to enter. If there are unoccupied turnstiles, you can go right through, but when all are occupied, you must wait. When ticket holders are passing through the gates at maximum speed, the rate at which they enter cannot increase, no matter how many are waiting outside.
Facilitated diffusion in red blood cells Several examples of facilitated diffusion can be found in the plasma membrane of vertebrate red blood cells (RBCs). One RBC carrier protein, for example, transports a different molecule in each direction: chloride ion (Cl–) in one direction and bicarbonate ion (HCO3–) in the opposite direction. As you will www.ravenbiology.com
rav32223_ch05_088-106.indd 97
learn in chapter 51, this carrier is important in the uptake and release of carbon dioxide. The glucose transporter is a second vital facilitated diffusion carrier in RBCs. Red blood cells keep their internal concentration of glucose low through a chemical trick: They immediately add a phosphate group to any entering glucose molecule, converting it to a highly charged glucose phosphate that can no longer bind to the glucose transporter, and therefore cannot pass back across the membrane. This maintains a steep concentration gradient for unphosphorylated glucose, favoring its entry into the cell. The glucose transporter that assists the entry of glucose into the cell does not appear to form a channel in the membrane. Instead, this transmembrane protein appears to bind to a glucose molecule and then to flip its shape, dragging the glucose through the bilayer and releasing it on the inside of the plasma membrane. After it releases the glucose, the transporter reverts to its original shape and is then available to bind the next glucose molecule that comes along outside the cell.
Osmosis is the movement of water across membranes The cytoplasm of a cell contains ions and molecules, such as sugars and amino acids, dissolved in water. The mixture of these substances and water is called an aqueous solution. Water is termed the solvent, and the substances dissolved in the water are solutes. Both water and solutes tend to diffuse from regions of high concentration to ones of low concentration; that is, they diffuse down their concentration gradients. When two regions are separated by a membrane, what happens depends on whether the solutes can pass freely through that membrane. Most solutes, including ions and sugars, are not lipid-soluble and, therefore, are unable to cross the lipid bilayer. The concentration gradient of these solutes can lead to the movement of water. chapter
5 Membranes
97
11/6/09 12:02:05 PM
Osmosis Water molecules interact with dissolved solutes by forming hydration shells around the charged solute molecules. When a membrane separates two solutions with different concentrations of solutes, the concentrations of free water molecules on the two sides of the membrane also differ. The side with higher solute concentration has tied up more water molecules in hydration shells and thus has fewer free water molecules. As a consequence of this difference, free water molecules move down their concentration gradient, toward the higher solute concentration. This net diffusion of water across a membrane toward a higher solute concentration is called osmosis (figure 5.11). The concentration of all solutes in a solution determines the osmotic concentration of the solution. If two solutions have unequal osmotic concentrations, the solution with the higher concentration is hypertonic (Greek hyper, “more than”), and the solution with the lower concentration is hypotonic (Greek hypo, “less than”). When two solutions have the same osmotic concentration, the solutions are isotonic (Greek iso, “equal”). The terms hyperosmotic, hypoosmotic, and isosmotic are also used to describe these conditions.
Urea molecule
Water molecules
Semipermeable membrane
Figure 5.11 Osmosis. Concentration differences in charged or polar molecules that cannot cross a semipermeable membrane result in movement of water, which can cross the membrane. Water molecules form hydrogen bonds with charged or polar molecules creating a hydration shell around them in solution. A higher concentration of polar molecules (urea) shown on the left side of the membrane leads to water molecules gathering around each urea molecule. These water molecules are no longer free to diffuse across the membrane. The polar solute has reduced the concentration of free water molecules, creating a gradient. This causes a net movement of water by diffusion from right to left in the U-tube, raising the level on the left and lowering the level on the right. 98
part
A cell in any environment can be thought of as a plasma membrane separating two solutions: the cytoplasm and the extracellular fluid. The direction and extent of any diffusion of water across the plasma membrane is determined by comparing the osmotic strength of these solutions. Put another way, water diffuses out of a cell in a hypertonic solution (that is, the cytoplasm of the cell is hypotonic, compared with the extracellular fluid). This loss of water causes the cell to shrink until the osmotic concentrations of the cytoplasm and the extracellular fluid become equal.
Aquaporins: Water channels The transport of water across the membrane is complex. Studies on artificial membranes show that water, despite its polarity, can cross the membrane, but this flow is limited. Water flow in living cells is facilitated by aquaporins, which are specialized channels for water. A simple experiment demonstrates this. If an amphibian egg is placed in hypotonic spring water (the solute concentration in the cell is higher than that of the surrounding water), it does not swell. If aquaporin mRNA is then injected into the egg, the channel proteins are expressed and appear in the egg’s plasma membrane. Water can now diffuse into the egg, causing it to swell. More than 11 different kinds of aquaporins have been found in mammals. These fall into two general classes: those that are specific for only water, and those that allow other small hydrophilic molecules, such as glycerol or urea, to cross the membrane as well. This latter class explains how some membranes allow the easy passage of small hydrophilic substances. The human genetic disease, hereditary (nephrogenic) diabetes insipidus (NDI), has been shown to be caused by a nonfunctional aquaporin protein. This disease causes the excretion of large volumes of dilute urine, illustrating the importance of aquaporins to our physiology.
Osmotic pressure What happens to a cell in a hypotonic solution? (That is, the cell’s cytoplasm is hypertonic relative to the extracellular fluid.) In this situation, water diffuses into the cell from the extracellular fluid, causing the cell to swell. The pressure of the cytoplasm pushing out against the cell membrane, or hydrostatic pressure, increases. The amount of water that enters the cell depends on the difference in solute concentration between the cell and the extracellular fluid. This is measured as osmotic pressure, defined as the force needed to stop osmotic flow. If the membrane is strong enough, the cell reaches an equilibrium, at which the osmotic pressure, which tends to drive water into the cell, is exactly counterbalanced by the hydrostatic pressure, which tends to drive water back out of the cell. However, a plasma membrane by itself cannot withstand large internal pressures, and an isolated cell under such conditions would burst like an overinflated balloon (figure 5.12). Accordingly, it is important for animal cells, which only have plasma membranes, to maintain osmotic balance. In contrast, the cells of prokaryotes, fungi, plants, and many protists are surrounded by strong cell walls, which can withstand high internal pressures without bursting.
II Biology of the Cell
rav32223_ch05_088-106.indd 98
11/6/09 12:02:11 PM
Human Red Blood Cells
Hypertonic Solution
Isotonic Solution
Hypotonic Solution
Shriveled cells
Normal cells
Cells swell and eventually burst
0.55 µm
0.55 µm
Isosmotic Regulation. Some organisms that live in the ocean adjust their internal concentration of solutes to match that of the surrounding seawater. Because they are isosmotic with respect to their environment, no net flow of water occurs into or out of these cells. Many terrestrial animals solve the problem in a similar way, by circulating a fluid through their bodies that bathes cells in an isotonic solution. The blood in your body, for example, contains a high concentration of the protein albumin, which elevates the solute concentration of the blood to match that of your cells’ cytoplasm. Turgor. Most plant cells are hypertonic to their immediate environment, containing a high concentration of solutes in their central vacuoles. The resulting internal hydrostatic pressure, known as turgor pressure, presses the plasma membrane firmly against the interior of the cell wall, making the cell rigid. Most green plants depend on turgor pressure to maintain their shape, and thus they wilt when they lack sufficient water.
0.55 µm
Plant Cells
Learning Outcomes Review 5.4
Cell body shrinks from cell wall
Flaccid cell
Normal turgid cell
Passive transport involves diffusion, which requires a concentration gradient. Hydrophobic molecules can diffuse directly through the membrane (simple diffusion). Polar molecules and ions can also diffuse through the membrane, but only with the aid of a channel or carrier protein (facilitated diffusion). Channel proteins assist by forming a hydrophilic passageway through the membrane, whereas carrier proteins bind to the molecule they assist. Water passes through the membrane and through aquaporins in response to solute concentration differences inside and outside the cell. This process is called osmosis.
Figure 5.12 How solutes create osmotic pressure. In a hypertonic solution, water moves out of the cell, causing the cell to shrivel. In an isotonic solution, water diffuses into and out of the cell at the same rate, with no change in cell size. In a hypotonic solution, water moves into the cell. Direction and amount of water movement is shown with blue arrows (top). As water enters the cell from a hypotonic solution, pressure is applied to the plasma membrane until the cell ruptures. Water enters the cell due to osmotic pressure from the higher solute concentration in the cell. Osmotic pressure is measured as the force needed to stop osmosis. The strong cell wall of plant cells can withstand the hydrostatic pressure to keep the cell from rupturing. This is not the case with animal cells.
■
If you require intravenous (IV) medication in the hospital, what should the concentration of solutes in the IV solution be relative to your blood cells?
5.5
Active Transport Across Membranes
Maintaining osmotic balance Organisms have developed many strategies for solving the dilemma posed by being hypertonic to their environment and therefore having a steady influx of water by osmosis. Extrusion. Some single-celled eukaryotes, such as the protist Paramecium, use organelles called contractile vacuoles to remove water. Each vacuole collects water from various parts of the cytoplasm and transports it to the central part of the vacuole, near the cell surface. The vacuole possesses a small pore that opens to the outside of the cell. By contracting rhythmically, the vacuole pumps out (extrudes) through this pore the water that is continuously drawn into the cell by osmotic forces. www.ravenbiology.com
rav32223_ch05_088-106.indd 99
Learning Outcomes 1. 2. 3.
Differentiate between active transport and diffusion. Describe the function of the Na+/K+ pump. Explain the energetics of coupled transport.
Diffusion, facilitated diffusion, and osmosis are passive transport processes that move materials down their concentration gradients, but cells can also actively move substances across a cell membrane up their concentration gradients. This process requires the expenditure of energy, typically from ATP, and is therefore called active transport. chapter
5 Membranes
99
11/6/09 12:02:13 PM
Active transport uses energy to move materials against a concentration gradient Like facilitated diffusion, active transport involves highly selective protein carriers within the membrane that bind to the transported substance, which could be an ion or a simple molecule, such as a sugar, an amino acid, or a nucleotide. These carrier proteins are called uniporters if they transport a single type of molecule and symporters or antiporters if they transport two different molecules together. Symporters transport two molecules in the same direction, and antiporters transport two molecules in opposite directions. These terms can also be used to describe facilitated diffusion carriers. Active transport is one of the most important functions of any cell. It enables a cell to take up additional molecules of a substance that is already present in its cytoplasm in concentrations higher than in the extracellular fluid. Active
transport also enables a cell to move substances out of its cytoplasm and into the extracellular fluid, despite higher external concentrations. The use of energy from ATP in active transport may be direct or indirect. Let’s first consider how ATP is used directly to move ions against their concentration gradients.
The sodium–potassium pump runs directly on ATP More than one-third of all of the energy expended by an animal cell that is not actively dividing is used in the active transport of sodium (Na+) and potassium (K+) ions. Most animal cells have a low internal concentration of Na+, relative to their surroundings, and a high internal concentration of K+. They maintain these concentration differences by actively pumping Na+ out of the cell and K+ in.
Extracellular
Na; K;
P
Intracellular 1. Carrier in membrane binds intracellular sodium. 6. Dephosphorylation of protein triggers change back to original conformation, with low affinity for K;. K; diffuses into the cell, and the cycle repeats.
+
ADP
ATP
2. ATP phosphorylates protein with bound sodium.
P P P P 5. Binding of potassium causes dephosphorylation of protein.
3. Phosphorylation causes conformational change in protein, reducing its affinity for Na;. The Na; then diffuses out.
4. This conformation has higher affinity for K;. Extracellular potassium binds to exposed sites.
Figure 5.13 The sodium–potassium pump. The protein carrier known as the sodium–potassium pump transports sodium (Na+) and potassium (K+) across the plasma membrane. For every three Na+ transported out of the cell, two K+ are transported into it. The sodium– potassium pump is fueled by ATP hydrolysis. The affi nity of the pump for Na+ and K+ is changed by adding or removing phosphate (P), which changes the conformation of the protein.
100
part
II Biology of the Cell
rav32223_ch05_088-106.indd 100
11/6/09 12:02:15 PM
The remarkable protein that transports these two ions across the cell membrane is known as the sodium–potassium pump (figure 5.13). This carrier protein uses the energy stored in ATP to move these two ions. In this case, the energy is used to change the conformation of the carrier protein, which changes its affinity for either Na+ ions or K+ ions. This is an excellent illustration of how subtle changes in the structure of a protein affect its function. The important characteristic of the sodium–potassium pump is that it is an active transport mechanism, transporting Na+ and K+ from areas of low concentration to areas of high concentration. This transport is the opposite of passive transport by diffusion; it is achieved only by the constant expenditure of metabolic energy. The sodium–potassium pump works through the following series of conformational changes in the transmembrane protein (summarized in figure 5.13): Step 1. Three Na+ bind to the cytoplasmic side of the protein, causing the protein to change its conformation. Step 2. In its new conformation, the protein binds a molecule of ATP and cleaves it into adenosine diphosphate (ADP) and phosphate (Pi). ADP is released, but the phosphate group is covalently linked to the protein. The protein is now phosphorylated. Step 3. The phosphorylation of the protein induces a second conformational change in the protein. This change translocates the three Na+ across the membrane, so they now face the exterior. In this new conformation, the protein has a low affinity for Na+, and the three bound Na+ break away from the protein and diffuse into the extracellular fluid. Step 4. The new conformation has a high affinity for K+, two of which bind to the extracellular side of the protein as soon as it is free of the Na+. Step 5. The binding of the K+ causes another conformational change in the protein, this time resulting in the hydrolysis of the bound phosphate group. Step 6. Freed of the phosphate group, the protein reverts to its original shape, exposing the two K+ to the cytoplasm. This conformation has a low affinity for K+, so the two bound K+ dissociate from the protein and diffuse into the interior of the cell. The original conformation has a high affinity for Na+. When these ions bind, they initiate another cycle. In every cycle, three Na+ leave the cell and two K+ enter. The changes in protein conformation that occur during the cycle are rapid, enabling each carrier to transport as many as 300 Na+ per second. The sodium–potassium pump appears to exist in all animal cells, although cells vary widely in the number of pump proteins they contain.
Coupled transport uses ATP indirectly Some molecules are moved against their concentration gradient by using the energy stored in a gradient of a different molecule. In this process, called coupled transport, the energy released
www.ravenbiology.com
rav32223_ch05_088-106.indd 101
as one molecule moves down its concentration gradient is captured and used to move a different molecule against its gradient. As you just saw, the energy stored in ATP molecules can be used to create a gradient of Na+ and K+ across the membrane. These gradients can then be used to power the transport of other molecules across the membrane. As one example, let’s consider the active transport of glucose across the membrane in animal cells. Glucose is such an important molecule that there are a variety of transporters for it, one of which was discussed earlier under passive transport. In a multicellular organism, intestinal epithelial cells can have a higher concentration of glucose inside the cell than outside, so these cells need to be able to transport glucose against its concentration gradient. This requires energy and a different transporter than the one involved in facilitated diffusion of glucose. The active glucose transporter uses the Na+ gradient produced by the sodium–potassium pump as a source of energy to power the movement of glucose into the cell. In this system, both glucose and Na+ bind to the transport protein, which allows Na+ to pass into the cell down its concentration gradient, capturing the energy and using it to move glucose into the cell. In this kind of cotransport, both molecules are moving in the same direction across the membrane; therefore the transporter is a symporter (figure 5.14).
Outside of cell
Na; Glucose Na;/
K;
Coupled transport protein
pump
ATP ADP+Pi
Inside of cell
K;
Figure 5.14 Coupled transport. A membrane protein transports Na+ into the cell, down its concentration gradient, at the same time it transports a glucose molecule into the cell. The gradient driving the Na+ entry allows sugar molecules to be transported against their concentration gradient. The Na+ gradient is maintained by the Na+/K+ pump. ADP = adenosine diphosphate; ATP = adenosine triphosphate; Pi = inorganic phosphate
chapter
5 Membranes
101
11/6/09 12:02:21 PM
In a related process, called countertransport, the inward movement of Na+ is coupled with the outward movement of another substance, such as Ca2+ or H+. As in cotransport, both Na+ and the other substance bind to the same transport protein, which in this case is an antiporter, as the substances bind on opposite sides of the membrane and are moved in opposite directions. In countertransport, the cell uses the energy released as Na+ moves down its concentration gradient into the cell to eject a substance against its concentration gradient. In both cotransport and countertransport, the potential energy in the concentration gradient of one molecule is used to transport another molecule against its concentration gradient. They differ only in the direction that the second molecule moves relative to the first.
5.6
Learning Outcomes 1. 2.
Active transport requires both a carrier protein and energy, usually in the form of ATP, to move molecules against a concentration gradient. The sodium–potassium pump uses ATP to moved Na+ in one direction and K+ in the other to create and maintain concentration differences of these ions. In coupled transport, a favorable concentration gradient of one molecule is used to move a different molecule against its gradient, such as in the transport of glucose by Na+.
Bulk material enters the cell in vesicles In endocytosis, the plasma membrane envelops food particles and fluids. Cells use three major types of endocytosis: phagocytosis, pinocytosis, and receptor-mediated endocytosis (figure 5.15). Like active transport, these processes also require energy expenditure.
Can active transport involve a channel protein. Why or why not?
Figure 5.15 Endocytosis. Both (a) phagocytosis and (b) pinocytosis are forms of endocytosis. c. In receptor-mediated endocytosis, cells have pits coated with the protein clathrin that initiate endocytosis when target molecules bind to receptor proteins in the plasma membrane. Photo inserts (false color has been added to enhance distinction of structures): (a) A TEM of phagocytosis of a bacterium, Rickettsia tsutsugamushi, by a mouse peritoneal mesothelial cell. The bacterium enters the host cell by phagocytosis and replicates in the cytoplasm. (b) A TEM of pinocytosis in a smooth muscle cell. (c) A coated pit appears in the plasma membrane of a developing egg cell, covered with a layer of proteins. When an appropriate collection of molecules gathers in the coated pit, the pit deepens and will eventually seal off to form a vesicle.
Distinguish between endocytosis and exocytosis. Explain how endocytosis can be specific.
The lipid nature of cell plasma membranes raises a second problem. The substances cells require for growth are mostly large, polar molecules that cannot cross the hydrophobic barrier a lipid bilayer creates. How do these substances get into cells? Two processes are involved in this bulk transport: endocytosis and exocytosis.
Learning Outcomes Review 5.5
■
Bulk Transport by Endocytosis and Exocytosis
Bacterial cells
Plasma membrane Cytoplasm
a. Phagocytosis
1 µm Solute
Plasma membrane Cytoplasm
b. Pinocytosis
0.1 µm
Target molecule Receptor protein Coated pit
Clathrin
c. Receptor-mediated endocytosis 102
part
Coated vesicle
0.093 µm
II Biology of the Cell
rav32223_ch05_088-106.indd 102
11/6/09 12:02:23 PM
Phagocytosis and pinocytosis If the material the cell takes in is particulate (made up of discrete particles), such as an organism or some other fragment of organic matter (figure 5.15a), the process is called phagocytosis (Greek phagein, “to eat,” + cytos, “cell”). If the material the cell takes in is liquid (figure 5.15b), the process is called pinocytosis (Greek pinein, “to drink”). Pinocytosis is common among animal cells. Mammalian egg cells, for example, “nurse” from surrounding cells; the nearby cells secrete nutrients that the maturing egg cell takes up by pinocytosis. Virtually all eukaryotic cells constantly carry out these kinds of endocytotic processes, trapping particles and extracellular fluid in vesicles and ingesting them. Endocytosis rates vary from one cell type to another. They can be surprisingly high; some types of white blood cells ingest up to 25% of their cell volume each hour.
Receptor-mediated endocytosis Molecules are often transported into eukaryotic cells through receptor-mediated endocytosis. These molecules first bind to specific receptors in the plasma membrane—they have a conformation that fits snugly into the receptor. Different cell types contain a characteristic battery of receptor types, each for a different kind of molecule in their membranes. The portion of the receptor molecule that lies inside the membrane is trapped in an indented pit coated on the cytoplasmic side with the protein clathrin. Each pit acts like a molecular mousetrap, closing over to form an internal vesicle when the right molecule enters the pit (figure 5.15c). The trigger that releases the trap is the binding of the properly fitted target molecule to the embedded receptor. When binding occurs, the cell reacts by initiating endocytosis; the process is highly specific and very fast. The vesicle is now inside the cell carrying its cargo. One type of molecule that is taken up by receptormediated endocytosis is low-density lipoprotein (LDL). LDL molecules bring cholesterol into the cell where it can be in-
corporated into membranes. Cholesterol plays a key role in determining the stiffness of the body’s membranes. In the human genetic disease familial hypercholesterolemia, the LDL receptors lack tails, so they are never fastened in the clathrincoated pits and as a result, do not trigger vesicle formation. The cholesterol stays in the bloodstream of affected individuals, accumulating as plaques inside arteries and leading to heart attacks. It is important to understand that endocytosis in itself does not bring substances directly into the cytoplasm of a cell. The material taken in is still separated from the cytoplasm by the membrane of the vesicle.
Material can leave the cell by exocytosis The reverse of endocytosis is exocytosis, the discharge of material from vesicles at the cell surface (figure 5.16). In plant cells, exocytosis is an important means of exporting the materials needed to construct the cell wall through the plasma membrane. Among protists, contractile vacuole discharge is considered a form of exocytosis. In animal cells, exocytosis provides a mechanism for secreting many hormones, neurotransmitters, digestive enzymes, and other substances. The mechanisms for transport across cell membranes are summarized in table 5.2.
Learning Outcomes Review 5.6 Large molecules and other bulky materials can enter a cell by endocytosis and leave the cell by exocytosis. These processes require energy. Endocytosis may be mediated by specific receptor proteins in the membrane that trigger the formation of vesicles. ■
What feature unites transport by receptor-mediated endocytosis, transport by a carrier, and catalysis by an enzyme?
Plasma membrane Secretory product
Secretory vesicle Cytoplasm
a.
b.
0.069 µm
Figure 5.16 Exocytosis. a. Proteins and other molecules are secreted from cells in small packets called vesicles, whose membranes fuse with the plasma membrane, releasing their contents outside the cell. b. A false-colored transmission electron micrograph showing exocytosis. www.ravenbiology.com
rav32223_ch05_088-106.indd 103
chapter
5 Membranes
103
11/9/09 10:29:51 AM
Mechanisms for Transport Across Cell Membranes
TA B L E 5 . 2 Process P A S S I V E
How It Works
Example
P R O C E S S E S
Diffusion Direct
Random molecular motion produces net migration of nonpolar molecules toward region of lower concentration
Movement of oxygen into cells
Protein channel
Polar molecules or ions move through a protein channel; net movement is toward region of lower concentration
Movement of ions in or out of cell
Protein carrier
Molecule binds to carrier protein in membrane and is transported across; net movement is toward region of lower concentration
Movement of glucose into cells
Diffusion of water across the membrane via osmosis; requires osmotic gradient
Movement of water into cells placed in a hypotonic solution
Na+/K+ pump
Carrier uses energy to move a substance across a membrane against its concentration gradient
Na+ and K+ against their concentration gradients
Coupled transport
Molecules are transported across a membrane against their concentration gradients by the cotransport of sodium ions or protons down their concentration gradients
Coupled uptake of glucose into cells against its concentration gradient using a Na+ gradient
Phagocytosis
Particle is engulfed by membrane, which folds around it and forms a vesicle
Ingestion of bacteria by white blood cells
Pinocytosis
Fluid droplets are engulfed by membrane, which forms vesicles around them
“Nursing” of human egg cells
Receptor-mediated endocytosis
Endocytosis triggered by a specific receptor, forming clathrin-coated vesicles
Cholesterol uptake
Facilitated Diffusion
Osmosis Aquaporins
A C T I V E
P R O C E S S E S
Active Transport Protein carrier
Endocytosis Membrane vesicle
Exocytosis Membrane vesicle
104
part
Vesicles fuse with plasma membrane and eject contents
Secretion of mucus; release of neurotransmitters
II Biology of the Cell
rav32223_ch05_088-106.indd 104
11/6/09 12:02:37 PM
Chapter Review 5.1 The Structure of Membranes
5.4 Passive Transport Across Membranes
The fluid mosaic model shows proteins embedded in a fluid lipid bilayer. Membranes are sheets of phospholipid bilayers with associated proteins (figure 5.2). Hydrophobic regions of a membrane are oriented inward and hydrophilic regions oriented outward. In the fluid mosaic model, proteins float on or in the lipid bilayer.
Transport can occur by simple diffusion. Simple diffusion is the passive movement of a substance along a chemical or electrical gradient. Biological membranes pose a barrier to hydrophilic polar molecules, while they allow hydrophobic substances to diffuse freely.
Cellular membranes consist of four component groups. In eukaryotic cells, membranes have four components: a phosopholipid bilayer, transmembrane proteins (integral membrane proteins), an interior protein network, and cell-surface markers. The interior protein network is composed of cytoskeletal filaments and peripheral membrane proteins, which are associated with the membrane but are not an integral part. Membranes contain glycoproteins and glycolipids on the surface that act as cell identity markers. Electron microscopy has provided structural evidence. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) have confirmed the structure predicted by the fluid mosaic model.
5.2 Phospholipids: The Membrane’s Foundation Phospholipids are composed of two fatty acids and a phosphate group linked to a three-carbon glycerol molecule. Phospholipids spontaneously form bilayers. The phosphate group of a phospholipid is polar and hydrophilic; the fatty acids are nonpolar and hydrophobic, and they orient away from the polar head of the phospholipids. The nonpolar interior of the lipid bilayer impedes the passage of water and water-soluble substances. The phospholipid bilayer is fluid. Hydrogen bonding of water keeps the membrane in its bilayer configuration; however, phospholipids and unanchored proteins in the membrane are loosely associated and can diffuse laterally. Membrane fluidity can change. Membrane fluidity depends on the fatty acid composition of the membrane. Unsaturated fats tend to make the membrane more fluid because of the “kinks” of double bonds in the fatty acid tails. Temperature also affects fluidity. Some bacteria have enzymes that alter the fatty acids of the membrane to compensate for temperature changes.
5.3 Proteins: Multifunctional Components Proteins and protein complexes perform key functions. Transporters are integral membrane proteins that carry specific substances through the membrane. Enzymes often occur on the interior surface of the membrane. Cell-surface receptors respond to external chemical messages and change conditions inside the cell; cell identity markers on the surface allow recognition of the body’s cells as “self.” Cell-to-cell adhesion proteins glue cells together; surface proteins that interact with other cells anchor to the cytoskeleton. Structural features of membrane proteins relate to function. Surface proteins are attached to the surface by nonpolar regions that associate with polar regions of phospholipids. Transmembrane proteins may cross the bilayer a number of times, and each membrane-spanning region is called a transmembrane domain. Such a domain is composed of hydrophobic amino acids usually arranged in α-helices. In certain proteins, β-pleated sheets in the nonpolar region form a pipelike passageway having a polar environment. An example is the porin class of proteins. www.ravenbiology.com
rav32223_ch05_088-106.indd 105
Proteins allow membrane diffusion to be selective. Ions and large hydrophilic molecules cannot cross the phospholipid bilayer. Diffusion can still occur with the help of proteins, thus we call this facilitated diffusion. These proteins can be either channels, or carriers. Channels allow the diffusion of ions based on concentration and charge across the membrane. They are specific for different ions, but form an aqueous pore in the membrane. Carrier proteins bind to the molecules they transport, much like an enzyme. The rate of transport by a carrier is limited by the number of carriers in the membrane. Osmosis is the movement of water across membranes. The direction of movement due to osmosis depends on the solute concentration on either side of the membrane (figure 5.12). Solutions can be isotonic, hypotonic, or hypertonic. Cells in an isotonic solution are in osmotic balance; cells in a hypotonic solution will gain water; and cells in a hypertonic solution will lose water. Aquaporins are water channels that facilitate the diffusion of water.
5.5 Active Transport Across Membranes Active transport uses energy to move materials against a concentration gradient. Active transport uses specialized protein carriers that couple a source of energy to transport. They are classified based on the number of molecules and direction of transport. Uniporters transport a specific molecule in one direction; symporters transport two molecules in the same direction; and antiporters transport two molecules in opposite directions. The sodium–potassium pump runs directly on ATP. The sodium–potassium pump moves Na+ out of the cell and K+ into the cell against their concentration gradients using ATP. In every cycle of the pump, three Na+ leave the cell and two K+ enter it. This pump appears to be almost universal in animal cells. Coupled transport uses ATP indirectly. Coupled transport occurs when the energy released by a diffusing molecule is used to transport a different molecule against its concentration gradient in the same direction. Countertransport is similar to coupled transport, but the two molecules move in opposite directions.
5.6 Bulk Transport by Endocytosis and Exocytosis Bulk transport moves large quantities of substances that cannot pass through the cell membrane. Bulk material enters the cell in vesicles. In endocytosis, the cell membrane surrounds material and pinches off to form a vesicle. In receptor-mediated endocytosis, specific molecules bind to receptors on the cell membrane. Material can leave the cell by exocytosis. In exocytosis, material in a vesicle is discharged when the vesicle fuses with the membrane. chapter
5 Membranes
105
11/6/09 12:02:40 PM
Review Questions U N D E R S TA N D 1. The fluid mosaic model of the membrane describes the membrane as a. containing a significant quantity of water in the interior. b. composed of fluid phospholipids on the outside and protein on the inside. c. composed of protein on the outside and fluid phospholipids on the inside. d. made of proteins and lipids that can freely move. 2. What chemical property characterizes the interior of the phospholipid bilayer? a. It is hydrophobic. c. It is polar. b. It is hydrophilic. d. It is saturated. 3. The transmembrane domain of an integral membrane protein a. is composed of hydrophobic amino acids. b. often forms an α-helical structure. c. can cross the membrane multiple times. d. is all of the above. 4. The specific function of a membrane within a cell is determined by the a. degree of saturation of the fatty acids within the phospholipid bilayer. b. location of the membrane within the cell. c. presence of lipid rafts and cholesterol. d. type and number of membrane proteins. 5. The movement of water across a membrane is dependent on a. the solvent concentration. b. the solute concentration. c. the presence of carrier proteins. d. membrane potential. 6. If a cell is in an isotonic environment, then a. the cell will gain water and burst. b. no water will move across the membrane. c. the cell will lose water and shrink. d. osmosis still occurs, but there is no net gain or loss of cell volume. 7. Which of the following is NOT a mechanism for bringing material into a cell? a. Exocytosis c. Pinocytosis b. Endocytosis d. Phagocytosis
A P P LY 1. A bacterial cell that can alter the composition of saturated and unsaturated fatty acids in its membrane lipids is adapted to a cold environment. If this cell is shifted to a warmer environment, it will react by a. b. c. d.
increasing the amount of cholesterol in its membrane. altering the amount of protein present in the membrane. increasing the degree of saturated fatty acids in its membrane. increasing the percentage of unsaturated fatty acids in its membrane. 2. What variable(s) influence(s) whether a nonpolar molecule can move across a membrane by passive diffusion? a. b. 106
The structure of the phospholipids bilayer The difference in concentration of the molecule across the membrane
part
c. The presence of transport proteins in the membrane d. All of the above 3. Which of the following does NOT contribute to the selective permeability of a biological membrane? a. Specificity of the carrier proteins in the membrane b. Selectivity of channel proteins in the membrane c. Hydrophobic barrier of the phospholipid bilayer d. Hydrogen bond formation between water and phosphate groups 4. How are active transport and coupled transport related? a. They both use ATP to move molecules. b. Active transport establishes a concentration gradient, but coupled transport doesn’t. c. Coupled transport uses the concentration gradient established by active transport. d. Active transport moves one molecule, but coupled transport moves two. 5. A cell can use the process of facilitated diffusion to a. concentrate a molecule such as glucose inside a cell. b. remove all of a toxic molecule from a cell. c. move ions or large polar molecules across the membrane regardless of concentration. d. move ions or large polar molecules from a region of high concentration to a region of low concentration.
SYNTHESIZE 1. Figure 5.4 describes a classic experiment demonstrating the ability of proteins to move within the plane of the cell’s plasma membrane. The following table outlines three different experiments using the fusion of labeled mouse and human cells. Experiment
Conditions
Temperature (°C)
Result
1
Fuse human and mouse cells
37
Intermixed membrane proteins
2
Fuse human and mouse cells in presence of ATP inhibitors
37
Intermixed membrane proteins
3
Fuse human and mouse cells
4
No intermixing of membrane proteins
What conclusions can you reach about the movement of these proteins? 2. Each compartment of the endomembrane system of a cell is connected to the plasma membrane. Create a simple diagram of a cell including the RER, Golgi apparatus, vesicle, and the plasma membrane. Starting with the RER, use two different colors to represent the inner and outer halves of the bilayer for each of these membranes. What do you observe? 3. The distribution of lipids in the ER membrane is symmetric, that is, it is the same in both leaflets of the membrane. The Golgi apparatus and plasma membrane do not have symmetric distribution of membrane lipids. What kinds of processes could achieve this outcome?
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
II Biology of the Cell
rav32223_ch05_088-106.indd 106
11/6/09 12:02:40 PM
CHAPTER
Chapter
6
Energy and Metabolism
Chapter Outline 6.1
The Flow of Energy in Living Systems
6.2
The Laws of Thermodynamics and Free Energy
6.3
ATP: The Energy Currency of Cells
6.4
Enzymes: Biological Catalysts
6.5
Metabolism: The Chemical Description of Cell Function
L
Introduction Life can be viewed as a constant flow of energy, channeled by organisms to do the work of living. Each of the significant properties by which we define life—order, growth, reproduction, responsiveness, and internal regulation—requires a constant supply of energy. Both the lion and the giraffe need to eat to provide energy for a wide variety of cellular functions. Deprived of a source of energy, life stops. Therefore, a comprehensive study of life would be impossible without discussing bioenergetics, the analysis of how energy powers the activities of living systems. In this chapter, we focus on energy—what it is and how it changes during chemical reactions.
rav32223_ch06_107-121.indd 107
11/6/09 12:28:53 PM
6.1
The Flow of Energy in Living Systems
Learning Outcomes 1. 2. 3.
Explain what energy is and describe its different forms. Identify the source of energy for the biosphere. Contrast oxidation and reduction reactions.
Thermodynamics is the branch of chemistry concerned with energy changes. Cells are governed by the laws of physics and chemistry, so we must understand these laws in order to understand how cells function.
Energy can take many forms Energy is defined as the capacity to do work. We think of energy as existing in two states: kinetic energy and potential energy (figure 6.1). Kinetic energy is the energy of motion. Moving objects perform work by causing other matter to move. Potential energy is stored energy. Objects that are not actively moving but have the capacity to do so possess potential energy. A boulder perched on a hilltop has gravitational potential energy. As it begins to roll downhill, some of its potential energy is converted into kinetic energy. Much of the work that living organisms carry out involves transforming potential energy into kinetic energy. Energy can take many forms: mechanical energy, heat, sound, electric current, light, or radioactivity. Because it can exist in so
a. Potential energy
many forms, energy can be measured in many ways. Heat is the most convenient way of measuring energy because all other forms of energy can be converted into heat. In fact, the term thermodynamics means “heat changes.” The unit of heat most commonly employed in biology is the kilocalorie (kcal). One kilocalorie is equal to 1000 calories (cal). One calorie is the heat required to raise the temperature of one gram of water one degree Celsius (°C). (You are probably more used to seeing the term Calorie with a capital C. This is used on food labels and is actually the same as kilocalorie.) Another energy unit, often used in physics, is the joule; one joule equals 0.239 cal.
The sun provides energy for living systems Energy flows into the biological world from the Sun. It is estimated that the Sun provides the Earth with more than 13 × 1023 calories per year, or 40 million billion calories per second! Plants, algae, and certain kinds of bacteria capture a fraction of this energy through photosynthesis. In photosynthesis, energy absorbed from sunlight is used to combine small molecules (water and carbon dioxide) into more complex ones (sugars). This process converts carbon from an inorganic to an organic form. In the process, energy from the Sun is stored as potential energy in the covalent bonds between atoms in the sugar molecules. Breaking the bonds between atoms requires energy. In fact, the strength of a covalent bond is measured by the amount of energy required to break it. For example, it takes 98.8 kcal to break one mole (6.023 × 1023) of the carbon–hydrogen (C–H) bonds found in organic molecules. Fat molecules have many C–H bonds, and breaking those bonds provides lots of energy.
b. Kinetic energy
Figure 6.1 Potential and kinetic energy. a. Objects that have the capacity to move but are not moving have potential energy. The energy required for the girl to climb to the top of the slide is stored as potential energy. b. Objects that are in motion have kinetic energy. The stored potential energy is released as kinetic energy as the girl slides down.
108
part
II Biology of the Cell
rav32223_ch06_107-121.indd 108
11/6/09 12:28:58 PM
Loss of electron (oxidation)
6.2
e: +
A
A
B
A;
B
+
The Laws of Thermodynamics and Free Energy
B:
Learning Outcomes Gain of electron (reduction) lower energy
higher energy
1. 2. 3.
Explain the laws of thermodynamics. Recognize how free energy can be used to predict the outcome of chemical reactions. Contrast the course of a reaction with and without an enzyme catalyst.
Figure 6.2 Redox reactions. Oxidation is the loss of an electron; reduction is the gain of an electron. In this example, the charges of molecules A and B appear as superscripts in each molecule. Molecule A loses energy as it loses an electron, and molecule B gains that energy as it gains an electron.
This is one reason animals store fat. The oxidation of one mole of a 16-carbon fatty acid that is completely saturated with hydrogens yields 2340 kcal.
All activities of living organisms—growing, running, thinking, singing, reading these words—involve changes in energy. A set of two universal laws we call the laws of thermodynamics govern all energy changes in the universe, from nuclear reactions to a bird flying through the air.
Oxidation–reduction reactions transfer electrons while bonds are made or broken
The First Law states that energy cannot be created or destroyed
During a chemical reaction, the energy stored in chemical bonds may be used to make new bonds. In some of these reactions, electrons actually pass from one atom or molecule to another. An atom or molecule that loses an electron is said to be oxidized, and the process by which this occurs is called oxidation. The name comes from the fact that oxygen is the most common electron acceptor in biological systems. Conversely, an atom or molecule that gains an electron is said to be reduced, and the process is called reduction. The reduced form of a molecule has a higher level of energy than the oxidized form (figure 6.2). Oxidation and reduction always take place together, because every electron that is lost by one atom through oxidation is gained by another atom through reduction. Therefore, chemical reactions of this sort are called oxidation–reduction, or redox, reactions. Oxidation–reduction reactions play a key role in the flow of energy through biological systems. In the next two chapters, you will learn the details of how organisms derive energy from the oxidation of organic compounds via respiration, as well as from the energy in sunlight via photosynthesis.
The First Law of Thermodynamics concerns the amount of energy in the universe. Energy cannot be created or destroyed; it can only change from one form to another (from potential to kinetic, for example). The total amount of energy in the universe remains constant. The lion eating a giraffe at the beginning of this chapter is acquiring energy. Rather than creating new energy or capturing the energy in sunlight, the lion is merely transferring some of the potential energy stored in the giraffe’s tissues to its own body, just as the giraffe obtained the potential energy stored in the plants it ate while it was alive. Within any living organism, chemical potential energy stored in some molecules can be shifted to other molecules and stored in different chemical bonds. It can also be converted into other forms, such as kinetic energy, light, or electricity. During each conversion, some of the energy dissipates into the environment as heat, which is a measure of the random motion of molecules (and therefore a measure of one form of kinetic energy). Energy continuously flows through the biological world in one direction, with new energy from the Sun constantly entering the system to replace the energy dissipated as heat. Heat can be harnessed to do work only when there is a heat gradient—that is, a temperature difference between two areas. Cells are too small to maintain significant internal temperature differences, so heat energy is incapable of doing the work of cells. Instead, cells must rely on chemical reactions for energy. Although the total amount of energy in the universe remains constant, the energy available to do work decreases as more of it is progressively lost as heat.
Learning Outcomes Review 6.1 Energy is defined as the capacity to do work. The two forms of energy are kinetic energy, or energy of motion, and potential energy, or stored energy. The ultimate source of energy for living systems is the Sun. Organisms derive their energy from oxidation–reduction reactions. In oxidation, a molecule loses an electron; in reduction, a molecule gains an electron. ■
What energy source might ecosystems at the bottom of the ocean use?
www.ravenbiology.com
rav32223_ch06_107-121.indd 109
chapter
6 Energy and Metabolism
109
11/6/09 12:29:02 PM
The Second Law states that some energy is lost as disorder increases The Second Law of Thermodynamics concerns the transformation of potential energy into heat, or random molecular motion. It states that the disorder in the universe, more formally called entropy, is continuously increasing. Put simply, disorder is more likely than order. For example, it is much more likely that a column of bricks will tumble over than that a pile of bricks will arrange themselves spontaneously to form a column. In general, energy transformations proceed spontaneously to convert matter from a more ordered, less stable form to a less ordered, but more stable form. For this reason, the second law is sometimes called “time’s arrow.” Looking at the photographs in figure 6.3, you could put the pictures into correct sequence using the information that time had elapsed with only natural processes occurring. Although it might be great if our rooms would straighten themselves up, we know from experience how much work it takes to do so. The Second Law of Thermodynamics can also be stated simply as “entropy increases.” When the universe formed, it held all the potential energy it will ever have. It has become progressively more disordered ever since, with every energy exchange increasing the amount of entropy.
Chemical reactions can be predicted based on changes in free energy It takes energy to break the chemical bonds that hold the atoms in a molecule together. Heat energy, because it increases atomic motion, makes it easier for the atoms to pull apart. Both chemical bonding and heat have a significant influence on a molecule. Chemical bonding reduces disorder; heat increases it. The net effect, the amount of energy actually available to break and subsequently form other chemical bonds, is called the free energy of that molecule. In a more general sense, free energy is defined as the energy available to do work in any system.
For a molecule within a cell, where pressure and volume usually do not change, the free energy is denoted by the symbol G (for “Gibbs free energy”). G is equal to the energy contained in a molecule’s chemical bonds (called enthalpy and designated H) together with the energy term (TS) related to the degree of disorder in the system, where S is the symbol for entropy and T is the absolute temperature expressed in the Kelvin scale (K = °C + 273): G = H – TS Chemical reactions break some bonds in the reactants and form new ones in the products. Consequently, reactions can produce changes in free energy. When a chemical reaction occurs under conditions of constant temperature, pressure, and volume—as do most biological reactions—the change symbolized by the Greek capital letter delta, Δ, in free energy (ΔG) is simply: ΔG = ΔH – TΔS We can use the change in free energy, or ΔG, to predict whether a chemical reaction is spontaneous or not. For some reactions, the ΔG is positive, which means that the products of the reaction contain more free energy than the reactants; the bond energy (H) is higher, or the disorder (S) in the system is lower. Such reactions do not proceed spontaneously because they require an input of energy. Any reaction that requires an input of energy is said to be endergonic (“inward energy”). For other reactions, the ΔG is negative. In this case, the products of the reaction contain less free energy than the reactants; either the bond energy is lower, or the disorder is higher, or both. Such reactions tend to proceed spontaneously. These reactions release the excess free energy as heat and are thus said to be exergonic (“outward energy”). Any chemical reaction tends to proceed spontaneously if the difference in disorder (TΔS) is greater than the difference in bond energies between reactants and products (ΔH). Note that spontaneous does not mean the same thing as instantaneous. A spontaneous reaction may proceed very slowly. Figure 6.4 sums up endergonic and exergonic reactions.
Disorder happens spontaneously
Figure 6.3 Entropy in action. As time elapses, the room shown at right becomes more disorganized. Entropy has increased in this room. It takes energy to restore it to the ordered state shown at left. Organization requires energy
110
part
II Biology of the Cell
rav32223_ch06_107-121.indd 110
11/6/09 12:29:03 PM
Products Energy must be supplied
0
DG>0 Reactants
Course of Reaction
How catalysts work
0 Energy is released Products DG c. In this expression, b and c are the benefits and costs of the altruistic act, respectively, and r is the coefficient of relatedness, the proportion of alleles shared by two individuals through common descent. For example, an individual should be willing to have one less child (c = 1) if such actions allow a half-sibling, which shares one-quarter of its genes (r = 0.25), to have five or more additional offspring (b = 5).
Haplodiploidy and altruism in ants, bees, and wasps The relationship between genetic relatedness, kin selection, and altruism can be best understood using social insects as an example. A hive of honeybees consists of a single queen, who is the sole egg-layer, and tens of thousands of her offspring, female workers with nonfunctional ovaries (figure 55.35). Honeybees are eusocial (“truly” social): their societies are defined by reproductive division of labor (only the queen reproduces), cooperative care of the brood (workers nurse, clean, and forage), and overlap of generations (the queen lives with several generations of her offspring). Darwin was perplexed by eusociality. How could natural selection favor the evolution of sterile workers that left no offspring? It remained for Hamilton to explain the origin of eusociality in hymenopterans (bees, wasps, and ants) using his kin selection model. In these insects, males are haploid (produced from unfertilized eggs) and females are diploid. This system of sex determination and parthenogenesis, called haplodiploidy, leads to unusual genetic relatedness among colony members. If the queen is fertilized by a single male, then all female offspring will inherit exactly the same alleles from their father (because he is haploid and has only one copy of each allele). Female offspring (workers and future queens) will also share among themselves, on average, half of the alleles they get from their mother, the queen. Consequently, they will share, on average, 75% of their alleles with each sister (to verify this, rework figure 55.34, but allow the father to only have one allele for each gene). Now recall Haldane’s statement of commitment to family while you read this section. If a worker should have offspring of 1156
part
Figure 55.35 Reproductive division of labor in honeybees. The queen (center) is the sole egg-layer. Her daughters are sterile workers. her own, she would share only half of her alleles with her young (the other half would come from their father). Thus, because of this close genetic relatedness due to haplodiploidy, workers would propagate more of their own alleles by giving up their own reproduction to assist their mother in rearing their sisters, some of whom will be new queens, start new colonies, and reproduce. In this way, the unusual haplodiploid system may have set the “genetic stage” for the evolution of eusociality. Indeed, eusociality has evolved at least 12 separate times in the Hymenoptera. One wrinkle in this theory, however, is that eusocial systems have evolved in other insects (thrips, weevils, and termites), and mammals (naked mole rats). Although thrips are also haplodiploid, termites and naked mole rats are not. Thus, although haplodiploidy may have facilitated the evolution of eusociality, other factors can influence social evolution.
Other examples of kin selection Kin selection may explain altruism in other animals. Belding’s ground squirrels give alarm calls when they spot a predator such as a coyote or a badger. Such predators may attack a calling squirrel, so giving the signal places the caller at risk. A ground squirrel colony consists of a female and her daughters, sisters, aunts, and nieces. When males mature, they disperse long distances from where they are born, so adult males in the colony are not genetically related to the females. By marking all squirrels in a colony with an individual dye pattern on their fur and by recording which individuals gave calls and the social circumstances of their calling, researchers found that females who have relatives living nearby are more likely to give alarm calls than females with no kin nearby. Males tend to call much less frequently, as would be expected because they are not related to most colony members. Another example of kin selection is provided by the white-fronted bee-eater, a bird which lives along river banks in Africa in colonies of 100 to 200 individuals (figure 55.36). In contrast to ground squirrels, the male bee-eaters usually remain in the colony in which they were born, and the females disperse to join new colonies. Many bee-eaters do not raise their own offspring, but instead help others. Most helpers are young birds,
VIII Ecology and Behavior
rav32223_ch55_1132-1161.indd 1156
11/20/09 1:51:24 PM
Figure 55.36 Kin selection in the white-fronted bee-eater (Merops bullockoides). Bee-eaters are small insectivorous birds that live in Africa in large colonies. Bee-eaters often help others raise their young; helpers usually choose to help close relatives.
but older birds whose nesting attempts have failed may also be helpers. The presence of a single helper, on average, doubles the number of offspring that survive. Two lines of evidence support the idea that kin selection is important in determining helping behavior in this species. First, helpers are normally males, which are usually related to other birds in the colony, and not females, which are not related. Second, when birds have the choice of helping different parents, they almost invariably choose the parents to which they are most closely related.
Learning Outcomes Review 55.11 Genetic and ecological factors have contributed to evolution of altruism, a behavior that benefits another individual at a cost to the actor. Individuals may benefit directly if cooperative acts are reciprocated among unrelated interactants. Kin selection explains how altruistic acts directed toward relatives, which share alleles, increase an individual’s inclusive fitness. Haplodiploidy has resulted in eusociality among some insects by increasing genetic relatedness; it is not found in vertebrates. ■
Imagine that you witness older group members rescuing infants in a troupe of monkeys when a predator appears. How would you test whether the altruistic act you see is reciprocity or kin selection?
55.12
The Evolution of Group Living and Animal Societies
Learning Outcomes 1. 2. 3.
Explain the possible advantages of group living. Contrast the nature of insect and vertebrate societies. Discuss social organization in African weaver birds and how it is influenced by ecology.
Organisms from cnidarians and insects to fish, whales, chimpanzees, and humans live in social groups. To encompass the www.ravenbiology.com
rav32223_ch55_1132-1161.indd 1157
wide variety of social phenomena, we can broadly define a society as a group of organisms of the same species that are organized in a cooperative manner. Why have individuals in some species given up a solitary existence to become members of a group? One hypothesis is that individuals in groups benefit directly from social living. For example, a bird in a flock may be better protected from predators. As flock size increases, the risk of predation decreases because there are more individuals to scan the environment for predators (figure 55.37). A member of a flock may also increase its feeding success if it can acquire information from other flock members about the location of new, rich food sources. In some predators, hunting in groups can increase success and allow the group to tackle prey too large for any one individual.
Insect societies form efficient colonies containing specialized castes We’ve already discussed the origin of eusociality in the insect order Hymenoptera (ants, bees, and wasps). Additionally, all termites (order Isoptera) are also eusocial, and a few other insect and arthropod species are eusocial. Social insect colonies are composed of different castes, groups of individuals that differ in reproductive ability (queens vs. workers), size, and morphology and perform different tasks. Workers nurse, maintain the nest, and forage; soldiers are large and have powerful jaws specialized for defense. The structure of an insect society is illustrated by leafcutters, which form colonies of as many as several million individuals. These ants cut leaves and use it to grow crops of fungi beneath the ground. Workers divide the tasks of leaf cutting, defense, mulching the fungus garden, and implanting fungal hyphae according to their body size (figure 55.38).
The structure of a vertebrate society is related to ecology In contrast to the highly structured and integrated insect societies and their remarkable forms of altruism, vertebrate social chapter
55 Behavioral Biology
1157
11/20/09 1:51:29 PM
Figure 55.37 Flocking
How would living in a flock affect the time available for foraging by individual pigeons?
100
80
80
60
60
40
40
20
20
Percent Attack Success
?
Inquiry question
100
0
Reaction Distance (m)
behavior decreases predation. When more pigeons are present in the flock, they can detect hawks at greater distances, thus allowing more time for the pigeons to escape. As a result, as the size of a pigeon flock increases, hawks are less successful at capturing pigeons.
0 1
2–10
11–50
50+
Number of Pigeons in Flock
groups are usually less rigidly organized and less cohesive. It seems paradoxical that vertebrates, which have larger brains and are capable of more complex behaviors, are generally less altruistic than insects (the exception, of course, is humans). Reciprocity and kin-selected altruism are common in vertebrate societies, although there is often more conflict and aggression among group members. Conflicts generally center on access to food and mates and occur because a vertebrate society is a made up of individuals striving to improve their own fitness. Social groups of vertebrates have a size, stability of members, number of breeding males and females, and type of mating system characteristic of a given species. Diet and predation
Figure 55.38 Castes of ants. These leaf-cutter ants are members of different castes. The large ant is a worker carrying leaves to the nest, whereas the smaller ants are protecting the worker from attack. 1158
part
are important factors in shaping social groups. For example, meerkats take turns watching for predators while other group members forage for food (figure 55.39). African weaver birds, which construct nests from vegetation, provide an excellent example of the relationship between ecology and social organization. Their roughly 90 species can be divided according to the type of social group they form. One group of species lives in the forest and builds camouflaged, solitary nests. Males and females are monogamous; they forage for insects to feed their young. The second group of species nests in colonies in trees on the savanna. They are polygynous and feed in flocks on seeds. The feeding and nesting habits of these two groups of species are correlated with their mating systems. In the forest, insects are hard to find, and both parents must cooperate in feeding the young. The camouflaged nests do not call the attention of predators to their brood. On the open savanna, building a hidden nest is not an option. Rather, savanna-dwelling weaver birds protect their young from predators by nesting in trees, which are not very abundant. This shortage of safe nest sites means that birds must nest together in colonies. Because seeds occur abundantly, a female can acquire all the food needed to rear young without a male’s help. The male, free from the duties of parenting, spends his time courting many females—a polygynous mating system. One exception to the general rule that vertebrate societies are not organized like those of insects is the naked mole rat, a small, hairless rodent that lives in and near East Africa. Unlike other kinds of mole rats, which live alone or in small family groups, naked mole rats form large underground colonies with a far-ranging system of tunnels and a central nesting area. It is not unusual for a colony to contain 80 individuals. Naked mole rats feed on bulbs, roots, and tubers, which they locate by constant tunneling. As in insect societies, there is a division of labor among the colony members, with some individuals working as tunnelers while others perform different
VIII Ecology and Behavior
rav32223_ch55_1132-1161.indd 1158
11/20/09 1:51:32 PM
tasks, depending on the size of their bodies. Large mole rats defend the colony and dig tunnels. Naked mole rat colonies have a reproductive division of labor similar to the one normally associated with the eusocial insects. All of the breeding is done by a single female, or “queen,” who has one or two male consorts. The workers, consisting of both sexes, keep the tunnels clear and forage for food.
Learning Outcomes Review 55.12 Advantages of group living include protection from predators and increased feeding success. Eusocial insects form complex, highly altruistic societies that increase the fitness of the colony. The members of vertebrate societies exhibit more conflict and competition, but also cooperate and behave altruistically, especially toward kin. African weaver birds have developed different types of societies depending on the ecology of their habitat, particularly the safety of nesting sites. ■
What are the benefits and costs associated with living in social groups? ■ Why is altruism directed toward kin considered to be selfish behavior? ■ Is a human army more like an insect society or a vertebrate society? Explain your answer.
Figure 55.39 Foraging and predator avoidance. A meerkat sentinel on duty. Meerkats (Suricata suricata) are a species of highly social mongoose living in the semiarid sands of the Kalahari Desert in southern Africa. This meerkat is taking its turn to act as a lookout for predators. Under the security of its vigilance, the other group members can focus their attention on foraging.
Chapter Review 55.1 The Natural History of Behavior
55.3 Behavioral Genetics
Behavior can be analyzed in terms of mechanisms (cause) and evolutionary origin (adaptive nature). Proximate causation refers to the mechanisms of behavior. Ultimate causation examines a behavior’s evolutionary significance.
Artificial selection and hybrid studies link genes and behavior. Breeding fast-learning and slow-learning rats among each other for several generations produced two distinct behavioral populations (see figure 55.3).
Ethology emphasizes the study of instinct and its origins. Innate, or instinctive, behavior is a response to an environmental stimulus or trigger that does not require learning (see figure 55.1).
Some behaviors appear to be controlled by a single gene.
55.2 Nerve Cells, Neurotransmitters, Hormones, and Behavior Instinctive behaviors are accomplished by neural circuits, which develop under genetic control. Hormones and neurotransmitters can act to regulate behavior. www.ravenbiology.com
rav32223_ch55_1132-1161.indd 1159
55.4 Learning Learning mechanisms include habituation and association. Habituation, a form of nonassociative learning, is a decrease in response to repeated nonessential stimuli. Associative learning is a change in behavior by association of two stimuli or of a behavior and a response (conditioning).
chapter
55 Behavioral Biology
1159
11/20/09 1:51:34 PM
Classical (Pavlovian) conditioning occurs when two stimuli are associated with each other. Operant conditioning occurs when an animal associates a behavior with reward or punishment. Instinct governs learning preparedness. What an animal can learn is biologically influenced—that is, learning is possible only within the boundaries set by evolution.
55.5 The Development of Behavior Parent–offspring interactions influence how behavior develops. In imprinting, a young animal forms an attachment to other individuals or develops preferences that influence later behavior. Instinct and learning may interact as behavior develops. Animals may have an innate genetic template that guides their learning as behavior develops, such as song development in birds. Studies on twins reveal a role for both genes and environment in human behavior.
55.6 Animal Cognition Some animals exhibit cognitive behavior and can respond to novel situations using logic (see figures 55.12, 55.13).
55.7 Orientation and Migratory Behavior Migration often involves populations moving large distances. Migrating animals must be capable of orientation and navigation (see figure 55.16). Orientation is the mechanism by which animals move by tracking environmental stimuli such as celestial clues or Earth’s magnetic field. Navigation is following a route based on orientation and some sort of “map.” The nature of the map in animals is not known.
55.8 Animal Communication Successful reproduction depends on appropriate signals and responses. Courtship signals are usually species-specific and help to ensure reproductive isolation (see figure 55.19). Communication enables information exchange among group members (see figures 55.20, 55.21).
55.9 Behavioral Ecology Foraging behavior can directly influence energy intake and individual fitness. Natural selection favors optimal foraging strategies in which energy acquisition (cost) is minimized and reproductive success (benefit) is maximized.
Territorial behavior evolves if the benefits of holding a territory exceed the costs.
55.10 Reproductive Strategies and Sexual Selection The sexes often have different reproductive strategies. One sex may be choosier than the other, and which one often depends on the degree of parental investment. Sexual selection occurs through mate competition and mate choice. Intrasexual selection involves competition among members of the same sex for the chance to mate. Intersexual selection is one sex choosing a mate. Mate choice may provide direct benefits (increased resource availability or parental care) or indirect benefits (genetic quality of the mate). Mating systems reflect the ability of parents to care for offspring and are influenced by ecology. Mating systems include monogamy, polygyny, and polyandry; they are influenced by ecology and constrained by needs of offspring.
55.11 Altruism Reciprocity theory explains altruism between unrelated individuals. Mutual exchanges benefit both participants; a participant that does not reciprocate would not receive future aid. Kin selection theory proposes a direct genetic advantage to altruism. Kin selection increases the reproductive success of relatives and increased frequency of alleles shared by kin, and thus increases an individual’s inclusive fitness. Ants, bees, and wasps have haplodiploid reproduction, and therefore high degree of gene sharing.
55.12 The Evolution of Group Living and Animal Societies A social system is a group organized in a cooperative manner. Insect societies form efficient colonies containing specialized castes (see figure 55.38). Social insect societies are composed of different castes that are specialized to reproduce or to perform certain colony maintenance tasks. The structure of a vertebrate society is related to ecology. Vertebrate social systems are less rigidly organized and cohesive and are influenced by food availability and predation.
Review Questions U N D E R S TA N D 1. A key stimulus, innate releasing mechanism, and fixed action pattern a. b. c. d. 1160
are mechanisms associated with behaviors that are learned. are components of behaviors that are innate. involve behaviors that cannot be explained in terms of ultimate causation. involve behaviors that are not subject to natural selection. part
2. In operant conditioning a. b. c. d.
an animal learns that a particular behavior leads to a reward or punishment. an animal associates an unconditioned stimulus with a conditioned response. learning is unnecessary. habituation is required for an appropriate response.
VIII Ecology and Behavior
rav32223_ch55_1132-1161.indd 1160
11/20/09 1:51:37 PM
3. The study of song development in sparrows showed that a. b. c. d.
the acquisition of a species-specific song is innate. there are two components to this behavior: a genetic template and learning. song acquisition is an example of associative learning. All of these are correct.
4. The difference between following a set of driving directions given to you by somebody on the street (for example “. . . take a right at the next light, go four blocks and turn left . . .”) and using a map to find your destination is a. b. c. d.
the difference between navigation and orientation, respectively. the difference between learning and migration, respectively. the difference between orientation and navigation, respectively. why birds are not capable of orientation.
5. In courtship communication a. b. c. d.
the signal itself is always species-specific. the sign communicates species identity. it involves a stimulus–response chain. courtship signals are produced only by males.
6. Behavioral ecology assumes a. b. c. d.
that all behavioral traits are innate. learning is the dominant determinant of behavior. behavioral traits are subject to natural selection. behavioral traits do not affect fitness.
7. According to optimal foraging theory a. b. c. d.
individuals minimize energy intake per unit of time. energy content of a food item is the only determinant of a forager’s food choice. time taken to capture a food item is the only determinant of a forager’s food choice. a higher energy item might be less valuable than a lower energy item if it takes too much time to capture the larger item.
8. The elaborate tail feathers of a male peacock evolved because they a. b. c. d.
improve reproductive success of males and females. improve male survival. reduce survival. None of the above.
9. From the perspective of females, extra-pair copulations (EPCs) a. b. c. d.
are always disadvantageous to females. can be associated with receiving male aid. are too rare to affect female fitness. can only be of benefit if the EPC male has elaborate secondary sexual traits.
10. In the haplodiploidy system of sex determination, males are a. b. c. d.
haploid. diploid. sterile. not present because bees exist as single-sex populations.
11. According to kin selection, saving the life of your _____ would do the least for increasing your inclusive fitness. a. b.
mother brother
c. d.
sister-in-law niece
12. Altruism a. b.
is only possible through reciprocity. is only possible through kin selection.
www.ravenbiology.com
rav32223_ch55_1132-1161.indd 1161
c. d.
can only be explained by group selection. will only occur when the fitness benefit of a given act is greater than the fitness cost.
A P P LY 1. Refer to figure 55.25. Data on size of mussels eaten by shore crabs suggest they eat sizes smaller than expected by an optimal foraging model. Suggest a hypothesis for why and describe an experiment to test your hypothesis. 2. Refer to figure 55.26. Six pairs of birds were removed but only four pairs moved in. Where did the new pairs come from? Additionally, it appears that many of the birds that were not removed expanded their territories and that the new residents ended up with smaller territories than the pairs they replaced. Explain. 3. Refer to figure 55.28. Peahens prefer to mate with peacocks that have more eyespots in their tail feathers (that is, longer tail feathers). It has also been suggested that the longer the tail feathers, the more impaired the flight of the males. One possible hypothesis to explain such a preference by females is that the males with the longest tail feathers experience the most severe handicap, and if they can nevertheless survive, it reflects their “vigor.” Suggest some studies that would allow you to test this idea. Your description should include the kinds of traits that you would measure and why. 4. An altruistic act is defined as one that benefits another individual at a cost to the actor. There are two theories to explain how such behavior evolves: reciprocity and kin selection. How would you distinguish between the two in a field study? In the context of natural selection, is an altruistic act “costly” to an individual who performs it?
SYNTHESIZE 1. Insects that sting or contain toxic chemicals often have black and yellow coloration and consequentially are not eaten by predators. How could you determine if a predator has an innate avoidance of insects that are colored this way, or if the avoidance is learned? If avoidance is learned, how would you determine the learning mechanism involved? How would you measure the adaptive significance of the black and yellow coloration to the prey insect? 2. Behavioral genetics has made great advances from detailed studies of a single animal such as the fruit fly as a model system to develop general principles of how genes regulate behavior. What are advantages and disadvantages of this “model system” approach? How would you determine how broadly applicable the results of such studies are to other animals? 3. If a female bird chooses to live in the territory of a particular male, why might she mate with a male other than the territory owner?
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more. chapter
55 Behavioral Biology
1161
11/20/09 1:51:37 PM
CHAPTER
Chapter
56
Ecology of Individuals and Populations Chapter Outline 56.1
The Environmental Challenges
56.2
Populations: Groups of a Single Species in One Place
56.3
Population Demography and Dynamics
56.4
Life History and the Cost of Reproduction
56.5
Environmental Limits to Population Growth
56.6
Factors That Regulate Populations
56.7
Human Population Growth
E
Introduction
Ecology, the study of how organisms relate to one another and to their environments, is a complex and fascinating area of biology that has important implications for each of us. In our exploration of ecological principles, we first consider how organisms respond to the abiotic environment in which they exist and how these responses affect the properties of populations, emphasizing population dynamics. In chapter 57, we discuss communities of coexisting species and the interactions that occur among them. In subsequent chapters, we discuss the functioning of entire ecosystems and of the biosphere, concluding with a consideration of the problems facing our planet and our fellow species.
56.1
The Environmental Challenges
Learning Outcomes 1. 2. 3.
List some challenges that organisms face in their environments. Describe ways in which individuals respond to environmental changes. Explain how species adapt to environmental conditions.
rav32223_ch56_1162-1184.indd 1162
The nature of the physical environment in large measure determines which organisms live in a particular climate or region. Key elements of the environment include: Temperature. Most organisms are adapted to live within a relatively narrow range of temperatures and will not thrive if temperatures are colder or warmer. The growing season of plants, for example, is importantly influenced by temperature. Water. All organisms require water. On land, water is often scarce, so patterns of rainfall have a major influence on life.
11/20/09 1:46:43 PM
TA B L E 5 6 .1
Physiological Changes at High Elevation
Increased rate of breathing Increased erythrocyte production, raising the amount of hemoglobin in the blood Decreased binding capacity of hemoglobin, increasing the rate at which oxygen is unloaded in body tissues Increased density of mitochondria, capillaries, and muscle myoglobin
Sunlight. Almost all ecosystems rely on energy captured by photosynthesis; the availability of sunlight influences the amount of life an ecosystem can support, particularly below the surface in marine communities. Soil. The physical consistency, pH, and mineral composition of the soil often severely limit terrestrial plant growth, particularly the availability of nitrogen and phosphorus. An individual encountering environmental variation may maintain a “steady-state” internal environment, a condition known as homeostasis. Many animals and plants actively employ physiological, morphological, or behavioral mechanisms to maintain homeostasis. The beetle in figure 56.1 is using a behavioral mechanism to cope with drastic changes in water availability. Other animals and plants are known as conformers because they conform to the environment in which they find themselves, their bodies adopting the temperature, salinity, and other physical aspects of their surroundings. Responses to environmental variation can be seen over both the short and the long term. In the short term, spanning periods of a few minutes to an individual’s lifetime, organisms have a variety of ways of coping with environmental change. Over longer periods, natural selection can operate to make a population better adapted to the environment.
Organisms are capable of responding to environmental changes that occur during their lifetime During the course of a day, a season, or a lifetime, an individual organism must cope with a range of living conditions. They do so through the physiological, morphological, and behavioral abilities they possess. These abilities are a product of natural selection acting in a particular environmental setting over time, which explains why an individual organism that is moved to a different environment may not survive. www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1163
Physiological responses Many organisms are able to adapt to environmental change by making physiological adjustments. For example, you sweat when it is hot, increasing evaporative heat loss and thus preventing overheating. Similarly, people who visit high altitudes may initially experience altitude sickness—the symptoms of which include heart palpitations, nausea, fatigue, headache, mental impairment, and in serious cases, pulmonary edema— because of the lower atmospheric pressure and consequent lower oxygen availability in the air. After several days, however, the same people usually feel fine, because a number of physiological changes have increased the delivery of oxygen to their body tissues (table 56.1). Some insects avoid freezing in the winter by adding glycerol “antifreeze” to their blood; others tolerate freezing by converting much of their glycogen reserves into alcohols that protect their cell membranes from freeze damage.
Morphological capabilities Animals that maintain a constant internal temperature (endotherms) in a cold environment have adaptations that tend to minimize energy expenditure. For example, many mammals grow thicker coats during the winter, their fur acting as insulation to retain body heat. In general, the thicker the fur, the greater the insulation (figure 56.2). Thus, a wolf’s fur is about three times thicker in winter than in summer and insulates more than twice as well.
Insulation (°C cal/m2/h)
Figure 56.1 Meeting the challenge of obtaining moisture. On the dry sand dunes of the Namib Desert in southwestern Africa, the fog-basking beetle (Onymacris unguicularis) collects moisture from the fog by holding its abdomen up at the crest of a dune to gather condensed water; water condenses as droplets and trickles down to the beetle’s mouth.
1.5
winter summer wolf polar bear
1.0
0.5
1.0
2.0
3.0
4.0
5.0
6.0
Thickness of Fur (mm)
Figure 56.2 Morphological adaptation. Fur thickness in North American mammals has a major effect on the degree of insulation the fur provides. chapter
56 Ecology of Individuals and Populations
1163
11/20/09 1:46:49 PM
Behavioral responses Many animals deal with variation in the environment by moving from one patch of habitat to another, avoiding areas that are unsuitable. The tropical lizard in figure 56.3 manages to maintain a fairly uniform body temperature in an open habitat by basking in patches of sunlight and then retreating to the shade when it becomes too hot. By contrast, in shaded forests, the same lizard does not have the opportunity to regulate its body temperature through behavioral means. Thus, it becomes a conformer and adopts the temperature of its surroundings. Behavioral adaptations can be extreme. Spadefoot toads (genus Scaphiophus), which live in the deserts of North America, can burrow nearly a meter below the surface and remain there for as long as nine months of each year, their metabolic rates greatly reduced as they live on fat reserves. When moist, cool conditions return, the toads emerge and breed. The young toads mature rapidly and burrow underground.
Natural selection leads to evolutionary adaptation to environmental conditions The ability of an individual to alter its physiology, morphology, or behavior is itself an evolutionary adaptation, the result of natural selection. The results of natural selection can also be detected by comparing closely related species that live in different environments. In such cases, species often have evolved striking adaptations to the particular environment in which they live.
Body Temperature (°C)
32 30 28 26 open habitat shaded forest
24 24
26 28 Air Temperature (°C)
30
Figure 56.3 Behavioral adaptation. In open habitats, the Puerto Rican crested lizard (Anolis cristatellus) maintains a relatively constant temperature by seeking out and basking in patches of sunlight; as a result, it can maintain a relatively high temperature even when the air is cool. In contrast, in shaded forests, this behavior is not possible, and the lizard’s body temperature conforms to that of its surroundings.
?
1164
Inquiry question When given the opportunity, lizards regulate their body temperature to maintain a temperature optimal for physiological functioning. Would lizards in open habitats exhibit different escape behaviors from lizards in shaded forest? part
For example, animals that live in different climates show many differences. Mammals from colder climates tend to have shorter ears and limbs—a phenomenon termed Allen’s rule— which reduces the surface area across which animals lose heat. Lizards that live in different climates exhibit physiological adaptations for coping with life at different temperatures. Desert lizards are unaffected by high temperatures that would kill a lizard from northern Europe, but the northern lizards are capable of running, capturing prey, and digesting food at cooler temperatures at which desert lizards would be completely immobilized. Many species also exhibit adaptations to living in areas where water is scarce. Everyone knows of the camel and other desert animals that can go extended periods without drinking water. Another example of desert adaptation is seen in frogs. Most frogs have moist skins through which water permeates readily. Such animals could not survive in arid climates because they would rapidly dehydrate and die. However, some frogs have solved this problem by evolving a greatly reduced rate of water loss through the skin. One species, for example, secretes a waxy substance from specialized glands that waterproofs its skin and reduces rates of water loss by 95%. Adaptation to different environments can also be studied experimentally. For example, when strains of E. coli were grown at high temperatures (42°C), the speed at which the bacteria utilized resources improved through time. After 2000 generations, this ability increased 30% over what it had been when the experiment started. The means by which efficiency of resource use increased is unknown and is the focus of current research.
Learning Outcomes Review 56.1 Environmental conditions include temperature, water and light availability, and soil characteristics. When the environment changes, individual organisms use a variety of physiological, morphological, and behavioral mechanisms to adjust. Over time, adaptations to different environments may evolve in populations. ■
How might a species respond if its environment grew steadily warmer over time?
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1164
11/20/09 1:46:51 PM
56.2
Populations: Groups of a Single Species in One Place
Learning Outcomes Distinguish between a population and a metapopulation. Understand what causes a species’ geographic ranges to change through time.
Organisms live as members of populations, groups of individuals that occur together at one place and time. In the rest of this chapter, we consider the properties of populations, focusing on factors that influence whether a population grows or shrinks, and at what rate. The explosive growth of the world’s human population in the last few centuries provides a focus for our inquiry. The term population can be defined narrowly or broadly. This flexibility allows us to speak in similar terms of the world’s human population, the population of protists in the gut of a termite, or the population of deer that inhabit a forest. Sometimes the boundaries defining a population are sharp, such as the edge of an isolated mountain lake for trout, and sometimes they are fuzzier, as when deer readily move back and forth between two forests separated by a cornfield. Three characteristics of population ecology are particularly important: (1) population range, the area throughout which a population occurs; (2) the pattern of spacing of individuals within that range; and (3) how the population changes in size through time.
Figure 56.4 The Devil’s Hole pupfish (Cyprinodon diabolis). This fish has the smallest range of any vertebrate species in the world.
Ranges undergo expansion and contraction Population ranges are not static but change through time. These changes occur for two reasons. In some cases, the environment changes. As the glaciers retreated at the end of the last ice age, approximately 10,000 years ago, many North American plant and animal populations expanded northward. At the same time, as climates warmed, species experienced shifts in the elevation at which they could live (figure 56.5).
Present Alpine tundra 3 km
A population’s geographic distribution is termed its range
www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1165
2 km
Woodlands
1 km
Grassland, chaparral, and desert scrub
0 km
15,000 Years Ago Alpine tundra 3 km Spruce-fir forests Elevation (km)
No population, not even one composed of humans, occurs in all habitats throughout the world. Most species, in fact, have relatively limited geographic ranges, and the range of some species is miniscule. For example, the Devil’s Hole pupfish lives in a single spring in southern Nevada (figure 56.4), and the Socorro isopod (Thermosphaeroma thermophilus) is known from a single spring system in New Mexico. At the other extreme, some species are widely distributed. The common dolphin (Delphinus delphis), for example, is found throughout all the world’s oceans. As discussed earlier, organisms must be adapted for the environment in which they occur. Polar bears are exquisitely adapted to survive the cold of the Arctic, but you won’t find them in the tropical rain forest. Certain prokaryotes can live in the near-boiling waters of Yellowstone’s geysers, but they do not occur in cooler streams nearby. Each population has its own requirements—temperature, humidity, certain types of food, and a host of other factors—that determine where it can live and reproduce and where it can’t. In addition, in places that are otherwise suitable, the presence of predators, competitors, or parasites may prevent a population from occupying an area, a topic we will take up in chapter 57.
Spruce-fir forests Mixed conifer forest
Elevation (km)
1. 2.
2 km
Mixed conifer forest
1 km
Woodlands
0 km
Grassland, chaparral, and desert scrub
Figure 56.5 Altitude shifts in altitudinal distributions of trees in the mountains of southwestern North America. During the glacial period 15,000 years ago, conditions were cooler than they are now. As the climate warmed, tree species that require colder temperatures shifted their range upward in altitude so that they live in the climatic conditions to which they are adapted. chapter
56 Ecology of Individuals and Populations
1165
11/20/09 1:46:55 PM
that by 1980, they occurred throughout the United States. Similar stories could be told for countless plants and animals, and the list increases every year. Unfortunately, the success of these invaders often comes at the expense of native species.
1966 1970
1964
1960
1965
Dispersal mechanisms Immigration from Africa 1961 1958
1951 1943 1937
Equator 1956
1970
Figure 56.6 Range expansion of the cattle egret (Bubulcus ibis). The cattle egret—so named because it follows cattle and other hoofed animals, catching any insects or small vertebrates it disturbs—fi rst arrived in South America from Africa in the late 1800s. Since the 1930s, the range expansion of this species has been well documented, as it has moved northward into much of North America, as well as southward along the western side of the Andes to near the southern tip of South America.
In addition, populations can expand their ranges when they are able to circumvent inhospitable habitat to colonize suitable, previously unoccupied areas. For example, the cattle egret is native to Africa. Some time in the late 1800s, these birds appeared in northern South America, having made the nearly 3500-km transatlantic crossing, perhaps aided by strong winds. Since then, they have steadily expanded their range and now can be found throughout most of the United States (figure 56.6).
Dispersal to new areas can occur in many ways. Lizards have colonized many distant islands, as one example, probably due to individuals or their eggs floating or drifting on vegetation. Bats are the only mammals on many distant islands because they can fly to them. Seeds of plants are designed to disperse in many ways (figure 56.7). Some seeds are aerodynamically designed to be blown long distances by the wind. Others have structures that stick to the fur or feathers of animals, so that they are carried long distances before falling to the ground. Still others are enclosed in fleshy fruits. These seeds can pass through the digestive systems of mammals or birds and then germinate where they are defecated. Finally, seeds of mistletoes (Arceuthobium) are violently propelled from the base of the fruit in an explosive discharge. Although the probability of longdistance dispersal events leading to successful establishment of new populations is low, over millions of years, many such dispersals have occurred.
Windblown Fruits
Adherent Fruits
Fleshy Fruits
Asclepias syriaca
Medicago polycarpa
Solanum dulcamara
Acer saccharum
Bidens frondosa
Juniperus chinensis
Terminalia calamansanai
Ranunculus muricatus
Rubus fruticosus
The human effect By altering the environment, humans have allowed some species, such as coyotes, to expand their ranges and move into areas they previously did not occupy. Moreover, humans have served as an agent of dispersal for many species. Some of these transplants have been widely successful, as is discussed in greater detail in chapter 60. For example, 100 starlings were introduced into New York City in 1896 in a misguided attempt to establish every species of bird mentioned by Shakespeare. Their population steadily spread so 1166
part
Figure 56.7 Some of the many adaptations of seeds. Seeds have evolved a number of different means of facilitating dispersal from their maternal plant. Some seeds can be transported great distances by the wind, whereas seeds enclosed in adherent or fleshy fruits can be transported by animals.
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1166
11/20/09 1:46:59 PM
Individuals in populations exhibit different spacing patterns Another key characteristic of population structure is the way in which individuals of a population are distributed. They may be randomly spaced, uniformly spaced, or clumped.
Random spacing Random spacing of individuals within populations occurs when they do not interact strongly with one another and when they are not affected by nonuniform aspects of their environment. Random distributions are not common in nature. Some species of trees, however, appear to exhibit random distributions in Panamanian rain forests.
Uniform spacing Uniform spacing within a population may often, but not always, result from competition for resources. This spacing is accomplished, however, in many different ways In animals, uniform spacing often results from behavioral interactions, as described in chapter 55. In many species, individuals of one or both sexes defend a territory from which other individuals are excluded. These territories provide the owner with exclusive access to resources, such as food, water, hiding refuges, or mates, and tend to space individuals evenly across the habitat. Even in nonterritorial species, individuals often maintain a defended space into which other animals are not allowed to intrude. Among plants, uniform spacing is also a common result of competition for resources. Closely spaced individual plants compete for available sunlight, nutrients, or water. These contests can be direct, as when one plant casts a shadow over another, or indirect, as when two plants compete by extracting nutrients or water from a shared area. In addition, some plants, such as the creosote bush, produce chemicals in the surrounding soil that are toxic to other members of their species. In all of these cases, only plants that are spaced an adequate distance from each other will be able to coexist, leading to uniform spacing.
Clumped spacing Individuals clump into groups or clusters in response to uneven distribution of resources in their immediate environments. Clumped distributions are common in nature because individual animals, plants, and microorganisms tend to occur in habitats defined by soil type, moisture, or other aspects of the environment to which they are best adapted. Social interactions also can lead to clumped distributions. Many species live and move around in large groups, which go by a variety of names (for example, flock, herd, pride). These groupings can provide many advantages, including increased awareness of and defense against predators, decreased energy cost of moving through air and water, and access to the knowledge of all group members. On a broader scale, populations are often most densely populated in the interior of their range and less densely distributed toward the edges. Such patterns usually result from the manner in which the environment changes in different areas. Populations are often best adapted to the conditions in the interior of their distribution. As environmental conditions www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1167
change, individuals are less well adapted, and thus densities decrease. Ultimately, the point is reached at which individuals cannot persist at all; this marks the edge of a population’s range.
A metapopulation comprises distinct populations that may exchange members Species often exist as a network of distinct populations that interact with one another by exchanging individuals. Such networks, termed metapopulations, usually occur in areas in which suitable habitat is patchily distributed and is separated by intervening stretches of unsuitable habitat.
Dispersal and habitat occupancy The degree to which populations within a metapopulation interact depends on the amount of dispersal; this interaction is often not symmetrical: Populations increasing in size tend to send out many dispersers, whereas populations at low levels tend to receive more immigrants than they send off. In addition, relatively isolated populations tend to receive relatively few arrivals. Not all suitable habitats within a metapopulation’s area may be occupied at any one time. For a number of reasons, some individual populations may become extinct, perhaps as a result of an epidemic disease, a catastrophic fire, or the loss of genetic variation following a population bottleneck (see chapter 60). Dispersal from other populations, however, may eventually recolonize such areas. In some cases, the number of habitats occupied in a metapopulation may represent an equilibrium in which the rate of extinction of existing populations is balanced by the rate of colonization of empty habitats.
Source–sink metapopulations A species may also exhibit a metapopulation structure in areas in which some habitats are suitable for long-term population maintenance, but others are not. In these situations, termed source– sink metapopulations, the populations in the better areas (the sources) continually send out dispersers that bolster the populations in the poorer habitats (the sinks). In the absence of such continual replenishment, sink populations would have a negative growth rate and would eventually become extinct. Metapopulations of butterflies have been studied particularly intensively. In one study, researchers sampled populations of the Glanville fritillary butterfly at 1600 meadows in southwestern Finland (figure 56.8). On average, every year, 200 populations became extinct, but 114 empty meadows were colonized. A variety of factors seemed to increase the likelihood of a population’s extinction, including small population size, isolation from sources of immigrants, low resource availability (as indicated by the number of flowers on a meadow), and lack of genetic variation within the population. The researchers attribute the greater number of extinctions than colonizations to a string of very dry summers. Because none of the populations is large enough to survive on its own, continued survival of the species in southwestern Finland would appear to require the continued existence of a metapopulation network in which new populations are continually chapter
56 Ecology of Individuals and Populations
1167
11/20/09 1:47:00 PM
Sweden occupied habitat patch unoccupied habitat patch
56.3
Norway
Population Demography and Dynamics
Finland Åland Islands
Learning Outcomes 1. 2. 3.
10 km
Figure 56.8 Metapopulations of butterflies. The Glanville fritillary butterfly (Melitaea cinxia) occurs in metapopulations in southwestern Finland on the Åland Islands. None of the populations is large enough to survive for long on its own, but continual immigration of individuals from other populations allows some populations to survive. In addition, continual establishment of new populations tends to offset extinction of established populations, although in recent years, extinctions have outnumbered colonizations.
created and existing populations are supplemented by immigrants. Continued bad weather thus may doom the species, at least in this part of its range. Metapopulations, where they occur, can have two important implications for the range of a species. First, through continuous colonization of empty patches, metapopulations prevent longterm extinction. If no such dispersal existed, then each population might eventually perish, leading to disappearance of the species from the entire area. Moreover, in source–sink metapopulations, the species occupies a larger area than it otherwise might, including marginal areas that could not support a population without a continual influx of immigrants. For these reasons, the study of metapopulations has become very important in conservation biology as natural habitats become increasingly fragmented.
Learning Outcomes Review 56.2 A population is a group of individuals of a single species existing together in an area. A population’s range, the area it occupies, changes over time. Populations, in turn, may form a network, or metapopulation, connected by individuals that move from one group to another. Within a population, the distribution of individuals can be random, uniform, or clumped, and the distribution is determined in part by the availability of resources. ■
1168
How might the geographic range of a species change if populations could not exchange individuals with each other? part
Define demography. Describe the factors that influence a species’ demography. Explain the significance of survivorship curves.
The dynamics of a population—how it changes through time— are affected by many factors. One important factor is the age distribution of individuals—that is, what proportion of individuals are adults, juveniles, and young. Demography is the quantitative study of populations. How the size of a population changes through time can be studied at two levels: as a whole or broken down into parts. At the most inclusive level, we can study the whole population to determine whether it is increasing, decreasing, or remaining constant. Put simply, populations grow if births outnumber deaths and shrink if deaths outnumber births. Understanding these trends is often easier, however, if we break the population into smaller units composed of individuals of the same age (for example, 1-year-olds) and study the factors affecting birth and death rates for each unit separately.
Sex ratio and generation time affect population growth rates Population growth can be influenced by the population’s sex ratio. The number of births in a population is usually directly related to the number of females; births may not be as closely related to the number of males in species in which a single male can mate with several females. In many species, males compete for the opportunity to mate with females, as you learned in the preceding chapter; consequently, a few males have many matings, and many males do not mate at all. In such species, the sex ratio is female-biased and does not affect population growth rates; reduction in the number of males simply changes the identities of the reproductive males without reducing the number of births. By contrast, among monogamous species, pairs may form long-lasting reproductive relationships, and a reduction in the number of males can then directly reduce the number of births. Generation time is the average interval between the birth of an individual and the birth of its offspring. This factor can also affect population growth rates. Species differ greatly in generation time. Differences in body size can explain much of this variation—mice go through approximately 100 generations during the course of one elephant generation (figure 56.9). But small size does not always mean short generation time. Newts, for example, are smaller than mice, but have considerably longer generation times. In general, populations with short generations can increase in size more quickly than populations with long generations. Conversely, because generation time and life span are
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1168
11/20/09 1:47:00 PM
100 m
Sequoia Fir
Whale
Birch
Kelp
10 m
Balsam
Dogwood Rhino Elk
1m
Deer
Body Size (length)
10 cm
Mouse Scallop Snail Bee
1 cm
Human
Snake Beaver
Fox Rat Crab
Elephant Bear
Salamander Horseshoe crab Turtle Newt Frog Chameleon Oyster
Horsefly Clam
Housefly
Life tables show probability of survival and reproduction through a cohort’s life span
Drosophila
1 mm
Daphnia
Stentor
Paramecium Didinium
100 μm Tetrahymena
Euglena Spirochaeta
10 μm E. coli Pseudomonas
1 μm
rs
rs
a ye
th
ea 0y
10
10
r
ea 1y
k
on
1m
ee 1w
ay
1d
r
ou
1h
Generation Time
Figure 56.9 The relationship between body size and generation time. In general, larger organisms have longer generation times, although there are exceptions.
?
Inquiry question If resources became more abundant, would you expect smaller or larger species to increase in population size more quickly?
usually closely correlated, populations with short generation times may also diminish in size more rapidly if birth rates suddenly decrease.
Age structure is determined by the numbers of individuals in different age groups A group of individuals of the same age is referred to as a cohort. In most species, the probability that an individual will reproduce or die varies through its life span. As a result, within www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1169
a population, every cohort has a characteristic birth rate, or fecundity, defined as the number of offspring produced in a standard time (for example, per year), and death rate, or mortality, the number of individuals that die in that period. The relative number of individuals in each cohort defines a population’s age structure. Because different cohorts have different fecundity and death rates, age structure has a critical influence on a population’s growth rate. Populations with a large proportion of young individuals, for example, tend to grow rapidly because an increasing proportion of their individuals are reproductive. Human populations in many developing countries are an example, as will be discussed later in this chapter. Conversely, if a large proportion of a population is relatively old, populations may decline. This phenomenon now characterizes Japan and some countries in Europe.
To assess how populations in nature are changing, ecologists use a life table, which tabulates the fate of a cohort from birth until death, showing the number of offspring produced and the number of individuals that die each year. Table 56.2 shows an example of a life table analysis from a study of the meadow grass Poa annua. This study follows the fate of 843 individuals through time, charting how many survive in each interval and how many offspring each survivor produces. In table 56.2, the first column indicates the age of the cohort (that is, the number of 3-month intervals from the start of the study). The second and third columns indicate the number of survivors and the proportion of the original cohort still alive at the beginning of that interval. The fifth column presents the mortality rate, the proportion of individuals that started that interval alive but died by the end of it. The seventh column indicates the average number of seeds produced by each surviving individual in that interval, and the last column shows the number of seeds produced relative to the size of the original cohort. Much can be learned by examining life tables. In the case of P. annua, we see that both the probability of dying and the number of offspring produced per surviving individual steadily increases with age. By adding up the numbers in the last column, we get the total number of offspring produced per individual in the initial cohort. This number is almost 2, which means that for every original member of the cohort, on average two new individuals have been produced. A figure of 1.0 would be the break-even number, the point at which the population was neither growing nor shrinking. In this case, the population appears to be growing rapidly. In most cases, life table analysis is more complicated than this. First, except for organisms with short life spans, it is difficult to track the fate of a cohort until the death of the last individual. An alternative approach is to construct a crosssectional study, examining the fate of cohorts of different ages in a single period. In addition, many factors—such as offspring chapter
56 Ecology of Individuals and Populations
1169
11/20/09 1:47:01 PM
TA B L E 5 6 . 2
Age (in 3-month intervals)
Life Table of the Meadow Grass (Poa annua) for a Cohort Containing 843 Seedlings Number Alive at Beginning of Time Interval
Proportion of Cohort Alive at Beginning of Time Interval (survivorship)
Deaths During Time Interval
Mortality Rate During Time Interval
Seeds Produced During Time Interval
Seeds Produced per Surviving Individual (fecundity)
0
843
1.000
121
0.143
0
0.00
0.00
1
722
0.857
195
0.271
303
0.42
0.36
2
527
0.625
211
0.400
622
1.18
0.74
3
316
0.375
172
0.544
430
1.36
0.51
4
144
0.171
90
0.626
210
1.46
0.25
5
54
0.064
39
0.722
60
1.11
0.07
6
15
0.018
12
0.800
30
2.00
0.04
7
3
0.004
3
1.000
10
3.33
0.01
8
0
0.000
—
reproducing before all members of their parents’ cohort have died—complicate the interpretation of whether populations are growing or shrinking.
Total = 1665
part
1.0 Human (type I)
Proportion Surviving
The percentage of an original population that survives to a given age is called its survivorship. One way to express some aspects of the age distribution of populations is through a survivorship curve. Examples of different survivorship curves are shown in figure 56.10. Oysters produce vast numbers of offspring, only a few of which live to reproduce. However, once they become established and grow into reproductive individuals, their mortality rate is extremely low (type III survivorship curve). Note that in this type of curve, survival and mortality rates are inversely related. Thus, the rapid decrease in the proportion of oysters surviving indicates that few individuals survive, thus producing a high mortality rate. In contrast, the relatively flat line at older ages indicates high survival and low mortality. In hydra, animals related to jellyfish, individuals are equally likely to die at any age. The result is a straight survivorship curve (type II). Finally, mortality rates in humans, as in many other animals and in protists, rise steeply later in life (type I survivorship curve).
Total = 1.98
Of course, these descriptions are just generalizations, and many organisms show more complicated patterns. Examination of the data for P. annua, for example, reveals that it is most similar to a type II survivorship curve (figure 56.11).
Survivorship curves demonstrate how survival probability changes with age
1170
Seeds Produced per Member of Cohort (fecundity × survivorship)
Hydra (type II) 0.1
0.01 Oyster (type III)
0.001 0
25 50 75 Percent of Maximum Life Span
100
Figure 56.10 Survivorship curves. By convention, survival (the vertical axis) is plotted on a log scale. Humans have a type I life cycle, hydra (an animal related to jellyfish) type II, and oysters type III.
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1170
11/20/09 1:47:01 PM
Figure 56.11 Survivorship curve for a cohort of the meadow grass. After several months of age, mortality increases at a constant rate through time.
0.5 0.4 0.3 0.2 0.1 0.05 0.04 0.03 0.02 0.01 0.005 0.004 0.003 0.002 3
6
9
12
15
18
21
24
27
Age (months)
?
Inquiry question Suppose you wanted to keep meadow grass in your room as a houseplant. Suppose, too, that you wanted to buy an individual plant that was likely to live as long as possible. What age plant would you buy? How might the shape of the survivorship curve affect your answer?
Learning Outcomes Review 56.3 Demography is the quantitative study of populations. Demographic characteristics include age structure, life span, sex ratio, generation time, and birth and mortality rates. The age structure of a population and the manner in which mortality and birth rates vary among different age cohorts, determine whether a population will increase or decrease in size. ■
Will populations with higher survivorship rates always have higher population growth rates than populations with lower survivorship rates?
56.4
Life History and the Cost of Reproduction
Learning Outcomes 1. 2.
Describe reproductive trade-offs in an organism’s life history. Compare the costs and benefits of allocating resources to reproduction.
5 Number of Offspring per Year
Proportion Surviving
1.0
Why doesn’t every organism reproduce immediately after its own birth, produce large families of offspring, care for them intensively, and perform these functions repeatedly throughout a long life, while outcompeting others, escaping predators, and capturing food with ease? The answer is that no one organism can do all of this, simply because not enough resources are available. Consequently, organisms allocate resources either to current reproduction or to increasing their prospects of surviving and reproducing at later life stages. The complete life cycle of an organism constitutes its life history. All life histories involve significant trade-offs. Because resources are limited, a change that increases reproduction may decrease survival and reduce future reproduction. As one example, a Douglas fir tree that produces more cones increases its current reproductive success—but it also grows more slowly. Because the number of cones produced is a function of how large a tree is, this diminished growth will decrease the number of cones it can produce in the future. Similarly, birds that have more offspring each year have a higher probability of dying during that year or of producing smaller clutches the following year (figure 56.12). Conversely, individuals that delay reproduction may grow faster and larger, enhancing future reproduction. In one elegant experiment, researchers changed the number of eggs in the nests of a bird, the collared flycatcher (figure 56.13). Birds whose clutch size (the number of eggs produced in one breeding event) was decreased expended less energy raising their young and thus were able to lay more eggs the next year, whereas those given more eggs worked harder and consequently produced fewer eggs the following year. Ecologists refer to the reduction in future reproductive potential resulting from current reproductive efforts as the cost of reproduction.
2 1 0.5
0.2 0.1 0.05
0.1
0.2
0.5
1.0
Adult Mortality Rate per Year
Figure 56.12 Reproduction has a price. Data from many Natural selection favors traits that maximize the number of surviving offspring left in the next generation by an individual organism. Two factors affect this quantity: how long an individual lives, and how many young it produces each year. www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1171
bird species indicate that increased fecundity in birds correlates with higher mortality, ranging from the albatross (lowest) to the sparrow (highest). Birds that raise more offspring per year have a higher probability of dying during that year. chapter
56 Ecology of Individuals and Populations
1171
11/20/09 1:47:01 PM
19.5
6
Nestling Size (g)
Clutch Size Following Year
7
5
:2 :1
0
19.0
18.5
18.0
;1 ;2
Change in Clutch Size
17.5 0
2
4
Figure 56.13 Reproductive events per lifetime. Adding eggs to nests of collared flycatchers (Ficedula albicollis), which increases the reproductive efforts of the female rearing the young, decreases clutch size the following year; removing eggs from the nest increases the next year’s clutch size. This experiment demonstrates the trade-off between current reproductive effort and future reproductive success.
Natural selection favors the life history that maximizes lifetime reproductive success. When the cost of reproduction is low, individuals should produce as many offspring as possible because there is little cost. Low costs of reproduction may occur when resources are abundant and may also be relatively low when overall mortality rates are high. In the latter case, individuals may be unlikely to survive to the next breeding season anyway, so the incremental effect of increased reproductive efforts may have little effect on future survival. Alternatively, when costs of reproduction are high, lifetime reproductive success may be maximized by deferring or minimizing current reproduction to enhance growth and survival rates. This situation may occur when costs of reproduction significantly affect the ability of an individual to survive or decrease the number of offspring that can be produced in the future.
6
8
10
12
14
Clutch Size
Figure 56.14 The relationship between clutch size and offspring size. In great tits (Parus major), the size of the nestlings is inversely related to the number of eggs laid. The more mouths they have to feed, the less the parents can provide to any one nestling.
?
Inquiry question Would natural selection favor producing many small young or a few large ones?
A trade-off exists between number of offspring and investment per offspring In terms of natural selection, the number of offspring produced is not as important as how many of those offspring themselves survive to reproduce. Assuming that the amount of energy to be invested in offspring is limited, a balance must be reached between the number of offspring produced and the size of each offspring (figure 56.14). This trade-off has been experimentally demonstrated in the side-blotched lizard, which normally lays between four and five eggs at a time. When some of the eggs are removed surgically early in the reproductive cycle, the female lizard produces only one to three eggs, but supplies each of these eggs with greater amounts of yolk, producing eggs and, subsequently, hatchlings that are much larger than normal (figure 56.15). Alternatively, by removing yolk from eggs, scientists have demonstrated that smaller young would be produced. 1172
part
Figure 56.15 Variation in the size of baby sideblotched lizards (Uta stansburiana) produced by experimental manipulations. In clutches in which some developing eggs were surgically removed, the remaining offspring were larger (center) than lizards produced in control clutches in which all the eggs were allowed to develop (right). In experiments in which some of the yolk was removed from the eggs, smaller lizards hatched (left).
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1172
11/20/09 1:47:04 PM
In the side-blotched lizard and many other species, the size of offspring is critical—larger offspring have a greater chance of survival. Producing many offspring with little chance of survival might not be the best strategy, but producing only a single, extraordinarily robust offspring also would not maximize the number of surviving offspring. Rather, an intermediate situation, in which several fairly large offspring are produced, should maximize the number of surviving offspring.
Reproductive events per lifetime represent an additional trade-off The trade-off between age and fecundity plays a key role in many life histories. Annual plants and most insects focus all their reproductive resources on a single large event and then die. This life history adaptation is called semelparity. Organisms that produce offspring several times over many seasons exhibit a life history adaptation called iteroparity. Species that reproduce yearly must avoid overtaxing themselves in any one reproductive episode so that they will be able to survive and reproduce in the future. Semelparity, or “big bang” reproduction, is usually found in short-lived species that have a low probability of staying alive between broods, such as plants growing in harsh climates. Semelparity is also favored when fecundity entails large reproductive cost, exemplified by Pacific salmon migrating upriver to their spawning grounds. In these species, rather than investing some resources in an unlikely bid to survive until the next breeding season, individuals put all their resources into one reproductive event.
Age at first reproduction correlates with life span Among mammals and many other animals, longer-lived species put off reproduction longer than short-lived species, relative to expected life span. The advantage of delayed reproduction is that juveniles gain experience before expending the high costs of reproduction. In long-lived animals, this advantage outweighs the energy that is invested in survival and growth rather than reproduction. In shorter-lived animals, on the other hand, time is of the essence; thus, quick reproduction is more critical than juvenile training, and reproduction tends to occur earlier.
Learning Outcomes Review 56.4 Life history adaptations involve many trade-offs between reproductive cost and investment in survival. These trade-offs take a variety of forms, from laying fewer than the maximum possible number of eggs to putting all energy into a single bout of reproduction. Natural selection favors maximizing reproductive success, but number of offspring produced must be tempered by available resources. ■
How might the life histories of two species differ if one was subject to high levels of predation and the other had few predators?
www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1173
56.5
Environmental Limits to Population Growth
Learning Outcomes 1. 2. 3.
Explain exponential growth. Discuss why populations cannot grow exponentially forever. Define carrying capacity.
Populations often remain at a relatively constant size, regardless of how many offspring are born. As you saw in chapter 1, Darwin based his theory of natural selection partly on this seeming contradiction. Natural selection occurs because of checks on reproduction, with some individuals producing fewer surviving offspring than others. To understand populations, we must consider how they grow and what factors in nature limit population growth.
The exponential growth model applies to populations with no growth limits The rate of population increase, r, is defined as the difference between the birth rate, b, and the death rate, d, corrected for movement of individuals in or out of the population (e, rate of movement out of the area; i, rate of movement into the area). Thus, r = (b – d ) + (i – e) Movements of individuals can have a major influence on population growth rates. For example, the increase in human population in the United States during the closing decades of the 20th century was mostly due to immigration. The simplest model of population growth assumes that a population grows without limits at its maximal rate and also that rates of immigration and emigration are equal. This rate, called the biotic potential, is the rate at which a population of a given species increases when no limits are placed on its rate of growth. In mathematical terms, this is defined by the following formula: dN = r iN dt where N is the number of individuals in the population, dN/dt is the rate of change in its numbers over time, and ri is the intrinsic rate of natural increase for that population—its innate capacity for growth. The biotic potential of any population is exponential (red line in figure 56.16). Even when the rate of increase remains constant, the actual number of individuals accelerates rapidly as the size of the population grows. The result of unchecked exponential growth is a population explosion. A single pair of houseflies, laying 120 eggs per generation, could produce more than 5 trillion descendants in a year. In 10 years, their descendants would form a swarm more than 2 m thick over the entire surface of the Earth! In practice, such patterns of unrestrained growth prevail only for short periods, usually when an organism reaches a new habitat with abundant chapter
56 Ecology of Individuals and Populations
1173
11/20/09 1:47:06 PM
dN = 1.0 N dt
Carrying capacity
1000 750 dN = 1.0 N dt
500
1000 – N 1000
250 0 0
5 10 Number of Generations (t)
Population Growth Rate (dN/dt)
Population Size (N)
1250
15
Positive Growth Rate N=K
0 Negative Growth Rate Below K
Population Size (N)
Figure 56.16 Two models of population growth. The red line illustrates the exponential growth model for a population with an r of 1.0. The blue line illustrates the logistic growth model in a population with r = 1.0 and K = 1000 individuals. At fi rst, logistic growth accelerates exponentially; then, as resources become limited, the death rate increases and growth slows. Growth ceases when the death rate equals the birth rate. The carrying capacity (K) ultimately depends on the resources available in the environment.
Figure 56.17 Relationship between population growth rate and population size. Populations far from the carrying capacity (K ) have high growth rates—positive if the population is below K, and negative if it is above K. As the population approaches K, growth rates approach zero.
? resources. Natural examples of such short period of unrestrained growth include dandelions arriving in the fields, lawns, and meadows of North America from Europe for the first time; algae colonizing a newly formed pond; or cats introduced to an island with many birds, but previously lacking predators.
Carrying capacity No matter how rapidly populations grow, they eventually reach a limit imposed by shortages of important environmental factors, such as space, light, water, or nutrients. A population ultimately may stabilize at a certain size, called the carrying capacity of the particular place where it lives. The carrying capacity, symbolized by K, is the maximum number of individuals that the environment can support.
The logistic growth model applies to populations that approach their carrying capacity As a population approaches its carrying capacity, its rate of growth slows greatly, because fewer resources remain for each new individual to use. The growth curve of such a population, which is always limited by one or more factors in the environment, can be approximated by the following logistic growth equation:
(
)
dN = rN K – N dt K In this model of population growth, the growth rate of the population (dN/dt) is equal to its intrinsic rate of natural increase (r multiplied by N, the number of individuals present at any one time), adjusted for the amount of resources available. The adjust1174
part
Carrying Above K Capacity (K)
Inquiry question Why does the growth rate converge on zero?
ment is made by multiplying rN by the fraction of K, the carrying capacity, still unused [(K – N )/K ]. As N increases, the fraction of resources by which r is multiplied becomes smaller and smaller, and the rate of increase of the population declines. Graphically, if you plot N versus t (time), you obtain a sigmoidal growth curve characteristic of many biological populations. The curve is called “sigmoidal” because its shape has a double curve like the letter S. As the size of a population stabilizes at the carrying capacity, its rate of growth slows, eventually coming to a halt (blue line in figure 56.16). In mathematical terms, as N approaches K, the rate of population growth (dN/dt) begins to slow, reaching 0 when N = K (figure 56.17). Conversely, if the population size exceeds the carrying capacity, then K – N will be negative, and the population will experience a negative growth rate. As the population size then declines toward the carrying capacity, the magnitude of this negative growth rate will decrease until it reaches 0 when N = K. Notice that the population tends to move toward the carrying capacity regardless of whether it is initially above or below it. For this reason, logistic growth tends to return a population to the same size. In this sense, such populations are considered to be in equilibrium because they would be expected to be at or near the carrying capacity at most times. In many cases, real populations display trends corresponding to a logistic growth curve. This is true not only in the laboratory, but also in natural populations (figure 56.18a). In some cases, however, the fit is not perfect (figure 56.18b), and as we shall see shortly, many populations exhibit other patterns.
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1174
11/20/09 1:47:07 PM
Number of Cladocerans (per 200 mL)
Number of Breeding Male Fur Seals (thousands)
10 8 6 4 2 0 1915
1925 1935 Time (years)
1945
exhibit logistic growth. a. A fur seal (Callorhinus ursinus) population on St. Paul Island, Alaska. b. Two laboratory populations of the cladoceran Bosmina longirostris. Note that the populations fi rst exceeded the carrying capacity, before decreasing to a size that was then maintained.
400 300 200 100 0 0
10
Exponential growth refers to population growth in which the number of individuals accelerates even when the rate of increase remains constant; it results in a population explosion. Exponential growth is eventually limited by resource availability. The size at which a population in a particular location stabilizes is defined as the carrying capacity of that location for that species. Populations often grow to the carrying capacity of their environment. What might cause a population’s carrying capacity to change, and how would the population respond?
56.6
Factors That Regulate Populations
Learning Outcomes 1. 2. 3.
Compare density-dependent and density-independent factors. Evaluate why the size of some populations cycle. Consider how the life history adaptations of species may differ depending on how often populations are at their carrying capacity.
Densityindependent death rate
Equilibrium population density Population Density
www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1175
Densitydependent death rate
Density-dependent effects occur when reproduction and survival are affected by population size The reason population growth rates are affected by population size is that many important processes have density-dependent effects. That is, as population size increases, either reproductive rates decline or mortality rates increase, or both, a phenomenon termed negative feedback (figure 56.19). Populations can be regulated in many different ways. When populations approach their carrying capacity, competition for resources can be severe, leading both to a decreased birth rate and an increased risk of death (figure 56.20). In addition, predators often focus their attention on a particularly common prey species, which also results in increasing rates of mortality as populations increase. High population densities can also lead to an accumulation of toxic wastes in the environment.
Affecting Birth and Death Rates
Densityindependent birth rate
Low
Densitydependent birth rate
Affecting Death Rates High
Affecting Birth Rates
A number of factors may affect population size through time. Some of these factors depend on population size and are therefore termed density-dependent. Other factors, such as natural disasters, affect populations regardless of size; these factors are termed density-independent. Many populations exhibit cyclic fluctuations in size that may result from complex interactions of factors.
Equilibrium population density Population Density
Densitydependent birth rate Densitydependent death rate
Low
■
High
50
b.
Learning Outcomes Review 56.5
Low
20 30 40 Time (days)
High
a.
Figure 56.18 Many populations
500
Equilibrium population density
Figure 56.19 Densitydependent population regulation. Densitydependent factors can affect birth rates, death rates, or both.
?
Inquiry question Why might birth rates be density-dependent?
Population Density chapter
56 Ecology of Individuals and Populations
1175
11/20/09 1:47:07 PM
4.0
0.8
3.0
0.7 0.6
2.0
0.5
1.0
0.4 0
20
40 80 60 100 120 Number of Breeding Adults
140
Figure 56.20 Density dependence in the song sparrow (Melospiza melodia) on Mandarte Island. Reproductive success decreases and mortality rates increase as population size increases.
?
Inquiry question What would happen if researchers supplemented the food available to the birds?
Behavioral changes may also affect population growth rates. Some species of rodents, for example, become antisocial, fighting more, breeding less, and generally acting stressed-out. These behavioral changes result from hormonal actions, but their ultimate cause is not yet clear; most likely, they have evolved as adaptive responses to situations in which resources are scarce. In addition, in crowded populations, the population growth rate may decrease because of an increased rate of emigration of individuals attempting to find better conditions elsewhere (figure 56.21). However, not all density-dependent factors are negatively related to population size. In some cases, growth rates increase with population size. This phenomenon is referred to as the Allee effect (after Warder Allee, who first described it), and is an example of positive feedback. The Allee effect can take several forms. Most obviously, in populations that are too sparsely distributed, individuals may have difficulty finding mates. Moreover, some species may rely on large groups to deter predators or to provide the necessary stimulation for breeding activities. The Allee effect
is a major threat for many endangered species, which may never recover from decreased population sizes caused by habitat destruction, overexploitation, or other causes (see chapter 60).
Density-independent effects include environmental disruptions and catastrophes Growth rates in populations sometimes do not correspond to the logistic growth equation. In many cases, such patterns result because growth is under the control of density-independent effects. In other words, the rate of growth of a population at any instant is limited by something unrelated to the size of the population. A variety of factors may affect populations in a densityindependent manner. Most of these are aspects of the external environment, such as extremely cold winters, droughts, storms, or volcanic eruptions. Individuals often are affected by these occurrences regardless of the size of the population. Populations in areas where such events occur relatively frequently display erratic growth patterns in which the populations increase rapidly when conditions are benign, but exhibit large reductions whenever the environment turns hostile (figure 56.22). Needless to say, such populations do not produce the sigmoidal growth curves characteristic of the logistic equation.
Population cycles may reflect complex interactions In some populations, density-dependent effects lead not to an equilibrium population size but to cyclic patterns of increase and decrease. For example, ecologists have studied cycles in hare
103
Panolis
10 Number of Moth Pupae per m2 Plotted on a Logarithmic Scale
0.9 Juvenile Mortality
Number of Young per Female
5.0
Hyloicus
103 10 105
Dendrolimus 103 10 105 Bupalus 103 10 1880
1890
1900
1910
1920
1930
1940
Year
Figure 56.22 Fluctuations in the number Figure 56.21 Density-dependent effects. Migratory locusts (Locusta migratoria) are a legendary plague of large areas of Africa and Eurasia. At high population densities, the locusts have different hormonal and physical characteristics and take off as a swarm. 1176
part
of pupae of four moth species in Germany. The population fluctuations suggest that density-independent factors are regulating population size. The concordance in trends through time suggests that the same factors are regulating population size in all four species.
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1176
11/20/09 1:47:08 PM
populations since the 1820s. They have found that the North American snowshoe hare (Lepus americanus) follows a “10-year cycle” (in reality, the cycle varies from 8 to 11 years). Hare population numbers fall 10-fold to 30-fold in a typical cycle, and 100fold changes can occur (figure 56.23). Two factors appear to be generating the cycle: food plants and predators. Food plants. The preferred foods of snowshoe hares are willow and birch twigs. As hare density increases, the quantity of these twigs decreases, forcing the hares to feed on high-fiber (low-quality) food. Lower birthrates, low juvenile survivorship, and low growth rates follow. The hares also spend more time searching for food, an activity that increases their exposure to predation. The result is a precipitous decline in willow and birch twig abundance, and a corresponding fall in hare abundance. It takes 2 to 3 years for the quantity of mature twigs to recover. Predators. A key predator of the snowshoe hare is the Canada lynx. The Canada lynx shows a “10-year” cycle of abundance that seems remarkably entrained to the hare abundance cycle (see figure 55.23). As hare numbers increase, lynx numbers do too, rising in response to the increased availability of the lynx’s food. When hare numbers fall, so do lynx numbers, their food supply depleted.
Number of Pelts (in thousands)
Which factor is responsible for the predator–prey oscillations? Do increasing numbers of hares lead to overharvesting of plants (a hare–plant cycle), or do increasing numbers of lynx lead to overharvesting of hares (a hare–lynx cycle)? Field experiments carried out by Charles Krebs and coworkers in 1992 provide an answer.
160 120
snowshoe hare lynx
80 40 0 1845 1855 1865 1875 1885 1895 1905 1915 1925 1935 Year
Figure 56.23 Linked population cycles of the snowshoe hare (Lepus americanus) and the northern lynx (Lynx canadensis). These data are based on records of fur returns from trappers in the Hudson Bay region of Canada. The lynx population carefully tracks that of the snowshoe hare, but lags behind it slightly.
?
Inquiry question Suppose experimenters artificially kept the hare population at a high and constant level; what would happen to the lynx population? Conversely, if experimenters artificially kept the lynx population at a high and constant level, what would happen to the hare population?
www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1177
In Canada’s Yukon, Krebs set up experimental plots that contained hare populations. If food is added (no food shortage effect) and predators are excluded (no predator effect) in an experimental area, hare numbers increase 10-fold and stay there—the cycle is lost. However, the cycle is retained if either of the factors is allowed to operate alone: exclude predators but don’t add food (food shortage effect alone), or add food in the presence of predators (predator effect alone). Thus, both factors can affect the cycle, which in practice seems to be generated by the interaction between the two. Population cycles traditionally have been considered to occur rarely. However, a recent review of nearly 700 long-term (25 years or more) studies of trends within populations found that cycles were not uncommon; nearly 30% of the studies— including birds, mammals, fish, and crustaceans—provided evidence of some cyclic pattern in population size through time, although most of these cycles are nowhere near as dramatic in amplitude as the hare–lynx cycles. In some cases, such as that of the snowshoe hare and lynx, density-dependent factors may be involved, whereas in other cases, density-independent factors, such as cyclic climatic patterns, may be responsible.
Resource availability affects life history adaptations As you have seen, some species usually maintain stable population sizes near the carrying capacity, whereas in other species population sizes fluctuate markedly and are often far below carrying capacity. The selective factors affecting such species differ markedly. Individuals in populations near their carrying capacity may face stiff competition for limited resources; by contrast, individuals in populations far below carrying capacity have access to abundant resources. We have already described the consequences of such differences. When resources are limited, the cost of reproduction often will be very high. Consequently, selection will favor individuals that can compete effectively and utilize resources efficiently. Such adaptations often come at the cost of lowered reproductive rates. Such populations are termed K-selected because they are adapted to thrive when the population is near its carrying capacity (K). Table 56.3 lists some of the typical features of K-selected populations. Examples of K-selected species include coconut palms, whooping cranes, whales, and humans. By contrast, in populations far below the carrying capacity, resources may be abundant. Costs of reproduction are low, and selection favors those individuals that can produce the maximum number of offspring. Selection here favors individuals with the highest reproductive rates; such populations are termed r-selected. Examples of organisms displaying r-selected life history adaptations include dandelions, aphids, mice, and cockroaches. Most natural populations show life history adaptations that exist along a continuum ranging from completely r-selected traits to completely K-selected traits. Although these tendencies hold true as generalities, few populations are purely r- or K-selected and show all of the traits listed in table 56.3. These attributes should be treated as generalities, with the recognition that many exceptions exist. chapter
56 Ecology of Individuals and Populations
1177
11/20/09 1:47:09 PM
r-Selected and K-Selected Life TA B L E 5 6 . 3 History Adaptations r-Selected Populations
Adaptation
K-Selected Populations
Age at first reproduction
Early
Late
Life span
Short
Long
Maturation time
Short
Long
Mortality rate
Often high
Usually low
Number of offspring produced per reproductive episode
Many
Few
Number of reproductions per lifetime
Few
Many
Parental care
None
Often extensive
Size of offspring or eggs
Small
Large
Learning Outcomes Review 56.6 Density-dependent factors such as resource availability come into play particularly when population size is larger; density-independent factors such as natural disasters operate regardless of population size. Population density may be cyclic due to complex interactions such as resource cycles and predator effects. Populations with density-dependent regulation often are near their carrying capacity; in species with populations well below carrying capacity, natural selection may favor high rates of reproduction when resources are abundant. ■
Can a population experience both positive and negative density-dependent effects?
56.7
Human Population Growth
Learning Outcomes 1. 2. 3.
Explain how the rate of human population growth has changed through time. Describe the effects of age distribution on future growth. Evaluate the relative importance of rapid population growth and resource consumption as threats to the biosphere and human welfare.
Humans exhibit many K-selected life history traits, including small brood size, late reproduction, and a high degree of parental care. These life history traits evolved during the early history of hominids, when the limited resources available from the environment controlled population size. Throughout most of 1178
part
human history, our populations have been regulated by food availability, disease, and predators. Although unusual disturbances, including floods, plagues, and droughts, no doubt affected the pattern of human population growth, the overall size of the human population grew slowly during our early history. Two thousand years ago, perhaps 130 million people populated the Earth. It took a thousand years for that number to double, and it was 1650 before it had doubled again, to about 500 million. In other words, for over 16 centuries, the human population was characterized by very slow growth. In this respect, human populations resembled many other species with predominantly K-selected life history adaptations.
Human populations have grown exponentially Starting in the early 1700s, changes in technology gave humans more control over their food supply, enabled them to develop superior weapons to ward off predators, and led to the development of cures for many diseases. At the same time, improvements in shelter and storage capabilities made humans less vulnerable to climatic uncertainties. These changes allowed humans to expand the carrying capacity of the habitats in which they lived and thus to escape the confines of logistic growth and re-enter the exponential phase of the sigmoidal growth curve. Responding to the lack of environmental constraints, the human population has grown explosively over the last 300 years. Although the birth rate has remained unchanged at about 30 per 1000 per year over this period, the death rate has fallen dramatically, from 20 per 1000 per year to its present level of 13 per 1000 per year. The difference between birth and death rates meant that the population grew as much as 2% per year, although the rate has now declined to 1.2% per year. A 1.2% annual growth rate may not seem large, but it has produced a current human population of nearly 7 billion people (figure 56.24). At this growth rate, 78 million people would be added to the world population in the next year, and the human population would double in 58 years. Both the current human population level and the projected growth rate have potentially grave consequences for our future.
Population pyramids show birth and death trends Although the human population as a whole continues to grow rapidly at the beginning of the 21st century, this growth is not occurring uniformly over the planet. Rather, most of the population growth is occurring in Africa, Asia, and Latin America (figure 56.25). By contrast, populations are actually decreasing in some countries in Europe. The rate at which a population can be expected to grow in the future can be assessed graphically by means of a population pyramid, a bar graph displaying the numbers of people in each age category (figure 56.26). Males are conventionally shown to the left of the vertical age axis, females to the right. A human population pyramid thus displays the age composition of a population by sex. In most human population pyramids, the number of older females is disproportionately large compared with the
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1178
11/20/09 1:47:10 PM
7000
6
6721
2005 2050
6000 5350
5000
5
2000
1931
Population (in millions)
Billions of People
1800
4
Significant advances in public health
3
2
Industrial Revolution
1600 1400 1200 1000
907
871
800
767 685
600
Bubonic plague “Black Death”
1
527
516
400
375
200
4000
3000
2000
B.C.
B.C.
B.C.
1000
0
1000
2000
B.C.
48
33
0 Africa
Asia
Australasia
Year
number of older males, because females in most regions have a longer life expectancy than males. Viewing such a pyramid, we can predict demographic trends in births and deaths. In general, a rectangular pyramid is characteristic of countries whose populations are stable, neither growing nor shrinking. A triangular pyramid is characteristic of a country that will exhibit rapid future growth because most of
Inquiry question Based on what we have learned about population growth, what do you predict will happen to human population size?
male female
Figure 56.26 Population pyramids from 2008. Population
Kenya
pyramids are graphed according to a population’s age distribution. Kenya’s pyramid has a broad base because of the great number of individuals below childbearing age. When the young people begin to bear children, the population will experience rapid growth. The Swedish pyramid exhibits a slight bulge among middleaged Swedes, the result of the “baby boom” that occurred in the middle of the 20th century, and many postreproductive individuals resulting from Sweden’s long average life span.
80; 75–79 70–74 65–69 60–64 55–59 50–54 Age
South America
Developed countries are predicted to grow little; almost all of the population increase will occur in less-developed countries.
Temporary increases in death rate, even a severe one such as that occurring during the Black Death of the 1300s, have little lasting effect. Explosive growth began with the Industrial Revolution in the 1800s, which produced a significant, long-term lowering of the death rate. The current world population is 6.9 billion, and at the present rate, it will double in 58 years.
Sweden
North America
Figure 56.25 Projected population growth in 2050.
Figure 56.24 History of human population size.
?
Europe
45–49 40–44 35–39 30–34 25–29 20–24 15–19 10–14
?
5–9 0–4 8
www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1179
4
0
4
8
18 15 12 9 6 3 Percent of Population
0
3
6
9 12 15 18
chapter
Inquiry question What will the population distributions look like in 20 years?
56 Ecology of Individuals and Populations
1179
11/20/09 1:47:11 PM
11 10 World Population in Billions
its population has not yet entered the childbearing years. Inverted triangles are characteristic of populations that are shrinking, usually as a result of sharply declining birth rates. Examples of population pyramids for Sweden and Kenya in 2008 are shown in figure 56.26. The two countries exhibit very different age distributions. The nearly rectangular population pyramid for Sweden indicates that its population is not expanding because birth rates have decreased and average life span has increased. The very triangular pyramid of Kenya, by contrast, results from relatively high birthrates and shorter average life spans, which can lead to explosive future growth. The difference is most apparent when we consider that only 16% of Sweden’s population is less than 15 years old, compared with nearly half of all Kenyans. Moreover, the fertility rate (offspring per woman) in Sweden is 1.7; in Kenya, it is 4.7. As a result, Kenya’s population could double in less than 35 years, whereas Sweden’s will remain stable.
9 8
m
World total
7
ty tili fer h hig lity fer ti um edi low fertility
6 5 Developing countries
4 3 2 1
Developed countries
0 1900
1950
Time
2050
2000
Figure 56.27 Distribution of population growth. Most
Humanity’s future growth is uncertain Earth’s rapidly growing human population constitutes perhaps the greatest challenge to the future of the biosphere, the world’s interacting community of living things. Humanity is adding 78 million people a year to its population—over a million every 5 days, 150 every minute! In more rapidly growing countries, the resulting population increase is staggering (table 56.4). India, for example, had a population of 1.05 billion in 2002; by 2050, its population likely will exceed 1.6 billion. A key element in the world’s population growth is its uneven distribution among countries. Of the billion people added to the world’s population in the 1990s, 90% live in developing countries (figure 56.27). The fraction of the world’s population that lives in industrialized countries is therefore diminishing. In 1950, fully one-third of the world’s population lived in industrialized countries; by 1996, that proportion had fallen to onequarter; and in 2020, the proportion will have fallen to one-sixth.
TA B L E 5 6 . 4
Fertility rate
of the worldwide increase in population since 1950 has occurred in developing countries. The age structures of developing countries indicate that this trend will increase in the near future. World population in 2050 likely will be between 7.3 and 10.7 billion, according to a recent United Nations study. Depending on fertility rates, the population at that time will either be increasing rapidly or slightly, or in the best case, declining slightly.
In the future, the world’s population growth will be centered in the parts of the world least equipped to deal with the pressures of rapid growth. Rapid population growth in developing countries has had the harsh consequence of increasing the gap between rich and poor. Today, the 19% of the world’s population that lives in the industrialized world have a per capita income of $22,060, but 81% of the world’s population lives in developing countries and has a per capita income of only $3,580. Furthermore, of the
A Comparison of 2005 Population Data in Developed and Developing Countries United States (highly developed)
Brazil (moderately developed)
Ethiopia (poorly developed)
2.1
1.9
5.3
Doubling time at current rate (years)
75
65
29
Infant mortality rate (per 1000 births)
6.5
30
95
Life expectancy at birth (years)
78
72
49
$40,100
$8100
$800
21
26
44
Per capita GDP (U.S. $)* Population < 15 years old (%) *GDP, gross domestic product.
1180
part
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1180
11/20/09 1:47:11 PM
people in the developing world, about one-quarter of the population gets by on $1 per day. Eighty percent of all the energy used today is consumed by the industrialized world, but only 20% is used by developing countries. No one knows whether the world can sustain today’s population of 6.9 billion people, much less the far greater numbers expected in the future. As chapter 58 outlines, the world ecosystem is already under considerable stress. We cannot reasonably expect to expand its carrying capacity indefinitely, and indeed we already seem to be stretching the limits. Despite using an estimated 45% of the total biological productivity of Earth’s landmasses and more than one-half of all renewable sources of fresh water, between one-fourth and one-eighth of all people in the world are malnourished. Moreover, as anticipated by Thomas Malthus in his famous 1798 work, Essay on the Principle of Population, death rates are beginning to rise in some areas. In sub-Saharan Africa, for example, population projections for the year 2025 have been scaled back from 1.33 billion to 1.05 billion (21%) because of the effect of AIDS. Similar decreases are projected for Russia as a result of higher death rates due to disease. If we are to avoid catastrophic increases in the death rate, birth rates must fall dramatically. Faced with this grim dichotomy, significant efforts are underway worldwide to lower birth rates.
Consumption in the developed world further depletes resources Population size is not the only factor that determines resource use; per capita consumption is also important. In this respect, we in the industrialized world need to pay more attention to lessening the impact each of us makes because, even though the vast majority of the world’s population is in developing countries, the overwhelming percentage of consumption of resources occurs in the industrialized countries. Indeed, the wealthiest 20% of the world’s population accounts for 86% of the world’s consumption of resources and produces 53% of the world’s carbon dioxide emissions, whereas the poorest 20% of the world is responsible for only 1.3% of consumption and 3% of carbon dioxide emissions. Looked at another way, in terms of resource use, a child born today in the industrialized world will consume many more resources over the course of his or her life than a child born in the developing world. One way of quantifying this disparity is by calculating what has been termed the ecological footprint, which is the amount of productive land required to support an individual at the standard of living of a particular population through the course of his or her life. This figure estimates the acreage used for the production of food (both plant and animal), forest products, and housing, as well as the area of forest required to absorb carbon dioxide produced by the combustion of fossil fuels. As figure 56.28 illustrates, the
The population growth rate has declined
www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1181
28 Acres of Land Required to Support an Individual at Standard of Living of Population
The world population growth rate is declining, from a high of 2.0% in the period 1965–1970 to 1.2% in 2008. Nonetheless, because of the larger population, this amounts to an increase of 78 million people per year to the world population, compared with 53 million per year in the 1960s. The United Nations attributes the growth rate decline to increased family planning efforts and the increased economic power and social status of women. The United States has led the world in funding family planning programs abroad, but some groups oppose spending money on international family planning. The opposition believes that money is better spent on improving education and the economy in other countries, leading to an increased awareness and lowered fertility rates. The U.N. certainly supports the improvement of education programs in developing countries, but interestingly, it has reported increased education levels following a decrease in family size as a result of family planning. Most countries are devoting considerable attention to slowing the growth rate of their populations, and there are genuine signs of progress. For example, from 1984 to 2008, family planning programs in Kenya succeeded in reducing the fertility rate from 8.0 to 4.7 children per couple, thus lowering the population growth rate from 4.0% per year to 2.8% per year. Because of these efforts, the global population may stabilize at about 8.9 billion people by the middle of the current century. How many people the planet can support sustainably depends on the quality of life that we want to achieve; there are already more people than can be sustainably supported with current technologies.
30
26 24
23.2
22 20 18 16 14 12
10.4
10 8 5.9
6
3.2
4
2.2
2.2
2 0
USA
Germany
Brazil
Nigeria Indonesia
India
Figure 56.28 Ecological footprints of individuals in different countries. An ecological footprint calculates how much land is required to support a person through his or her life, including the acreage used for production of food, forest products, and housing, in addition to the forest required to absorb the carbon dioxide produced by the combustion of fossil fuels.
?
Inquiry question Which is a more important cause of resource depletion, overpopulation or overconsumption? chapter
56 Ecology of Individuals and Populations
1181
11/20/09 1:47:11 PM
ecological footprint of an individual in the United States is more than 10 times greater than that of someone in India. Based on these measurements, researchers have calculated that resource use by humans is now one-third greater than the amount that nature can sustainably replace. Moreover, consumption is increasing rapidly in parts of the developing world; if all humans lived at the standard of living in the industrialized world, two additional planet Earths would be needed. Building a sustainable world is the most important task facing humanity’s future. The quality of life available to our children will depend to a large extent on our success in limiting both population growth and the amount of per capita resource consumption.
Learning Outcomes Review 56.7 For most of its history, the K-selected human population increased gradually. In the last 400 years, with resource control, the human population has grown exponentially; at the current rate, it would double in 58 years. A population pyramid shows the number of individuals in different age categories. Pyramids with a wide base are undergoing faster growth than those that are uniform from top to bottom. Growth rates overall are declining, but consumption per capita in the developed world is still a significant drain on resources. ■
Which is more important, reducing global population growth or reducing resource consumption levels in developed countries?
Chapter Review 56.1 The Environmental Challenges
56.3 Population Demography and Dynamics
Key environmental factors include temperature, water, sunlight, and soil type. Individuals seek to maintain internal homeostasis.
Sex ratio and generation time affect population growth rates. Abundant females, a short generation time, or both can be responsible for more rapid population growth.
Organisms are capable of responding to environmental changes that occur during their lifetime. Most individuals can cope with variations in their natural habitat, such as short-term changes in temperature and water availability. Natural selection leads to evolutionary adaptation to environmental conditions. Over evolutionary time, physiological, morphological, or behavioral adaptations evolve that make organisms better suited to the environment in which they live.
56.2 Populations: Groups of a Single Species in One Place
Age structure is determined by the numbers of individuals in different age groups. Every age cohort has a characteristic fecundity and death rate, and so the age structure of a population affects growth. Life tables show probability of survival and reproduction through a cohort’s life span. Survivorship curves demonstrate how survival probability changes with age (see figures 56.11, 56.12). In some populations, survivorship is high until old age, whereas in others, survivorship is lowest among the youngest individuals.
A population’s geographic distribution is termed its range.
56.4 Life History and the Cost of Reproduction
Ranges undergo expansion and contraction. Most populations have limited geographic ranges that can expand or contract through time as the environment changes. Dispersal mechanisms may allow some species to cross a barrier and expand their range. Human actions have led to range expansion of some species, often with detrimental effects.
Because resources are limited, reproduction has a cost. Resources allocated toward current reproduction cannot be used to enhance survival and future reproduction (see figure 56.13).
Individuals in populations exhibit different spacing patterns. Within a population, individuals are distributed randomly, uniformly, or are clumped . Nonrandom distributions may reflect resource distributions or competition for resources. A metapopulation comprises distinct populations that may exchange members. The degree of exchange between populations in a metapopulation is highest when populations are large and more connected. Metapopulations may act as a buffer against extinction by permitting recolonization of vacant areas or marginal areas. 1182
part
A trade-off exists between number of offspring and investment per offspring. When reproductive cost is high, fitness can be maximized by deferring reproduction, or by producing a few large-sized young that have a greater chance of survival. Reproductive events per lifetime represent an additional trade-off. Semelparity is reproduction once in a single large event. Iteroparity is production of offspring several times over many seasons. Age at first reproduction correlates with life span. Longer-lived species delay first reproduction longer compared with short-lived species, in which time is of the essence.
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1182
11/20/09 1:47:12 PM
56.5 Environmental Limits to Population Growth The exponential growth model applies to populations with no growth limits. The rate of population increase, r, is defined as the difference between birth rate, b, and death rate, d. Exponential growth occurs when a population is not limited by resources or by other species (see figure 56.16). The logistic model applies to populations that approach their carrying capacity. Logistic growth is observed as a population reaches its carrying capacity. Usually, a population’s growth rate slows to a plateau. In some cases the population overshoots and then drops back to the carrying capacity.
56.6 Factors That Regulate Populations Density-dependent effects occur when reproduction and survival are affected by population size. Density-dependent factors include increased competition and disease. To stabilize a population size, birth rates must decline, death rates must increase, or both. Density-independent effects include environmental disruptions and catastrophes. Density-independent factors are not related to population size and include environmental events that result in mortality.
Resource availability affects life history adaptations. Populations at carrying capacity have adaptations to compete for limited resources; populations well below carrying capacity exhibit a high reproductive rate to use abundant resources.
56.7 Human Population Growth Human populations have grown exponentially. Technology and other innovations have simultaneously increased the carrying capacity and decreased mortality in the past 300 years. Population pyramids show birth and death trends. Populations with many young individuals are likely to experience high growth rates as these individuals reach reproductive age. Humanity’s future growth is uncertain. The human population is unevenly distributed. Rapid growth in developing countries has resulted in poverty, whereas most resources are utilized by the industrialized world. The population growth rate has declined. Even at lower growth rates, the number of individuals on the planet is likely to plateau at 7 to 10 billion. Consumption in the developed world further depletes resources. Resource consumption rates in the developed world are very high; a sustainable future requires limits both to population growth and to per capita resource consumption.
Population cycles may reflect complex interactions. In some cases, population size is cyclic because of the interaction of factors such as food supply and predation (see figure 56.23).
Review Questions U N D E R S TA N D 1. Source–sink metapopulations are distinct from other types of metapopulations because a. b. c. d.
exchange of individuals only occurs in the former. populations with negative growth rates are a part of the former. populations never go extinct in the former. all populations eventually go extinct in the former.
2. The potential for social interactions among individuals should be maximized when individuals a. b. c. d.
are randomly distributed in their environment. are uniformly distributed in their environment. have a clumped distribution in their environment. None of the above
3. When ecologists talk about the cost of reproduction they mean a. b. c. d.
the reduction in future reproductive output as a consequence of current reproduction. the amount of calories it takes for all the activity used in successful reproduction. the amount of calories contained in eggs or offspring. None of the above
www.ravenbiology.com
rav32223_ch56_1162-1184.indd 1183
4. A life history trade-off between clutch size and offspring size a. b. c. d.
means that as clutch size increases, offspring size increases. means that as clutch size increases, offspring size decreases. means that as clutch size increases, adult size increases. means that as clutch size increases, adult size decreases.
5. The difference between exponential and logistic growth rates is a. b. c. d.
exponential growth depends on birth and death rates and logistic does not. in logistic growth, emigration and immigration are unimportant. that both are affected by density, but logistic growth is slower. that only logistic growth reflects density-dependent effects on births or deaths.
6. The logistic population growth model, dN/dt = rN[(K – N)/K], describes a population’s growth when an upper limit to growth is assumed. As N approaches (numerically) the value of K a. b. c. d.
dN/dt increases rapidly. dN/dt approaches 0. dN/dt increases slowly. the population becomes threatened by extinction. chapter
56 Ecology of Individuals and Populations
1183
11/20/09 1:47:12 PM
7. Which of the following is an example of a density-dependent effect on population growth? a. b. c. d.
An extremely cold winter A tornado An extremely hot summer in which cool burrow retreats are fewer than number of individuals in the population A drought
A P P LY 1. If the size of a population is reduced due to a natural disaster such as a flood a. b. c. d.
population growth rates may increase because the population is no longer near its carrying capacity. population growth rates may decrease because individuals have trouble finding mates. both effects a. and b. may occur and whether population rates increase or decrease cannot be predicted. All of the above
2. In populations subjected to high levels of predation a. b. c. d.
individuals should invest little in reproduction so as to maximize their survival. individuals should produce few offspring and invest little in any of them. individuals should invest greatly in reproduction because their chance of surviving to another breeding season is low. individuals should stop reproducing altogether.
3. In a population in which individuals are uniformly distributed a. b. c. d.
the population is probably well below its carrying capacity. natural selection should favor traits that maximize the ability to compete for resources. immigration from other populations is probably keeping the population from going extinct. None of the above
4. The elimination of predators by humans a. b.
1184
will cause its prey to experience exponential growth until new predators arrive or evolve. will lead to an increase in the carrying capacity of the environment.
part
c.
d.
may increase the population size of a prey species if that prey’s population was being regulated by predation from the predator. will lead to an Allee effect.
SYNTHESIZE 1. Refer to figure 56.8. What are the implications for evolutionary divergence among populations that are part of a metapopulation versus populations that are independent of other populations? 2. Refer to figure 56.13. Given a trade-off between current reproductive effort and future reproductive success (the so-called cost of reproduction), would you expect old individuals to have the same “optimal” reproductive effort as young individuals? 3. Refer to figure 56.14. Because the number of offspring that a parent can produce is often a trade-off with the size of individual offspring, many circumstances lead to an intermediate number and size of offspring being favored. If the size of an offspring was completely unrelated to the quality of that offspring (its chances of surviving until it reaches reproductive age), would you expect parents to fall on the left or right side of the x-axis (clutch size)? Explain. 4. Refer to figure 56.26. Would increasing the mean generation time have the same kind of effect on population growth rate as reducing the number of children that an individual female has over her lifetime? Which effect would have a bigger influence on population growth rate? Explain.
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
VIII Ecology and Behavior
rav32223_ch56_1162-1184.indd 1184
11/20/09 1:47:13 PM
CHAPTER
Chapter
57
Community Ecology
Chapter Outline 57.1
Biological Communities: Species Living Together
57.2
The Ecological Niche Concept
57.3
Predator–Prey Relationships
57.4
The Many Types of Species Interactions
57.5
Ecological Succession, Disturbance, and Species Richness
A
Introduction All the organisms that live together in a place are members of a community. The myriad of species that inhabit a tropical rain forest are a community. Indeed, every inhabited place on Earth supports its own particular array of organisms. Over time, the different species that live together have made many complex adjustments to community living, evolving together and forging relationships that give the community its character and stability. Both competition and cooperation have played key roles; in this chapter, we look at these and other factors in community ecology.
rav32223_ch57_1185-1206.indd 1185
11/20/09 2:08:15 PM
57.1
Biological Communities: Species Living Together
interact with one another are studied. Although scientists sometimes refer to such subsets as communities (for example, the “spider community”), the term assemblage is more appropriate to connote that the species included are only a portion of those present within the entire community.
Learning Outcomes 1. 2.
Define community. Describe how community composition may change across a geographic landscape.
Almost any place on Earth is occupied by species, sometimes by many of them, as in the rain forests of the Amazon, and sometimes by only a few, as in the near-boiling waters of Yellowstone’s geysers (where a number of microbial species live). The term community refers to the species that occur at any particular locality (figure 57.1). Communities can be characterized either by their constituent species or by their properties, such as species richness (the number of species present) or primary productivity (the amount of energy produced). Interactions among community members govern many ecological and evolutionary processes. These interactions, such as predation and mutualism, affect the population biology of particular species—whether a population increases or decreases in abundance, for example—as well as the ways in which energy and nutrients cycle through the ecosystem. Moreover, the community context affects the patterns of natural selection faced by a species, and thus the evolutionary course it takes. Scientists study biological communities in many ways, ranging from detailed observations to elaborate, large-scale experiments. In some cases, studies focus on the entire community, whereas in other cases only a subset of species that are likely to
Communities have been viewed in different ways Two views exist on the structure and functioning of communities. The individualistic concept of communities holds that a community is simply an aggregation of species that happen to occur together at one place. By contrast, the holistic concept of communities views communities as an integrated unit. In this sense, the community could be viewed as a superorganism whose constituent species have coevolved to the extent that they function as part of a greater whole, just as the kidneys, heart, and lungs all function together within an animal’s body. In this view, then, a community would amount to more than the sum of its parts. These two views make differing predictions about the integrity of communities across space and time. If, as the individualistic view implies, communities are nothing more than a combination of species that occur together, then moving geographically across the landscape or back through time, we would not expect to see the same community. That is, species should appear and disappear independently, as a function of each species’ own unique ecological requirements. By contrast, if a community is an integrated whole, then we would make the opposite prediction: Communities should stay the same through space or time, until being replaced by completely different communities when environmental differences are sufficiently great.
Figure 57.1 An African savanna community. A community consists of all the species—plants, animals, fungi, protists, and prokaryotes—that occur at a locality, i n this case Etosha National Park in Namibia.
1186
part
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1186
11/20/09 2:08:20 PM
Communities change over space and time Normal soil
Ecotone
Serpentine soil
Black oak Poison oak Iris Douglas fir Hawkweed Species of Plant
Most ecologists today favor the individualistic concept. For the most part, species seem to respond independently to changing environmental conditions. As a result, community composition changes gradually across landscapes as some species appear and become more abundant, while others decrease in abundance and eventually disappear. A famous example of this pattern is the abundance of tree species in the Santa Catalina Mountains of Arizona along a geographic gradient running from very dry to very moist. Figure 57.2 shows that species can change abundance in patterns that are for the most part independent of one another. As a result, tree communities at different localities in these mountains fall on a continuum, one merging into the next, rather than representing discretely different sets of species. Similar patterns through time are seen in paleontological studies. For example, a very good fossil record exists for the trees and small mammals that occurred in North America over the past 20,000 years. Examination of prehistoric communities shows little similarity to those that occur today. Many species that occur together today were never found together in the past. Conversely, species that used to occur in the same communities often do not overlap in their geographic ranges today. These findings suggest that as climate has changed during the waxing and waning of the Ice Ages, species have responded independently, rather than shifting their distributions together, as would be expected if the community were an integrated unit.
California fescue Snakeroot Canyon live oak Collomia Ragwort Yarrow Buck brush Small fescue Fireweed Knotweed 5
10
15
20
25
30
Distance Along Transect (m)
Figure 57.3 Change in community composition across an ecotone. The plant assemblages on normal and serpentine soils are greatly different, and the transition from one community to another occurs over a short distance.
Inquiry question
?
Why is there a sharp transition between the two community types?
Number of Trees per Hectare
400
200
0 Wet
Dry Moisture Gradient
Figure 57.2 Abundance of tree species along a moisture gradient in the Santa Catalina Mountains of southeastern Arizona. Each line represents the abundance of a different tree species. The species’ patterns of abundance are independent of one another. Thus, community composition changes continually along the gradient.
?
Inquiry question Why do species exhibit different patterns of response to change in moisture?
www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1187
Nonetheless, in some cases the abundance of species in a community does change geographically in a synchronous pattern. Often, this occurs at ecotones, places where the environment changes abruptly. For example, in the western United States, certain patches of habitat have serpentine soils. This soil differs from normal soil in many ways—for example, high concentrations of nickel, chromium, and iron; low concentrations of copper and calcium. Comparison of the plant species that occur on different soils shows that distinct communities exist on each type, with an abrupt transition from one to the other over a short distance (figure 57.3). Similar transitions are seen wherever greatly different habitats come into contact, such as at the interface between terrestrial and aquatic habitats or where grassland and forest meet.
Learning Outcomes Review 57.1 A community comprises all species that occur at one site. In most cases, the abundance of community members appears to vary independently across space and through time. Community composition also changes gradually depending on environmental factors when moving from one location to another, such as from a very dry area to a very moist area. ■
In a community, would you expect greater variation over time in abundance of animal life or plant life? Why? chapter
57 Interspecific Interactions and the Ecology of Communities
1187
11/20/09 2:08:22 PM
57.2
The Ecological Niche Concept
Learning Outcomes 1. 2. 3.
fundamental niche. The actual set of environmental conditions, including the presence or absence of other species, in which the species can establish a stable population is its realized niche. Because of interspecific interactions, the realized niche of a species may be considerably smaller than its fundamental niche.
Competition between species for niche occupancy
Define niche and resource partitioning. Differentiate between fundamental and realized niches. Explain how the presence of other species can affect a species’ realized niche.
Each organism in a community confronts the challenge of survival in a different way. The niche an organism occupies is the total of all the ways it uses the resources of its environment. A niche may be described in terms of space utilization, food consumption, temperature range, appropriate conditions for mating, requirements for moisture, and other factors. Sometimes species are not able to occupy their entire niche because of the presence or absence of other species. Species can interact with one another in a number of ways, and these interactions can either have positive or negative effects. One type of interaction, interspecific competition, occurs when two species attempt to use the same resource and there is not enough of the resource to satisfy both. Physical interactions over access to resources—such as fighting to defend a territory or displacing an individual from a particular location—are referred to as interference competition; consuming the same resources is called exploitative competition.
Fundamental niches are potential; realized niches are actual
In a classic study, Joseph Connell of the University of California, Santa Barbara, investigated competitive interactions between two species of barnacles that grow together on rocks along the coast of Scotland. Of the two species Connell studied, Chthamalus stellatus lives in shallower water, where tidal action often exposes it to air, and Semibalanus balanoides (called Balanus balanoides prior to 1995) lives lower down, where it is rarely exposed to the atmosphere (figure 57.4). In these areas, space is at a premium. In the deeper zone, S. balanoides could always outcompete C. stellatus by crowding it off the rocks, undercutting it, and replacing it even where it had begun to grow, an example of interference competition. When Connell removed S. balanoides from the area, however, C. stellatus was easily able to occupy the deeper zone, indicating that no physiological or other general obstacles prevented it from becoming established there. In contrast, S. balanoides could not survive in the shallow-water habitats where C. stellatus normally occurs; it does not have the physiological adaptations to warmer temperatures that allow C. stellatus to occupy this zone. Thus, the fundamental niche of C. stellatus includes both shallow and deeper zones, but its realized niche is much narrower because C. stellatus can be outcompeted by S. balanoides in parts of its fundamental niche. By contrast, the realized and fundamental niches of S. balanoides appear to be identical.
Other causes of niche restriction
The entire niche that a species is capable of using, based on its physiological tolerance limits and resource needs, is called the
Processes other than competition can also restrict the realized niche of a species. For example, the plant St. John’s wort (Hypericum perforatum) was introduced and became widespread in
Figure 57.4 Competition among two species of barnacles. The fundamental niche of Chthamalus stellatus includes both deep and shallow zones, but Semibalanus balanoides forces C. stellatus out of the part of its fundamental niche that overlaps the realized niche of Semibalanus.
Chthamalus Chthamalus realized niche Chthamalus fundamental niche
Semibalanus
High tide
Low tide
Semibalanus realized niche Semibalanus fundamental niche
S.balanoides and C.stellatus competing
1188
part
C.stellatus fundamental and realized niches are identical when S.balanoides is removed.
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1188
11/20/09 2:08:24 PM
Figure 57.5 Competitive
Population Density (measured by volume)
200
exclusion among three species of Paramecium.
150 100 50 0 0
4
8
12 16 20
24
0
4
8
12
16 20 24
0
4
Days
Days
8
12
16 20 24
Days
Paramecium caudatum Paramecium aurelia Paramecium bursaria
200 Population Density (measured by volume)
Population Density (measured by volume)
a.
150 100 50
75
50
In the microscopic world, Paramecium is a ferocious predator that preys on smaller protists. a. In his experiments, Gause found that three species of Paramecium grew well alone in culture tubes. b. However, P. caudatum declined to extinction when grown with P. aurelia because they shared the same realized niche, and P. aurelia outcompeted P. caudatum for food resources. c. P. caudatum and P. bursaria were able to coexist because the two have different realized niches and thus avoided competition.
25 0
0 0
4
8
12 16 20 24
0
Days
b.
4
8
12 16 20 24 Days
c.
open rangeland habitats in California until a specialized beetle was introduced to control it. Population size of the plant quickly decreased, and it is now only found in shady sites where the beetle cannot thrive. In this case, the presence of a predator limits the realized niche of a plant. In some cases, the absence of another species leads to a smaller realized niche. Many North American plants depend on insects for pollination; indeed, the value of insect pollination for American agriculture has been estimated as more than $2 billion per year. However, pollinator populations are currently declining for several reasons. Conservationists are concerned that if these insects disappear from some habitats, the realized niche of many plant species will decrease or even disappear entirely. In this case, the absence—rather than the presence—of another species will be the cause of a relatively small realized niche.
Competitive exclusion can occur when species compete for limited resources In classic experiments carried out in 1934 and 1935, Russian ecologist Georgii Gause studied competition among three species of Paramecium, a tiny protist. Each of the three species grew well in culture tubes by themselves, preying on bacteria and yeasts that fed on oatmeal suspended in the culture fluid (figure 57.5a). However, when Gause grew P. aurelia together www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1189
with P. caudatum in the same culture tube, the numbers of P. caudatum always declined to extinction, leaving P. aurelia the only survivor (figure 57.5b). Why did this happen? Gause found that P. aurelia could grow six times faster than its competitor P. caudatum because it was able to better utilize the limited available resources, an example of exploitative competition. From experiments such as this, Gause formulated what is now called the principle of competitive exclusion. This principle states that if two species are competing for a limited resource such as food or water, the species that uses the resource more efficiently will eventually eliminate the other locally. In other words, no two species with the same niche can coexist when resources are limiting.
Niche overlap and coexistence In a revealing experiment, Gause challenged Paramecium caudatum—the defeated species in his earlier experiments—with a third species, P. bursaria. Because he expected these two species to also compete for the limited bacterial food supply, Gause thought one would win out, as had happened in his previous experiments. But that’s not what happened. Instead, both species survived in the culture tubes, dividing the food resources. The explanation for the species’ coexistence is simple. In the upper part of the culture tubes, where the oxygen concentration and bacterial density were high, P. caudatum dominated because it was better able to feed on bacteria. In the lower part chapter
57 Interspecific Interactions and the Ecology of Communities
1189
11/20/09 2:08:27 PM
of the tubes, however, the lower oxygen concentration favored the growth of a different potential food, yeast, and P. bursaria was better able to eat this food. The fundamental niche of each species was the whole culture tube, but the realized niche of each species was only a portion of the tube. Because the realized niches of the two species did not overlap too much, both species were able to survive. However, competition did have a negative effect on the participants (figure 57.5c). When grown without a competitor, both species reached densities three times greater than when they were grown with a competitor.
Competitive exclusion refined
a.
Gause’s principle of competitive exclusion can be restated as: No two species can occupy the same niche indefinitely when resources are limiting. Certainly species can and do coexist while competing for some of the same resources. Nevertheless, Gause’s hypothesis predicts that when two species coexist on a long-term basis, either resources must not be limited or their niches will always differ in one or more features; otherwise, one species will outcompete the other, and the extinction of the second species will inevitably result.
Competition may lead to resource partitioning Gause’s competitive exclusion principle has a very important consequence: If competition for a limited resource is intense, then either one species will drive the other to extinction, or natural selection will reduce the competition between them. When the ecologist Robert MacArthur studied five species of warblers, small insect-eating forest songbirds, he discovered that they appeared to be competing for the same resources. But when he studied them more carefully, he found that each species actually fed in a different part of spruce trees and so ate different subsets of insects. One species fed on insects near the tips of branches, a second within the dense foliage, a third on the lower branches, a fourth high on the trees, and a fifth at the very apex of the trees. Thus, each species of warbler had evolved so as to utilize a different portion of the spruce tree resource. They had subdivided the niche to avoid direct competition with one another. This niche subdivision is termed resource partitioning. Resource partitioning is often seen in similar species that occupy the same geographic area. Such sympatric species often avoid competition by living in different portions of the habitat or by using different food or other resources (figure 57.6). This pattern of resource partitioning is thought to result from the process of natural selection causing initially similar species to diverge in resource use to reduce competitive pressures. Whether such evolutionary divergence occurs can be investigated by comparing species whose ranges only partially overlap. Where the two species occur together, they often tend to exhibit greater differences in morphology (the form and structure of an organism) and resource use than do allopatric populations of the same species that do not occur with the other species. Called character displacement, the differences evident between sympatric species are thought to have been favored by 1190
part
b.
c.
d.
Figure 57.6 Resource partitioning among sympatric lizard species. Species of Anolis lizards on Caribbean islands partition their habitats in a variety of ways. a. Some species occupy leaves and branches in the canopy of trees, (b) others use twigs on the periphery, and (c) still others are found at the base of the trunk. In addition, (d) some use grassy areas in the open. When two species occupy the same part of the tree, they either utilize different-sized insects as food or partition the thermal microhabitat; for example, one might only be found in the shade, whereas the other would only bask in the sun.
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1190
11/20/09 2:08:28 PM
Individuals in Each Size Class (%)
50 25
Los Hermanos Islets
G. fuliginosa Allopatric
Daphne Major Island
G. fortis Allopatric
0 50 25 0 G. fuliginosa and G. fortis Sympatric
San Cristobal and Floreana Islands
50 25 0 7
9
11
13
rats had been removed, the holes were too small to allow the kangaroo rats to reenter. Over the course of the next 3 years, the researchers monitored the number of the smaller rodents present in the plots. As figure 57.8 illustrates, the number of other rodents was substantially higher in the absence of kangaroo rats, indicating that kangaroo rats compete with the other rodents and limit their population sizes. A great number of similar experiments have indicated that interspecific competition occurs between many species of plants and animals. The effects of competition can be seen in aspects of population biology other than population size, such
15
Finch Beak Depth (mm)
SCIENTIFIC THINKING
Figure 57.7 Character displacement in Darwin’s finches. These two species of finches (genus Geospiza) have beaks
Question: Does interspecific interaction occur between rodent species?
of similar size when allopatric, but different size when sympatric.
other species. Experiment: Build large cages in desert areas. Remove kangaroo rats from some cages, leaving them present in others. Result: In the absence of kangaroo rats, the number of other rodents increases quickly and remains higher than in the control cages throughout the course of the experiment.
Number of Captures of Other Rodents
natural selection as a means of partitioning resources and thus reducing competition. As an example, the two Darwin’s finches in figure 57.7 have bills of similar size where the finches are allopatric (that is, each living on an island where the other does not occur). On islands where they are sympatric (that is, occur together), the two species have evolved beaks of different sizes, one adapted to larger seeds and the other to smaller ones. Character displacement such as this may play an important role in adaptive radiation, leading new species to adapt to different parts of the environment, as discussed in chapter 22.
Hypothesis: The larger kangaroo rat will have a negative effect on
Detecting interspecific competition can be difficult It is not simple to determine when two species are competing. The fact that two species use the same resources need not imply competition if that resource is not in limited supply. Even if the population sizes of two species are negatively correlated, such that where one species has a large population, the other species has a small population and vice versa, the two species may not be competing for the same limiting resource. Instead, the two species might be independently responding to the same feature of the environment—perhaps one species thrives best in warm conditions and the other where it’s cool.
Experimental studies of competition Some of the best evidence for the existence of competition comes from experimental field studies. By setting up experiments in which two species occur either alone or together, scientists can determine whether the presence of one species has a negative effect on a population of the second species. For example, a variety of seed-eating rodents occur in North American deserts. In 1988, researchers set up a series of 50-m × 50-m enclosures to investigate the effect of kangaroo rats on smaller, seed-eating rodents. Kangaroo rats were removed from half of the enclosures, but not from the others. The walls of all of the enclosures had holes that allowed rodents to come and go, but in the plots in which the kangaroo www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1191
kangaroo rats removed kangaroo rats present
15 10 5 0 1988
1989
1990
Interpretation: Why do you think population sizes rise and fall in synchrony in the two cages?
Figure 57.8 Detecting interspecific competition. This experiment tested how removal of kangaroo rats affected the population size of other rodents. Immediately after kangaroo rats were removed, the number of other rodents increased relative to the enclosures that still contained kangaroo rats. Notice that population sizes (as estimated by number of captures) changed in synchrony in the two treatments, probably reflecting changes in the weather.
?
Inquiry question Why are there more individuals of other rodent species when kangaroo rats are excluded? chapter
57 Interspecific Interactions and the Ecology of Communities
1191
11/20/09 2:08:33 PM
Limitations of experimental studies Experimental studies are a powerful means of understanding interactions between coexisting species and are now commonly conducted by ecologists. Nonetheless, they have their limitations. First, care is necessary in interpreting the results of field experiments. Negative effects of one species on another do not automatically indicate the existence of competition. For example, many similarly sized fish have a negative effect on one another, but it results not from competition, but from the fact that adults of each species prey on juveniles of the other species. In addition, the presence of one species may attract predators or parasites, which then also prey on the second species. In this case, even if the two species are not competing, the second species may have a lower population size in the presence of the first species due to predators or parasites. Indeed, we can’t rule out this possibility with the results of the kangaroo rat exclusion study just mentioned, although the close proximity of the enclosures (they were adjacent) would suggest that the same predators and parasites were present in all of them. Thus, experimental studies are most effective when combined with detailed examination of the ecological mechanisms causing the observed effect of one species on another. Second, experimental studies are not always feasible. For example, the coyote population has increased in the United States in recent years concurrently with the decline of the grey wolf. Is this trend an indication that the species compete? Because of the size of the animals and the large geographic areas occupied by each individual, manipulative experiments involving fenced areas with only one or both species—with each experimental treatment replicated several times for statistical analysis—are not practical. Similarly, studies of slow-growing trees might require many centuries to detect competition between adult trees. In such cases, detailed studies of the ecological requirements of each species are our best bet for understanding interspecific interactions.
57.3
Predator–Prey Relationships
Learning Outcomes 1. 2.
Define predation. Describe the effects predation can have on a population.
Predation is the consuming of one organism by another. In this sense, predation includes everything from a leopard capturing and eating an antelope, to a deer grazing on spring grass. When experimental populations are set up under simple laboratory conditions, as illustrated in figure 57.9 with the predatory protist Didinium and its prey Paramecium, the predator often exterminates its prey and then becomes extinct itself, having nothing left to eat. If refuges are provided for the Paramecium, however, its population drops to low levels but not to extinction. Low prey population levels then provide inadequate food for the Didinium, causing the predator population to decrease. When this occurs, the prey population can recover.
Predation strongly influences prey populations In nature, predators often have large effects on prey populations. As the previous example indicates, however, the interaction is a two-way street: prey can also affect the dynamics of predator populations. The outcomes of such interactions are complex and depend on a variety of factors.
Didinium Paramecium
1200 Number of Individuals
as behavior and individual growth rates. For example, two species of Anolis lizards occur on the Caribbean island of St. Maarten. When one of the species, A. gingivinus, is placed in 12-m × 12-m enclosures without the other species, individual lizards grow faster and perch lower than do lizards of the same species when placed in enclosures in which A. pogus, a species normally found near the ground, is also present.
Didinium Paramecium 800
400
0
1
Learning Outcomes Review 57.2 A niche comprises the total number of ways in which an organism utilizes resources in its environment. A fundamental niche is the entire niche possible to a species; a realized niche is the niche a species actually utilizes. If resources are limiting, two species cannot occupy the same niche indefinitely without competition driving one to local extinction. Resource partitioning allows two sympatric species to occupy a niche, reducing competition between them and also lessening the size of the realized niche. ■
1192
Under what circumstances can two species with identical niches coexist indefinitely? part
2
3 4 Days
5
6
7
Figure 57.9 Predator–prey in the microscopic world. When the predatory Didinium is added to a Paramecium population, the numbers of Didinium initially rise, and the numbers of Paramecium steadily fall. When the Paramecium population is depleted, however, the Didinium individuals also die.
?
Inquiry question Can you think of any ways this experiment could be changed so that Paramecium might not go extinct?
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1192
11/20/09 2:08:36 PM
Prey population explosions and crashes Some of the most dramatic examples of the interconnection between predators and their prey involve situations in which humans have either added or eliminated predators from an area. For example, the elimination of large carnivores from much of the eastern United States has led to population explosions of white-tailed deer, which strip the habitat of all edible plant life within their reach. Similarly, when sea otters were hunted to near extinction on the western coast of the United States, populations of sea urchins, a principal prey item of the otters, exploded. Conversely, the introduction of rats, dogs, and cats to many islands around the world has led to the decimation of native fauna. Populations of Galápagos tortoises on several islands are endangered by introduced rats, pigs, dogs, and cats, which eat the eggs and the young tortoises. Similarly, in New Zealand, several species of birds and reptiles have been eradicated by rat predation and now only occur on a few offshore islands that the rats have not reached. On Stephens Island, near New Zealand, every individual of the now-extinct Stephens Island wren was killed by a single lighthouse keeper’s cat. A classic example of the role predation can play in a community involves the introduction of prickly pear cactus to Australia in the 19th century. In the absence of predators, the cactus spread rapidly, so that by 1925 it occupied 12 million hectares of rangeland in an impenetrable morass of spines that made cattle ranching difficult. To control the cactus, a predator from its natural habitat in Argentina, the moth Cactoblastis cactorum, was introduced, beginning in 1926. By 1940, cactus populations had been greatly reduced and it now usually occurs in small populations.
Predation and coevolution Predation provides strong selective pressures on prey populations. Any feature that would decrease the probability of capture should be strongly favored. In turn, the evolution of such features causes natural selection to favor counteradaptations in predator populations. The process by which these adaptations are selected in lockstep fashion in two or more interacting species is termed coevolution. A coevolutionary “arms race” may ensue in which predators and prey are constantly evolving better defenses and better means of circumventing these defenses. In the sections that follow, you’ll learn more about these defenses and responses.
that when attacked by caterpillars, wild tobacco plants emit a chemical into the air that attracts a species of bug that feeds on that caterpillar (discussed in greater detail in chapter 40). The best known and perhaps most important of the chemical defenses of plants against herbivores are secondary chemical compounds. These chemicals are distinguished from primary compounds, which are the components of a major metabolic pathway, such as respiration. Many plants, and apparently many algae as well, contain structurally diverse secondary compounds that are either toxic to most herbivores or disturb their metabolism greatly, preventing, for example, the normal development of larval insects. Consequently, most herbivores tend to avoid the plants that possess these compounds. The mustard family (Brassicaceae) produces a group of chemicals known as mustard oils. These substances give the pungent aromas and tastes to plants such as mustard, cabbage, watercress, radish, and horseradish. The flavors we enjoy indicate the presence of chemicals that are toxic to many groups of insects. Similarly, plants of the milkweed family (Asclepiadaceae) and the related dogbane family (Apocynaceae) produce a milky sap that deters herbivores from eating them. In addition, these plants usually contain cardiac glycosides, molecules that can produce drastic deleterious effects on the heart function of vertebrates.
The coevolutionary response of herbivores Certain groups of herbivores are associated with each family or group of plants protected by a particular kind of secondary compound. These herbivores are able to feed on these plants without harm, often as their exclusive food source. For example, cabbage butterfly caterpillars (subfamily Pierinae) feed almost exclusively on plants of the mustard and caper families, as well as on a few other small families of plants that also contain mustard oils (figure 57.10). Similarly, caterpillars of
Plant adaptations defend against herbivores Plants have evolved many mechanisms to defend themselves from herbivores. The most obvious are morphological defenses: Thorns, spines, and prickles play an important role in discouraging large plant eaters, and plant hairs, especially those that have a glandular, sticky tip, deter insect herbivores. Some plants, such as grasses, deposit silica in their leaves, both strengthening and protecting themselves. If enough silica is present, these plants are simply too tough to eat.
Chemical defenses As significant as morphological adaptations are, the chemical defenses that occur so widely in plants are even more widespread. Plants exhibit some amazing chemical adaptations to combat herbivores. For example, recent work demonstrates www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1193
a.
Figure 57.10 Insect herbivores well suited to their plant hosts. a. The
b.
green caterpillars of the cabbage white butterfly (Pieris rapae) are camouflaged on the leaves of cabbage and other plants on which they feed. Although mustard oils protect these plants against most herbivores, the cabbage white butterfly caterpillars are able to break down the mustard oil compounds. b. An adult cabbage white butterfly. chapter
57 Interspecific Interactions and the Ecology of Communities
1193
11/20/09 2:08:37 PM
monarch butterflies and their relatives (subfamily Danainae) feed on plants of the milkweed and dogbane families. How do these animals manage to avoid the chemical defenses of the plants, and what are the evolutionary precursors and ecological consequences of such patterns of specialization? We can offer a potential explanation for the evolution of these particular patterns. Once the ability to manufacture mustard oils evolved in the ancestors of the caper and mustard families, the plants were protected for a time against most or all herbivores that were feeding on other plants in their area. At some point, certain groups of insects—for example, the cabbage butterflies—evolved the ability to break down mustard oils and thus feed on these plants without harming themselves. Having developed this new capability, the butterflies were able to use a new resource without competing with other herbivores for it. As we saw in chapter 22, exposure to an underutilized resource often leads to evolutionary diversification and adaptive radiation.
Animal adaptations defend against predators Some animals that feed on plants rich in secondary compounds receive an extra benefit. For example, when the caterpillars of monarch butterflies feed on plants of the milkweed family, they do not break down the cardiac glycosides that protect these plants from herbivores. Instead, the caterpillars concentrate and store the cardiac glycosides in fat bodies; they then pass them through the chrysalis stage to the adult and even to the eggs of the next generation. The incorporation of cardiac glycosides protects all stages of the monarch life cycle from predators. A bird that eats a monarch butterfly quickly regurgitates it (figure 57.11) and in the future avoids the conspicuous orange-and-black pattern that characterizes the adult monarch. Some bird species have
Figure 57.12 Vertebrate chemical defenses. Frogs of the family Dendrobatidae, abundant in the forests of Central and South America, are extremely poisonous to vertebrates; 80 different toxic alkaloids have been identified from different species in this genus. Dendrobatids advertise their toxicity with bright coloration. As a result of either instinct or learning, predators avoid such brightly colored species that might otherwise be suitable prey.
evolved the ability to tolerate the protective chemicals; these birds eat the monarchs.
Chemical defenses Animals also manufacture and use a startling array of defensive substances. Bees, wasps, predatory bugs, scorpions, spiders, and many other arthropods use chemicals to defend themselves and to kill their own prey. In addition, various chemical defenses have evolved among many marine invertebrates, as well as a variety of vertebrates, including frogs, snakes, lizards, fishes, and some birds. The poison-dart frogs of the family Dendrobatidae produce toxic alkaloids in the mucus that covers their brightly colored skin; these alkaloids are distasteful and sometimes deadly to animals that try to eat the frogs (figure 57.12). Some of these toxins are so powerful that a few micrograms will kill a person if injected into the bloodstream. More than 200 different alkaloids have been isolated from these frogs, and some are playing important roles in neuromuscular research. Similarly intensive investigations of marine animals, venomous reptiles, algae, and flowering plants are underway in search of new drugs to fight cancer and other diseases, or to use as sources of antibiotics.
Defensive coloration
a.
b.
Figure 57.11 A blue jay learns not to eat monarch butterflies. a. This cage-reared jay had never seen a monarch butterfly before it tried eating one. b. The same jay regurgitated the butterfly a few minutes later. This bird will probably avoid trying to capture all orange-and-black insects in the future. 1194
part
Many insects that feed on milkweed plants are brightly colored; they advertise their poisonous nature using an ecological strategy known as warning coloration. Showy coloration is characteristic of animals that use poisons and stings to repel predators; organisms that lack specific chemical defenses are seldom brightly colored. In fact, many have cryptic coloration—color that blends with the surroundings and thus hides the individual from predators (figure 57.13). Camouflaged animals usually do not live together in groups because a predator that discovers one individual gains a valuable clue to the presence of others.
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1194
11/20/09 2:08:39 PM
The caterpillars of the tiger swallowtail feed on a variety of trees, including tulip, aspen, and cherry, and neither caterpillars nor adults are distasteful to birds. Interestingly, the Batesian mimicry seen in the adult tiger swallowtail butterfly does not extend to the caterpillars: Tiger swallowtail caterpillars are camouflaged on leaves, resembling bird droppings, but the pipevine swallowtail’s distasteful caterpillars are very conspicuous.
Müllerian mimicry
Figure 57.13 Cryptic coloration and form. An inchworm caterpillar (Nacophora quernaria) closely resembles the twig on which it is hanging..
Mimicry allows one species to capitalize on defensive strategies of another
Another kind of mimicry, Müllerian mimicry, was named for the German biologist Fritz Müller, who first described it in 1878. In Müllerian mimicry, several unrelated but protected animal species come to resemble one another (figure 57.14b). If animals that resemble one another are all poisonous or dangerous, they gain an advantage because a predator will learn more quickly to avoid them. In some cases, predator populations even evolve an innate avoidance of species; such evolution may occur more quickly when multiple dangerous prey look alike.
During the course of their evolution, many species have come to resemble distasteful ones that exhibit warning coloration. The mimic gains an advantage by looking like the distasteful model. Two types of mimicry have been identified: Batesian mimicry and Müllerian mimicry.
Batesian mimicry Batesian mimicry is named for Henry Bates, the British naturalist who first brought this type of mimicry to general attention in 1857. In his journeys to the Amazon region of South America, Bates discovered many instances of palatable insects that resembled brightly colored, distasteful species. He reasoned that the mimics would be avoided by predators, who would be fooled by the disguise into thinking the mimic was the distasteful species. Many of the best-known examples of Batesian mimicry occur among butterflies and moths. Predators of these insects must use visual cues to hunt for their prey; otherwise, similar color patterns would not matter to potential predators. Increasing evidence indicates that Batesian mimicry can involve nonvisual cues, such as olfaction, although such examples are less obvious to humans. The kinds of butterflies that provide the models in Batesian mimicry are, not surprisingly, members of groups whose caterpillars feed on only one or a few closely related plant families. The plant families on which they feed are strongly protected by toxic chemicals. The model butterflies incorporate the poisonous molecules from these plants into their bodies. The mimic butterflies, in contrast, belong to groups in which the feeding habits of the caterpillars are not so restricted. As caterpillars, these butterflies feed on a number of different plant families that are unprotected by toxic chemicals. One often-studied mimic among North American butterflies is the tiger swallowtail, whose range occurs throughout the eastern United States and into Canada (figure 57.14a). In areas in which the poisonous pipevine swallowtail occurs, female tiger swallowtails are polymorphic and one color form is extremely similar in appearance to the pipevine swallowtail. www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1195
Battus philenor
Papilio glaucus
a. Batesian mimicry: Pipevine swallowtail butterfly (Battus philenor) is poisonous; Tiger swallowtail (Papilio glaucus) is a palatable mimic.
Heliconius erato
Heliconius melpomene
Heliconius sapho
Heliconius cydno
b. Müllerian mimicry: Two pairs of mimics; all are distasteful.
Figure 57.14 Mimicry. a. Batesian mimicry. Pipevine swallowtail butterfl ies (Battus philenor) are protected from birds and other predators by the poisonous compounds they derive from the food they eat as caterpillars and store in their bodies. Adult pipevine swallowtails advertise their poisonous nature with warning coloration. Tiger swallowtails (Papilio glaucus) are Batesian mimics of the poisonous pipevine swallowtail and are not chemically protected. b. Pairs of Müllerian mimics. Heliconius erato and H. melpomene are sympatric, and H. sapho and H. cydno are sympatric. All of these butterfl ies are distasteful. They have evolved similar coloration patterns in sympatry to minimize predation; predators need only learn one pattern to avoid. chapter
57 Interspecific Interactions and the Ecology of Communities
1195
11/20/09 2:08:45 PM
In both Batesian and Müllerian mimicry, mimic and model must not only look alike but also act alike. For example, the members of several families of insects that closely resemble wasps behave surprisingly like the wasps they mimic, flying often and actively from place to place.
Learnings Outcomes Review 57.3 Predation is the consuming of one organism by another. High predation can drive prey populations to extinction; conversely, in the absence of predators, prey populations often explode and exhaust their resources. Defensive adaptations may evolve in prey species, such as becoming distasteful or poisonous, or having defensive structures, appearance, or capabilities. ■
A nonpoisonous scarlet king snake has red, black, and yellow bands of color similar to that of the poisonous eastern coral snake. What type of mimicry is being exhibited?
57.4
The Many Types of Species Interactions
Learning Outcomes 1. 2. 3.
Explain the different forms of symbiosis. Describe how coevolution occurs between mutualistic partners. Explain how the occurrence of one ecological process may affect the outcome of another occurring at the same time.
The plants, animals, protists, fungi, and prokaryotes that live together in communities have changed and adjusted to one another continually over millions of years. We have already discussed competition and predation, but other types of ecological interactions commonly occur. For example, many features of flowering plants have evolved in relation to the dispersal of the plant’s gametes by animals (figure 57.15). These animals, in turn, have evolved a number of special traits that enable them to obtain food or other resources efficiently from the plants they visit, often from their flowers. While doing so, the animals pick up pollen, which they may deposit on the next plant they visit, or seeds, which may be left elsewhere in the environment, sometimes a great distance from the parent plant.
Symbiosis involves long-term interactions In symbiosis, two or more kinds of organisms interact in often elaborate and more-or-less permanent relationships. All symbiotic relationships carry the potential for coevolution between the organisms involved, and in many instances the results of this coevolution are fascinatingly complex. Examples of symbiosis include lichens, which are associations of certain fungi with green algae or cyanobacteria. Another important example are mycorrhizae, associations between fungi and the roots of most kinds of plants. The fungi expedite the plant’s absorption of certain nutrients, and the plants in 1196
part
Figure 57.15 Pollination by a bat. Many flowers have coevolved with other species to facilitate pollen transfer. Insects are widely known as pollinators, but they’re not the only ones: birds, bats, and even small marsupials and lizards serve as pollinators for some species. Notice the cargo of pollen on the bat’s snout.
turn provide the fungi with carbohydrates (both mycorrhizae and lichens are discussed in greater detail in chapter 31). Similarly, root nodules that occur in legumes and certain other kinds of plants contain bacteria that fix atmospheric nitrogen and make it available to their host plants. In the tropics, leaf-cutter ants are often so abundant that they can remove a quarter or more of the total leaf surface of the plants in a given area in a single year (see figure 31.18). They do not eat these leaves directly; rather, they take them to underground nests, where they chew them up and inoculate them with the spores of particular fungi. These fungi are cultivated by the ants and brought from one specially prepared bed to another, where they grow and reproduce. In turn, the fungi constitute the primary food of the ants and their larvae. The relationship between leaf-cutter ants and these fungi is an excellent example of symbiosis. Recent phylogenetic studies using DNA and assuming a molecular clock (see chapter 23) suggest that these symbioses are ancient, perhaps originating more than 50 mya. The major kinds of symbiotic relationships include (1) commensalism, in which one species benefits and the other neither benefits nor is harmed; (2) mutualism, in which both participating species benefit; and (3) parasitism, in which one species benefits but the other is harmed. Parasitism can also be viewed as a form of predation, although the organism that is preyed on does not necessarily die.
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1196
11/20/09 2:08:46 PM
Commensalism benefits one species and is neutral to the other In commensalism, one species benefits and the other is neither hurt nor helped by the interaction. In nature, individuals of one species are often physically attached to members of another. For example, epiphytes are plants that grow on the branches of other plants. In general, the host plant is unharmed, and the epiphyte that grows on it benefits. An example is Spanish moss, which hangs on trees in the southern United States. This plant and other members of its genus, which is in the pineapple family, grow on trees to gain access to sunlight; they generally do not harm the trees (figure 57.16). Similarly, various marine animals, such as barnacles, grow on other, often actively moving sea animals, such as whales, and thus are carried passively from place to place. These “passengers” presumably gain more protection from predation than they would if they were fixed in one place, and they also reach new sources of food. The increased water circulation that these animals receive as their host moves around may also be of great importance, particularly if the passengers are filter feeders. Unless the number of these passengers gets too large, the host species is usually unaffected.
When commensalism may not be commensalism
Figure 57.17 Commensalism, mutualism, or parasitism?
One of the best known examples of symbiosis involves the relationships between certain small tropical fishes (clownfish) and sea anemones, shown in the first figure of this chapter. The fish have evolved the ability to live among the stinging tentacles of sea anemones, even though these tentacles would quickly paralyze other fishes that touched them. The clownfish feed on food particles left from the meals of the host anemone, remaining uninjured under remarkable circumstances. On land, an analogous relationship exists between birds called oxpeckers and grazing animals such as cattle or ante-
In this symbiotic relationship, oxpeckers defi nitely receive a benefit in the form of nutrition from the ticks and other parasites they pick off their host (in this case, an impala, Aepyceros melampus). But the effect on t he host is not always clear. If the ticks are harmful, their removal benefits the host, and the relationship is mutually beneficial. If the oxpeckers also pick at scabs, causing blood loss and possible infection, the relationship may be parasitic. If the hosts are unharmed by either the ticks or the oxpeckers, the relationship may be an example of commensalism.
Figure 57.16 An example of commensalism. Spanish moss (Tillandsia usneoides) benefits from using trees as a substrate, but the trees generally are not affected positively or negatively. www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1197
lopes (figure 57.17). The birds spend most of their time clinging to the animals, picking off parasites and other insects, carrying out their entire life cycles in close association with the host animals. No clear-cut boundary exists between commensalism and mutualism; in each of these casees, it is difficult to be certain whether the second partner receives a benefit or not. A sea anemone may benefit by having particles of food removed from its tentacles because it may then be better able to catch other prey. Similarly, although often thought of as commensalism, the association of grazing mammals and gleaning birds is actually an example of mutualism. The mammal benefits by having parasites and other insects removed from its body, but the birds also benefit by gaining a dependable source of food. On the other hand, commensalism can easily transform itself into parasitism. Oxpeckers are also known to pick not only parasites, but also scabs off their grazing hosts. Once the scab is picked, the birds drink the blood that flows from the wound. Occasionally, the cumulative effect of persistent attacks can greatly weaken the herbivore, particularly when conditions are not favorable, such as during droughts. chapter
57 Interspecific Interactions and the Ecology of Communities
1197
11/20/09 2:08:50 PM
Mutualism benefits both species Mutualism is a symbiotic relationship between organisms in which both species benefit. Mutualistic relationships are of fundamental importance in determining the structure of biological communities.
Mutualism and coevolution Some of the most spectacular examples of mutualism occur among flowering plants and their animal visitors, including insects, birds, and bats. During the course of flowering-plant evolution, the characteristics of flowers evolved in relation to the characteristics of the animals that visit them for food and, in the process, spread their pollen from individual to individual. At the same time, characteristics of the animals have changed, increasing their specialization for obtaining food or other substances from particular kinds of flowers. Another example of mutualism involves ants and aphids. Aphids are small insects that suck fluids from the phloem of living plants with their piercing mouthparts. They extract a certain amount of the sucrose and other nutrients from this fluid, but they excrete much of it in an altered form through their anus. Certain ants have taken advantage of this—in effect, domesticating the aphids. Like ranchers taking cattle to fresh fields to graze, the ants carry the aphids to new plants and then consume as food the “honeydew” that the aphids excrete.
Ants and acacias: A prime example of mutualism A particularly striking example of mutualism involves ants and certain Latin American tree species of the genus Acacia. In these species, certain leaf parts, called stipules, are modified as paired, hollow thorns. The thorns are inhabited by stinging ants of the genus Pseudomyrmex, which do not nest anywhere else (figure 57.18). Like all thorns that occur on plants, the acacia thorns serve to deter herbivores. At the tip of the leaflets of these acacias are unique, protein-rich bodies called Beltian bodies, named after the 19th-century British naturalist Thomas Belt. Beltian bodies do not occur in species of Acacia that are not inhabited by ants, and their role is clear: they serve as a primary food for the ants. In addition, the plants secrete nectar from glands near the bases of their leaves. The ants consume this nectar as well, feeding it and the Beltian bodies to their larvae. Obviously, this association is beneficial to the ants, and one can readily see why they inhabit acacias of this group. The ants and their larvae are protected within the swollen thorns, and the trees provide a balanced diet, including the sugar-rich nectar and the protein-rich Beltian bodies. What, if anything, do the ants do for the plants? Whenever any herbivore lands on the branches or leaves of an acacia inhabited by ants, the ants, which continually patrol the acacia’s branches, immediately attack and devour the herbivore. The ants that live in the acacias also help their hosts compete with other plants by cutting away any encroaching branches that touch the acacia in which they are living. They create, in effect, a tunnel of light through which the acacia can grow, even in the lush tropical rain forests of lowland Central America. In fact, when an ant colony is experimentally removed 1198
part
Figure 57.18 Mutualism: Ants and acacias. Ants of the genus Pseudomyrmex live within the hollow thorns of certain species of acacia trees in Latin America. The nectaries at the bases of the leaves and the Beltian bodies at the ends of the leaflets provide food for the ants. The ants, in turn, supply the acacias with organic nutrients and protect the acacias from herbivores and shading from other plants.
from a tree, the acacia is unable to compete successfully in this habitat. Finally, the ants bring organic material into their nests. The parts they do not consume, together with their excretions, provide the acacias with an abundant source of nitrogen.
When mutualism may not be mutualism As with commensalism, however, things are not always as they seem. Ant–acacia associations also occur in Africa; in Kenya, several species of acacia ants occur, but only a single species is found on any one tree. One species, Crematogaster nigriceps, is competitively inferior to two of the other species. To prevent invasion by these other ant species, C. nigriceps prunes the branches of the acacia, preventing it from coming into contact with branches of other trees, which would serve as a bridge for invaders. Although this behavior is beneficial to the ant, it is detrimental to the tree because it destroys the tissue from which flowers are produced, essentially sterilizing the tree. In this case, what initially evolved as a mutualistic interaction has instead become a parasitic one.
Parasitism benefits one species at the expense of another Parasitism is harmful to the prey organism and beneficial to the parasite. In many cases, the parasite kills its host, and thus the ecological effects of parasitism can be similar to those of predation. In the past parasitism was studied mostly in terms of its effects on individuals and the populations in which they live, but in recent years researchers have realized that parasitism can be an important factor affecting community structure.
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1198
11/20/09 2:08:53 PM
External parasites Parasites that feed on the exterior surface of an organism are external parasites, or ectoparasites (figure 57.19). Many instances of external parasitism are known in both plants and animals. Parasitoids are insects that lay eggs in or on living hosts. This behavior is common among wasps, whose larvae feed on the body of the unfortunate host, often killing it.
Internal parasites Parasites that live within the body of their hosts, termed endoparasites, occur in many different phyla of animals and protists. Internal parasitism is generally marked by much more extreme specialization than external parasitism, as shown by the many protist and invertebrate parasites that infect humans. The more closely the life of the parasite is linked with that of its host, the more its morphology and behavior are likely to have been modified during the course of its evolution (the same is true of symbiotic relationships of all sorts). Conditions within the body of an organism are different from those encountered outside and are apt to be much more constant. Consequently, the structure of an internal parasite is often simplified, and unnecessary armaments and structures are lost as it evolves (for example, see descriptions of tapeworms in chapter 33).
Parasites and host behaviors Many parasites have complex life cycles that require several different hosts for growth to adulthood and reproduction. Recent research has revealed the remarkable adaptations of certain parasites that alter the behavior of the host and thus facilitate transmission from one host to the next. For example, many parasites cause their hosts to behave in ways that make them more vulnerable to their predators; when the host is ingested, the parasite is able to infect the predator.
Figure 57.20 Parasitic manipulation of host behavior.
Infected ant
Due to a parasite in its brain, an ant climbs to the top of a grass blade, where it may be eaten by a grazing herbivore, thus passing the parasite from insect to mammal.
One of the most famous examples involves a parasitic flatworm, Dicrocoelium dendriticum, which lives in ants as an intermediate host, but reaches adulthood in large herbivorous mammals such as cattle and deer. Transmission from an ant to a cow might seem difficult because cows do not normally eat insects. The flatworm, however, has evolved a remarkable adaptation. When an ant is infected, one of the flatworms migrates to the brain and causes the ant to climb to the top of vegetation and lock its mandibles onto a grass blade at the end of the day, just when herbivores are grazing (figure 57.20). The result is that the ant is eaten along with the grass, leading to infection of the grazer.
Ecological processes have interactive effects We have seen the different ways in which species can interact with one another. In nature, however, more than one type of interaction often occurs at the same time. In many cases, the outcome of one type of interaction is modified or even reversed when another type of interaction is also occurring.
Predation reduces competition
Figure 57.19 An external parasite. The yellow vines are the flowering plant dodder (Cuscuta), a parasite that has lost its chlorophyll and its leaves in the course of its evolution. Because it is heterotrophic (unable to manufacture its own food), dodder obtains its food from the host plants it grows on. www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1199
When resources are limiting, a superior competitor can eliminate other species from a community through competitive exclusion. However, predators can prevent or greatly reduce exclusion by lowering the numbers of individuals of competing species. A given predator may often feed on two, three, or more kinds of plants or animals in a given community. The predator’s choice depends partly on the relative abundance of the prey options. In other words, a predator may feed on species A when it is abundant and then switch to species B when A is rare. Similarly, a given prey species may become a primary source of food for increasing numbers of species as it becomes more abundant. In this way, superior competitors may be prevented from competitively excluding other species. chapter
57 Interspecific Interactions and the Ecology of Communities
1199
11/20/09 2:08:55 PM
malaria), whereas the other species is highly susceptible. In places where the parasite occurs, the competitively inferior species can hold its own and the two species coexist; elsewhere, the competitively dominant species outcompetes and eliminates it.
Such patterns are often characteristic of communities in marine intertidal habitats. For example, in preying selectively on bivalves, sea stars prevent bivalves from monopolizing a habitat, opening up space for many other organisms (figure 57.21). When sea stars are removed from a habitat, species diversity falls precipitously, and the seafloor community comes to be dominated by a few species of bivalves. Predation tends to reduce competition in natural communities, so it is usually a mistake to attempt to eliminate a major predator, such as wolves or mountain lions, from a community. The result may be a decrease in biological diversity.
Indirect effects In some cases, species may not directly interact, yet the presence of one species may affect a second by way of interactions with a third. Such effects are termed indirect effects. The desert rodents described earlier in the experiment with kangaroo rats eat seeds, and so do the ants in their community; thus, we might expect them to compete with each other. But when all rodents were removed from experimental enclosures and not allowed back in (unlike the previous experiment, no holes were placed in the enclosure walls), ant populations first increased but then declined (figure 57.22). The initial increase was the expected result of removing a competitor. Why did it then reverse? The answer reveals the intricacies of natural ecosystems. Rodents prefer large seeds, whereas ants prefer smaller ones. Furthermore, in this system, plants with large seeds are competitively superior to plants with small seeds. The removal of rodents therefore led to an increase in the number of plants with large seeds, which reduced the number of small seeds available to ants, which in turn led to a decline in ant populations. In summary, the effect
Parasitism may counter competition Parasites may affect sympatric species differently and thus influence the outcome of interspecific interactions. One classic experiment investigated interactions between two sympatric flour beetles, Tribolium castaneum and T. confusum, with and without a parasite, Adelina. In the absence of the parasite, T. castaneum is dominant, and T. confusum normally becomes extinct. When the parasite is present, however, the outcome is reversed, and T. castaneum perishes. Similar effects of parasites in natural systems have been observed in many species. For example, in the Anolis lizards of St. Maarten mentioned previously, the competitively inferior species is resistant to lizard malaria (a disease related to human
SCIENTIFIC THINKING Question: Does predation affect the outcome of interspecific competitive interactions? Hypothesis: In the absence of predators, prey populations will increase until resources are limiting, and some species will be competitively excluded. Experiment: Remove predatory sea stars (Pisaster ochraceus) from some areas of rocky intertidal shoreline and monitor populations of species the sea stars prey upon. In control areas, pick up sea stars, but replace them where they were found.
a.
b.
Result: In the absence of sea stars, the population of the mussel Mytilus californianus exploded, occupying all available space and eliminating many other species from the community. Interpretation: What would happen if sea stars were returned to the experimental plots?
Figure 57.21 Predation reduces competition. a. In a controlled experiment in a coastal ecosystem, Robert Paine of the University of Washington removed a key predator, sea stars (Pisaster). b. In response, fiercely competitive mussels, a type of bivalve mollusk, exploded in population growth, effectively crowding out seven other indigenous species. 1200
part
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1200
11/20/09 2:08:58 PM
of rodents on ants is complicated: a direct, negative effect of resource competition and an indirect, positive effect mediated by plant competition. rodents removed rodents not removed
Keystone species have major effects on communities
Number of Ant Colonies
60
40
20
Oct 74
May 75
Sep 75
May 76
Aug 76
Jul 77
Sampling Periods
a.
Species whose effects on the composition of communities are greater than one might expect based on their abundance are termed keystone species. Predators, such as the sea star described earlier, can often serve as keystone species by preventing one species from outcompeting others, thus maintaining high levels of species richness in a community. A wide variety of other types of keystone species also exist. Some species manipulate the environment in ways that create new habitats for others. Beavers, for example, change running streams into small impoundments, altering the flow of water and flooding areas (figure 57.23). Similarly, alligators excavate deep holes at the bottoms of lakes. In times of drought, these holes are the only areas where water remains, thus allowing aquatic species that otherwise would perish to persist until the drought ends and the lake refills.
Learning Outcomes Review 57.4 The types of symbiosis include mutualism, in which both participants benefit; commensalism, in which one benefits and the other is neutrally affected; and parasitism, in which one benefits at the expense of the other. Mutualistic species often undergo coevolution, such as the shape of flowers and the features of animals that feed on and pollinate them. Ecological interactions can affect many processes in a community; for example, predation and parasitism may lessen resource competition.
(–) Ants
Rodents
(+)
(–)
(+)
(+)
■
How could the presence of a predator positively affect populations of a species on which it preys?
(–) Large seeds
Small seeds
( + ) Indirect positive effect
b.
Figure 57.23 Example of a keystone species. Beavers, by constructing dams and transforming flowing streams into ponds, create new habitats for many plant and animal species.
Figure 57.22 Direct and indirect effects in an ecological community. a. In the enclosures in which kangaroo rats had been removed, ants initially increased in population size relative to the ants in the control enclosures, but then these ant populations declined. b. Rodents and ants both eat seeds, so the presence of rodents has a direct negative effect on ants, and vice versa. However, the presence of rodents has a negative effect on large seeds. In turn, the number of plants with large seeds has a negative effect on plants that produce small seeds, which the ants eat. Hence, the presence of rodents should increase the number of small seeds. In turn, the number of small seeds has a positive effect on ant populations. Thus, indirectly, the presence of rodents has a positive effect on ant population size.
?
Inquiry question How would you test the hypothesis that plant competition mediates the positive effect of kangaroo rats on ants?
www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1201
11/20/09 2:09:01 PM
57.5
Ecological Succession, Disturbance, and Species Richness
Learning Outcomes 1. 2. 3.
Define succession and distinguish primary versus secondary. Describe how early colonizers may affect subsequent occurrence of other species. Explain how disturbance can either positively or negatively affect species richness.
Even when the climate of an area remains stable year after year, communities have a tendency to change from simple to complex in a process known as succession. This process is familiar to anyone who has seen a vacant lot or cleared woods slowly become occupied by an increasing number of species.
Succession produces a change in species composition If a wooded area is cleared or burned and left alone, plants will slowly reclaim the area. Eventually, all traces of the clear-
Nitrogen Concentration (g/m2 of surface)
300
ing will disappear, and the area will again be woods. This kind of succession, which occurs in areas where an existing community has been disturbed but organisms still remain, is called secondary succession. In contrast, primary succession occurs on bare, lifeless substrate, such as rocks, or in open water, where organisms gradually move into an area and change its nature. Primary succession occurs in lakes and on land exposed after the retreat of glaciers, and on volcanic islands that rise from the sea (figure 57.24). Primary succession on glacial moraines provides an example (see figure 57.24). On the bare, mineral-poor ground exposed when glaciers recede, soil pH is basic as a result of carbonates in the rocks, and nitrogen levels are low. Lichens are the first vegetation able to grow under such conditions. Acidic secretions from the lichens help break down the substrate and reduce the pH, as well as adding to the accumulation of soil. Mosses then colonize these pockets of soil, eventually building up enough nutrients in the soil for alder shrubs to take hold. Over a hundred years, the alders, which have symbiotic bacteria that fix atmospheric nitrogen (described in chapter 28), increase soil nitrogen levels, and their acidic leaves further lower soil pH. Eventually, spruce trees grow above the alders and shade them, crowding them out entirely and forming a dense spruce forest. In a similar example, an oligotrophic lake—one poor in nutrients—may gradually, by the accumulation of organic matter, become eutrophic—rich in nutrients. As this occurs, the composition of communities will change, first increasing in species richness and then declining.
Why succession happens
250 c
200
Nitrogen in forest floor
150
Succession happens because species alter the habitat and the resources available in it in ways that favor other species. Three dynamic concepts are of critical importance in the process: establishment, facilitation, and inhibition.
100 b
50
Nitrogen in mineral soil
Figure 57.24 Primary succession at Alaska’s Glacier Bay. Year 1 Pioneer Mosses
Year 100 Invading Alder Alders Thickets
Year 200 Spruce Forest
a.
b. 1202
c. part
a. Initially, the glacial moraine at Glacier Bay, Alaska, had little soil nitrogen b. The first invaders of these exposed sites are pioneer moss species with nitrogen-fi xing, mutualistic microbes. c. Within 20 years, young alder shrubs take hold. Rapidly fi xing nitrogen, they soon form dense thickets. d. Eventually spruce overgrow the mature alders, forming a forest.
d.
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1202
11/20/09 2:09:04 PM
1. Establishment. Early successional stages are characterized by weedy, r-selected species that are tolerant of the harsh, abiotic conditions in barren areas (the preceding chapter discussed r-selected and K-selected species). 2. Facilitation. The weedy early successional stages introduce local changes in the habitat that favor other, less weedy species. Thus, the mosses in the Glacier Bay succession convert nitrogen to a form that allows alders to invade (see figure 57.24). Similarly, the nitrogen build-up produced by the alders, though not necessary for spruce establishment, leads to more robust forests of spruce better able to resist attack by insects. 3. Inhibition. Sometimes the changes in the habitat caused by one species, while favoring other species, also inhibit the growth of the original species that caused the changes. Alders, for example, do not grow as well in acidic soil as the spruce and hemlock that replace them. Over the course of succession, the number of species typically increases as the environment becomes more hospitable. In some cases, however, as ecosystems mature, more K-selected species replace r-selected ones, and superior competitors force out other species, leading ultimately to a decline in species richness.
Succession in animal communities The species of animals present in a community also change through time in a successional pattern. As the vegetation changes during succession, habitat disappears for some species and appears for others. A particularly striking example occurred on the Krakatau islands, which were devastated by an enormous volcanic eruption in 1883. Initially composed of nothing but barren ashfields, the three islands of the group experienced rapid successional change as vegetation became reestablished. A few blades of grass appeared the next year, and within 15 years the coastal vegetation was well established and the interior was covered with dense grasslands. By 1930, the islands were almost entirely forested (figure 57.25).
The fauna of Krakatau changed in synchrony with the vegetation. Nine months after the eruption, the only animal found was a single spider, but by 1908, 200 animal species were found in a 3-day exploration. For the most part, the first animals were grassland inhabitants, but as trees became established, some of these early colonists, such as the zebra dove and the long-tailed shrike (a type of predatory bird), disappeared and were replaced by forest-inhabiting species, such as fruit bats and fruit-eating birds. Although patterns of succession of animal species have typically been caused by vegetational succession, changes in the composition of the animal community in turn have affected plant occurrences. In particular, many plant species that are animal-dispersed or pollinated could not colonize Krakatau until their dispersers or pollinators had become established. For example, fruit bats were slow to colonize Krakatau, and until they appeared, few bat-dispersed plant species were present.
Disturbances can play an important role in structuring communities Traditionally, many ecologists considered biological communities to be in a state of equilibrium, a stable condition that resisted change and fairly quickly returned to its original state if disturbed by humans or natural events. Such stability was usually attributed to the process of interspecific competition. In recent years, this viewpoint has been reevaluated. Increasingly, scientists are recognizing that communities are constantly changing as a result of climatic changes, species invasions, and disturbance events. As a result, many ecologists now invoke nonequilibrium models that emphasize change, rather than stability. A particular focus of ecological research concerns the role that disturbances play in determining the structure of communities. Disturbances can be widespread or local. Severe disturbances, such as forest fires, drought, and floods, may affect large areas. Animals may also cause severe disruptions. Gypsy moths can devastate a forest by consuming all of the leaves on its trees. Unregulated deer populations may grow explosively, the deer
Figure 57.25 Succession after a volcanic eruption. A major volcanic explosion in 1883 on the island of Krakatau destroyed all life on the island. a. This photo shows a later, much less destruct ive eruption of the volcano. b. Krakatau, forested and populated by animals.
a.
a. www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1203
b. chapter
57 Interspecific Interactions and the Ecology of Communities
1203
11/20/09 2:09:07 PM
overgrazing and so destroying the forest in which they live. On the other hand, local disturbances may affect only a small area, as when a tree falls in a forest or an animal digs a hole and uproots vegetation.
Intermediate disturbance hypothesis In some cases, disturbance may act to increase the species richness of an area. According to the intermediate disturbance hypothesis, communities experiencing moderate amounts of disturbance will have higher levels of species richness than communities experiencing either little or great amounts of disturbance. Two factors could account for this pattern. First, in communities where moderate amounts of disturbance occur, patches of habitat exist at different successional stages. Within the area as a whole, then, species diversity is greatest because the full range of species—those characteristic of all stages of succession—are present. For example, a pattern of intermittent episodic disturbance that produces gaps in the rain forest (as when a tree falls) allows invasion of the gap by other species (figure 57.26). Eventually, the species inhabiting the gap will go through a successional sequence, one tree replacing another, until a canopy tree species comes again to occupy the gap. But if there are many gaps of different ages in the forest, many different species will be coexisting, some in young gaps and others in older ones. Second, moderate levels of disturbance may prevent communities from reaching the final stages of succession, in which a few dominant competitors eliminate most of the other species. In contrast, too much disturbance might leave the community continually in the earliest stages of succession, when species richness is relatively low. Ecologists are increasingly realizing that disturbance is common, rather than exceptional, in many communities. As a result, the idea that communities inexorably move along a successional trajectory culminating in the development of a predictable end-state, or “climax,” community is no longer widely accepted. Rather, predicting the state of a community in the future may be difficult because the unpredictable occurrence of disturbances will often counter successional changes. Understanding the role that disturbances play in structuring communities is currently an important area of investigation in ecology.
Figure 57.26 Intermediate disturbance. A single fallen tree created a small light gap in the tropical rain forest of Panama. Such gaps play a key role in maintaining the high species diversity of the rain forest. In this case, a sunlight-loving plant is able to sprout up among the dense foliage of trees in the forest.
Learning Outcomes Review 57.5 Communities change through time by a process termed succession. Primary succession occurs on bare, lifeless substrate; secondary succession occurs where an existing community has been disturbed. Early-arriving species alter the environment in ways that allow other species to colonize, and new colonizers may have negative effects on species already present. Sometimes, moderate levels of disturbance can lead to increased species richness because species characteristic of all levels of succession may be present. ■
From a community point of view, would clear-cutting a forest be better than selective harvest of individual trees? Why or why not?
Chapter Review 57.1 Biological Communities: Species Living Together
of a community is an integrated unit composed of species that work together as part of a functional whole.
A community is a group of different species that occupy a given location.
Communities change over space and time. In accordance with the individualistic view, species generally respond independently to environmental conditions, and community composition gradually changes over space and time. However, in locations where conditions rapidly change, species composition may change greatly over short distances.
Communities have been viewed in different ways. The individualistic concept of a community is a random assemblage of species that happen to occur in a given place. The holistic concept 1204
part
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1204
11/20/09 2:09:12 PM
57.2 The Ecological Niche Concept Fundamental niches are potential; realized niches are actual. A niche is the total of all the ways a species uses environmental resources. The fundamental niche is the entire niche a species is capable of using if there are no intervening factors. The realized niche is the set of actual environmental conditions that allow establishment of a stable population. Realized niches are usually smaller than fundamental niches because interspecific interactions limit a species’ use of some resources. Competitive exclusion can occur when species compete for limited resources. The principle of competitive exclusion states that if resources are limiting, two species cannot simultaneously occupy the same niche; rather, one species will be eliminated. Competition may lead to resource partitioning. By using different resources (partitioning), sympatric species can avoid competing with each other and can coexist with reduced realized niches. Detecting interspecific competition can be difficult. Although experimentation is a powerful means of testing the hypothesis that species compete, practical limitations exist. Detailed knowledge of the ecology of species is important to evaluate the results of experiments and possible interactions.
57.3 Predator–Prey Relationships Predation strongly influences prey populations. Predation is the consuming of one organism by another, and includes not only one animal eating another, but also an animal eating a plant. Natural selection strongly favors adaptations of prey species to prevent predation. In turn, sometimes predators evolve counteradaptations, leading to an evolutionary “arms race.” Plant adaptations defend against herbivores. Plants produce secondary chemical compounds that deter herbivores. Sometimes the herbivores evolve an ability to ingest the compounds and use them for their own defense. Animal adaptations defend against predators. Animal adaptations include chemical defenses and defensive coloration such as warning coloration or camouflage. Mimicry allows one species to capitalize on defensive strategies of another. In Batesian mimicry, a species that is edible or nontoxic evolves warning coloration similar to that of an inedible or poisonous species.
In Müllerian mimicry, two species that are both toxic evolve similar warning coloration.
57.4 The Many Types of Species Interactions Symbiosis involves long-term interactions. Many symbiotic species have coevolved and have permanent relationships. Commensalism benefits one species and is neutral to the other. Examples of commensal relationships include epiphytes growing on large plants and barnacles growing on sea animals. Mutualism benefits both species. One example is the case of ants and acacias, in which Acacia plants provide a home and food for a species of stinging ants that protect them from herbivores. Parasitism benefits one species at the expense of another. Many organisms have parasitic lifestyles, living on or inside one or more host species and causing damage or disease as a result. Ecological processes have interactive effects. Because many processes may occur simultaneously, species may affect one another not only through direct interactions but also through their effects on other species in the community. Keystone species have major effects on communities. Keystone species are those that maintain a more diverse community by reducing competition between species or by altering the environment to create new habitats.
57.5 Ecological Succession, Disturbance, and Species Richness Succession produces a change in species composition. Primary succession begins with a barren, lifeless substrate, whereas secondary succession occurs after an existing community is disrupted by fire, clearing, or other events. Disturbances can play an important role in structuring communities. Community composition changes as a result of local and global disturbances that “reset” succession. Intermediate levels of such disturbance may maximize species richness in two ways: by creating a patchwork of different habitats harboring different species, and by preventing communities from reaching the final stage of succession, which may be dominated by only a few, competitively superior species.
Review Questions U N D E R S TA N D 1. Studies that demonstrate that species living in an ecological community change independently of one another in space and time a. b. c. d.
support the individualistic concept of ecological communities. support the holistic concept of ecological communities. suggest species interactions are the sole determinant of which species coexist in a community. None of the above
www.ravenbiology.com
rav32223_ch57_1185-1206.indd 1205
2. If two species have very similar realized niches and are forced to coexist and share a limiting resource indefinitely, a. b. c. d.
both species would be expected to coexist. both species would be expected to go extinct. the species that uses the limiting resource most efficiently should drive the other species extinct. both species would be expected to become more similar to one another.
chapter
57 Interspecific Interactions and the Ecology of Communities
1205
11/20/09 2:09:16 PM
3. According to the idea of coevolution between predator and prey, when a prey species evolves a novel defense against a predator a. b. c. d.
the predator is expected to always go extinct. the prey population should increase irreversibly out of control of the predator. the predator population should increase. evolution of a predator response should be favored by natural selection.
4. In order for mimicry to be effective in protecting a species from predation, it must a. b. c. d.
occur in a palatable species that looks like a distasteful species. have cryptic coloration. occur such that mimics look and act like models. occur in only poisonous or dangerous species.
5. Which of the following is an example of commensalism? a. b. c. d.
A tapeworm living in the gut of its host A clownfish living among the tentacles of a sea anemone An acacia tree and acacia ants Bees feeding on nectar from a flower
6. A species whose effect on the composition of a community is greater than expected based on its abundance can be called a a. b. c. d.
predator. primary succession species. secondary succession species. keystone species.
7. When a predator preferentially eats the superior competitor in a pair of competing species a. b. c. d.
the inferior competitor is more likely to go extinct. the superior competitor is more likely to persist. coexistence of the competing species is more likely. None of the above
8. Species that are the first colonists in a habitat undergoing primary succession a. b. c. d.
are usually the fiercest competitors. help maintain their habitat constant so their persistence is ensured. may change their habitat in a way that favors the invasion of other species. must first be successful secondary succession specialists.
A P P LY 1. Which of the following can cause the realized niche of a species to be smaller than its fundamental niche? a. b.
Predation Competition
c. d.
Parasitism All of the above
c. d.
results in the fundamental and realized niches being the same. is more common in herbivores than carnivores.
4. Parasitism differs from predation because a. b. c. d.
the presence of parasitism doesn’t lead to selection for defensive adaptations in parasitized species. parasites and the species they parasitize never engage in an evolutionary “arms race.” parasites don’t have strong effects on the populations of the species they parasitize. None of the above
5. The presence of one species (A) in a community may benefit another species (B) if a. b. c. d.
a commensualistic relationship exists between the two. The first species (A) preys on a predator of the second species (B). The first species (A) preys on a species that competes with a species that is eaten by the second species (B). All of the above
SYNTHESIZE 1. Competition is traditionally indicated by documenting the effect of one species on the population of another. Are there alternative ways to study the potential effects of competition on organisms that are impractical to study with experimental manipulations because they are too big or live too long? 2. Refer to figure 57.9. If the single prey species of Paramecium was replaced by several different potential prey species that varied in their palatability or ease of subduing by the predator (leading to different levels of preference by the predator) what would you expect the dynamics of the system to look like; that is, would the system be more or less likely to go to extinction? 3. Refer to figure 57.22. Are there alternative hypotheses that might explain the increase followed by the decrease in ant colony numbers subsequent to rodent removal in the experiment described in figure 57.22? If so, how would you test the mechanism hypothesized in the figure? 4. Refer to figure 57.7. Examine the pattern of beak size distributions of two species of finches on the Galápagos Islands. One hypothesis that can be drawn from this pattern is that character displacement has taken place. Are there other hypotheses? If so, how would you test them? 5. Is it possible that some species function together as an integrated, holistic community, whereas other species at the same locality behave more individualistically? If so, what factors might determine which species function in which way?
2. The presence of a predatory species a. b. c. d.
always drives a prey species to extinction. can positively affect a prey species by having a detrimental effect on competing species. indicates that the climax stage of succession has been reached. None of the above
3. Resource partitioning by sympatric species a. b.
1206
always occurs when species have identical niches. may not occur in the presence of a predator, which reduces prey population sizes.
part
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
VIII Ecology and Behavior
rav32223_ch57_1185-1206.indd 1206
11/20/09 2:09:17 PM
CHAPTER
Chapter
58
Dynamics of Ecosystems
Chapter Outline 58.1
Biogeochemical Cycles
58.2
The Flow of Energy in Ecosystems
58.3
Trophic-Level Interactions
58.4
Biodiversity and Ecosystem Stability
58.5
Island Biogeography
T
Introduction The Earth is a relatively closed system with respect to chemicals. It is an open system in terms of energy, however, because it receives energy at visible and near-visible wavelengths from the Sun and steadily emits thermal energy to outer space in the form of infrared radiation. The organisms in ecosystems interact in complex ways as they participate in the cycling of chemicals and as they capture and expend energy. All organisms, including humans, depend on the specialized abilities of other organisms—plants, algae, animals, fungi, and prokaryotes—to acquire the essentials of life, as explained in this chapter. In chapters 58 and 59, we consider the many different types of ecosystems that constitute the biosphere and discuss the threats to the biosphere and the species it contains.
rav32223_ch58_1207-1229.indd 1207
11/20/09 2:21:59 PM
58.1
your life to contain a carbon or oxygen atom that once was part of Julius Caesar’s body or Cleopatra’s. The atoms of the various chemical elements are said to move through ecosystems in biogeochemical cycles, a term emphasizing that the cycles of chemical elements involve not only biological organisms and processes, but also geological (abiotic) systems and processes. Biogeochemical cycles include processes that occur on many spatial scales, from cellular to planetary, and they also include processes that occur on multiple timescales, from seconds (biochemical reactions) to millennia (weathering of rocks). Biogeochemical cycles usually cross the boundaries of ecosystems to some extent, rather than being self-contained within individual ecosystems. For example, one ecosystem might import or export carbon to others. In this section, we consider the cycles of some major elements along with the compound water. We also present an example of biogeochemical cycles in a forest ecosystem.
Biogeochemical Cycles
Learning Outcomes 1. 2. 3.
Define ecosystem. List four chemicals whose cyclic interactions are critical to organisms. Describe how human activities disrupt these cycles.
An ecosystem includes all the organisms that live in a particular place, plus the abiotic (nonliving) environment in which they live—and with which they interact—at that location. Ecosystems are intrinsically dynamic in a number of ways, including their processing of matter and energy. We start with matter.
The atomic constituents of matter cycle within ecosystems
Carbon, the basis of organic compounds, cycles through most ecosystems
During the biological processing of matter, the atoms of which it is composed, such as the atoms of carbon or oxygen, maintain their integrity even as they are assembled into new compounds and the compounds are later broken down. The Earth has an essentially fixed number of each of the types of atoms of biological importance, and the atoms are recycled. Each organism assembles its body from atoms that previously were in the soil, the atmosphere, other parts of the abiotic environment, or other organisms. When the organism dies, its atoms are released unaltered to be used by other organisms or returned to the abiotic environment. Because of the cycling of the atomic constituents of matter, your body is likely during
Carbon is a major constituent of the bodies of organisms because carbon atoms help form the framework of all organic compounds (see chapter 3); almost 20% of the weight of the human body is carbon. From the viewpoint of the dayto-day dynamics of ecosystems, carbon dioxide (CO2) is the most significant carbon-containing compound in the abiotic environments of organisms. It makes up 0.03% of the volume of the atmosphere, meaning the atmosphere contains about 750 billion metric tons of carbon. In aquatic ecosystems, CO2 reacts spontaneously with the water to form bicarbonate ions (HCO3–).
Figure 58.1 The carbon cycle. Photosynthesis by plants and algae captures carbon in the form of organic chemical compounds. Aerobic respiration by organisms and fuel combustion by humans return carbon to the form of carbon dioxide (CO2) or bicarbonate (HCO32). Microbial methanogens living in oxygen-free microhabitats, such as Oxidation the mud at the of methane bottom of the pond, might produce methane (CH4), a gas Release of methane that would enter the atmosphere and then gradually be oxidized abiotically to carbon dioxide (shown in green circled inset).
Combustion of fuels in industry, homes, and cars CO2 in atmosphere
Photosynthesis Plant Respiration Animal Respiration
Exchange between water and atmosphere
part
Food chains Carbon in animals
Microbial Respiration Carbon in dead organic matter
Dissolved CO2 and HCO3Respiration Photosynthesis
Carbon in fossil fuels (coal, petroleum) Conversion by geological processes
Carbon in algae and plants Food chains
1208
Carbon in plants
Carbon in animals
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1208
11/20/09 2:22:05 PM
Figure 58.2 The water cycle. Water circulates from Transpiration
Condensation Droplet water
Precipitation
Gaseous water (water vapor) in the atmosphere
the atmosphere to the surface of the Earth and back again. The Sun provides much of the energy required for evaporation.
Precipitation
Precipitation
Evaporation
Evaporation
Water in the oceans Water in lakes and rivers
Flow of rivers to the sea Percolation through soil
Groundwater
The basic carbon cycle The carbon cycle is straightforward, as shown in figure 58.1. In terrestrial ecosystems, plants and other photosynthetic organisms take in CO2 from the atmosphere and use it in photosynthesis to synthesize the carbon-containing organic compounds of which they are composed (see chapter 8). The process is sometimes called carbon fixation; fixation refers to metabolic reactions that make nongaseous compounds from gaseous ones. Animals eat the photosynthetic organisms and build their own tissues by making use of the carbon atoms in the organic compounds they ingest. Both the photosynthetic organisms and the animals obtain energy during their lives by breaking down some of the organic compounds available to them, through aerobic cellular respiration (see chapter 7). When they do this, they produce CO2. Decaying organisms also produce CO2. Carbon atoms returned to the form of CO2 are available once more to be used in photosynthesis to synthesize new organic compounds. In aquatic ecosystems, the carbon cycle is fundamentally similar, except that inorganic carbon is present in the water not only as dissolved CO2, but also as HCO3– ions, both of which act as sources of carbon for photosynthesis by algae and aquatic plants.
Methane producers Microbes that break down organic compounds by anaerobic cellular respiration (see chapter 7) provide an additional dimension to the global carbon cycle. Methanogens, for example, are microbes that produce methane (CH4) instead of CO2. One major source of CH4 is wetland ecosystems, where methanogens live in the oxygen-free sediments. Methane that enters the atmosphere is oxidized abiotically to CO2, but CH4 that remains isolated from oxygen can persist for great lengths of time.
The rise of atmospheric carbon dioxide Another dimension of the global carbon cycle is that over long stretches of time, some parts of the cycle may proceed more www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1209
rapidly than others. These differences in rate have ordinarily been relatively minor on a year-to-year basis; in any one year, the amount of CO2 made by breakdown of organic compounds almost matches the amount of CO2 used to synthesize new organic compounds. Small mismatches, however, can have large consequences if continued for many years. The Earth’s present reserves of coal were built up over geologic time. Organic compounds such as cellulose accumulated by being synthesized faster than they were broken down, and then they were transformed by geological processes into the fossil fuels. Most scientists believe that the world’s petroleum reserves were created in the same way. Human burning of fossil fuels today is creating large contemporary imbalances in the carbon cycle. Carbon that took millions of years to accumulate in the reserves of fossil fuels is being rapidly returned to the atmosphere, driving the concentration of CO2 in the atmosphere upward year by year and helping to spur fears of global warming (see chapter 59).
The availability of water is fundamental to terrestrial ecosystems The water cycle, seen in figure 58.2, is probably the most familiar of all biogeochemical cycles. All life depends on the presence of water; even organisms that can survive without water in resting states require water to regain activity. The bodies of most organisms consist mainly of water. The adult human body, for example, is about 60% water by weight. The amount of water available in an ecosystem often determines the nature and abundance of the organisms present, as illustrated by the difference between forests and deserts (see chapter 59). Each type of biogeochemical cycle has distinctive features. A distinctive feature of the water cycle is that water is a compound, not an element, and thus it can be synthesized and broken down. It is synthesized during aerobic cellular respiration (see chapter 7) and chemically split during photosynthesis (see chapter 8). The rates of these processes are ordinarily about equal, and therefore a relatively constant amount of water cycles through the biosphere. chapter
58 Dynamics of Ecosystems
1209
11/20/09 2:22:07 PM
The basic water cycle One key part of the water cycle is that liquid water from the Earth’s surface evaporates into the atmosphere. The change of water from a liquid to a gas requires a considerable addition of thermal energy, explaining why evaporation occurs more rapidly when solar radiation beats down on a surface. Evaporation occurs directly from the surfaces of oceans, lakes, and rivers. In terrestrial ecosystems, however, approximately 90% of the water that reaches the atmosphere passes through plants. Trees, grasses, and other plants take up water from soil via their roots, and then the water evaporates from their leaves and other surfaces through a process called transpiration (see chapter 38). Evaporated water exists in the atmosphere as a gas, just like any other atmospheric gas. The water can condense back into liquid form, however, mostly because of cooling of the air. Condensation of gaseous water (water vapor) into droplets or crystals causes the formation of clouds, and if the droplets or crystals are large enough, they fall to the surface of the Earth as precipitation (rain or snow).
Groundwater Less obvious than surface water, which we see in rivers and lakes, is water under ground—termed groundwater. Groundwater occurs in aquifers, which are permeable, underground layers of rock, sand, and gravel that are often saturated with water. Groundwater is the most important reservoir of water on land in many parts of the world, representing over 95% of all fresh water in the United States, for example. Goundwater consists of two subparts. The upper layers of the groundwater constitute the water table, which is unconfined in the sense that it flows into streams and is partly accessible to the roots of plants. The lower, confined layers of the groundwater are generally out of reach to streams and plants, but can be tapped by wells. Groundwater is recharged by water that percolates downward from above, such as from precipitation. Water in an aquifer flows much more slowly than surface water, anywhere from a few millimeters to a meter or so per day. In the United States, groundwater provides about 25% of the water used by humans for all purposes, and it supplies about 50% of the population with drinking water. In the Great Plains states, the deep Ogallala Aquifer is tapped extensively as a water source for agricultural and domestic needs. The aquifer is being depleted faster than it is recharged—a local imbalance in the water cycle—posing an ominous threat to the agricultural production of the area. Similar threats exist in many of the drier portions of the globe.
25 mya. Starting at about that time, mountains such as Mount Kilimanjaro rose up between the rain forests and the Indian Ocean, their source of moisture. The presence of the mountains forced winds from the Indian Ocean upward, cooling the air and causing much of its moisture to precipitate before the air reached the rain forests. The land became much drier, and the forests turned to grasslands. Today, human activities can alter the water cycle so profoundly that major changes occur in ecosystems. Changes in rain forests caused by deforestation provide an example. In healthy tropical rain forests, more than 90% of the moisture that falls as rain is taken up by plants and returned to the air by transpiration. Plants, in a very real sense, create their own rain: The moisture returned to the atmosphere falls back on the forests. When human populations cut down or burn the rain forests in an area, the local water cycle is broken. Water that falls as rain thereafter drains away in rivers instead of rising to form clouds and fall again on the forests. Just such a transformation is occurring today in many tropical rain forests (figure 58.3). Large areas in Brazil, for example, were transformed in the 20th century from lush tropical forest to semiarid desert, depriving many unique plant and animal species of their native habitat.
The nitrogen cycle depends on nitrogen fixation by microbes Nitrogen is a component of all proteins and nucleic acids and is required in substantial amounts by all organisms; proteins are 16% nitrogen by weight. In many ecosystems, nitrogen is the chemical element in shortest supply relative to the needs of organisms. A paradox is that the atmosphere is 78% nitrogen by volume.
Changes in ecosystems brought about by changes in the water cycle Water is so crucial for life that changes in its supply in an ecosystem can radically alter the nature of the ecosystem. Such changes have occurred often during the Earth’s geological history. Consider, for example, the ecosystem of the Serengeti Plain in Tanzania, famous for its seemingly endless grasslands occupied by vast herds of antelopes and other grazing animals. The semiarid grasslands of today’s Serengeti were rain forests 1210
part
Figure 58.3 Deforestation disrupts the local water cycle. Tropical deforestation can have severe consequences, such as the extensive erosion in this area in the Amazon region of Brazil.
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1210
11/20/09 2:22:10 PM
Nitrogen availability How can nitrogen be in short supply if the atmosphere is so rich with it? The answer is that the nitrogen in the atmosphere is in its elemental form—molecules of nitrogen gas (N2)—and the vast majority of organisms, including all plants and animals, have no way to use nitrogen in this chemical form. For animals, the ultimate source of nitrogen is nitrogencontaining organic compounds synthesized by plants or by algae or other microbes. Herbivorous animals, for example, eat plant or algal proteins and use the nitrogen-containing amino acids in them to synthesize their own proteins. Plants and algae use a number of simple nitrogencontaining compounds as their sources of nitrogen to synthesize proteins and other nitrogen-containing organic compounds in their tissues. Two commonly used nitrogen sources are ammonia (NH3) and nitrate ions (NO3–). As described in chapter 39, certain prokaryotic microbes can synthesize ammonia and nitrate from N2 in the atmosphere, thereby constituting a part of the nitrogen cycle that makes atmospheric nitrogen accessible to plants and algae (figure 58.4). Other prokaryotes turn NH3 and NO3– into N2, making the nitrogen inaccessible. The balance of the activities of these two sets of microbes determines the accessibility of nitrogen to plants and algae.
Microbial nitrogen fixation, nitrification, and denitrification The synthesis of nitrogen-containing compounds from N2 is known as nitrogen fixation. The first step in this process is the synthesis of NH3 from N2, and biochemists sometimes use the
term nitrogen fixation to refer specifically to this step. After NH3 has been synthesized, other prokaryotic microbes oxidize part of it to form NO3–, a process called nitrification. Certain genera of prokaryotes have the ability to accomplish nitrogen fixation using a system of enzymes known as the nitrogenase complex (the nif gene complex; see chapter 28). Most of the microbes are free-living, but on land some are found in symbiotic relationships with the roots of legumes (plants of the pea family, Fabaceae), alders, myrtles, and other plants. Additional prokaryotic microbes (including both bacteria and archaea) are able to convert the nitrogen in NO3– into N2 (or other nitrogen gases such as N2O), a process termed denitrification. Ammonia can be subjected to denitrification indirectly by being converted first to NO3– and then to N2.
Nitrogenous wastes and fertilizer use Most animals, when they break down proteins in their metabolism, excrete the nitrogen from the proteins as NH3. Humans and other mammals excrete nitrogen as urea in their urine (see chapter 51); a number of types of microbes convert the urea to NH3. The NH3 from animal excretion can be picked up by plants and algae as a source of nitrogen. Human populations are radically altering the global nitrogen cycle by the use of fertilizers on lawns and agricultural fields. The fertilizers contain forms of fixed nitrogen that crops can use, such as ammonium (NH4) salts manufactured industrially from atmospheric N2. Partly because of the production of fertilizers, humans have already doubled the rate of transfer of N2 in usable forms into soils and waters.
Figure 58.4 The nitrogen cycle. The nitrogen cycle is complicated because it involves multiple changes in the chemical form of nitrogen. Certain N2 in prokaryotes fi x atmospheric atmosphere nitrogen (N2), converting it to Nitrogen in forms such as ammonia animal tissues Food (NH3) and nitrate (NO3–) chains Nitrogen in that plants and algae can plant tissues use. Other prokaryotes Nitrogen fixation by soil microbes return nitrogen to the Excretion Release Decomposition Uptake atmosphere as N2 by Decomposition by roots of ammonia breaking down by soil Urea Soil NH3 and NO3: NH3 or other Microbial metabolism nitrogen-containing compounds. Ammonia, a gas, can enter the Nitrogen fixation Nitrogen in by aquatic atmosphere directly Activity of tissues of algae cyanobacteria denitrifying microbes from soils. and plants Dissolved NH3 and NO3: Animal excretion of NH3
www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1211
Growth Nitrogen in animal tissues
Food chains
chapter
58 Dynamics of Ecosystems
1211
11/20/09 2:22:11 PM
Figure 58.5 The phosphorus cycle. In contrast to carbon, water, and nitrogen, phosphorus occurs only in the liquid and solid states and thus does not enter the atmosphere.
Phosphates in animal tissues
Food chains Phosphates in plant tissues
Decomposition
Soluble phosphates in soil
Excretion
Loss in drainage
Uptake by roots Phosphates in rocks and minerals
Excretion and Weathering decomposition Phosphates in solution
Phosphates in animal tissues
Precipitation
Phosphorus cycles through terrestrial and aquatic ecosystems, but not the atmosphere Phosphorus is required in substantial quantities by all organisms; it occurs in nucleic acids, membrane phospholipids, and other essential compounds, such as adenosine triphosphate (ATP). Unlike carbon, water, and nitrogen, phosphorus has no significant gaseous form and does not cycle through the atmosphere (figure 58.5). In this respect, the phosphorus cycle exemplifies the sorts of cycles also exhibited by calcium, silicon, and many other mineral elements. Another feature that greatly simplifies the phosphorus cycle compared with the nitrogen cycle is that phosphorus exists in ecosystems in just a single oxidation state, phosphate (PO43 –).
Phosphate availability Plants and algae use free inorganic PO43 – in the soil or water for synthesizing their phosphorus-containing organic compounds. Animals then tap the phosphorus in plant or algal tissue compounds to build their own phosphorus compounds. When organisms die, decay microbes—in a process called phosphate remineralization—break up the organic compounds in their bodies, releasing phosphorus as inorganic PO43 – that plants and algae again can use. The phosphorus cycle includes critical abiotic chemical and physical processes. Free PO43 – exists in soil in only low concentrations both because it combines with other soil constituents to form insoluble compounds and because it tends to be washed away by streams and rivers. Weathering of many sorts of rocks releases new PO43 – into terrestrial systems, but then rivers carry the PO43 – into the ocean basins. There is a large one-way flux of PO43 – from terrestrial rocks to deep-sea sediments.
Phosphates as fertilizers Human activities have greatly modified the global phosphorus cycle since the advent of crop fertilization. Fertilizers are typically designed to provide PO43 – because crops might otherwise be short of it; the PO43 – in fertilizers is typically derived from crushed phosphate-rich rocks and bones. Detergents are an1212
part
Phosphates in sediment
Food chains
Phosphates in plant tissues
Uptake by roots
other potential culprit in adding PO43 – to ecosystems, but laws now mandate low-phosphate detergents in much of the world.
Limiting nutrients in ecosystems are those in short supply relative to need A chain is only as strong as its weakest link. For the plants and algae in an ecosystem to grow—and to thereby provide food for animals—they need many different chemical elements. The simplest theory is that in any particular ecosystem, one element will be in shortest supply relative to the needs for it by the plants and algae. That element is the limiting nutrient—the weak link—in the ecosystem. The cycle of a limiting nutrient is particularly important because it determines the rate at which the nutrient is made available for use. We gave the nitrogen and phosphorus cycles close attention precisely because those elements are the limiting nutrients in many ecosystems. Nitrogen is the limiting nutrient in about two-thirds of the oceans and in many terrestrial ecosystems. Oceanographers have discovered in just the last 15 years that iron is the limiting nutrient for algal populations (phytoplankton) in about one-third of the world’s oceans. In these waters, windborne soil dust seems often to be the chief source of iron. When wind brings in iron-rich dust, algal populations proliferate, provided the iron is in a usable chemical form. In this way, sand storms in the Sahara Desert, by increasing the dust in global winds, can increase algal productivity in Pacific waters (figure 58.6).
Biogeochemical cycling in a forest ecosystem has been studied experimentally An ongoing series of studies at the Hubbard Brook Experimental Forest in New Hampshire has yielded much of the available information about the cycling of nutrients in forest ecosystems.
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1212
11/20/09 2:22:17 PM
Dust
Concentration of nitrate (mg/L)
Figure 58.6 One world. Every year, millions of metric tons of iron-rich dust is carried westward by the trade winds from the Sahara Desert and neighboring Sahel area. A working hypothesis of many oceanographers is that this dust fertilizes parts of the ocean, including parts of the Pacific Ocean, where iron is the limiting nutrient. Land use practices in Africa, which are increasing the size of the north African desert, can thus affect ecosystems on the other side of the globe.
Hubbard Brook is the central stream of a large watershed that drains the hillsides of a mountain range covered with temperate deciduous forest. Multiple tributary streams carry water off the hillsides into Hubbard Brook. Six tributary streams, each draining a particular valley, were equipped with measurement devices when the study was started. All of the water that flowed out of each valley had to pass through the measurement system, where the flow of water and concentrations of nutrients was quantified. The undisturbed forests around Hubbard Brook are efficient at retaining nutrients. In a year, only small quantities of nutrients enter a valley from outside, doing so mostly as a result of precipitation. The quantities carried out in stream waters are small also. When we say “small,” we mean the influxes and outfluxes represent just minor fractions of the total amounts of nutrients in the system—about 1% in the case of calcium, for example. In 1965 and 1966, the investigators felled all the trees and cleared all shrubs in one of the six valleys and prevented regrowth (figure 58.7a). The effects were dramatic. The amount of water running out of that valley increased by 40%, indicating that water previously taken up by vegetation and evaporated into the atmosphere was now running off. The amounts of a number of nutrients running out of the system also greatly increased. For example, the rate of loss of calcium increased ninefold. Phosphorus, on the other hand, did not increase in the stream water; it apparently was locked up in insoluble compounds in the soil. The change in the status of nitrogen in the disturbed valley was especially striking (figure 58.7b). The undisturbed forest in this valley had been accumulating NO3– at a rate of about 5 kg per hectare per year, but the deforested ecosystem lost NO3– at a rate of about 53 kg per hectare per year. The NO3– concentration in the stream water rapidly increased. The fertility of the valley decreased dramatically, while the run-off of nitrate generated massive algal blooms downstream, and the danger of downstream flooding greatly increased. This experiment is particularly instructive at the start of the 21st century because forested land continues to be cleared worldwide (see chapter 59).
80 deforested watershed
40
undisturbed watershed
4 Deforestation 2 0 1965
1966
1967
1968
Year
a.
b.
Figure 58.7 The Hubbard Brook experiment. a. A 38-acre watershed was completely deforested, and the runoff monitored for several years. b. Deforestation greatly increased the loss of nutrients in runoff water from the ecosystem. The orange curve shows the nitrate concentration in the runoff water from the deforested watershed; the green curve shows the nitrate concentration in runoff water from an undisturbed neighboring watershed. www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1213
chapter
58 Dynamics of Ecosystems
1213
11/20/09 2:22:24 PM
Learning Outcomes Review 58.1 An ecosystem consists of the living and nonliving components of a particular place. Biogeochemical cycles describe how elements move between these components. Carbon, nitrogen, and phosphorus cycle in known ways, as does water, which is critical to ecosystems. Human populations disrupt these cycles with artificial fertilization, deforestation, diversion of water, and burning of fossil fuels. ■
Would fertilization with animal manure be less disruptive than fertilization with purified chemicals? Why or why not?
58.2
The Flow of Energy in Ecosystems
Learning Outcomes 1. 2. 3.
Describe the different trophic levels. Distinguish between energy and heat. Explain how energy moves through trophic levels.
The dynamic nature of ecosystems includes the processing of energy as well as that of matter. Energy, however, follows very different principles than does matter. Energy is never recycled. Instead, radiant energy from the Sun that reaches the Earth makes a one-way pass through our planet’s ecosystems before being converted to heat and radiated back into space, signifying that the Earth is an open system for energy.
Energy can neither be created nor destroyed, but changes form Why is energy so different from matter? A key part of the answer is that energy exists in several different forms, such as light, chemical-bond energy, motion, and heat. Although energy is neither created nor destroyed in the biosphere (the First Law of Thermodynamics), it frequently changes form. A second key point is that organisms cannot convert heat to any of the other forms of energy. Thus, if organisms convert some chemical-bond or light energy to heat, the conversion is one-way; they cannot cycle that energy back into its original form.
Living organisms can use many forms of energy, but not heat To understand why the Earth must function as an open system with regard to energy, two additional principles need to be recognized. The first is that organisms can use only certain forms of energy. For animals to live, they must have energy specifically as chemical-bond energy, which they acquire from their foods. Plants must have energy as light. Neither animals nor plants (nor any other organisms) can use heat as a source of energy. 1214
part
The second principle is that whenever organisms use chemical-bond or light energy, some of it is converted to heat; the Second Law of Thermodynamics states that a partial conversion to heat is inevitable. Put another way, animals and plants require chemical-bond energy and light to stay alive, but as they use these forms of energy, they convert them to heat, which they cannot use to stay alive and which they cannot cycle back into the original forms. Fortunately for organisms, the Earth functions as an open system for energy. Light arrives every day from the Sun. Plants and other photosynthetic organisms use the newly arrived light to synthesize organic compounds and stay alive. Animals then eat the photosynthetic organisms, making use of the chemicalbond energy in their organic molecules to stay alive. Light and chemical-bond energy are partially converted to heat at every step. In fact, the light and chemical-bond energy are ultimately converted completely to heat. The heat leaves the Earth by being radiated into outer space at invisible, infrared wavelengths of the electromagnetic spectrum. For life to continue, new light energy is always required. The Earth’s incoming and outgoing flows of radiant energy must be equal for global temperature to stay constant. One concern is that human activities are changing the composition of the atmosphere in ways that impede the outgoing flow—the so-called greenhouse effect, which is described in the following chapter. Heat may be accumulating on Earth, causing global warming (see chapter 59).
Energy flows through trophic levels of ecosystems In chapter 7, we introduced the concepts of autotrophs (“selffeeders”) and heterotrophs (“fed by others”). Autotrophs synthesize the organic compounds of their bodies from inorganic precursors such as CO2, water, and NO3– using energy from an abiotic source. Some autotrophs use light as their source of energy and therefore are photoautotrophs; they are the photosynthetic organisms, including plants, algae, and cyanobacteria. Other autotrophs are chemoautotrophs and obtain energy by means of inorganic oxidation reactions, such as the microbes that use hydrogen sulfide available at deep water vents (see chapter 59). All chemoautotrophs are prokaryotic. The photoautotrophs are of greatest importance in most ecosystems, and we focus on them in the remainder of this chapter. Heterotrophs are organisms that cannot synthesize organic compounds from inorganic precursors, but instead live by taking in organic compounds that other organisms have made. They obtain the energy they need to live by breaking up some of the organic compounds available to them, thereby liberating chemical-bond energy for metabolic use (see chapter 7). Animals, fungi, and many microbes are heterotrophs. When living in their native environments, species are often organized into chains that eat each other sequentially. For example, a species of insect might eat plants, and then a species of shrew might eat the insect, and a species of hawk might eat the shrew. Food passes through the four species in the sequence: plants → insect → shrew → hawk. A sequence of species like this is termed a food chain.
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1214
11/20/09 2:22:27 PM
Sun Trophic Level 4 Secondary carnivores Trophic Level 3 Primary carnivores Trophic Level 2 Herbivores Trophic Level 1 Primary producers
Detritivores
Figure 58.8 Trophic levels within an ecosystem. Primary producers such as plants obtain their energy directly from the Sun, placing them in trophic level 1. Animals that eat plants, such as plant-eating insects, are herbivores and are in trophic level 2. Animals that eat the herbivores, such as shrews, are primary carnivores and are in trophic level 3. Animals that eat the primary carnivores, such as owls, are secondary carnivores in trophic level 4. Each trophic level, although illustrated here by a particular species, consists of all the species in the ecosystem that function in a similar way in terms of what they eat. The organisms in the detritivore trophic level consume dead organic matter they obtain from all the other trophic levels. In a whole ecosystem, many species play similar roles; there is typically not just a single species in each role. For example, the animals that eat plants might include not just a single insect species, but perhaps 30 species of insects, plus perhaps 10 species of mammals. To organize this complexity, ecologists recognize a limited number of feeding, or trophic, levels (figure 58.8).
trophic levels in that they feed on the remains of already-dead organisms; detritus is dead organic matter. A subcategory of detritivores is the decomposers, which are mostly microbes and other minute organisms that live on and break up dead organic matter.
Definitions of trophic levels
Trophic levels consist of whole populations of organisms. For example, the primary-producer trophic level consists of the whole populations of all the autotrophic species in an ecosystem. Ecologists have developed a special set of terms to refer to the properties of populations and trophic levels. The productivity of a trophic level is the rate at which the organisms in the trophic level collectively synthesize new organic matter (new tissue substance). Primary productivity is the productivity of the primary producers. An important complexity in analyzing the primary producers is that not only do they synthesize new organic matter by photosynthesis, but they also break down some of the organic matter to release energy by means of aerobic cellular respiration (see chapter 7). The respiration of the primary producers, in this context, is the rate at which they break down organic compounds. Gross primary productivity (GPP) is simply the raw rate at which the primary producers synthesize new organic matter; net primary productivity (NPP) is the GPP minus the respiration of the
The first trophic level in an ecosystem, called the primary producers, consists of all the autotrophs in the system. The other trophic levels consist of the heterotrophs—the consumers. All the heterotrophs that feed directly on the primary producers are placed together in a trophic level called the herbivores. In turn, the heterotrophs that feed on the herbivores (eating them or being parasitic on them) are collectively termed primary carnivores, and those that feed on the primary carnivores are called secondary carnivores. Advanced studies of ecosystems need to take into account that organisms often do not line up in simple linear sequences in terms of what they eat; some animals, for example, eat both primary producers and other animals. A linear sequence of trophic levels is a useful organizing principle for many purposes, however. An additional consumer level is the detritivore trophic level. Detritivores differ from the organisms in the other www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1215
Concepts to describe trophic levels
chapter
58 Dynamics of Ecosystems
1215
11/20/09 2:22:29 PM
primary producers. The NPP represents the organic matter available for herbivores to use as food. The productivity of a heterotroph trophic level is termed secondary productivity. For instance, the rate that new organic matter is made by means of individual growth and reproduction in all the herbivores in an ecosystem is the secondary productivity of the herbivore trophic level. Each heterotroph trophic level has its own secondary productivity.
How trophic levels process energy The fraction of incoming solar radiant energy that the primary producers capture is small. Averaged over the course of a year, something around 1% of the solar energy impinging on forests or oceans is captured. Investigators sometimes observe far lower levels, but also see percentages as high as 5% under some conditions. The solar energy not captured as chemical-bond energy through photosynthesis is immediately converted to heat. The primary producers, as noted before, carry out respiration in which they break down some of the organic compounds in their bodies to release chemical-bond energy. They use a portion of this chemical-bond energy to make ATP, which they in turn use to power various energy-requiring processes. Ultimately, the chemical-bond energy they release by respiration turns to heat. Remember that organisms cannot use heat to stay alive. As a result, whenever energy changes form to become heat, it loses much or all of its usefulness for organisms as a fuel source. What we have seen so far is that about 99% of the solar energy impinging on an ecosystem turns to heat because it fails to be used by photosynthesis. Then some of the energy captured by photosynthesis also becomes heat because of respiration by the primary producers. All the heterotrophs in an ecosystem must live on the chemical-bond energy that is left.
An example of energy loss between trophic levels As chemical-bond energy is passed from one heterotroph trophic level to the next, a great deal of the energy is diverted all along the way. This principle has dramatic consequences. It means that, over any particular period of time, the amount of chemical-bond energy available to primary carnivores is far less than that available to herbivores, and the amount available to secondary carnivores is far less than that available to primary carnivores. Why does the amount of chemical-bond energy decrease as energy is passed from one trophic level to the next? Consider the use of energy by the herbivore trophic level as an example (figure 58.9). After an herbivore such as a leaf-eating insect ingests some food, it produces feces. The chemical-bond energy in the compounds in the feces is not passed along to the primary carnivore trophic level. The chemical-bond energy of the food that is assimilated by the herbivore is used for a number of functions. Part of the assimilated energy is liberated by cellular respiration to be used for tissue repair, body movements, and other such functions. The energy used in these ways turns to heat and is not passed along to the carnivore trophic level. Some chemical-bond energy is built into the tissues of the herbivore and can serve as food for a carnivore. However, some herbivore individuals die of disease or accident rather than being eaten by predators. 1216
part
17% growth 33% cellular respiration
50% feces
Figure 58.9 The fate of ingested chemical-bond energy: Why all the energy ingested by a heterotroph is not available to the next trophic level. A heterotroph such as this herbivorous insect assimilates only a fraction of the chemical-bond energy it ingests. In this example, 50% is not assimilated and is eliminated in feces; this eliminated chemical-bond energy cannot be used by the primary carnivores. A third (33%) of the ingested energy is used to fuel cellular respiration and thus is converted to heat, which cannot be used by the primary carnivores. Only 17% of the ingested energy is converted into insect biomass through growth and can serve as food for the next trophic level, but not even that percentage is certain to be used in that way because some of the insects die before they are eaten.
In the end, of course, some of the initial chemical-bond energy acquired from the leaf is built into the tissues of herbivore individuals that are eaten by primary carnivores. Much of the initial chemical-bond energy, however, is diverted into heat, feces, and the bodies of herbivore individuals that carnivores do not get to eat. The same scenario is repeated at each step in a series of trophic levels (figure 58.10). Ecologists figure as a rule of thumb that the amount of chemical-bond energy available to a trophic level over time is about 10% of that available to the preceding level over the same period of time. In some instances the percentage is higher, even as high as 30%.
Heat as the final energy product Essentially all of the chemical-bond energy captured by photosynthesis in an ecosystem eventually becomes heat as the chemical-bond energy is used by various trophic levels. To see this important point, recognize that when the detritivores in the ecosystem metabolize all the dead bodies, feces, and other materials made available to them, they produce heat just like the other trophic levels do.
Productive ecosystems Ecosystems vary considerably in their NPP. Wetlands and tropical rain forests are examples of particularly productive ecosystems (figure 58.11); in them, the NPP, measured as dry weight of new organic matter produced, is often around 2000 g/m2/ year. By contrast, the corresponding figures for some other types of ecosystems are 1200 to 1300 for temperate forests, 900 for savanna, and 90 for deserts. (These general ecosystem types, termed biomes, are described in the following chapter.)
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1216
11/20/09 2:22:29 PM
99 %
s ol
Figure 58.10 The flow of ar
an d
de
ath
Solar energy
en
er
a or
Feces
Blue arrows represent the flow of energy that enters the ecosystem as light and is then passed along as chemical-bond energy to successive trophic levels. At each step energy is diverted, meaning that the chemical-bond energy available to each trophic level is less than that available to the preceding trophic level. Red arrows represent diversions of energy into heat. Tan arrows represent diversions of energy into feces and other organic materials useful only to the detritivores. Detritivores may be eaten by carnivores, so some of the chemical-bond energy returns to higher trophic levels.
bs
1%
energy through an ecosystem. gy
tio
sh
n
eat
Feces and death
pira
da
Detritivores Chemical-bond energy in dead bodies, feces, and other nonliving organic products useful only to detritivores.
Res
Primary producers
ath
be
De
Respiration Heat
Herbivores
Fe ce sa nd
de a
p Res
th
i ra
tio
n
Primary carnivores
c Fe
es
an d
de
ath
Re
s
a pir
tio
n
Secondary carnivores
p Res
The number of trophic levels is limited by energy availability The rate at which chemical-bond energy is made available to organisms in different trophic levels decreases exponentially as energy makes its way from primary producers to herbivores and
i ra t
i on
then to various levels of carnivores. To envision this critical point, assume for simplicity that the primary producers in an ecosystem gain 1000 units of chemical-bond energy over a period of time. If the energy input to each trophic level is 10% of the input to the preceding level, then the input of chemicalbond energy to the herbivore trophic level is 100 units, to the
Figure 58.11 Ecosystem productivity per year. The
Algal beds and reefs Tropical rain forest Wetlands Tropical seasonal forest Estuaries Temperate evergreen forest Temperate deciduous forest Savanna Boreal forest Woodland and shrubland Cultivated land Temperate grassland Continental shelf Lake and stream Tundra and alpine Open ocean Desert and semidesert Extreme desert 0
500
1000
1500
2000
2500 0
NPP per unit area (g dry matter/m2/yr)
10
20
30
40
50
World NPP (1012 kg dry matter/m2/yr)
Source: Data in: Begon, M., J.L. Harper, and C. R. Townsend, Ecology 3/e, Blackwell Science, 1996, page 715. Original source: Whittaker, R. H. Communities and Ecosystems, 2/e, Macmillan, London, 1975. www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1217
first column of data shows the average net primary productivity (NPP) per square meter per year. The second column of data factors in the area covered by the ecosystem type; it is the product of the productivity per square meter per year times the number of square meters occupied by the ecosystem type worldwide. Note that an ecosystem type that is very productive on a squaremeter basis may not contribute much to global productivity if it is an uncommon type, such as wetlands. On the other hand, a very widespread ecosystem type, such as the open ocean, can contribute greatly to global productivity even if its productivity per square meter is low. chapter
58 Dynamics of Ecosystems
1217
11/20/09 2:22:30 PM
primary carnivores, 10 units, and to the secondary carnivores, 1 unit over the same period of time.
Limits on top carnivores The exponential decline of chemical-bond energy in a trophic chain limits the lengths of trophic chains and the numbers of top carnivores an ecosystem can support. According to our model calculations, if an ecosystem includes secondary carnivores, only about one-thousandth of the energy captured by photosynthesis passes all the way through the series of trophic levels to reach these animals as usable chemical-bond energy. Tertiary carnivores would receive only one ten-thousandth. This helps explain why no predators subsist solely on eagles or lions. The decline of available chemical-bond energy also helps explain why the numbers of individual top-level carnivores in an ecosystem tend to be low. The whole trophic level of top carnivores receives relatively little energy, and yet such carnivores tend to be big: They have relatively large individual body sizes and great individual energy needs. Because of these two factors, the population numbers of top predators tend to be small. The longest trophic chains probably occur in the oceans. Some tunas and other top-level ocean predators probably function as third- and fourth-level carnivores at times. The challenge of explaining such long trophic chains is obvious, but the solutions are not well understood presently.
In a pyramid of biomass, the widths of the boxes are drawn to be proportional to standing crop biomass. Usually, trophic levels that have relatively low productivity also have relatively little biomass present at a given time. Thus, pyramids of biomass are usually upright, meaning each box is narrower than the one below it (figure 58.13b). An upright pyramid of biomass is not mandated by fundamental and inviolable rules like an upright pyramid of productivity is, however. In some ecosystems, the pyramid of biomass is inverted, meaning that at least one trophic level has greater biomass than the one below it (figure 58.13c). How is it possible for the pyramid of biomass to be inverted? Consider a common sort of aquatic system in which the primary producers are single-celled algae (phytoplankton), and the herbivores are rice grain-sized animals (such as copepods) that feed directly on the algal cells. In such a system, the turnover of the algal cells is often very rapid: The cells multiply rapidly, but the animals consume them equally rapidly. In these circumstances, the algal cells never develop a large population size or large biomass. Nonetheless, because the algal cells are very productive, the ecosystem can support a substantial
Primary producers (algae and cyanobacteria)
Humans as consumers: A case study The flow of energy in Cayuga Lake in upstate New York (figure 58.12) helps illustrate how the energetics of trophic levels can affect the human food supply. Researchers calculated from the actual properties of this ecosystem that about 150 of each 1000 calories of chemical-bond energy captured by primary producers in the lake were transferred into the bodies of herbivores. Of these calories, about 30 were transferred into the bodies of smelt, small fish that were the principal primary carnivores in the system. If humans ate the smelt, they gained about 6 of the 1000 calories that originally entered the system. If trout ate the smelt and humans ate the trout, the humans gained only about 1.2 calories. For human populations in general, more energy is available if plants or other primary producers are eaten than if animals are eaten—and more energy is available if herbivores rather than carnivores are consumed.
Herbivores (animal plankton)
Trout Smelt
Ecological pyramids illustrate the relationship of trophic levels Imagine that the trophic levels of an ecosystem are represented as boxes stacked on top of each other. Imagine also that the width of each box is proportional to the productivity of the trophic level it represents. The stack of boxes will always have the shape of a pyramid; each box is narrower than the one under it because of the inviolable rules of energy flow. A diagram of this sort is called a pyramid of energy flow or pyramid of productivity (figure 58.13a). It is an example of an ecological pyramid. There are several types of ecological pyramids. Pyramid diagrams can be used to represent standing crop biomass or numbers of individuals, as well as productivity. 1218
part
Human 1.2 calories
1000 calories 150 calories 30 calories 6 calories
Figure 58.12 Flow of energy through the trophic levels of Cayuga Lake. Autotrophic plankton (algae and cyanobacteria) fi x the energy of the Sun, the herbivores (animal plankton) feed on them, and both are consumed by smelt. The smelt are eaten by trout. The amount of fish flesh produced per unit time for human consumption is at least five times greater if people eat smelt rather than trout, but people typically prefer to eat trout.
?
Inquiry question Why does it take so many calories of algae to support so few calories of humans?
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1218
11/20/09 2:22:30 PM
Inverted Pyramid of Biomass
Pyramid of Energy Flow (Productivity) First-level carnivore (48 kcal/m2/year)
Herbivorous zooplankton and bottom fauna (21 g/m2)
Herbivore (596 kcal/m2/year) Photosynthetic plankton (36,380 kcal/m2/year)
Phytoplankton (4 g/m2)
a.
c. Pyramid of Biomass
Pyramid of Numbers Carnivore
First-level carnivore (11 g/m2)
Figure 58.13 Ecological pyramids. In an ecological pyramid, successive trophic levels in an ecosystem are represented as stacked boxes, and the widths of the boxes represent the magnitude of an ecological property in the various trophic levels. Ecological pyramids can represent several different properties. a. Pyramid of energy flow (productivity). b. Pyramid of biomass of the ordinary type. c. Inverted pyramid of biomass. d. Pyramid of numbers.
Herbivore
Herbivore (37 g/m2) Photosynthetic plankton (807 g/m2)
1 11
Photosynthetic plankton
?
Inquiry question How can the existence of inverted pyramids of biomass be explained?
4,000,000,000
d.
b.
biomass of the animals, a biomass larger than that ever observed in the algal population. In a pyramid of numbers, the widths of the boxes are proportional to the numbers of individuals present in the various trophic levels (figure 58.13d). Such pyramids are usually, but not always, upright.
Learning Outcomes Review 58.2 Trophic levels in an ecosystem include primary producers, herbivores, primary carnivores, and secondary carnivores. Detritivores consume dead or waste matter from all levels. As energy passes from one level to another, some is inevitably lost as heat, which cannot be reclaimed. Photosynthetic primary producers capture about 1% of solar energy as chemical-bond energy. As this energy is passed through the other trophic levels, some is diverted at each step into heat, feces, and dead matter; only about 10% is available to the next level. ■
Describe the different ways that matter, such as carbon atoms, and energy move through ecosystems?
58.3
Trophic-Level Interactions
Learning Outcomes 1. 2.
Explain the meaning of trophic cascade. Distinguish between top-down and bottom-up effects.
www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1219
The existence of food chains creates the possibility that species in any one trophic level may have effects on more than one trophic level. Primary carnivores, for example, may have effects not only on the animals they eat, but also, indirectly, on the plants or algae eaten by their prey. Conversely, increases in primary productivity may provide more food not just to herbivores, but also, indirectly, to carnivores. The process by which effects exerted at an upper trophic level flow down to influence two or more lower levels is termed a trophic cascade. The effects themselves are called top-down effects. When an effect flows up through a trophic chain, such as from primary producers to higher trophic levels, it is termed a bottom-up effect.
Top-down effects occur when changes in the top trophic level affect primary producers The existence of top-down effects has been confirmed by controlled experiments in some types of ecosystems, particularly freshwater ones. For example, in one study, sections of a stream were enclosed with a mesh that prevented fish from entering. Brown trout—predators on invertebrates—were added to some enclosures but not others. After 10 days, the numbers of invertebrates in the enclosures with trout were only two-thirds as great as the numbers in the no-fish enclosures (figure 58.14). In turn, the biomass of algae, which the invertebrates ate, was five times greater in the trout enclosures than the no-fish ones. The logic of the trophic cascade just described leads to the expectation that if secondary carnivores are added to chapter
58 Dynamics of Ecosystems
1219
11/20/09 2:22:31 PM
2.0
Algae (μg chlorophyll a/cm2)
Invertebrates (number/m2)
5000
4000
3000
2000
1000
0
1.5
1.0
0.5
0 No fish
Trout
No fish
Trout
Figure 58.14 Top-down effects demonstrated by experiment in a simple trophic cascade. In a New Zealand stream, enclosures with trout had fewer herbivorous invertebrates (see the left-hand panel) and more algae (see the right-hand panel) than ones without trout.
?
Inquiry question Why do streams with trout have more algae?
enclosures, they would also cause cascading effects. The secondary carnivores would be predicted to keep populations of primary carnivores in check, which would lead to a profusion of herbivores and a scarcity of primary producers.
In an experiment similar to the one just described, enclosures were created in free-flowing streams in northern California. In these streams, the principal primary carnivores were damselfly larvae (termed nymphs). Fish that preyed on the nymphs and on other primary carnivores were added to some enclosures but not others. In the enclosures with fish, the numbers of damselfly nymphs were reduced, leading to higher numbers of their prey, including herbivorous insects, which led in turn to a decreased biomass of algae (figure 58.15). Trophic cascades in large-scale ecosystems are not as easy to verify by experiment as ones in stream enclosures, and the workings of such cascades are not thoroughly known. Nonetheless, certain cascades in large-scale ecosystems are recognized by most ecologists. One of the most dramatic involves sea otters, sea urchins, and kelp forests along the West Coast of North America (figure 58.16). The otters eat the urchins, and the urchins eat young kelps, inhibiting the development of kelp forests. When the otters are abundant, the kelp forests are well developed because there are relatively few urchins in the system. But when the otters are sparse, the urchins are numerous and impair development of the kelp forests. Orcas (killer whales) also enter the picture because in recent years they have started to prey intensively on the otters, driving otter populations down.
Human removal of carnivores produces top-down effects Human activities are believed to have had top-down effects in a number of ecosystems, usually by the removal of top-level
No Fish
Fish
Population Size
High
Population Size
High
Low
Low Carnivorous damselfly nymphs
Herbivorous insects
Algae
Carnivorous damselfly nymphs
Herbivorous insects
Algae
Figure 58.15 Top-down effects demonstrated by an experiment in a four-level trophic cascade. Stream enclosures with large, carnivorous fish (on right) have fewer primary carnivores, such as damselfly nymphs, more herbivorous insects (exemplified here by the number of chironomids, a type of aquatic insect), and lower levels of algae.
? 1220
Inquiry question What might be the effect if snakes that prey on fish were added to the enclosures?
part
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1220
11/20/09 2:22:32 PM
High
Orca predation drives sea otter population down
Population Size
Population Size
High
Low
Low Sea Otters
Sea Urchins
Kelp
a.
Sea Otters
Sea Urchins
Kelp
b.
Figure 58.16 A trophic cascade in a large-scale ecosystem. Along the West Coast of North America, the sea otter/sea urchin/kelp system exists in two states: In the state shown in panel a, low populations of sea otters permit high populations of urchins, which suppress kelp populations; in the state shown in panel b, high populations of otters keep urchins in check, permitting profuse kelp growth. According to a recent hypothesis, a switch of orcas to preying on otters rather than other mammals is leading the ecosystem today to be mostly in the state represented on the left.
carnivores. The great naturalist Aldo Leopold posited such effects long before the trophic cascade hypothesis had been scientifically articulated when he wrote in Sand County Almanac: “I have lived to see state after state extirpate its wolves. I have watched the face of many a new wolfless mountain, and seen the south-facing slopes wrinkle with a maze of new deer trails. I have seen every edible bush and seedling browsed, first to anemic desuetude, and then to death. I have seen every edible tree defoliated to the height of a saddle horn.” Many similar examples exist in which the removal of predators has led to cascading effects on lower trophic levels. Large predators such as jaguars and mountain lions are absent on Barro Colorado Island, a hilltop turned into an island by the construction of the Panama Canal at the beginning of the last century. As a result, smaller predators whose populations are normally held in check—including monkeys, peccaries (a relative of the pig), coatimundis, and armadillos—have become extraordinarily abundant. These animals eat almost anything they www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1221
find. Ground-nesting birds are particularly vulnerable, and many species have declined; at least 15 bird species have vanished from the island entirely. Similarly, in the world’s oceans, large predatory fish such as billfish and cod have been reduced by overfishing to an average of 10% of their previous numbers in virtually all parts of the world’s oceans. In some regions, the prey of cod—such as certain shrimp and crabs—have become many times more abundant than they were before, and further cascading effects are evident at still lower trophic levels.
Bottom-up effects occur when changes to primary producers affect higher trophic levels In predicting bottom-up effects, ecologists must take account of the life histories of the organisms present. A model of bottom-up effects thought to apply to a number of types of ecosystems is diagrammed in figure 58.17. chapter
58 Dynamics of Ecosystems
1221
11/20/09 2:22:37 PM
According to the model, when primary productivity is low, producer populations cannot support significant herbivore populations. As primary productivity increases, herbivore populations become a feature of the ecosystem. Increases in primary productivity are then entirely devoured by the herbivores,
Biomass of Carnivores
High
the populations of which increase in size while keeping the populations of primary producers from increasing. As primary productivity becomes still higher, herbivore populations become large enough that primary carnivores can be supported. Further increases in primary productivity then does not lead to increases in herbivore populations, but rather to increases in carnivore populations. Experimental evidence for the bottom-up effects predicted by the model was provided by a study conducted in enclosures on a river (figure 58.18). The enclosures excluded large fish (secondary carnivores). A roof was placed above each enclosure. Some roofs were clear, whereas others were tinted to various degrees, so that the enclosures differed in the amount of sunlight entering them.
Low
Biomass of Herbivores
Carnivore Biomass (g/m2)
High
Low
1.2 1.0 0.8 0.6 0.4 0.2 0
Biomass of Primary Producers
Herbivore Biomass (g/m2)
High
Low Primary Productivity
Figure 58.17 A model of bottom-up effects. At low levels of primary productivity, herbivore populations cannot obtain enough food to be maintained; without herbivory, the standing crop biomass of the primary producers such as these diatoms increases as their productivity increases. Above some threshold, increases in primary productivity lead to increases in herbivore populations and herbivore biomass; the biomass of the primary producers then does not increase as primary productivity increases because the increasing productivity is cropped by the herbivores. Above another threshold, populations of primary carnivores can be sustained. As primary productivity increases above this threshold, the carnivores consume the increasing productivity of the herbivores, so the biomass of the herbivore populations remains relatively constant while the biomass of the carnivore populations increases. The biomass of the primary producers is no longer constrained by increases in the herbivore populations and thus also increases with increasing primary productivity. A key to understanding the model is to maintain a distinction between the concepts of productivity and standing crop biomass.
? 1222
Inquiry question How is it possible for the biomass of the primary producers to stay relatively constant as the primary productivity increases? part
300
600
900
1200
1500
0
300
600
900
1200
1500
0
300
600
900
1200
1500
8 6 4 2 0
High Primary Producer Biomass (g algae/m2)
Low
0
12 10 8 6 4 2 0 Intensity of Illumination (μmol of photons of light/m2/s)
Figure 58.18 An experimental study of bottom-up effects in a river ecosystem. This system, studied on the Eel River in northern California, exhibited the patterns modeled by the red graphs of figure 58.17. Increases in the intensity of illumination led to increases in primary productivity and in the biomass of the primary producers. The biomass of the carnivore populations also increased. However, herbivore biomass did not increase much with increasing primary productivity because increases in herbivore productivity were consumed by the carnivores.
?
Inquiry question Why is the amount of light an important determinant of carnivore biomass?
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1222
11/20/09 2:22:39 PM
The primary productivity was highest in the enclosures with clear roofs and lowest in the ones with darkly tinted roofs. As primary productivity increased in parallel with illumination, the biomass of the primary producers increased, as did the biomass of the carnivores. However, the biomass of the trophic level sandwiched in between, the herbivores, did not increase much, as predicted by the model in figure 58.17 (see red graph lines).
SCIENTIFIC THINKING Question: Does species richness affect the invasibility of a community? Hypothesis: The rate of successful invasion will be lower in communities with greater richness. Experiment: Add seeds from the same number of non-native plants to experimental plots that differ in the number of plant species.
Learning Outcomes Review 58.3 Populations of species at different trophic levels affect one another, and these effects can propagate through the levels. Top-down effects, termed trophic cascades, are observed when changes in carnivore populations affect lower trophic levels. Bottom-up effects are observed when changes in primary productivity affect the higher trophic levels. ■
Could top-down and bottom-up effects occur simultaneously?
58.4
Biodiversity and Ecosystem Stability
Learning Outcomes 1. 2. 3.
Define ecosystem stability. Describe the effects of species richness on ecosystem function. Name possible factors that contribute to species richness in the tropics.
Number of Invading Species
a.
100
10
1 0
5
10 15 20 Number of Species on Plots
25
b. Result: Although the number of successful invasive species is highly
In the preceding chapter, we discussed species richness—the number of species present in a community. Ecologists have long debated the consequences of differences in species richness between communities. One theory is that species-rich communities are more stable—that is, more constant in composition and better able to resist disturbance. This hypothesis has been elegantly studied by David Tilman and colleagues at the University of Minnesota’s Cedar Creek Natural History Area.
Species richness may increase stability: The Cedar Creek studies Workers monitored 207 small rectangular plots of land (8–16 m2) for 11 years (figure 58.19a). In each plot, they counted the number of prairie plant species and measured the total amount of plant biomass (that is, the mass of all plants on the plot). Over the course of the study, plant species richness was related to community stability—plots with more species showed less year-to-year variation in biomass. Moreover, in two drought years, the decline in biomass was negatively related to species richness—that is, plots with more species were less affected by drought. These findings were subsequently confirmed by an experiment in which plots were seeded with different numbers of www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1223
variable, more species-rich plots on average are invaded by fewer species. Interpretation: What might explain why so much variation exists in the number of successful invading species in communities with the same species richness?
Figure 58.19 Effect of species richness on ecosystem
stability. a. One of the Cedar Creek experimental plots. b. Community stability can be assessed by looking at the effect of species richness on community invasibility. Each dot represents data from one experimental plot in the Cedar Creek experimental fields. Plots with more species are harder to invade by nonnative species.
?
Inquiry question How could you devise an experiment on invasibility that didn’t rely on species from surrounding areas?
species. Again, more species-rich plots had greater year-to-year stability in biomass over a 10-year period. In a related experiment, when seeds of other plant species were added to different plots, the ability of these species to become established was negatively related to species richness (figure 58.19b). More diverse communities, in other words, are more resistant to invasion by new species, which is another measure of community stability. chapter
58 Dynamics of Ecosystems
1223
11/23/09 10:37:32 AM
Species richness may also affect other ecosystem processes. Tilman and colleagues monitored 147 experimental plots that varied in number of species to estimate how much growth was occurring and how much nitrogen the growing plants were taking up from the soil. They found that the more species a plot had, the greater the nitrogen uptake and total amount of biomass produced. In his study, increased biodiversity clearly appeared to lead to greater productivity. Laboratory studies on artificial ecosystems have provided similar results. In one elaborate study, ecosystems covering 1 m2 were constructed in growth chambers that controlled temperature, light levels, air currents, and atmospheric gas concentrations. A variety of plants, insects, and other animals were introduced to construct ecosystems composed of 9, 15, or 31 species, with the lower diversity treatments containing a subset of the species in the higher diversity enclosures. As with Tilman’s experiments, the amount of biomass produced was related to species richness, as was the amount of carbon dioxide consumed, another measure of the productivity of the ecosystem. Tilman’s conclusion that healthy ecosystems depend on diversity is not accepted by all ecologists, however. Critics question the validity and relevance of these biodiversity studies, arguing that the more species are added to a plot, the greater the probability that one species will be highly productive. To show that high productivity results from high species richness per se, rather than from the presence of particular highly productive species, experimental plots have to exhibit “overyielding”; in other words, plot productivity has to be greater than that of the single most productive species grown in isolation. Although this point is still debated, recent work at Cedar Creek and elsewhere has provided evidence of overyielding, supporting the claim that species richness of communities enhances community productivity and stability.
30
Species richness is influenced by ecosystem characteristics A number of factors are known or hypothesized to affect species richness in a community. We discussed some in chapter 57, such as loss of keystone species and moderate physical disturbance. Here we discuss three more: primary productivity, habitat heterogeneity, and climatic factors.
Primary productivity Ecosystems differ substantially in primary productivity (see figure 58.11). Some evidence indicates that species richness is related to primary productivity, but the relationship between them is not linear. In a number of cases, for example, ecosystems with intermediate levels of productivity tend to have the greatest number of species (figure 58.20a). Why this is so is debated. One possibility is that levels of productivity are linked with numbers of consumers. Applying this concept to plant species richness, the argument is that at low productivity, there are few herbivores, and superior competitors among the plants are able to eliminate most other plant species. In contrast, at high productivity so many herbivores are present that only the plant species most resistant to grazing survive, reducing species diversity. As a result, the greatest numbers of plant species coexist at intermediate levels of productivity and herbivory.
Habitat heterogeneity Spatially heterogeneous abiotic environments are those that consist of many habitat types—such as soil types, for example. These heterogeneous environments can be expected to accommodate more species of plants than spatially homogeneous environments. What’s more, the species richness of animals can be expected to reflect the species richness of plants present. An
150
10
20
10
Number of Mammal Species
Number of Lizard Species
Plant Species Richness
9 8 7 6 5
100
50
4
0 0
100 200 300 Primary Productivity
a.
400
0
b.
0.2 0.4 0.6 0.8 Plant Structural Complexity
0
5 10 15 20 25 Temperature Range (OC)
c.
Figure 58.20 Factors that affect species richness. a. Productivity: In plant communities of mountainous areas of South Africa, species richness of plants peaks at intermediate levels of productivity (biomass). b. Spatial heterogeneity: The species richness of desert lizards is positively correlated with the structural complexity of the plant cover in desert sites in the American Southwest. c. Climate: The species richness of mammals is inversely correlated with monthly mean temperature range along the West Coast of North America.
? 1224
Inquiry question (a.) Why is species richness greatest at intermediate levels of productivity? (b.) Why do more structurally complex areas have more species? (c.) Why do areas with less variation in temperature have more species? part
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1224
11/20/09 2:22:43 PM
example of this latter effect is seen in figure 58.20b: The number of lizard species at various sites in the American Southwest mirrors the local structural diversity of the plants.
Climatic factors The role of climatic factors is more difficult to predict. On the one hand, more species might be expected to coexist in a seasonal environment than in a constant one because a changing climate may favor different species at different times of the year. On the other hand, stable environments are able to support specialized species that would be unable to survive where conditions fluctuate. The number of mammal species at locations along the West Coast of North America is inversely correlated with the amount of local temperature variation—the wider the variation, the fewer mammalian species—supporting the latter line of argument (figure 58.20c).
Tropical regions have the highest diversity, although reasons are unclear Since before Darwin, biologists have recognized that more different kinds of animals and plants inhabit the tropics than the temperate regions. For many types of organisms, there is a steady increase in species richness from the arctic to the tropics. Called a species diversity cline, this biogeographic gradient in numbers of species correlated with latitude has been reported for plants and animals, including birds (figure 58.21), mammals, and reptiles. For the better part of a century, ecologists have puzzled over the species diversity cline from the arctic to the tropics. The difficulty has not been in forming a reasonable hypothesis of why more species exist in the tropics, but rather in sorting through these many reasonable hypotheses. Here, we consider five of the most commonly discussed suggestions.
Evolutionary age of tropical regions Scientists have frequently proposed that the tropics have more species than temperate regions because the tropics have existed over long, uninterrupted periods of evolutionary time, whereas temperate regions have been subject to repeated glaciations. The greater age of tropical communities would have allowed complex population interactions to coevolve within them, fostering a greater variety of plants and animals. Recent work suggests that the long-term stability of tropical communities has been greatly exaggerated, however. An examination of pollen within undisturbed soil cores reveals that during glaciations, the tropical forests contracted to a few small refuges surrounded by grassland. This suggests that the tropics have not had a continuous record of species richness over long periods of evolutionary time.
Increased productivity A second often-advanced hypothesis is that the tropics contain more species because this part of the Earth receives more solar radiation than do temperate regions. The argument is that more solar energy, coupled to a year-round growing season, greatly increases the overall photosynthetic activity of tropical plants. www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1225
Number of species 0–50 50–100 100–150 150–200 200–250 250–300 300–350 350–400 400–450 450–500 500–550 550–600 600–650 650–700
Figure 58.21 A latitudinal cline in species richness. Among North and Central American birds, a marked increase in the number of species occurs moving toward the tropics. Fewer than 100 species are found at arctic latitudes, but more than 600 species live in southern Central America.
If we visualize the tropical forest’s total resources as a pie, and its species niches as slices of the pie, we can see that a larger pie accommodates more slices. But as noted earlier, many field studies have indicated that species richness is highest at intermediate levels of productivity. Accordingly, increasing productivity would be expected to lead to lower, not higher, species richness.
Stability/constancy of conditions Seasonal variation, though it does exist in the tropics, is generally substantially less than in temperate areas. This reduced seasonality might encourage specialization, with niches subdivided to partition resources and so avoid competition. The expected result would be a larger number of more specialized species in the tropics, which is what we see. Many field tests of this hypothesis have been carried out, and almost all support it, reporting larger numbers of narrower niches in tropical communities than in temperate areas.
Predation Many reports indicate that predation may be more intense in the tropics. In theory, more intense predation could reduce the importance of competition, permitting greater niche overlap and thus promoting greater species richness.
Spatial heterogeneity As noted earlier, spatial heterogeneity promotes species richness. Tropical forests, by virtue of their complexity, create a variety of microhabitats and so may foster larger numbers of species. Perhaps the long vertical column of vegetation through chapter
58 Dynamics of Ecosystems
1225
11/20/09 2:22:43 PM
An ecosystem is stable if it remains relatively constant in composition and is able to resist disturbance. Experimental field studies support the conclusion that species-rich communities are better able to resist invasion by new species, as well as have increased biomass production at the primary level, although not all ecologists agree with these conclusions. Species richness is greatest in the tropics, and the reasons may include habitat variation, increased sunlight, and long-term climate and seasonal stability. ■
What might be the effects on primary productivity if air pollution decreased the amount of sunlight reaching Earth’s surface?
Island Biogeography
58.5
Learning Outcomes 1. 2.
Describe the species–area relationship. Explain how area and isolation affect rates of colonization and extinction.
One of the most reliable patterns in ecology is the observation that larger islands contain more species than do smaller islands. In 1967, Robert MacArthur of Princeton University and Edward O. Wilson of Harvard University proposed that this species–area relationship was a result of the effect of geographic area and isolation on the likelihood of species extinction and colonization.
Colonization rate of new species
Island near mainland Colonization Rate
Rate
Rate
Extinction rate of island species
Number of Species
a.
MacArthur and Wilson reasoned that species are constantly being dispersed to islands, so islands have a tendency to accumulate more and more species. At the same time that new species are added, however, other species are lost by extinction. As the number of species on an initially empty island increases, the rate of colonization must decrease as the pool of potential colonizing species not already present on the island becomes depleted. At the same time, the rate of extinction should increase—the more species on an island, the greater the likelihood that any given species will perish. As a result, at some point, the number of extinctions and colonizations should be equal, and the number of species should then remain constant. Every island of a given size, then, has a characteristic equilibrium number of species that tends to persist through time (the intersection point in figure 58.22a)— though the species composition will change as some species become extinct and new species colonize. MacArthur and Wilson’s equilibrium model proposes that island species richness is a dynamic equilibrium between colonization and extinction. Both island size and distance from the mainland would affect colonization and extinction. We would expect smaller islands to have higher rates of extinction because their population sizes would, on average, be smaller. Also, we would expect fewer colonizers to reach islands that lie farther from the mainland. Thus, small islands far from the mainland would have the fewest species; large islands near the mainland would have the most (figure 58.22b). The predictions of this simple model bear out well in field data. Asian Pacific bird species (figure 58.22c) exhibit a positive correlation of species richness with island size, but a negative correlation of species richness with distance from the source of colonists.
Small island
Island far from mainland
Large island
Number of Bird Species
Learning Outcomes Review 58.4
The equilibrium model proposes that extinction and colonization reach a balance point
Extinction Rate
which light passes in a tropical forest produces a wide range of light frequencies and intensities, creating a greater variety of light environments and so promoting species diversity.
Number of Species
b.
More than 3200 km from New Guinea 800–3200 km from New Guinea Less than 800 km from New Guinea
1000 100 10 10
100 1000 10,000 100,000 Island Size (km2)
c.
Figure 58.22 The equilibrium model of island biogeography. a. Island species richness reaches an equilibrium (black dot) when the colonization rate of new species equals the extinction rate of species on the island. b. The equilibrium shifts depending on the rate of colonization, the size of an island, and its distance to sources of colonists. Species richness is positively correlated with island size and inversely correlated with distance from the mainland. Smaller islands have higher extinction rates, shifting the equilibrium point to the left. Similarly, more distant islands have lower colonization rates, again shifting the equilibrium point leftward. c. The effect of distance from a larger island, which can be the source of colonizing species, is readily apparent. More distant islands have fewer Asian Pacific bird species than do nearer islands of the same size. 1226
part
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1226
11/20/09 2:22:43 PM
The equilibrium model is still being tested Wilson and Dan Simberloff, then a graduate student, performed initial studies in the mid-1960s on small mangrove islands in the Florida keys. These islands were censused, cleared of animal life by fumigation, and then allowed to recolonize, with censuses being performed at regular intervals. These and other such field studies have tended to support the equilibrium model. Long-term experimental field studies, however, are suggesting that the situation is more complicated than MacArthur and Wilson envisioned. Their model predicts a high level of species turnover as some species perish and others arrive. But studies of island birds and spiders indicate that very little turnover occurs from year to year. Those species that do come and go, moreover, comprise a subset of species that never attain high populations. A substantial proportion of the species appear to maintain high populations and rarely go extinct.
These studies have been going on for a relatively short period of time. It is possible that over periods of centuries, the equilibrium model is a good description of what determines island species richness.
Learning Outcomes Review 58.5 The species–area relationship is an observation that an island of larger area contains more species. Species richness on islands appears to be a dynamic equilibrium between colonization and extinction. Distance from a mainland also affects the rates of colonization and extinction, and therefore fewer species would be found on small, isolated islands far from a mainland. ■
Under what circumstances would a smaller island be expected to have more species than a larger island?
Chapter Review 58.1 Biogeochemical Cycles The atomic constituents of matter cycle within ecosystems. The atoms of chemical elements move through ecosystems in biogeochemical cycles. Carbon, the basis of organic compounds, cycles through most ecosystems. The carbon cycle usually involves carbon dioxide, which is fixed through photosynthesis and released by respiration. Carbon is also present as bicarbonate ions and as methane. Burning of fossil fuels has created an imbalance in the carbon cycle (see figure 58.1). The availability of water is fundamental to terrestrial ecosystems. Water enters the atmosphere via evaporation and transpiration and returns to the Earth’s surface as precipitation. It is broken down during photosynthesis and also produced during cellular respiration. Much of the Earth’s water, including the groundwater in aquifers, is polluted, and human activities alter the water supply of ecosystems (see figure 58.2).
Biogeochemical cycling in a forest ecosystem has been studied experimentally. Ongoing experiments indicate that severe disturbance of an ecosystem results in mineral depletion and runoff of water.
58.2 The Flow of Energy in Ecosystems Energy can neither be created nor destroyed, but changes form. Energy exists in forms such as light, stored chemical-bond energy, motion, and heat. In any conversion, some energy is lost. Living organisms can use many forms of energy, but not heat. The Second Law of Thermodynamics states that whenever organisms use chemical-bond or light energy, some of it is inevitably converted to heat and cannot be retrieved.
Phosphorus cycles through terrestrial and aquatic ecosystems, but not the atmosphere. Phosphorus, another limiting nutrient, is released by weathering of rocks; it flows into the oceans where it is deposited in deep-sea sediments. Humans also use phosphates as fertilizers (see figure 58.5).
Energy flows through trophic levels of ecosystems. Organic compounds are synthesized by autotrophs and are utilized by both autotrophs and heterotrophs. As energy passes from organism to organism, each level is termed a trophic level, and the sequence through progressive trophic levels is called a food chain (see figure 58.8). The base trophic level includes the primary producers; herbivores that consume primary producers are the next level. They in turn are eaten by primarily carnivores, which may be consumed by secondary carnivores. Detritivores feed on waste and the remains of dead organisms. Only about 1% of the solar energy that impinges on the Earth is captured by photosynthesis. As energy moves through each trophic level, very little (approximately 10%) remains from the preceding trophic level (see figure 58.10).
Limiting nutrients in ecosystems are those in short supply relative to need. The cycle of a limiting nutrient, such as nitrogen, determines the rate at which the nutrient is made available for use.
The number of trophic levels is limited by energy availability. The exponential decline of energy between trophic levels limits the length of food chains and the numbers of top carnivores that can be supported.
The nitrogen cycle depends on nitrogen fixation by microbes. Nitrogen is usually the element in shortest supply even though N2 makes up 78% of the atmosphere. Nitrogen must be converted into usable forms by nitrogen-fixing microorganisms. Human use of nitrates in fertilizers has doubled the available nitrogen (see figure 58.4).
www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1227
chapter
58 Dynamics of Ecosystems
1227
11/20/09 2:22:44 PM
Ecological pyramids illustrate the relationship of trophic levels. Ecological pyramids based on energy flow, biomass, or numbers of organisms are usually upright. Inverted pyramids of biomass or numbers are possible if at least one trophic level has a greater biomass or more organisms than the level below it (see figure 58.13).
58.3 Trophic-Level Interactions Top-down effects occur when changes in the top trophic level affect primary producers. A trophic cascade, or top-down effect, occurs when a change exerted at an upper trophic level affects a lower level (see figure 58.15). Human removal of carnivores produces top-down effects. Removal of carnivores causes an increase in the abundance of species in lower trophic levels, such as an increase in deer populations when wolves or other predators are destroyed. Bottom-up effects occur when changes to primary producers affect higher trophic levels. An increase of producers may lead to the appearance or increase of herbivores; however, further increase in producers may then lead to increase in carnivores, without a comparable increase in herbivores (see figure 58.17).
Species richness is influenced by ecosystem characteristics. Primary production, habitat heterogeneity, and climatic factors all affect the number of species in an ecosystem (see figure 58.20). Tropical regions have the highest diversity, although the reasons are unclear. The higher diversity of tropical regions may reflect long evolutionary time, higher productivity from increased sunlight, less seasonal variation, greater predation that reduces competition, or spatial heterogeneity (see figure 58.21).
58.5 Island Biogeography The species–area relationship reflects that larger islands contain more species than do smaller ones. The equilibrium model proposes that extinction and colonization reach a balance point (see figure 58.22). Smaller islands have fewer species because of higher rates of extinction. Islands near a mainland have more species than distant islands because of higher rates of colonization. An equilibrium is reached when the extinction rate balances the colonization rate. The equilibrium model is still being tested. Long-term studies are needed to clarify all the factors involved.
58.4 Biodiversity and Ecosystem Stability Species richness may increase stability: The Cedar Creek studies. The Cedar Creek studies indicate that higher species richness results in less year-to-year variation in biomass and in greater resistance to drought and invasion by non-native species.
Review Questions U N D E R S TA N D 1. Which of the statements about groundwater is not accurate? a. b. c. d.
In the United States, groundwater provides 50% of the population with drinking water. Groundwaters are being depleted faster than they can be recharged. Groundwaters are becoming increasingly polluted. Removal of pollutants from groundwaters is easily achieved.
2. Photosynthetic organisms a. b. c. d. e.
fix carbon dioxide. release carbon dioxide. fix oxygen. (a) and (b) (a) and (c)
3. Some bacteria have the ability to “fix” nitrogen. This means a. b. c. d. 1228
they convert ammonia into nitrites and nitrates. they convert atmospheric nitrogen gas into biologically useful forms of nitrogen. they break down nitrogen-rich compounds and release ammonium ions. they convert nitrate into nitrogen gas. part
4. Which of the following statements about the phosphorus cycle is correct? a. b. c. d.
Phosphorus is fixed by plants and algae. Most phosphorus released from rocks is carried to the oceans by rivers. Animals cannot get their phosphorus from eating plants and algae. Fertilizer use has not affected the global phosphorus budget.
5. As a general rule, how much energy is lost in the transmission of energy from one trophic level to the one immediately above it? a. b.
1% 10%
c. d.
90% 50%
6. Inverted ecological pyramids of real systems usually involve a. b. c. d.
energy flow. biomass. energy flow and biomass. None of the above
7. Bottom-up effects on trophic structure result from a. b.
a limitation of energy flowing to the next higher trophic level. actions of top predators on lower trophic levels.
VIII Ecology and Behavior
rav32223_ch58_1207-1229.indd 1228
11/20/09 2:22:45 PM
c. d.
climatic disruptions on top consumers. stability of detritivores in ecosystems.
8. Species diversity a. b. c. d.
increases with latitude as you move away from the equator to the arctic. decreases with latitude as you move away from the equator to the arctic. stays the same as you move away from the equator to the arctic. increases with latitude as you move north of the equator and decreases with latitude as you move south of the equator.
9. The equilibrium model of island biogeography suggests all of the following except a. b. c. d.
larger islands have more species than smaller islands. the species richness of an island is determined by colonization and extinction. smaller islands have lower rates of extinction. islands closer to the mainland will have higher colonization rates.
A P P LY 1. Nitrogen is often a limiting nutrient in many ecosystems because a. b. c. d.
there is much less nitrogen in the atmosphere than carbon. elemental nitrogen is very rapidly used by most organisms. nitrogen availability is being reduced by pollution due to fertilizer use. most organisms cannot use nitrogen in its elemental form.
2. Based on results from studies at Hubbard Brook Experimental Forest, what would be the predicted effect of clearing trees from a watershed? a. b. c. d.
4. At Cedar Creek Natural History Area, experimental plots showed reduced numbers of invaders as species diversity of plots increased a. b. c. d.
suggesting that low species diversity increases stability of ecosystems. suggesting that ecosystem stability is a function of primary productivity only. consistent with the theory that intermediate disturbance results in the highest stability. None of the above
SYNTHESIZE 1. Given that ectotherms do not utilize a large fraction of ingested food energy to maintain a high and constant body temperature (generate heat), how would you expect the food chains of systems dominated by ectothermic herbivores and carnivores to compare with systems dominated by endothermic herbivores and carnivores? 2. Given that, in general, energy input is greatest at the bottom trophic level (primary producers) and decreases with increasing transfers across trophic levels, how is it possible for many lakes to show much greater standing biomass in herbivorous zooplankton than in the phytoplankton they consume? 3. Ecologists often worry about the potential effects of the loss of species (e.g., due to pollution, habitat degradation, or other human-induced factors) on an ecosystem for reasons other than just the direct loss of the species. Using figure 58.17 explain why. 4. Explain several detailed ways in which increasing plant structural complexity could lead to greater species richness of lizards (figure 58.20b). Could any of these ideas be tested? How?
Increased loss of water and nutrients from a watershed Decreased loss of water and nutrients from a watershed Increased availability of phosphorus Increased availability of nitrate
3. According to the trophic cascade hypothesis, the removal of carnivores from an ecosystem may result in a. b. c. d.
a decline in the number of herbivores and a decline in the amount of vegetation. a decline in the number of herbivores and an increase in the amount of vegetation. an increase in the number of herbivores and an increase in the amount of vegetation. an increase in the number of herbivores and a decrease in the amount of vegetation.
www.ravenbiology.com
rav32223_ch58_1207-1229.indd 1229
ONLINE RESOURCE www.ravenbiology.com Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more.
chapter
58 Dynamics of Ecosystems
1229
11/20/09 2:22:45 PM
CHAPTER
Chapter
59
The Biosphere Chapter Outline 59.1
Ecosystem Effects of Sun, Wind, and Water
59.2
Earth’s Biomes
59.3
Freshwater Habitats
59.4
Marine Habitats
59.5
Human Impacts on the Biosphere: Pollution and Resource Depletion
59.6
Human Impacts on the Biosphere: Climate Change
T
Introduction
The biosphere includes all living communities on Earth, from the profusion of life in the tropical rain forests to the planktonic communities in the world’s oceans. In a very general sense, the distribution of life on Earth reflects variations in the world’s abiotic environments, such as the variations in temperature and availability of water from one terrestrial environment to another. The figure on this page is a satellite image of the Americas, based on data collected over 8 years. The colors are keyed to the relative abundance of chlorophyll, an indicator of the richness of biological communities. Green and dark green areas on land are areas with high primary productivity (such as thriving forests), whereas yellow areas include the deserts of the Americas and the tundra of the far north, which have lower productivity.
59.1
Ecosystem Effects of Sun, Wind, and Water
Learning Outcomes 1. 2. 3.
Describe changes in wind and current direction with latitude. Explain the Coriolis effect. Describe how temperature changes with altitude and latitude.
rav32223_ch59_1230-1255.indd 1230
The great global patterns of life on Earth are heavily influenced by (1) the amount of solar radiation that reaches different parts of the Earth and seasonal variations in that radiation; and (2) the patterns of global atmospheric circulation and the resulting patterns of oceanic circulation. Local characteristics, such as soil types and the altitude of the land, interact with the global patterns in sunlight, winds, and water currents to determine the conditions under which life exists and thus the distributions of ecosystems.
11/20/09 2:44:13 PM
Sunlight
Vernal equinox (Sun aims directly at equator)
Sunlight
Equator
60
Winter solstice (northern hemisphere tilts away from the Sun)
30
Equ
ator
Equator
30 23.5°
a.
60
60 30
Figure 59.1 Relationships between the Earth and the
The Earth receives energy from the Sun at a high rate in the form of electromagnetic radiation at visible and near-visible wavelengths. Each square meter of the upper atmosphere receives about 1400 joules per second (J/sec), which is equivalent to the output of fourteen 100-watt (W) lightbulbs. As the solar radiant energy passes through the atmosphere, its intensity and wavelength composition are modified. About half of the energy is absorbed within the atmosphere, and half reaches the Earth’s surface. The gases in the atmosphere absorb some wavelengths strongly while allowing other wavelengths to pass freely through. As a result, the wavelength composition of the solar energy that reaches the Earth’s surface is different from that emitted by the Sun. For example, the band of ultraviolet wavelengths known as UV-B is strongly absorbed by ozone (O3) in the atmosphere, and thus this wavelength is greatly reduced in the solar energy that reaches the Earth’s surface.
How solar radiation affects climate Some parts of the Earth’s surface receive more energy from the Sun than others. These differences have a great effect on climate. A major reason for differences in solar radiation from place to place is the fact that Earth is a sphere, or nearly so (figure 59.1a). The tropics are particularly warm because the Sun’s rays arrive almost perpendicular to the surface of the Earth in regions near the equator. Closer to the poles, the angle at which the Sun’s rays strike, called the angle of incidence, spreads the solar energy out over more of the Earth’s surface, providing less energy per unit of surface area. As figure 59.2 shows, the highest annual mean temperatures occur near the equator (0° latitude). The Earth’s annual orbit around the Sun and its daily rotation on its own axis are also important in determining patterns of www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1231
ator
30
30
Summer solstice (northern hemisphere tilts toward the Sun)
60 30
Autumnal equinox (Sun aims directly at equator)
Equ
ator
30
b.
solar radiation and their effects on climate (figure 59.1b). The axis of rotation of the Earth is not perpendicular to the plane in which the earth orbits the Sun. Because the axis is tilted by approximately 23.5°, a progression of seasons occurs on all parts of the Earth, especially at latitudes far from the equator. The northern hemisphere, for example, tilts toward the Sun during some months but away during others, giving rise to summer and winter.
Global circulation patterns in the atmosphere Hot air tends to rise relative to cooler air because the motion of molecules in the air increases as temperature increases, making it less dense. Accordingly, the intense solar heating of the Earth’s
30 Temperature (°C)
Solar energy and the Earth’s rotation affect atmospheric circulation
Equ
ator
Sun are critical in determining the nature and distribution of life on Earth. a. A beam of solar energy striking the Earth in the middle latitudes of the northern hemisphere (or the southern) spreads over a wider area of the Earth’s surface than an equivalent beam striking the Earth at the equator. b. The fact that the Earth orbits the Sun each year has a profound effect on climate. In the northern and southern hemispheres, temperature changes in an annual cycle because the Earth’s axis is not perpendicular to its orbital plane and, consequently, each hemisphere tilts toward the Sun in some months but away from the Sun in others.
30
Sun
Equ
Annual mean
20 10 Variation in monthly means
0 –10
60° N
30°
0°
30°
60° S
Latitude
Figure 59.2 Annual mean temperature varies with latitude. The red line represents the annual mean temperature at various latitudes, ranging from near the North Pole at the left to near Antarctica at the right; the equator is at 0° latitude. At each latitude, the upper edge of the blue zone is the highest mean monthly temperature observed in all the months of the year, and the lower edge is the lowest mean monthly temperature. chapter
59 The Biosphere
1231
11/20/09 2:44:18 PM
surface at equatorial latitudes causes air to rise from the surface to high in the atmosphere at these latitudes. This rising air is typically rich with water vapor; one reason is that the moistureholding capacity of air increases when it is heated, and a second reason is that the intense solar radiation at the equator provides the heat needed for great quantities of water to evaporate. After the warm, moist air rises from the surface (figure 59.3), rising air underneath it is pushed away from the equator at high altitudes (above 10 km), to the north in the northern hemisphere and to the south in the southern hemisphere. To take the place of the rising air, cooler air flows toward the equator along the surface from both the north and the south. These air movements give rise to one of the major features of the global atmospheric circulation: air flows toward the equator in both hemispheres at the surface, rises at the equator, and flows away from the equator at high altitudes. The exact patterns of flow North Pole
60°N
30°N Westerlies
Northeast trades
0°
are affected by the spinning of the Earth on its axis; we discuss this effect shortly. For complex reasons, the air circulating up from the equator and away at high altitudes in both hemispheres tends to circulate back down to the surface of the Earth at about 30° of latitude, both north and south (see figure 59.3). During the course of this movement, the moisture content of the air changes radically because of the changes in temperature the air undergoes. Cooling dramatically decreases air’s ability to hold water vapor. Consequently, much of the water vapor in the air rising from the equator condenses to form clouds and rain as the air moves upward. This rain falls in the latitudes near the equator, latitudes that experience the greatest precipitation on Earth. By the time the air starts to descend back to the Earth’s surface at latitudes near 30°, it is cold and thus has lost most of its water vapor. Although the air rewarms as it descends, it does not gain much water vapor on the way down. Many of the greatest deserts occur at latitudes near 30° because of the steady descent of dry air to the surface at those latitudes. The Sahara Desert is the most dramatic example. The air that descends at latitudes near 30° flows only partly toward the equator after reaching the surface of the Earth. Some of it flows toward the poles, helping to give rise in each hemisphere to winds that blow over the Earth’s surface from 30° toward 60° latitude. At latitudes near 60° air tends to rise from the surface toward high altitudes.
?
Inquiry question Why is it hotter at latitudes near 0°?
Equatorial
The Coriolis effect 30°S Southeast trades Westerlies 60°S low precipitation high precipitation
Figure 59.3 Global patterns of atmospheric circulation. The diagram shows the patterns of air circulation that prevail on average over weeks and months of time (on any one day the patterns might be dramatically different from these average patterns). Rising air that is cooled creates bands of relatively high precipitation near the equator and at latitudes near 60°N and 60°S. Air that has lost most of its moisture at high altitudes tends to descend to the surface of the Earth at latitudes near 30°N and 30°S, creating bands of relatively low precipitation. The red arrows show the winds blowing at the surface of the Earth; the blue arrows show the direction the winds blow at high altitude. The winds travel in curved paths relative to the Earth’s surface because the Earth is rotating on its axis under them (the Coriolis effect). A terminological problem to recognize is that the formal names given to winds refer to the directions from which they come, rather than the directions toward which they go; thus, the winds between 30° and 60° are called Westerlies because they come out of the west. Unfortunately, oceanographers use the opposite approach, naming water currents for the directions in which they go. 1232
part
If Earth did not rotate on its axis, global air movements would follow the simple patterns already described. Air currents—the winds—move across a rotating surface, however. Because the solid Earth rotates under the winds, the winds move in curved paths across the surface, rather than straight paths. The curvature of the paths of the winds due to Earth’s rotation is termed the Coriolis effect, after the 19th-century French mathematician, Gaspard-Gustave Coriolis, who described it. If you were standing on the North Pole, the Earth would appear to be rotating counterclockwise on its axis, but if you were at the South Pole, the Earth would appear to be rotating clockwise. This property of a rotating sphere, that its direction of rotation is opposite when viewed from its two poles, explains why the direction of the Coriolis effect is opposite in the two hemispheres. In the northern hemisphere, winds always curve to the right of their direction of motion; in the southern hemisphere, they always curve to the left. The reason for these wind patterns is that the circumference of a sphere, the Earth, changes with latitude. It is zero at the poles and 38,000 km at the equator. Thus, land surface speed changes from about 0 to 1500 km per hour going from the poles to the equator. Air descending at 30° north latitude may be going roughly the same speed as the land surface below it. As it moves toward the equator, however, it is moving more slowly than the surface below it, so it is deflected to its right in the northern hemisphere and to its left in the southern hemisphere. In other words, in both the northern and southern
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1232
11/20/09 2:44:18 PM
hemispheres, the winds blow westward as well as toward the equator. The result (see figure 59.3) is that winds on both sides of the equator—called the Trade Winds—blow out of the east and toward the west. Conversely, air masses moving north from 30° are moving more rapidly than underlying land surfaces and thus are deflected again to their right, which in this case is eastward. Similarly, in the southern hemisphere, air masses between 30° and 60° are deflected eastward, to the left. In both hemispheres, therefore, winds between 30° and 60° blow out of the west and toward the east; these winds are called Westerlies.
turning from Europe and Africa to North America at latitudes near the equator. Water currents are affected by the Coriolis effect. Thus, the Coriolis effect contributes to this clockwise closed-curve motion. Water flowing across the Atlantic toward Europe at midlatitudes tends to curve to the right and enters the flow from east to west near the equator. This latter flow also tends to curve to its right and enters the flow from west to east at midlatitudes. In the south Atlantic Ocean, the same processes occur in a sort of mirror image, and similar clockwise and counterclockwise gyres occur in the north and south Pacific Ocean as well.
Global currents are largely driven by winds
Regional and local differences affect terrestrial ecosystems
The major ocean currents are driven by the winds at the surface of the Earth, which means that indirectly the currents are driven by solar energy. The radiant input of heat from the Sun sets the atmosphere in motion as already described, and then the winds set the ocean in motion. In the north Atlantic Ocean (figure 59.4), the global winds follow this pattern: Surface winds tend to blow out of the east and toward the west near the equator, but out of the west and toward the east at midlatitudes (between 30° and 60°). Consequently, surface waters of the north Atlantic Ocean tend to move in a giant closed curve—called a gyre—flowing from North America toward Europe at midlatitudes, then re-
The environmental conditions at a particular place are affected by regional and local effects of solar radiation, air circulation, and water circulation, not just the global patterns of these processes. In this section we look at just a few examples of regional and local effects, focusing on terrestrial systems. These include rain shadows, monsoon winds, elevation, and presence of microclimate factors.
Rain shadows
La
en t
Deserts on land sometimes occur because mountain ranges intercept moisture-laden winds from the sea. When air flowing
North America
lf Gu
rr cu
Europe Asia
eam Str
n gy tic re
rrent shio cu Kuro
or ad br
North Atla l subtropica
subtropical gyre acific North P
Africa
N. Equatorial current
oldt current
re
gy
al
Equator
ti c lan A t al gy c
Australia
re
ic South P acific subtrop
Hu mb
ua Eq S.
South America
l current toria
S sub outh tro pi
Equatorial countercurrent
rctic Anta
circum
urrent polar c
Antarctica
cold water current warm water current
Figure 59.4 Ocean circulation. In the centers of several of the great ocean basins, surface water moves in great closed-curve patterns called gyres. These water movements affect biological productivity in the oceans and sometimes profoundly affect the climate on adjacent landmasses, as when the Gulf Stream brings warm water to the region of the British Isles. www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1233
chapter
59 The Biosphere
1233
11/20/09 2:44:21 PM
n ectio Wind dir
but during winter the landmass cools more than the oceans. The consequence is that winds tend to blow off the water into the interior of the Asian continent in summer, particularly in the region of the Indian Ocean and western tropical Pacific Ocean. These winds reverse to flow off the continent out over the oceans in winter. These seasonally shifting winds are called the monsoons. They affect rainfall patterns, and their duration and strength can spell the difference between food sufficiency and starvation for hundreds of millions of people in the region each year. Rain shadow
Moist
Pacific Ocean
Sierra Nevada
Elevation Arid desert
Another significant regional pattern is that in mountainous regions, temperature and other conditions change with elevation. At any given latitude, air temperature falls about 6°C for every 1000-m increase in elevation. The ecological consequences of the change of temperature with elevation are similar to those of the change of temperature with latitude (figure 59.6).
Figure 59.5 The rain shadow effect exemplified in Elevation
California. Moisture-laden winds from the Pacific Ocean rise and are cooled when they encounter the Sierra Nevada Mountains. As the moisture-holding capacity of the air decreases at colder, higher altitudes, precipitation occurs, making the seaward-facing slopes of the mountains moist; tall forests occur on those slopes, including forests that contain the famous giant sequoias (Sequoiadendron giganteum). As the air descends on the eastern side of the mountain range, its moisture-holding capacity increases again, and the air picks up moisture from its surroundings. As a result, the eastern slopes of the mountains are arid, and rain shadow deserts sometimes occur.
landward from the oceans encounters a mountain range (figure 59.5), the air rises, and its moisture-holding capacity decreases because it becomes cooler at higher altitude, causing precipitation to fall on the mountain slopes facing the sea. As the air—stripped of much of its moisture—then descends on the other side of the mountain range, it remains dry even as it is warmed, and as it is warmed its moisture-holding capacity increases, meaning it can readily take up moisture from soils and plants. One consequence is that the two slopes of a mountain range often differ dramatically in how moist they are; in California, for example, the eastern slopes of the Sierra Nevada Mountains—facing away from the Pacific Ocean— are far drier than the western slopes. Another consequence is that a desert may develop on the dry side, the Mojave Desert being an example. The mountains are said to produce a rain shadow.
Monsoons The continent of Asia is so huge that heating and cooling of its surface during the passage of the seasons causes massive regional shifts in wind patterns. During summer, the surface of the Asian landmass heats up more than the surrounding oceans, 1234
part
3500 m Polar ice
Tundra Taiga Elevation Temperate forest
Tropical rain forest Sea level
Latitude 90°
Latitude Equator 0°
90°N Polar ice Tundra Taiga Temperate forest Tropical rain forest
Equator 0°
90°S
Figure 59.6 Elevation affects the distribution of biomes in much the same manner as latitude does. Biomes that normally occur far north of the equator at sea level also occur in the tropics at high mountain elevations. Thus, on a tall mountain in the tropics, one might see a sequence of biomes like the one illustrated above. In North America, a 1000-m increase in elevation results in a temperature drop equal to that of an 880-km increase in latitude.
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1234
11/20/09 2:44:22 PM
Microclimates Conditions also vary in significant ways on very small spatial scales. For example, in a forest, a bird sitting in an open patch may experience intense solar radiation, a high air temperature, and a low humidity, even while a mouse hiding under a log 10 feet away may experience shade, a cool temperature, and air saturated with water vapor. Such highly localized sets of climatic conditions are called microclimates. In some cases, species avoid competing by adapting to use different microclimates. Sympatric salamanders, for example, may be specialized for the different levels of moisture found in different parts of the habitat.
Learning Outcomes Review 59.1 More intense solar heating of some global regions relative to others sets up global patterns of atmospheric circulation, which in turn cause global patterns of water circulation in the oceans. The Coriolis effect is caused by the Earth’s spin beneath the moving air masses of the atmosphere. These patterns—plus seasonal changes—strongly affect the conditions that exist for living organisms in different parts of the world. In general, temperature declines as altitude or latitude increases. ■
How would global air movement patterns be different if the Earth turned in the opposite direction?
59.2
Earth’s Biomes
Learning Outcomes 1. 2.
Define biome. Explain the primary factors that determine which type of biome is found in a particular place.
Biomes are major types of ecosystems on land. Each biome has a characteristic appearance and is distributed over wide areas of land defined largely by sets of regional climatic conditions. Biomes are named according to their vegetational structures, but they also include the animals that are present. As you might imagine from the broad definition given for biomes, there are a number of ways to classify terrestrial ecosystems into biomes. Here we recognize eight principal biomes: (1) tropical rain forest, (2) savanna, (3) desert, (4) temperate grassland, (5) temperate deciduous forest, (6) temperate evergreen forest, (7) taiga, (8) tundra. Six additional biomes recognized by some ecologists are: polar ice, mountain zone, chaparral, warm moist evergreen forest, tropical monsoon forest, and semidesert. Other ecologists lump these six with the eight major ones. Figure 59.7 shows the distributions of all 14 biomes.
polar ice
mountain zone
warm, moist evergreen forest
chaparral
semidesert
tundra
temperate deciduous forest
tropical monsoon forest
temperate grassland
desert
taiga
temperate evergreen forest
tropical rain forest
savanna
Figure 59.7 The distributions of biomes. Each biome is similar in vegetational structure and appearance wherever it occurs. www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1235
chapter
59 The Biosphere
1235
11/20/09 2:44:25 PM
30 Hot desert
Tropical rain forest
Savanna
20 Temperate grassland
15 10 5
Semidesert
Mean Annual Temperature ( ⬚C)
25
0
Temperate evergreen forest
Temperate deciduous forest
Taiga
–5 –10
Tundra
–15 50
100
150
200
250
300
350
400
450
Mean Annual Precipitation (cm)
Figure 59.8 Predictors of biome distribution. Temperature and precipitation are quite useful predictors of biome distribution, although other factors sometimes also play critical roles.
In determining which biomes are found where, two key environmental factors are temperature and moisture. As seen in figure 59.8, if you know the mean annual temperature and mean annual precipitation in a terrestrial region, you often can predict the biome that dominates. Temperature and moisture affect ecosystems in a number of ways. One reason they are so influential is that primary productivity is strongly correlated with them, as described in the preceding chapter (figure 59.9). Different places that are similar in mean annual temperature and precipitation sometimes support different biomes, indicating that temperature and moisture are not the only factors that can be important. Soil structure and mineral composition (see chapter 39) are among the other factors that can be influential. The biome that is present may also depend on whether the conditions of temperature and precipitation are strongly seasonal or relatively constant.
Tropical rain forests are highly productive equatorial systems Tropical rain forests, which typically require 140 to 450 cm of rain per year, are the richest ecosystems on land (figure 59.10). 1236
part
2500 2000 1500 1000 500 0
50
100
200 300 Precipitation (cm/year)
400
a. Productivity (g/m2/year)
Temperature and moisture often determine biomes
Productivity (g/m2/year)
Biomes are defined by their characteristic vegetational structures and associated climatic conditions, rather than by the presence of particular plant species. Two regions assigned to the same biome thus may differ in the species that dominate the landscape. Tropical rain forests around the world, for example, are all composed of tall, lushly vegetated trees, but the tree species that dominate a South American tropical rain forest are different from those in an Indonesian one. The similarity between such forests results from convergent evolution (see chapter 21).
2500 2000 1500 1000 500 0 –10
–5
0
5 10 15 Temperature (⬚C)
20
25
30
b.
Figure 59.9 The correlations of primary productivity with precipitation and temperature. The net primary productivity of ecosystems at 52 locations around the globe correlates significantly with (a) mean annual precipitation and (b) mean annual temperature.
?
Inquiry question Why might you expect primary productivity to increase with increasing precipitation and temperature?
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1236
11/20/09 2:44:28 PM
Figure 59.10 Tropical rainforest.
They are very productive because they enjoy the advantages of both high temperature and high precipitation (see figure 59.9). They also exhibit very high biodiversity, being home to at least half of all the species of terrestrial plants and animals—over 2 million species! In a single square mile of Brazilian rain forest, there can be 1200 species of butterflies—twice the number found in all of North America. Tropical rain forests recycle nutrients rapidly, so their soils often lack great reservoirs of nutrients.
Savannas are tropical grasslands with seasonal rainfall The savannas are tropical or subtropical grasslands, often dotted with widely spaced trees or shrubs. On a global scale, savannas often occur as transition ecosystems between tropical rain forests and deserts; they are characteristic of warm places where annual rainfall (50–125 cm) is too little to support rain forest, but not so little as to produce desert conditions. Rainfall is often highly seasonal in savannas. The Serengeti ecosystem in East Africa is probably the world’s most famous example of the savanna biome. In most of the Serengeti, no rain falls for many months of the year, but during other months rain is abundant. The huge herds of grazing animals in the ecosystem respond to the seasonality of the rain; a number of species migrate away from permanently flowing rivers only during the months when rain falls.
Deserts are regions with little rainfall Deserts are dry places where rain is both sparse (annual rainfall often less than 25–40 cm) and unpredictable. The unpredictability means that plants and animals cannot depend on experiwww.ravenbiology.com
rav32223_ch59_1230-1255.indd 1237
encing rain even once each year. As mentioned earlier, many of the largest deserts occur at latitudes near 30°N and 30°S because of global air circulation patterns (see figure 59.3). Other deserts result from rain shadows (see figure 59.5). Vegetation is sparse in deserts, and survival of both plants and animals depends on water conservation. Many desert organisms enter inactive stages during rainless periods. To avoid extreme temperatures, small desert vertebrates often live in deep, cool, and sometimes even somewhat moist burrows. Some emerge only at night. Among large desert animals, camels drink large quantities of water when it is available and then conserve it so well that they can survive for weeks without drinking. Oryxes (large, desert-dwelling antelopes) survive opportunistically on moisture in leaves or roots that they dig up, as well as drinking water when possible.
Temperate grasslands have rich soils Halfway between the equator and the poles are temperate regions where rich temperate grasslands grow. These grasslands, also called prairies, once covered much of the interior of North America, and they were widespread in Eurasia and South America as well. The roots of perennial grasses characteristically penetrate far into the soil, and grassland soils tend to be deep and fertile. Temperate grasslands are often highly productive when converted to agricultural use, and vast areas have been transformed in this way. In North America prior to this change in land use, huge herds of bison and pronghorn antelope inhabited the temperate grasslands, migrating seasonally as resources changed over the course of the year. Natural temperate grasslands are one of the biomes adapted to periodic fire and therefore need fires to prosper. chapter
59 The Biosphere
1237
11/20/09 2:44:28 PM
Temperate deciduous forests are adapted to seasonal change Mild but seasonal climates (warm summers and cold winters), plus plentiful rains, promote the growth of temperate deciduous forests in the eastern United States, eastern Canada, and Eurasia (figure 59.11). A deciduous tree is one that drops its leaves in the winter. Deer, bears, beavers, and raccoons are familiar animals of these forests.
Temperate evergreen forests are coastal Temperate evergreen forests occur along coastlines with temperate climates, such as in the northwest of the United States. The dominant vegetation includes trees, such as spruces, pines, and redwoods, that do not drop their leaves (thus, they are ever green).
Taiga is the northern forest where winters are harsh Taiga and tundra (described next) differ from other biomes in that both stretch in great unbroken circles around the entire globe (see figure 58.7). The taiga consists of a great band of northern forest dominated by coniferous trees (spruce, hemlock, and fir) that retain their needle-like leaves all year long.
The taiga is one of the largest biomes on Earth. The winters where taiga occurs are severely long and cold, and most of the limited precipitation falls in the summer. Many large herbivores, including elk, moose, and deer, plus carnivores such as wolves, bears, lynx, and wolverines, are characteristic of the taiga.
Tundra is a largely frozen treeless area with a short growing season In the far north, at latitudes above the taiga but south of the polar ice, few trees grow. The landscape that occurs in this band, called tundra, is open, windswept, and often boggy. This enormous biome covers one-fifth of the Earth’s land surface. Little rain or snow falls. Permafrost—soil ice that persists throughout all seasons—usually exists within a meter of the ground surface. What trees can be found are small and mostly confined to the margins of streams and lakes. Large grazing mammals, including musk-oxen and reindeer (caribou), and carnivores such as wolves, foxes, and lynx, live in the tundra. Populations of lemmings (a small rodent native to the Arctic) rise and fall dramatically, with important consequences for the animals that prey on them.
Learning Outcomes Review 59.2 Major types of ecosystems called biomes can be distinguished in different climatic regions on land. These biomes are much the same wherever they are found on the Earth. Annual mean temperature and precipitation are effective predictors of biome type; however, the range of seasonal variation and the soil characteristics of a region also come into play. ■
Why do different biomes occur at different latitudes?
59.3
Freshwater Habitats
Learning Outcomes 1. 2. 3.
Figure 59.11 Temperate deciduous forest. 1238
part
Define photic zone. Explain what causes spring and fall overturns in lakes. Distinguish between eutrophic and oligotrophic lakes.
Of the major habitats, fresh water covers by far the smallest percentage of the Earth’s surface: Only 2%, compared with 27% for land and 71% for ocean. The formation of fresh water starts with the evaporation of water into the atmosphere, which removes most dissolved constituents, much like distillation does. When water falls back to the Earth’s surface as rain or snow, it arrives in an almost pure state, although it may have picked up biologically significant dissolved or particulate matter from the atmosphere. Freshwater wetlands—marshes, swamps, and bogs—represent intermediate habitats between the freshwater and terrestrial realms. Wetlands are highly productive (see figure 58.11).
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1238
11/20/09 2:44:31 PM
They also play key additional roles, such as acting as water storage basins that moderate flooding. Primary production in freshwater bodies is carried out by single-celled algae (phytoplankton) floating in the water, by algae growing as films on the bottom, and by rooted plants such as water lilies. In addition, a considerable amount of organic matter—such as dead leaves—enters some bodies of fresh water from plant communities growing on the land nearby.
Lake Zones and Productivity
Littoral zone
Life in freshwater habitats depends on oxygen availability The concentration of dissolved oxygen (O2) is a major determinant of the properties of freshwater communities. Oxygen dissolves in water just like sugar or salt does. Fish and other aquatic organisms obtain the oxygen they need by taking it up from solution. The solubility of oxygen is therefore critically important. In reality, oxygen is not very soluble in water. Consequently, even when fresh water is fully aerated and at equilibrium with the atmosphere, the amount of oxygen it contains per liter is only 5%, or less, of that in air. This means that, in terms of acquiring the oxygen they need, freshwater organisms have a far smaller margin of safety than air-breathing ones. Oxygen is constantly added to and removed from any body of fresh water. Oxygen is added by photosynthesis and by aeration from the atmosphere, and it is removed by animals and other heterotrophs. If a lot of decaying organic matter is present in a body of water, the oxygen demand of the decay microbes can be high and affect other life forms. Under conditions in which the rate of oxygen removal from water exceeds the rate of addition, the concentration of dissolved oxygen can fall so low that many aquatic animals cannot survive in it.
Lake and pond habitats change with water depth Bodies of relatively still fresh water are called lakes if large and ponds if small. Water absorbs light passing through it, and the intensity of sunlight available for photosynthesis decreases sharply with increasing depth. In deep lakes, only water relatively near the surface receives enough light for phytoplankton to exhibit a positive net primary productivity (figure 59.12). Those waters are described as the photic zone.
The photic zone The thickness of the photic zone depends on how much particulate matter is in the water. Water that is relatively free of particulate matter and clear allows light to penetrate to a depth of 10 m at sufficient intensity to support phytoplankton. Water that is thick with surface algal cells or soil from erosion may not allow light to penetrate very far before its intensity becomes too diminished for algal growth. The supply of dissolved oxygen to the deep waters of a lake can be a problem because all oxygen enters any aquatic system near its surface. In the still waters of a lake, mixing between the surface and deeper layers may not occur except occasionally. When photosynthesis produces oxygen, it adds it to the photic zone of the lake near the surface. Thermal stratificawww.ravenbiology.com
rav32223_ch59_1230-1255.indd 1239
Photic zone Productivity Aphotic zone
Figure 59.12 Light in a lake. The intensity of the sunlight available for photosynthesis decreases with depth in a lake. Consequently, only some of the upper waters—termed the photic zone—receive sufficient light for the net primary productivity of phytoplankton to be positive. The depth of the photic zone depends on how cloudy the water is. The shallows at the edge of a lake are called the littoral zone. They are well-illuminated to the bottom, so rooted plants and bottom algae can thrive there.
tion commonly affects how readily oxygen enters the deep waters from the surface waters.
Thermal stratification Thermal stratification is characteristic of many lakes and large ponds. In summer, as shown at the bottom of figure 59.13, water warmed by the Sun forms a layer known as the epilimnion at the surface—because warm water is less dense than cold water and tends to float on top. Colder, denser water, called the hypolimnion, lies below. Between the warm and cold layers is a transitional layer, the thermocline. Although here we are focusing on fresh water, a similar thermal structuring of the water column occurs also in many parts of the ocean. In a lake, thermal stratification tends to cut off the oxygen supply to the bottom waters; a consequence of the stratification is that the upper waters that receive oxygen do not mix with the bottom waters. The concentration of oxygen at the bottom may then gradually decline over time as the organisms living there use oxygen faster than it is replaced. If the rate of oxygen use is high, the bottom waters may run out of oxygen and become oxygen-free before summer is over. Oxygen-free conditions, if they occur, kill most (although not all) animals. In autumn, the temperature of the upper waters in a stratified lake drops until it is about the same as the temperature of the deep waters. The densities of the two water layers become similar, and the tendency for them to stay apart is weakened. chapter
59 The Biosphere
1239
11/20/09 2:44:37 PM
Winter
0° 2° 4° 4° 4° 4° 4°
Fall Overturn
Spring Overturn
4° 4° 4° 4° 4° 4° 4°
4° 4° 4° 4° 4° 4° 4°
Winds can then force the layers to mix, a phenomenon called the fall overturn (see figure 59.13). High oxygen concentrations are then restored in the bottom waters. Chapter 2 discussed the unique properties of water. Fresh water is densest when its temperature is 4°C, and ice, at 0°, floats on top of this dense water. As a lake is cooled toward the freezing point with the onset of winter, the whole lake first reaches 4°C. Then, some water cools to an even lower temperature, and when it does, it becomes less dense and rises to the top. Further cooling of this surface water causes it to freeze into a layer of ice covering the lake. In spring, the ice melts, the surface water warms up, and again winds are able to mix the whole lake—the spring overturn. Because temperature changes less over the course of the year in the tropics, many lakes there do not experience turnover. As a result, tropical lakes can have a permanent thermocline with depletion of oxygen near the bottom.
Lakes differ in oxygen and nutrient content Midsummer
22° 20° 18° 8° 6° 5° 4°
Epilimnion Thermocline Hypolimnion
Figure 59.13 The annual cycle of thermal stratification in a temperate-zone lake. During the summer (lower diagram), water warmed by the Sun (the epilimnion) floats on top of colder, denser water (the hypolimnion). The lake is also thermally stratified in winter (upper diagram) when water that is near freezing or frozen floats on top of water that is at 4°C (the temperature of greatest density for fresh water). Stratification is disrupted in the spring and fall overturns, when the lake is at an approximately uniform temperature and winds mix it from top to bottom.
Bodies of fresh water that are low in algal nutrients (such as nitrate or phosphate) and low in the amount of algal material per unit of volume are termed oligotrophic. Such waters are often crystal clear. Oligotrophic streams and rivers tend to be high in dissolved oxygen because the movement of the flowing water aerates them; the small amount of organic matter in the water means that oxygen is used at a relatively low rate. Similarly, oligotrophic lakes and ponds tend to be high in dissolved oxygen at all depths all year because they also have a low rate of oxygen use. Because the water is relatively clear, light can penetrate the waters readily, allowing photosynthesis to occur through much of the water column, from top to bottom (figure 59.14). Eutrophic bodies of water are high in algal nutrients and often populated densely with algae. They are more likely to be low in dissolved oxygen, especially in summer. In a eutrophic body of water, decay microbes often place high demands on the
Oligotrophic Lake
a.
Eutrophic Lake
b.
Figure 59.14 Oligotrophic and eutrophic lakes. a. Oligotrophic lakes are low in algal nutrients, have high levels of dissolved oxygen, and are clear. b. Eutrophic lakes have high levels of algal nutrients and low levels of dissolved oxygen. Light does not penetrate deeply in such lakes. 1240
part
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1240
11/20/09 2:44:38 PM
oxygen available because when thick populations of algae die, large amounts of organic matter are made available for decomposition. Moreover, light does not penetrate eutrophic waters well because of all the organic matter in the water; photosynthetic oxygen addition is therefore limited to just a relatively thin layer of water at the top. Human activities have often transformed oligotrophic lakes into eutrophic ones. For example, when people overfertilize their lawns or fields, nitrate and phosphate from the fertilizers wash off into local water systems. Lakes that receive these nutrients become more eutrophic. A consequence is that the bottom waters are more likely to become oxygen-free during the summer. Many species of fish that are characteristic of oligotrophic lakes, such as trout, are very sensitive to oxygen deprivation. When lakes become eutrophic, these species of fish disappear and are replaced with species like carp that can better tolerate low oxygen concentrations. Lakes can return toward an oligotrophic state over time if steps are taken to eliminate the addition of excess nitrates, phosphates, and foreign organic matter such as sewage.
Learning Outcomes Review 59.3 The photic zone is the layer near the surface into which light penetrates. Photosynthesis can occur only in the photic zone. Thermal stratification is a major determinant of oxygen levels. In temperate lakes, mixing of different layers occurs when the layers reach the same temperature in spring and fall, and winds can cause the layers to mix. This overturn prevents oxygen depletion near the lake bottom. Eutrophic lakes are high in nutrients for algae but are low in dissolved oxygen; oligotrophic lakes are low in nutrients but high in dissolved oxygen at all depths. ■
Why do tropical lakes often not experience seasonal turnover, and what effect is this likely to have on the ecosystems of these lakes?
59.4
Marine Habitats
Learning Outcomes 1. 2.
Know the different marine habitats. Explain why El Niño events occur.
About 71% of the Earth’s surface is covered by ocean. Near the coastlines of the continents are the continental shelves, where the water is not especially deep (figure 59.15); the shelves, in essence, represent the submerged edges of the continents. Worldwide, the shelves average about 80 km wide, and the depth of the water over them increases from 1 m to about 130 m as one travels from the coast toward the open ocean. Beyond the continental shelves, the depth suddenly becomes much greater. The average depth of the open ocean is 4000 to 5000 m, and some parts—called trenches—are far deeper, reaching 11,000 m in the Marianas Trench in the western Pacific Ocean. www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1241
Intertidal region Neritic zone
Continental shelf Photic zone
Benthic zone
Pelagic zone
Figure 59.15 Basic concepts and terminology used in describing marine ecosystems. The continental shelf is the submerged edge of the continent. The waters over it are termed neritic and, on a worldwide average basis, are only 130 m deep at their deepest. The region where the tides rise and fall along the shoreline is called the intertidal region. The bottom is called the benthic zone, whereas the water column in the open ocean is called the pelagic zone. The photic zone is the part of the pelagic zone in which enough light penetrates for the phytoplankton to have a positive net primary productivity. The vertical scale of this drawing is highly compressed; whereas the outer edge of the continental shelf is 130 m deep, the open ocean in fact averages 35 times deeper (4000–5000 m deep).
In most of the ocean, the principal primary producers are phytoplankton floating in the well-lit surface waters. A revolution is currently underway in scientific understanding of the limiting nutrients for ocean phytoplankton (see chapter 58). Primary production by the phytoplankton is presently understood to be nitrogen-limited in about twothirds of the world’s ocean, but iron-limited in about onethird. The principal known iron-limited areas are the great Southern Ocean surrounding Antarctica, parts of the equatorial Pacific Ocean, and parts of the subarctic, northeast Pacific Ocean. Where the water is shallow along coastlines, primary production is carried out not just by phytoplankton but also by rooted plants such as seagrasses and by bottomdwelling algae, including seaweeds. The world’s ocean is so vast that it includes many different types of ecosystems. Some, such as coral reefs and estuaries, are high in their net primary productivity per unit of area (see figure 58.11), but others are low in productivity per unit area. Ocean ecosystems are of four major types: open oceans, continental shelf ecosystems, upwelling regions, and deep sea. chapter
59 The Biosphere
1241
11/20/09 2:44:41 PM
Open oceans have low primary productivity In speaking of the open oceans, we mean the waters far from land (beyond the continental shelves) that are near enough to the surface to receive sunlight or to interact on a daily or weekly basis with those waters. We will discuss the deep sea separately later on. The intensity of solar illumination in the open oceans drops from being high at the surface to being essentially zero at 200 m of depth; photosynthesis is limited to this level of the ocean. However, nutrients for phytoplankton, such as nitrate, tend to be present at low concentrations in the photic zone because over eons of time in the past, ecological processes have exported nitrate and other nutrients from the upper waters to the deep waters, and no vigorous forces exist in the open ocean to return the nutrients to the sunlit waters. Because of the low concentrations of nutrients in the photic zone, large parts of the open oceans are low in primary productivity per unit area (see figure 58.11) and aptly called a “biological desert.” These parts—which correspond to the centers of the great midocean gyres (see figure 59.4)—are often collectively termed the oligotrophic ocean (figure 59.16) in reference to their low nutrient levels and low productivity. People fish the open oceans today for only a few species, such as tunas and some species of squids and whales. Fishing in the open oceans is limited to relatively few species for two reasons. First, because of the low primary productivity per unit of area, animals tend to be thinly distributed in the open oceans. The only ones that are commercially profitable to catch are
those that are individually large or tend to gather together in tight schools. Second, costs for travelling far from land are high. All authorities agree that as we turn to the sea to help feed the burgeoning human population, we cannot expect the open ocean regions to supply great quantities of food.
Continental shelf ecosystems provide abundant resources Many of the ecosystems on the continental shelves are relatively high in productivity per unit area. An important reason is that the waters over the shelves—termed the neritic waters (see figure 59.15)—tend to have relatively high concentrations of nitrate and other nutrients, averaged over the year. Because the waters over the shelves are shallow, they have not been subject, over the eons of time, to the loss of nutrients into the deep sea, as the open oceans have. Over the shelves, nutrient-rich materials that sink hit the shallow bottom, and the nutrients they contain are stirred back into the water column by stormy weather. In addition, nutrients are continually replenished by run-off from nearby land. Around 99% of the food people harvest from the ocean comes from continental shelf ecosystems or nearby upwelling regions. The shelf ecosystems are also particularly important to humankind in other ways. Mineral resources taken from the ocean, such as petroleum, come almost exclusively from the shelves. In addition, almost all recreational uses of the ocean, from sailing to scuba diving, take place on the shelves. The
Figure 59.16 Major functional regions of the ocean. The regions classed as oligotrophic ocean (colored dark blue) are “biological deserts” with low productivity per unit area. Continental shelf ecosystems (green at the edge of continents) are typically medium to high in productivity. Upwelling regions (yellow at the edge of continents) are the highest in productivity per unit area and rank with the most productive of all ecosystems on Earth. 1242
part
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1242
11/20/09 2:44:43 PM
shelves feature prominently in these ways because they are close to coastlines and relatively shallow.
Estuaries Estuaries are one of the types of shelf ecosystems. An estuary is a place along a coastline, such as a bay, that is partially surrounded by land and in which fresh water from streams or rivers mixes with ocean water, creating intermediate (brackish) salinities. Estuaries, besides being bodies of water, include intertidal marshes or swamps. An intertidal habitat is an area that is exposed to air at low tide but under water at high tide. The marshes of the intertidal zone are called salt marshes. Intertidal swamps called mangrove swamps (dominated by trees and bushes) occur in tropical and subtropical parts of the world. Estuaries are a vital and highly productive ecosystem— they provide shelter and food for many aquatic animals, especially the larvae and young, that people harvest for food. Estuaries are also important to a very large number of other animal species, such as migrating birds.
Banks and coral reefs Other types of shelf ecosystems include banks and coral reefs. Banks are local shallow areas on the shelves, often extremely important as fishing grounds; Georges Bank, 100 km off the shore of Massachusetts, was formerly one of the most productive and famous; much of this area has been closed to fishing since the mid-1990s because of overexploitation. Coral reef ecosystems occur in subtropical and tropical latitudes. Their defining feature is that in them, stony corals— corals that secrete a solid, calcified type of skeleton—build three-dimensional frameworks that form a unique habitat in which many other distinctive organisms live, including reef fish and soft corals (figure 59.17).
Figure 59.17 A coral reef ecosystem. Reef-building corals, which consist of symbioses between cnidarians and algae, construct the three-dimensional structure of the reef and carry out considerable primary production. Fish and many other kinds of animals fi nd food and shelter, making these ecosystems among the most diverse. About 20% of all fish species occur specifically in coral reef ecosystems. www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1243
All the 700 or so species of reef-building corals are animal–algal symbioses; the animals are cnidarians, and dinoflagellate symbionts live within the cells of their inner cell layer (the gastrodermis). These corals depend on photosynthesis by the algal symbionts, and thus require clear waters through which sunlight can readily penetrate. Reef-building corals are threatened worldwide, as described later in this chapter.
Upwelling regions experience mixing of nutrients and oxygen The upwelling regions of the ocean are localized places where deep water is drawn consistently to the surface because of the action of local forces such as local winds. The deep water is often rich in nitrate and other nutrients. Upwelling therefore steadily brings nutrients into the well-lit surface layers. Phytoplankton respond to the abundance of nutrients and light with prolific growth and reproduction. Upwelling regions have the highest primary productivity per unit area in the world’s ocean. The most famous upwelling region (see figure 59.16) is found along the coast of Peru and Ecuador, where upwelling occurs year-round. Another important upwelling region is the coastline of California, along which upwelling occurs during about half the year in the summer, explaining why swimmers find cold water at the beaches even in July and August. Upwelling regions support prolific but vulnerable fisheries. Sardine fishing in the California upwelling region crashed a few decades ago, but previously was enormously important to the region, as Nobel Prize–winning author John Steinbeck chronicled in a number of his books, most notably Cannery Row.
El Niño Southern Oscillation (ENSO) The phenomenon named El Niño first came to the attention of science in studies of the Peru–Ecuador upwelling region. In that region, every 2 to 7 years on an irregular and relatively unpredictable basis, the water along the coastline becomes profoundly warm, and simultaneously the primary productivity becomes unusually low. Because of the low primary productivity, the ordinarily prolific fish populations weaken, and populations of seabirds and sea mammals that depend on the fish are stressed or plummet. The local people had named a mild annual warming event, which occurred around Christmas each year, “El Niño” (literally, “the child,” after the Christ Child). Scientists adopted the term El Niño Southern Oscillation (ENSO) to refer to those dramatic warming events. The immediate cause of El Niño took several decades to figure out, but research ultimately showed that the cause is a weakening of the east-to-west Trade Winds in the region. The Trade Winds ordinarily blow warm surface water to the west, away from the Peru–Ecuador coast. This thins the warm surface layer of water along the coast, so that deep water—cold but highly rich in nutrients—is drawn to the surface, leading to high primary production. Weakening of the Trade Winds allows the warm surface layer to become thicker. Upwelling continues, but under such circumstances it merely recirculates the thick warm surface layer, which is nutrient-depleted. chapter
59 The Biosphere
1243
11/20/09 2:44:46 PM
After these fundamentals had been discovered, researchers in the 1980s realized that the weakening of the Trade Winds is actually part of a change in wind circulation patterns that recurs irregularly. One reason the Trade Winds blow east-towest in ordinary times is that the surface waters in the western equatorial Pacific are warmer than those in the eastern equatorial Pacific; air rises from the warm western areas, creating low pressure at the surface there, and air blows out of the east into the low pressure. During an El Niño, the warmer the eastern ocean gets, the more similar it becomes to the western ocean, reducing the difference in pressure across the ocean. Thus, once the Trade Winds weaken a bit, the pressure difference that makes them blow is lessened, weakening the Trade Winds further. Warm water ordinarily kept in the west by the Trade Winds creeps progressively eastward at equatorial latitudes because of this self-reinforcing series of events. Ultimately, effects of El Niño occur across large parts of the world’s weather systems, affecting sea temperatures in California, rainfall in the southwestern United States, and even systems as far distant as Africa. One specific result is to shift the weather systems of the western Pacific Ocean 6000 km eastward. The tropical rainstorms that usually drench Indonesia and the Philippines occur when warm seawater abutting these islands causes the air above it to rise, cool, and condense its moisture into clouds. When the warm water moves east, so do the clouds, leaving the previously rainy areas in drought. Conversely, the western edge of Peru and Ecuador, which usually receives little precipitation, gets a soaking. El Niño can wreak havoc on ecosystems. During an El Niño event, plankton can drop to 1/20 of their normal abundance in the waters of Peru and Ecuador, and because of the drop in plankton productivity, commercial fish stocks virtually disappear (figure 59.18). In the Galápagos Islands, for example, seabird and sea lion populations crash as animals starve due to the lack of fish. By contrast, on land, the heavy rains produce a
Warmer Warmer Warmer Wetter and cooler Drier Wetter and warmer
Warmer
Wetter and warmer ~ El Nino Sea temperature higher than normal
Drier
Warmer
Wetter
a.
b.
Figure 59.19 Life in the deep sea. a. The luminous spot below the eye of this deep-sea fish results from the presence of a symbiotic colony of bioluminescent bacteria. Bioluminescence is a fairly common feature of mobile animals in the parts of the ocean that are so deep as to be dark. It is more common among species living part way down to the bottom than in ones living at the bottom. b. These large worms live along vents where hot water containing hydrogen sulfide rises through cracks in the seafloor crust. Much of the body of each worm is devoted to a colony of symbiotic sulfur-oxidizing bacteria. The worms transport sulfide and oxygen to the bacteria, which oxidize the sulfur and use the energy thereby obtained for primary production of new organic compounds, which they share with their worm hosts. bumper crop of seeds, and land birds flourish. In Chile, similar effects on seed abundance propagate up the food chain, leading first to increased rodent populations and then to increased predator populations, a nice example of a bottom-up trophic cascade, as was discussed in chapter 58.
The deep sea is a cold, dark place with some fascinating communities The deep sea is by far the single largest habitat on Earth, in the sense that it is a huge region characterized by relatively uniform conditions throughout the globe. The deep sea is seasonless, cold (2–5°C), totally dark, and under high pressure (400–500 atmospheres where the bottom is 4000–5000 m deep). In most regions of the deep sea, food originates from photosynthesis in the sunlit waters far above. Such food—in the form of carcasses, fecal pellets, and mucus—can take as much as a month to drift down from the surface to the bottom, and along the way about 99% of it is eaten by animals living in the water column. Thus, the bottom communities receive only about 1% of the primary production and are food-poor. Nonetheless, a great many species of animals—most of them small-bodied and thinly distributed—are now known to live in the deep sea. Some of the animals are bioluminescent (figure 59.19a) and thereby able to communicate or attract prey by use of light.
Figure 59.18 An El Niño winter. This diagram shows just
Hydrothermal vent communities
some of the worldwide alterations of weather that are often associated with the El Niño phenomenon.
The most astounding communities in the deep sea are the hydrothermal vent communities. Unlike most parts of the deep
1244
part
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1244
11/20/09 2:44:47 PM
sea, these communities are thick with life (figure 59.19b), including large-bodied animals such as worms the size of baseball bats. The reason such a profusion of life can be supported is that these communities live on vigorous, local primary production rather than depending on the photic zone far above. The hydrothermal vent communities occur at places where tectonic plates are moving apart, and seawater—circulating through porous rock—is able to come into contact with very hot rock under the seafloor. This water is heated to temperatures in excess of 350°C and, in the process, becomes rich in hydrogen sulfide. As the water rises up out of the porous rock, free-living and symbiotic bacteria oxidize the sulfide, and from this reaction they obtain energy, which, in a manner analogous to photosynthesis, they use to synthesize their own cellular substance, grow, and reproduce. These sulfur-oxidizing bacteria are chemoautotrophs (see chapter 58). Animals in the communities either survive on the bacteria or eat other animals that do. The hydrothermal vent communities are among the few communities on Earth that do not depend on the Sun’s energy for primary production.
Learning Outcomes Review 59.4 The oligotrophic ocean includes the open ocean and the deep sea, where little primary productivity occurs. Continental shelf ecosystems tend to be moderate to high in productivity; they include estuaries, salt marshes, fishing banks, and coral reefs. The highest levels of productivity are found in upwelling regions, such as those along the west coasts of North and South America, where prolific but vulnerable fisheries can be found. Periodic weakening of the Trade Winds in this region can prevent the upwelling of cold water and subsequently cause weather changes in an event termed El Niño. ■
What sort of population cycles would you expect to see in regions that are affected by the ENSO?
cide that was sprayed widely in the decades following World War II, often on wetlands to control mosquitoes. During the years of heavy DDT use, populations of ospreys, bald eagles, and brown pelicans—all birds that catch large fish— plummeted. Ultimately, the use of DDT was connected with the demise of these birds. Scientists established that DDT and its metabolic products became more and more concentrated in the tissues of animals as the compounds were passed along food chains (figure 59.20). Animals at the bottom of food chains accumulated relatively low concentrations in their fatty tissues. But the primary carnivores that preyed on them accumulated higher concentrations from eating great numbers, and the secondary carnivores accumulated higher concentrations yet. Top-level carnivores, such as the birds that eat large fish, were dramatically affected by the DDT. In these birds, scientists found that metabolic products of DDT disrupted the formation of eggshells. The birds laid eggs with such thin shells that they often cracked before the young could hatch. Researchers concluded that the demise of the fish-eating birds could be reversed by a rational plan to clean ecosystems of DDT, and laws were passed banning its use. Now, three decades later, populations of ospreys, eagles, and pelicans are rebounding dramatically. For some people, a major reason to study science is the opportunity to be part of success stories of this sort.
DDT Concentration 25 ppm in predatory birds
59.5
Human Impacts on the Biosphere: Pollution and Resource Depletion
2 ppm in large fish 0.5 ppm in small fish 0.04 ppm in zooplankton
Learning Outcomes 1. 2. 3.
Name the major human threats to ecosystems. Differentiate between point-source pollution and diffuse pollution. Explain the effect of deforestation.
We all know that human activities can cause adverse changes in ecosystems. In discussing these, it is important to recognize that creative people can often come up with rational solutions to such problems. An outstanding example is provided by the history of DDT in the United States. DDT is a highly effective insectiwww.ravenbiology.com
rav32223_ch59_1230-1255.indd 1245
0.000003 ppm in water
Figure 59.20 Biological magnification of DDT concentration. Because all the DDT an animal eats in its food tends to accumulate in its fatty tissues, DDT becomes increasingly concentrated in animals at higher levels of the food chain. The concentrations at the right are in parts per million (ppm). Before DDT was banned in the United States, bird species that eat large fish underwent drastic population declines because metabolic products of DDT made their eggshells so thin that the shells broke during incubation.
chapter
59 The Biosphere
1245
11/20/09 2:44:54 PM
Freshwater habitats are threatened by pollution and resource depletion Fresh water is not just the smallest of the major habitats, but also the most threatened. One of the simplest yet most ominous threats to fresh water is that burgeoning human populations often extract excessive amounts of water from rivers, lakes, or streams. The Colorado River, for example, is one of the greatest rivers in North America, originating with snow melt in the Rocky Mountains and flowing through Utah, Arizona, Nevada, California, and northern Mexico before emptying into the ocean. Today, water is pumped out of the river all along its way to meet the water needs of cities (even ones as distant as Los Angeles) and to irrigate crops. The river now frequently runs out of water and dries up in the desert, never reaching the sea. Worldwide, many crises in the supply of fresh water loom on the horizon.
Pollution: Point source versus diffuse Pollution of fresh water is a global problem. Point-source pollution comes from an identifiable location—such as easily identified factories or other facilities that add pollutants at defined locations, such as an outfall pipe. Examples include sewage-treatment plants, which discharge treated effluents at specific spots on rivers, and factories that sometimes discharge water contaminated with heavy metals or chemicals. Laws and technologies can readily be brought to bear to moderate pointsource pollution because the exact locations and types of pollution are well defined. In many countries, great progress has been made, but in other countries, often in the developing world, water pollution is still a major problem. Diffuse pollution is exemplified by eutrophication caused by excessive run-off of nitrates and phosphates from lawn and agricultural field fertilization. When excessive nitrates and phosphates enter rivers and lakes, the character of the bodies of water is changed for the worse; the concentration of dissolved oxygen declines, and fish species such as carp take the place of more desirable species. The problem is exacerbated when rivers empty into the ocean. The eutrophication caused by the accumulation of chemicals can lead to enormous areas of water with no oxygen, causing massive die-offs of fish and other animals. The most famous such area, covering approximately 20,000 km2 in 2008, occurs where the Mississippi River empties into the Gulf of Mexico, but other “dead zones” occur in places around the world. The nitrates and phosphates that cause these problems originate on thousands of farms and lawns spread over whole watersheds, and they often enter fresh waters at virtually countless locations. The diffuseness of this sort of pollution renders it difficult to modify by simple technical fixes. Instead, solutions often depend on public education and political action.
Pollution from coal burning: Acid precipitation A type of pollution that has properties intermediate between the point-source and diffuse types is the pollution that can arise from burning of coal for power generation. Although each smokestack is a point source, there are many stacks, and the smoke and gases from these stacks spread over wide areas. 1246
part
Acid precipitation is one aspect of this problem. When coal is burned, sulfur in the coal is oxidized. The sulfur oxides, unless controlled, are spewed into the atmosphere in the stack smoke, and there they combine with water vapor to produce sulfuric acid. Falling rain or snow picks up the acid and is excessively acidic when it reaches the surface of the Earth (figure 59.21). Mercury emitted in stack smoke is a second potential problem. Burning of coal can be one of the major sources of environmental mercury, a serious public health issue because just small amounts of mercury can interfere with brain development in human fetuses and infants. Acid precipitation and mercury pollution affect freshwater ecosystems. At pH levels below 5.0, many fish species and other aquatic animals die, unable to reproduce. Thousands of lakes and ponds around the world no longer support fish because of pH shifts induced by acid precipitation. Mercury that falls from atmospheric emissions into lakes and ponds accumulates in the tissues of food fish. In the Great Lakes region of the United States, people—especially pregnant women—are advised to eat little or no locally caught fish because of its mercury content.
Forest ecosystems are threatened in tropical and temperate regions Probably the single greatest problem for terrestrial habitats worldwide is deforestation by cutting or burning. There are many reasons for deforestation. In poverty-stricken countries, deforestation is often carried out diffusely by the general population; people burn wood to cook or stay warm, and they collect it from the local forests.
Precipitation pH ⬎5.3
⬍4.3
Figure 59.21 pH values of rainwater in the United States. pH values of less than 7 represent acid conditions; the lower the values, the greater the acidity. Precipitation in parts of the United States, especially in the Northeast, is commonly more acidic than natural rainwater, which has a pH of 5.6 or higher.
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1246
11/20/09 2:44:57 PM
At the other extreme, corporations still cut large tracts of virgin forests in an industrialized fashion, often shipping the wood halfway around the world to buyers. Tropical hardwoods, such as mahogany, from Southeast Asian rain forests are shipped to the United States for use in furniture, and softwood logs are shipped from Alaska to East Asia for pulping and paper production. Forests are sometimes simply burned to open up land for farming or ranching (figure 59.22a).
Loss of habitat The loss of forest habitat can have dire consequences. Particularly diverse sets of species depend on tropical rain forests for their habitat, for example. Thus, when rain forests are cleared, the loss of biodiversity can be extreme. Many tropical forest regions have been severely degraded, and recent estimates suggest that less than half of the world’s tropical rain forests remain in pristine condition. All of the world’s tropical rain forests will be degraded or gone in about 30 years at present rates of destruction. Besides loss of habitat, deforestation can have numerous secondary consequences, depending on local contexts. In the Sahel region, South of the Sahara Desert in Africa, deforestation has been a major contributing factor in increased desertification. In the forests of the northeastern United States, as the Hubbard Brook experiment shows (see figure 58.7), deforestation can lead to both a loss of nutrients from forest soils and a simultaneous nutrient enrichment of bodies of water downstream.
Disruption of the water cycle As discussed in chapter 58, cutting of a tropical rain forest often interrupts the local water cycle in ways that permanently alter the landscape. After an area of tropical rain forest is cleared, rain water often runs off the land to distant places, rather than being returned to the atmosphere immediately above by transpiration. This change may render conditions unsuitable for the rain forest trees that originally lived there. Then the poorly vegetated land—exposed and no longer stabilized by thick root systems—may be ravaged by erosion (figure 59.22b).
Acid rain Deforestation can be a problem in temperate regions, as well as in the tropics. In addition, acid rain affects forests as well as lakes and streams; large tracts of trees in temperate regions have been adversely affected by acid rain. By changing the acidity of the soil, acid rain can lead to widespread tree mortality (figure 59.23).
Marine habitats are being depleted of fish and other species
a.
b.
Figure 59.22 Destroying the tropical rain forests. a. These fires are destroying a tropical rain forest in Brazil to clear it for cattle pasture. b. The consequences of deforestation can be seen on these middle-elevation slopes in Madagascar, which once supported tropical rain forest, but now support only low-grade pastures and permit topsoil to erode into the rivers (note the color of the water, stained brown by high levels of soil erosion). This sort of picture is seen in a number of places around the world, including Ecuador and Haiti as well as Madagascar.
fish stocks are presently officially rated as being overexploited, depleted, or in recovery; another 40% to 50% are rated as being maximally exploited. Major cod fisheries in waters off of Nova Scotia, Massachusetts, and Great Britain have been closed to fishing in the past 15 years because of collapse (figure 59.24). Overfishing can
Figure 59.23 Damage to trees by acid precipitation at Clingman’s Dome, Tennessee. Acid precipitation weakens trees and makes them more susceptible to pests and predators.
Overfishing of the ocean has risen to crisis proportions in recent decades and probably represents the single greatest current problem in the ocean realm. The ocean is so huge that it has tended to be more immune than fresh water or terrestrial ecosystems to global human alteration. Nonetheless, the total world fish catch has been pushed to its maximum for over two decades, even as demand for fish has continued to rise. Fishing pressure is so excessive that 25% to 30% of the world’s ocean www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1247
chapter
59 The Biosphere
1247
11/20/09 2:44:58 PM
Weight of Fish (thousands of metric tons)
150 total biomass in the ecosystem biomass taken by fishing
100
50
0 1960
1965 1970 1975 1980 1985 1990 1995 2000 Year
Figure 59.24 The collapse of a fishery. The red line shows the biomass of cod (Gadus morhua) in the Georges Bank ecosystem as estimated by the U.S. National Marine Fisheries Service based on data collected by scientific sampling. The biomass declined steeply between the 1970s and 1990s because of fishing pressure. As the years passed, commercial landings of cod (blue line) remained fairly constant, in part because ships worked harder and harder to catch cod, until catches fell precipitously toward zero and the fishery collapsed in the mid-1990s. Regulatory agencies closed the fishery in the mid-1990s to permit the cod to recover, but even in 2009 recovery of cod was weak at best, and production from the fishery was far below historical norms.
and a flame-retardant chemical often used in carpets. Nonetheless, because of the ocean’s vastness, concentrations of pollutants are not at crisis levels in the ocean at large.
Destruction of coastal ecosystems Second to overfishing, the greatest problem in the ocean realm is deterioration of coastal ecosystems. Estuaries along coastlines are often subject to severe eutrophication; since about 1970, for example, the bottom waters of the Chesapeake Bay near Washington, DC, have become oxygen-free each summer because of the decay of excessive amounts of organic matter. Another coastal problem is destruction of salt marshes, which (like freshwater wetlands) are often perceived as disposable. Most authorities believe that the loss of salt marshes in the 20th century was a major contributing factor to the destruction of New Orleans by Hurricane Katrina in 2005; had the salt marshes and cypress swamps been present at their full extent, they would have absorbed a great deal of the flooding water and buffered the city from some of the storm’s violence.
Stratospheric ozone depletion has led to an ozone “hole”
have disturbing indirect effects. In impoverished parts of Africa, poaching on primates and other wild mammals in national parks increases when fish catches decline.
The colors of the satellite photo in figure 59.25a represent different concentrations of ozone (O3) located 20 to 25 km above the Earth’s surface in the stratosphere. Stratospheric ozone is depleted over Antarctica (purple region in the figure) to between one-half and one-third of its historically normal concentration, a phenomenon called the ozone hole. Although depletion of stratospheric ozone is most dramatic over Antarctica, it is a worldwide phenomenon. Over the United States, the ozone concentration has been reduced by about 4%, according to the U.S. Environmental Protection Agency.
Aquaculture: At present only a quick fix
Stratospheric ozone and UV-B
Production of fish by aquaculture has grown steadily in the last two decades, and it is often viewed as a straightforward solution to the fisheries problem. But the dietary protein needs of many aquacultured fish, such as salmon, are met largely with wildcaught fish. In this case, exploitation has simply shifted to different species. In addition, current aquaculture practices often damage natural ocean ecosystems. One example is the clearing of mangrove swamps along coasts to create shrimp and fish ponds, which are abandoned when their productivity declines. Research is needed to ameliorate these problems.
Stratospheric ozone is important because it absorbs ultraviolet (UV) radiation—specifically the wavelengths called UV-B— from incoming solar radiation. UV-B is damaging to living organisms in a number of ways; for instance, it increases risks of cataracts and skin cancer in people. Depletion of stratospheric ozone permits more UV-B to reach the Earth’s surface and therefore increases the risks of UV-B damage. Every 1% drop in stratospheric ozone is estimated to lead to a 6% increase in the incidence of skin cancer, for example. UV exposure also may be detrimental to many types of animals, such as amphibians (figure 59.26)
Pollution effects
Ozone depletion and CFCs
As large as the ocean is, enough pollutants are being added that at the start of the 21st century, polluting materials are easily detectable on a global basis. An expedition to some of the most remote, uninhabited islands in the vast Pacific Ocean recently reported, for example, that considerable amounts of plastic could be found washed up on the beaches. Similarly, even the waters of the Arctic are laced with toxic chemicals; biopsy samples of tissue from Arctic killer whales (Orcinus orca) revealed extremely high levels of many chemicals, including pesticides
The major cause of the depletion of stratospheric ozone is the addition of industrially produced chlorine- and brominecontaining compounds to the atmosphere. Of particular concern are chlorofluorocarbons (CFCs), used until recently as refrigerants in air conditioners and refrigerators, and in manufacturing. CFCs released into the atmosphere can ultimately liberate free chlorine atoms, which in the stratosphere catalyze the breakdown of ozone molecules (O3) to form ordinary oxygen (O2). Ozone is continually being made and broken down,
1248
part
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1248
11/20/09 2:45:02 PM
Southern Hemisphere Ozone Hole Area (millions of square kilometers)
South Pole
27
2009 2008 2007 1999–2008 average
24 21 18 15 12 9 6 3 0 August
a.
September
October
November
December
b.
Figure 59.25 The ozone hole over Antarctica. NASA satellites currently track the extent of ozone depletion in the stratosphere over Antarctica each year. Every year since about 1980, an area of profound ozone depletion, called the ozone hole, has appeared in August (early spring in the southern hemisphere) when sunlight triggers chemical reactions in cold air trapped over the South Pole during the Antarctic winter. The hole intensifies during September before tailing off as temperature rises in November–December. a. In September, 2006, the 11.4 million-square-mile hole (purple in the satellite image shown) covered an area larger than the United States, Canada, and Mexico combined, the largest hole ever recorded. b. Concentrations of ozone-depleting chemical compounds in the atmosphere have probably peaked in the last few years and are expected to decline slowly over the decades ahead.
and free chlorine atoms tilt the balance toward a faster rate of breakdown. The extreme depletion of ozone seen in the ozone hole is a consequence of the unique weather conditions that exist over Antarctica. During the continuous dark of the Antarctic winter, a strong stratospheric wind, the polar-night jet, develops and, blowing around the full circumference of the Earth, isolates the stratosphere over Antarctica from the rest of the atmosphere.
The Antarctic stratosphere stays extremely cold (–80°C or lower) for many weeks as a consequence, permitting unique types of ice clouds to form. Reactions associated with the particles in these clouds lead to accumulation of diatomic chlorine, Cl2. When sunlight returns in the early Antarctic spring, the diatomic chlorine is photochemically broken up to form free chlorine atoms in great abundance, and the ozone-depleting reactions ensue.
SCIENTIFIC THINKING Question: Does exposure to UV radiation affect the survival of amphibian eggs? Hypothesis: Direct UV exposure is detrimental to eggs. Experiment: Fertilized eggs from several frog species are placed into enclosures in full sunlight. All enclosures have screens, some of which filter out UV
Mean Proportion Surviving to Hatching
radiation, whereas others do not affect UV transmission. Eggs are monitored to see whether they survive to hatching or whether they die. 1.0 UV-B blocking filter UV-B transmitting filter No filter
0.9 0.8 0.7 0.6 0.5 0.4 Hyla regilla
Bufo boreas
Rana cascadae
Result: Egg survival was greatly decreased in two of three species in the enclosures where UV radiation was not filtered out, as compared to survival in the filtered enclosures. Therefore, the hypothesis is confirmed: UV exposure is detrimental to amphibian eggs. Further Questions: What factors might explain why some species are affected by UV exposure and others are not? How could your hypotheses be tested?
Figure 59.26 The effect of UV radiation on amphibian eggs. www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1249
chapter
59 The Biosphere
1249
11/20/09 2:45:03 PM
Phase-out of CFCs After research revealed the causes of stratospheric ozone depletion, worldwide agreements were reached to phase out the production of CFCs and other compounds that lead to ozone depletion. Manufacture of such compounds ceased in the United States in 1996, and there is now a great deal of public awareness about the importance of using “ozone-safe” alternative chemicals. The atmosphere will cleanse itself of ozonedepleting compounds only slowly because the substances are chemically stable. Nonetheless, the problem of ozone depletion is diminishing and is expected to be substantially corrected by the second half of the 21st century. The CFC story is an excellent example of how environmental problems arise and can be solved. Initially, CFCs were heralded as an efficient and cost-effective way to provide cooling, a clear improvement over previous technologies. At that time, their harmful consequences were unknown. Once the problems were identified, international agreements led to an effective solution, and creative technological advances led to replacements that solved the problem at little cost.
Learning Outcomes Review 59.5 Pollution and resource depletion are the major human effects on the environment, with freshwater habitats being most threatened. Point-source pollution comes from identifiable locations, such as factories, whereas diffuse pollution comes from numerous sources, such as fertilized lawns. Deforestation is a major problem in that it destroys habitat, disrupts communities, depletes resources, and changes the local water cycle and weather patterns. Overfishing is the greatest problem in the oceans. ■
Were CFCs an example of point-source or diffuse pollution? In general, how do efforts to combat pollution depend on their source?
Because of changes in atmospheric composition, the average temperature of the Earth’s surface is increasing, a phenomenon called global warming. As you might imagine from what we said at the beginning of this chapter, changes in temperature alter global wind and water-current patterns in complicated ways. This means that as the average global temperature increases, some particular regions of the world warm to a lesser extent, whereas other regions heat up to a greater extent (figure 59.27). It also means that rainfall patterns are altered because global precipitation patterns depend on global wind patterns. Enormous computer models are used to calculate the effects predicted in all parts of the world.
Independent computer models predict global changes The Intergovernmental Panel on Climate Change, which shared the 2007 Nobel Peace Prize with Al Gore for their work on global climate change, recently released its fourth assessment report. Based on a variety of different scenarios, computer models predicted that global temperatures would increase 1.1°C to 6.4°C (2.0–11.5°F) by the end of this century. More ominous perhaps than temperature are some of the predictions for precipitation. For example, although northern Europe is expected to receive more precipitation than today, another recent studied predicted that parts of southern Europe will receive about 20% less, disrupting natural ecosystems, agriculture, and human water supplies. Some European countries may come out ahead economically, but others will come out behind, and political relationships among countries will likely change as some shift from being food exporters to the more tenuous role of requiring food imports.
2008 Surface Temperature Anomalies (°C)
59.6
Human Impacts on the Biosphere: Climate Change
Learning Outcomes 1. 2.
Explain the link between atmospheric carbon dioxide and global warming. Describe the consequences of global warming on ecosystems and human health.
By studying the Earth’s history and making comparisons with other planets, scientists have determined that concentrations of gases in our atmosphere, particularly CO2, maintain the average temperature on Earth about 25°C higher than it would be if these gases were absent. This fact emphasizes that the composition of our atmosphere is a key consideration for life on Earth. Unfortunately, human activities are now changing the composition of the atmosphere in ways that most authorities conclude will be damaging or, in the long run, disastrous. 1250
part
−3.5 −2.5 −1.5
−1
−0.6 −0.2
0.2
0.6
1
1.5
2.5
3.5
Figure 59.27 Geographic variation in global warming. The 10 warmest years since record keeping began in 1880 all occur within the 12-year period 1997–2008, but some areas of the globe heated up more than others. Colors indicate how much warming occurred in 2008 relative to the mean temperature during a reference period (1951–1980) prior to full onset of the modern greenhouse effect.
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1250
11/20/09 2:45:03 PM
60.0 380 59.8 370 59.6 360 59.4 350 59.2 340 59.0 330 58.8
Global Temperature (°F)
Carbon Dioxide Concentration (ppmv)
390
320 58.6 310 ’60
’70
’80
’90
’00
’10
Year
Figure 59.28 The greenhouse effect. The concentration of carbon dioxide in the atmosphere has increased steadily since the 1950s, as shown by the blue line. The red line shows the change in average global temperature over the same period.
Carbon dioxide is a major greenhouse gas Carbon dioxide is the gas usually emphasized in discussing the cause of global warming (figure 59.28), although other atmospheric gases are also involved. A monitoring station on the top of the 13,700-foot (4200-m) Mauna Loa volcano on the island of Hawaii has monitored the concentration of atmospheric CO2 since the 1950s. This station is particularly important because it is in the middle of the Pacific Ocean, far from the great continental landmasses where most people live, and it is therefore able to monitor the state of the global atmosphere without confounding influences of local events. In 1958, the atmosphere was 0.031% CO2. By 2004, the concentration had risen to 0.038%. All authorities agree that the cause of this steady rise in atmospheric CO2 is the burning of coal and petroleum products by the increasing (and increasingly energy-demanding) human population.
that a glass greenhouse gets warm inside is that window glass is transparent to light but only slightly transparent to long-wave infrared radiation. Energy that strikes a greenhouse as light enters the greenhouse freely. Once inside, the energy is absorbed as heat and then re-radiated as long-wave infrared radiation. The infrared radiation cannot easily get out through the glass, and therefore energy accumulates inside.
Other greenhouse gases Carbon dioxide is not the only greenhouse gas. Others include methane and nitrous oxide. The effect of any particular greenhouse gas depends on its molecular properties and concentration. For example, molecule-for-molecule, methane has about 20 times the heat-trapping effect of carbon dioxide; on the other hand, methane is less concentrated and less long-lived in the atmosphere than carbon dioxide. Methane is produced in globally significant quantities in anaerobic soils and in the fermentation reactions of ruminant mammals, such as cows. Huge amounts of methane are presently locked up in Arctic permafrost. Melting of the permafrost could cause a sudden and large perturbation in global temperature by releasing methane rapidly. Agricultural use of fertilizers is the largest source of nitrous oxide emissions, with energy consumption second and industrial use third.
Global temperature change has affected ecosystems in the past and is doing so now Evidence for warming can be seen in many ways. For example, on a worldwide statistical basis, ice on lakes and rivers forms later and melts sooner than it used to; on average, ice-free seasons are now 2.5 weeks longer than they were a century ago. Also, the extent of ice at the North Pole has decreased substantially, and glaciers are retreating around the world (figure 59.29).
Figure 59.29 Disappearing glaciers. Mount Kilimanjaro in Tanzania in 1970 (top) and 2000 (bottom). Note the decrease in glacier coverage over three decades.
How carbon dioxide affects temperature The atmospheric concentration of CO2 affects global temperature because carbon dioxide strongly absorbs electromagnetic radiant energy at some of the wavelengths that are critical for the global heat budget. As stressed in chapter 58, the Earth not only receives radiant energy from the Sun, but also emits radiant energy into outer space. The Earth’s temperature will be constant only if the rates of these two processes are equal. The incoming solar energy is at relatively short wavelengths of the electromagnetic spectrum: Wavelengths that are visible or near-visible. The outgoing energy from the Earth is at different, longer wavelengths. Carbon dioxide absorbs energy at certain of the important long-wave infrared wavelengths. This means that although carbon dioxide does not interfere with the arrival of radiant energy at short wavelengths, it retards the rate at which energy travels away from the Earth at long wavelengths into outer space. Carbon dioxide is often called a greenhouse gas because its effects are analogous to those of a greenhouse. The reason www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1251
11/20/09 2:45:05 PM
Global warming—and cooling—have occurred in the past, most recently during the ice ages and intervening warm periods. Species often responded by shifting their geographic ranges, tracking their environments. For example, a number of cold-adapted North American tree species that are now found only in the far north, or at high elevations, lived much farther south or at substantially lower elevations 10,000–20,000 years ago, when conditions were colder. Present-day global warming is having similar effects. For example, many butterfly and bird species have shifted northward in recent decades (figure 59.30). Many migratory birds arrive earlier at their summer breeding grounds than they did decades ago. Many insects and amphibians breed earlier in the year, and many plants flower earlier. In Australia, recent research shows that wild fruit fly populations have undergone changes in gene frequencies in the past 20 years, such that populations in cool parts of the country now genetically resemble ones in warm parts. Reef-building corals seem to have narrow margins of safety between the sea temperatures to which they are accustomed and the maximum temperatures they can survive. Global warming seems already to be threatening some corals by inducing mass “bleaching,” a disruption of the normal and necessary symbiosis between the cnidarians and algal cells. There are reasons to think that the effects of global warming on natural ecosystems today may, overall, be more severe than those of warming events in the distant past. One concern is that the rate of warming today is rapid, and therefore evolutionary adaptations would need to occur over relatively few generations to aid the survival of species. Another concern is that natural areas no longer cover the whole landscape but often take the form of parks that are completely surrounded by cities or farms. The parks are at fixed geographic locations and in general cannot be moved. If climatic conditions in a park become unsuitable for its inhabitants, the park will cease to perform its function. Moreover, the areas in which the park in-
habitants might then find suitable climatic conditions are likely to be developed, rather than being protected parks. Similarly, as temperatures increase, many montane species have shifted to higher altitudes to find their preferred habitat. However, eventually they can shift no higher because they reach the mountain’s peak. As the temperature continues to increase, the species’ habitat disappears entirely. A number of Costa Rican frog species are thought to have become extinct for this reason. The same fate may befall many Arctic species as their habitat melts away.
Global warming affects human populations as well Global warming could affect human health and welfare in a variety of ways. Some of these changes may be beneficial, but even if they are detrimental, some countries—particularly the wealthier ones—will be able to adjust. But poorer countries may not be able to transform as quickly, and some changes will require extremely costly countermeasures that even wealthy countries will be hard-pressed to afford.
Rising sea levels During the second half of the 20th century, sea level rose at 2 to 3 cm per decade. The U.S. Environmental Protection Agency predicts that sea level is likely to rise two or three times faster in the 21st century because of two effects of global warming: (1) the melting of polar ice and glaciers, adding water to the ocean, and (2) the increase of average ocean temperature, causing an increase in volume because water expands as it warms. Such an increase would cause increased erosion and inundation of low-lying land and coastal marshes, and other habitats would also be imperiled. As many as 200 million people would be affected by increased flooding. Should sea levels continue to rise, coastal cities and some entire islands, such as the Maldives in the Indian Ocean, would be in danger of becoming submerged.
Other climatic effects Global warming is predicted to have a variety of effects besides increased temperatures. In particular, the frequency or severity of extreme meteorological events—such as heat waves, droughts, severe storms, and hurricanes—is expected to increase, and El Niño events, with their attendant climatic effects, may become more common. In addition, rainfall patterns are likely to shift, and those geographic areas that are already water-stressed, which are currently home to nearly 2 billion people, will likely face even graver water shortage problems in the years to come. Some evidence suggests that these effects are already evident in the increase in powerful storms, hurricanes, and the frequency of El Niño events over the past few years.
Figure 59.30 Butterfly range shift. The distribution of the speckled wood butterfly, Pararge aegeria, in Great Britain in 1970–1997 (green) included areas far to the north of the distribution in 1915–1939 (black). 1252
part
Effects on agriculture Global warming may have both positive and negative effects on agriculture. On the positive side, warmer temperatures and increased atmospheric carbon dioxide tend to increase growth of some crops and thus may increase agricultural yields. Other crops, however, may be negatively affected. Furthermore, most
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1252
11/20/09 2:45:08 PM
crops will be affected by increased frequencies of droughts. Moreover, although crops in north temperate regions may flourish with higher temperatures, many tropical crops are already growing at their maximal temperatures, so increased temperatures may lead to reduced crop yields. Also on the negative side, changes in rainfall patterns, temperature, pest distributions, and various other factors will require many adjustments. Such changes may come relatively easily for farmers in the developed world, but the associated costs may be devastating for those in the developing countries.
Dengue fever (sometimes called “breakbone fever” because of the pain it causes) is also spreading. Previously a disease restricted to the tropics and subtropics, where it infects 50 to 100 million people a year, it now occurs in the United States, southern South America, and northern Australia. One of the most alarming aspects of these diseases is that no vaccines are available. Drug treatment is available (for malaria), but the parasites are rapidly evolving resistance and rendering the drugs ineffective. There is no drug treatment for dengue fever.
Effects on human health
Solving the problem
Increasingly frequent storms, flooding, and drought will have adverse consequences on human health. Aside from their direct effect, such events often disrupt the fragile infrastructure of developing countries, leading to the loss of safe drinking water and other problems. As a result, epidemics of cholera and other diseases may be expected to occur more often. In addition, as temperatures rise, areas suitable for tropical organisms will expand northward. Of particular concern are those organisms that cause human diseases. Many diseases currently limited to tropical areas may expand their range and become problematic in nontropical countries. Diseases transmitted by mosquitoes, such as malaria (see chapter 29), dengue fever, and several types of encephalitis, are examples. The distribution of mosquitoes is limited by cold; winter freezes kill many mosquitoes and their eggs. As a result, malaria only occurs in areas where temperatures are usually above 16°C, and yellow fever and dengue fever, transmitted by a different mosquito species from malaria, occur in areas where temperatures are normally above 10°C. Moreover, at higher temperatures, the malaria pathogen matures more rapidly. Malaria already kills 1 million people every year; some projections suggest that the percentage of the human population at risk for malaria may increase by 33% by the end of the 21st century. Moreover, as predicted, malaria already appears to be on the move. By 1980, malaria had been eradicated from all of the United States except California, but in recent years it has appeared in a variety of southern, and even a few northern, states.
The release of the IPCC’s fourth assessment in 2007 may come to be seen as a turning point in humanity’s response to climate change. Global warming is now recognized, even by former skeptics, as an ongoing phenomenon caused in large part by human actions. Even formerly recalcitrant governments now seem poised to take action, and corporations are recognizing the opportunities provided by the need to reverse human impacts. The resulting “green” technologies and practices are becoming increasingly common. With concerted efforts from citizens, corporations, and governments, the more serious consequences of global climate change hopefully can be averted, just as ozone depletion was reversed in the last century.
Learning Outcomes Review 59.6 Carbon dioxide is a significant greenhouse gas, meaning that it prevents heat from escaping the Earth so that temperatures rise. Global warming caused by changes in atmospheric composition—most notably CO2 accumulation—may increase desertification and cause some habitats and species to disappear. Global warming may also melt ice caps and glaciers, altering coastlines as water levels rise. Violent weather events, disruption of water availability, and flooding of low-lying areas, as well as increased incidence of tropical diseases, may also occur. ■
In what ways does global climate change pose different questions from those posed by ozone depletion?
Chapter Review 59.1 Ecosystem Effects of Sun, Wind, and Water Solar energy and the Earth’s rotation affect atmospheric circulation. The amount of solar radiation reaching the Earth’s surface has a great effect on climate. The seasons result from changes in the Earth’s position relative to the Sun (see figure 59.1). Hot air with its increased water content rises at the equator, then cools and loses its moisture, creating the equatorial rain forests (see figure 59.3). As the drier cool air of the upper atmosphere moves away from the equator and then descends to Earth, it removes moisture from the Earth’s surface and creates deserts on its way back to the equator. www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1253
Winds travel in curved paths relative to the Earth’s surface because the Earth rotates on its axis (the Coriolis effect; see figure 59.3). Global currents are largely driven by winds (see figure 59.4). Four large circular gyres in ocean currents can be found, driven by wind direction. These also are influenced by the Coriolis effect. Regional and local differences affect terrestrial ecosystems. A rain shadow occurs when a range of mountains removes moisture from air moving over it from the windward side, creating a drier environment on the opposite side (see figure 59.5). chapter
59 The Biosphere
1253
11/20/09 2:45:09 PM
For every 1000-m increase in elevation, temperature drops approximately 6°C (see figure 59.6). Microclimates are small-scale differences in conditions.
59.2 Earth’s Biomes Temperature and moisture often determine biomes. Average annual temperature and rainfall, as well as the range of seasonal variation, determine different biomes. Eight major types of biomes are recognized. Tropical rain forests are highly productive equatorial systems. Savannas are tropical grasslands with seasonal rainfall. Deserts are regions with little rainfall. Temperate grasslands have rich soils. Temperate deciduous forests are adapted to seasonal change. Temperate evergreen forests are coastal. Taiga is the northern forest where winters are harsh. Tundra is a largely frozen treeless area with a short growing season.
59.3 Freshwater Habitats Life in freshwater habitats depends on oxygen availability. Oxygen is not very soluble in water. Oxygen is constantly added by photosynthesis of aquatic plants and removed by heterotrophs. Lake and pond habitats change with water depth. The photic zone, near the surface, is the zone of primary productivity; its depth varies with water clarity (see figure 59.12). In the summer, the warmer water (epilimnion) floats on top of the colder water (hypolimnion). Freshwater lakes turn over twice a year as the temperature at the surface and at depth become the same, and the layers are set in motion by wind (see figure 59.13). Lakes differ in oxygen and nutrient content. Oligotrophic lakes have high oxygen and low nutrients, whereas eutrophic lakes are the opposite.
59.4 Marine Habitats The ocean is divided into several zones: intertidal, neritic, photic, benthic, and pelagic zones (see figure 59.15). Open oceans have low primary productivity. Phytoplankton is the primary producer in open waters, and primary production is low due to low nutrient levels. Continental shelf ecosystems provide abundant resources. Neritic waters are found over continental shelves and have higher nutrient levels (see figure 59.15). Estuaries frequently contain rich
1254
part
intertidal zones. Other ecosystems include productive banks on continental shelves and symbiotic coral reef ecosystems. Upwelling regions experience mixing of nutrients and oxygen. In upwelling regions, local winds bring up nutrient-rich deep waters, creating the highest rates of primary production. El Niño events occur when Trade Winds weaken, restricting upwelling to surface waters rather than to the deeper nutrient-rich waters. The deep sea is a cold, dark place with some fascinating communities. The deep sea is the single largest habitat. Hydrothermal vent communities occur where tectonic plates are moving apart; chemoautotrophs living there obtain energy from oxidation of sulfur.
59.5 Human Impacts on the Biosphere: Pollution and Resource Depletion Dangerous chemicals like DDT are biomagnified as energy moves up the food chain (see figure 59.20). Freshwater habitats are threatened by pollution and resource depletion. Point-source and diffuse pollution, acid precipitation, and overuse threaten freshwater habitats (see figure 59.21). Forest ecosystems are threatened in tropical and temperate regions. Deforestation leads to loss of habitat, disruption of the water cycle, and loss of nutrients. Acid rain has a major detrimental effect on forests as well as on lakes and streams (see figure 59.23). Marine habitats are being depleted of fish and other species. Many fisheries, such as the Georges Bank ecosystem, have collapsed and have not recovered. Stratospheric ozone depletion has led to an ozone “hole.” Increased transmission of UV-B radiation is harmful to life. Global regulation of CFCs seems to be reversing ozone depletion.
59.6 Human Impacts on the Biosphere: Climate Change Independent computer models predict global changes. Carbon dioxide is a major greenhouse gas. Carbon dioxide allows solar radiation to pass through the atmosphere but prevents heat from leaving the Earth, creating warmer conditions. Global temperature change has affected ecosystems in the past and is doing so now. If temperatures change rapidly, natural selection cannot occur rapidly enough to prevent many species from becoming extinct. Global warming affects human populations as well. Changing sea levels, increased frequency of extreme climatic events, direct and indirect effects on agriculture, and the expansion of tropical diseases can all affect human life.
VIII Ecology and Behavior
rav32223_ch59_1230-1255.indd 1254
11/20/09 2:45:10 PM
Review Questions 2. Oligotrophic lakes can be turned into eutrophic lakes as a result of human activities such as
U N D E R S TA N D 1. The Coriolis effect a. b. c. d.
drives the rotation of the Earth. is responsible for the relative lack of seasonality at the equator. drives global wind circulation patterns. drives global wind and ocean circulation patterns.
2. What two factors are most important in biome distribution? a. b. c. d.
Temperature and latitude Rainfall and temperature Latitude and rainfall Temperature and soil type
is directly related to air temperature. is inversely related to air temperature. is unaffected by air temperature. produces changes in air temperature. is not modified by fall and spring overturn. leads to higher oxygen in deep versus surface waters. leads to higher oxygen in surface versus deep waters. is reduced when ice forms on the surface of the lake.
5. Oligotrophic lakes have a. b. c. d.
low oxygen, and high nutrient availability. high oxygen, and high nutrient availability. high oxygen, and low nutrient availability. low oxygen, and low nutrient availability.
6. Deep-sea hydrothermal vent communities a. b. c. d.
get their energy from photosynthesis in the photic zone near the surface. use bioluminescence to generate food. are built on the energy produced by the activity of chemoautotrophs that oxidize sulfur. contain only bacteria and other microorganisms.
7. Biological magnification occurs when a. b. c. d.
c.
pollutants increase in concentration in tissues at higher trophic levels. the effect of a pollutant is magnified by chemical interactions within organisms. an organism is placed under a dissecting scope. a pollutant has a greater than expected effect once ingested by an organism.
overfishing of sensitive species, which disrupts fish communities. introducing nutrients into the water, which stimulates plant and algal growth. disrupting terrestrial vegetation near the shore, which causes soil to run into the lake. spraying pesticides into the water to control aquatic insect populations.
3. If a pesticide is harmless at low concentrations (such as, DDT) and used properly, how can it become a threat to nontarget organisms? a. b. c. d.
4. Thermal stratification in a lake a. b. c. d.
b.
d.
3. In a rain shadow, air is cooled as it rises and heated as it descends, often producing a wet and dry side because the waterholding capacity of the air a. b. c. d.
a.
Because after exposure to DDT, some species develop allergic reactions even at low levels of exposure Because DDT molecules can combine so that their concentration increases through time Because the concentration of chemicals such as DDT is increasingly concentrated at higher trophic levels Because global warming and exposure to UV-B radiation renders molecules such as DDT increasingly potent
4. If there are many greenhouse gases, why is only carbon dioxide considered a cause of global warming? a. b.
c. d.
The other gases do not cause global warming. Scientists are concerned about other causes; for example, release of methane from melting permafrost could have significant effects on global warming. Other gases occur in such low quantities that they have little effect on the climate. Carbon dioxide is the only gas that absorbs longwavelength infrared radiation.
SYNTHESIZE 1. Discuss how figure 59.1 explains the pattern observed in figure 59.2. 2. Why are most of the Earth’s deserts found at approximately 30° latitude? 3. If the world has experienced global warming many times in the past, why should we be concerned about it happening again now?
8. Which of the following is a point source of pollution? a. b. c. d.
Lawns Smokestacks of coal-fired power plants Factory effluent pipe draining into a river Acid rain
ONLINE RESOURCE A P P LY
www.ravenbiology.com
1. If the Earth were not tilted on its axis of rotation, the annual cycle of seasons in the northern and southern hemispheres a. b.
would be reversed. would stay the same.
www.ravenbiology.com
rav32223_ch59_1230-1255.indd 1255
c. d.
would be reduced. would not exist.
Understand, Apply, and Synthesize—enhance your study with animations that bring concepts to life and practice tests to assess your understanding. Your instructor may also recommend the interactive eBook, individualized learning tools, and more. chapter
59 The Biosphere
1255
11/20/09 2:45:10 PM
CHAPTER
Chapter
60
Conservation Biology Chapter Outline 60.1
Overview of the Biodiversity Crisis
60.2
The Value of Biodiversity
60.3
Factors Responsible for Extinction
60.4
Approaches for Preserving Endangered Species and Ecosystems
A
Introduction
Among the greatest challenges facing the biosphere is the accelerating pace of species extinctions. Not since the end of the Cretaceous period 65 MYA have so many species become extinct in so short a time span. This challenge has led to the emergence of the discipline of conservation biology. Conservation biology is an applied science that seeks to learn how to preserve species, communities, and ecosystems. It studies the causes of declines in species richness and attempts to develop methods for preventing such declines. In this chapter, we first examine the biodiversity crisis and its importance. Then, using case histories, we identify and study factors that have played key roles in many extinctions. We finish with a review of recovery efforts at the species and community levels.
rav32223_ch60_1256-1280.indd 1256
11/20/09 3:07:58 PM
60.1
Overview of the Biodiversity Crisis
Learning Outcomes 1. 2.
Describe the history of extinction through time. Explain the importance of hotspots to biodiversity conservation.
Extinction is a fact of life. Most species—probably all—become extinct eventually. More than 99% of species known to science (most from the fossil record) are now extinct. Current rates of extinction are alarmingly high, however. Taking into account the current rapid and accelerating loss of habitat, especially in the tropics, it has been calculated that as much as 20% of the world’s biodiversity may be lost by the middle of this century. In addition, many of these species may be lost before we are even aware of their existence. Scientists estimate that no more than 15% of the world’s eukaryotic organisms have been discovered and given scientific names, and this proportion is probably much lower for tropical species. These losses will affect more than poorly known groups. As many as 50,000 species of the world’s total of 250,000 species of plants, 4000 of the world’s 20,000 species of butterflies, and nearly 2000 of the world’s 8600 species of birds could be lost during this period. Considering that the human species has
been in existence for less than 200,000 years of the world’s 4.5-billion-year history, and that our ancestors developed agriculture only about 10,000 years ago, this is an astonishing—and dubious—accomplishment.
Prehistoric humans were responsible for local extinctions A great deal can be learned about current rates of extinction by studying the past. In prehistoric times, members of Homo sapiens wreaked havoc whenever they entered a new area. For example, at the end of the last Ice Age, approximately 12,000 years ago, the fauna of North America was composed of a diversity of large mammals similar to those living in Africa today: mammoths and mastodons, horses, camels, giant ground sloths, saber-toothed cats, and lions, among others (figure 60.1). Shortly after humans arrived, 74% to 86% of the megafauna (that is, animals weighing more than 100 lb) became extinct. These extinctions are thought to have been caused by hunting and, indirectly, by burning and clearing of forests. (Some scientists attribute these extinctions to climate change, but that hypothesis doesn’t explain why the ends of earlier Ice Ages were not associated with mass extinctions, nor does it explain why extinctions occurred primarily among larger animals, with smaller species being relatively unaffected.) Around the globe, similar results have followed the arrival of humans. Forty thousand years ago, Australia was occupied by a wide variety of large animals, including marsupials
Figure 60.1 North America before human inhabitants. Animals found in North America prior to the arrival of humans included birds and large mammals, such as the ancient North American camel, saber-toothed cat, giant ground sloth, and teratorn vulture.
rav32223_ch60_1256-1280.indd 1257
11/20/09 3:08:08 PM
the 85 species of mammals that have gone extinct in the last 400 years, 60% lived on islands. The particular vulnerability of island species probably results from a number of factors: Such species have often evolved in the absence of predators, and so have lost their ability to escape both humans and introduced predators such as rats and cats. In addition, humans have introduced competitors and diseases; malaria, for example, has devastated the bird fauna of the Hawaiian Islands. Finally, island populations are often relatively small, and thus particularly vulnerable to extinction, as we shall see later in this chapter. In recent years, the extinction crisis has moved from islands to continents. Most species now threatened with extinction occur on continents, and these areas will bear the brunt of the extinction crisis in this century. Some people have argued that we should not be concerned, because extinctions are a natural event and mass extinctions have occurred in the past. Indeed, mass extinctions have taken place several times over the past half-billion years (see figure 22.18). However, the current mass extinction event is notable in several respects. First, it is the only such event triggered by a single species (us!). Moreover, although species diversity usually recovers after a few million years (as discussed in chapter 22), this is a long time to deny our descendants the benefits and joys of biodiversity. In addition, it is not clear that biodiversity will rebound this time. After previous mass extinctions, new species have evolved to utilize resources newly available due to extinctions of the species that previously used them. Today, however, such resources are unlikely to be available, because humans are destroying the habitats and taking the resources for their own use.
similar in size and ecology to hippos and leopards, a kangaroo 9 ft tall, and a 20-ft-long monitor lizard. These all disappeared at approximately the same time as humans arrived. Smaller islands have also been devastated. Madagascar has seen the extinction of at least 15 species of lemurs, including one the size of a gorilla; a pygmy hippopotamus; and the flightless elephant bird, Aepyornis, the largest bird to ever live (more than 3 m tall and weighing 450 kg). On New Zealand, 30 species of birds went extinct, including all 13 species of moas, another group of large, flightless birds. Interestingly, one continent that seems to have been spared these megafaunal extinctions is Africa. Scientists speculate that this lack of extinction in prehistoric Africa may have resulted because much of human evolution occurred in Africa. Consequently, African species had been coevolving with humans for several million years and thus had evolved counteradaptations to human predation.
Extinctions have continued in historical time Historical extinction rates are best known for birds and mammals because these species are conspicuous—that is, relatively large and well studied. Estimates of extinction rates for other species are much rougher. The data presented in table 60.1, based on the best available evidence, show recorded extinctions from 1600 to the present. These estimates indicate that about 85 species of mammals and 113 species of birds have become extinct since the year 1600. That is about 2.1% of known mammal species and 1.3% of known birds. The majority of extinctions have occurred in the last 150 years: one species every year during the period from 1850 to 1950, and four species per year between 1986 and 1990. This increase in the rate of extinction is the heart of the biodiversity crisis. Unfortunately, the situation is worsening. For example, the number of bird species recognized as “critically endangered” increased 8% from 1996 to 2000, and a recent report suggested that as many as half of Earth’s plant species may be threatened with extinction. Some researchers predict that two-thirds of all vertebrate species could perish by the end of this century. The majority of historic extinctions—though by no means all of them—have occurred on islands. For example, of
TA B L E 6 0 .1
Mainland
E X T I N C T I O N S
Island
Ocean
Total
Approximate Number of Species
Percent of Taxon Extinct
Mammals
30
51
4
85
4,000
2.1
Birds
21
92
0
113
8,600
1.3
1
20
0
21
6,300
0.3
Fish
22
1
0
23
24,000
0.1
Invertebrates*
49
48
1
98
1,000,000+
245
139
0
384
250,000
Reptiles
Flowering plants *
A species found naturally in only one geographic area and no place else is said to be endemic to that area. The area over which an endemic species is found may be very large. For example, the black cherry tree (Prunus serotina) is endemic to all of temperate North America. More typically, however, endemic species occupy restricted ranges. The Komodo dragon (Varanus
Recorded Extinctions Since 1600 R E C O R D E D
Taxon
Endemic species hotspots are especially threatened
0.01 0.2
Number of extinct invertebrates is probably greatly underestimated due to lack of knowledge for many species (other groups are probably underestimated to a lesser extent for the same reason).
1258
part
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1258
11/20/09 3:08:11 PM
komodoensis) lives only on a few small islands in the Indonesian archipelago, and the Mauna Kea (Argyroxiphium sandwicense) and Haleakala silverswords (A. s. macrocephalum) each lives in a single volcano crater on the island of Hawaii (figure 60.2). Isolated geographic areas, such as oceanic islands, lakes, and mountain peaks, often have high percentages of endemic species, many in significant danger of extinction. The number of endemic plant species can vary greatly from one place to another. In the United States, for example, 379 plant species are found in Texas and nowhere else, whereas New York has only one endemic plant species. California, with its varied array of habitats, including deserts, mountains, seacoast, old-growth forests, and grasslands, is home to more endemic plant species than any other state.
Figure 60.2 Mauna Kea silversword (Argyroxiphium sandwicense). Many species of silverswords are endemic to very
Species hotspots
small areas. This photo illustrates two stages in the plant’s life cycle.
Worldwide, notable concentrations of endemic species occur in particular regions. Conservationists have recently identified areas, termed hotspots, that have high endemism and are disappearing at a rapid rate. Such hotspots include Madagascar, a variety of tropical rain forests, the eastern Himalayas, areas with Mediterranean climates such as California, South Africa, and Australia, and several other areas (figure 60.3 and table 60.2). Overall, 25 such hotspots have been identified,
which in total contain nearly half of all the terrestrial species in the world. Why these areas contain so many endemic species is a topic of active scientific research. Some of these hotspots occur in areas of high species diversity; for these hotspots, the explanations for high species diversity in general, such as high productivity, probably apply (see chapter 58). In addition, some hotspots occur
Figure 60.3 Hotspots of high endemism. These areas are rich in endemic species under threat of imminent extinction. Madagascar
Tropical Andes
Philippines
Cape Floristic Province
Lemur catta
Frailejones espeletia
Dillenia philippinensis
Leucospermum cordifolium
Caucasus
California Floristic Province Polynesia & Micronesia
Caribbean
Mesoamerica Chocó
Brazilian Cerrado
Tropical Andes biodiversity "hot spots"
Mountains of South-Central China Western Indo-Burma Ghats & Sri Lanka Philippines
Mediterranean Basin
Central Chile
Atlantic Forest
Guinean Forests of West Africa
Eastern Arc Mountains & Coastal Forests
Wallacea
Polynesia & Micronesia
Sundaland
Succulent Karoo
Madagascar & Indian Ocean Islands Cape Floristic Province
New Caledonia Southwest Australia New Zealand
www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1259
chapter
60 Conservation Biology
1259
11/20/09 3:08:15 PM
Numbers of Endemic Species in Some Hotspot Areas
TA B L E 6 0 . 2 Region
Mammals
Reptiles
Amphibians
160
60
253
6,000
South American Chocó
60
63
210
2,250
Philippines
115
159
65
5,832
Tropical Andes
68
218
604
20,000
7
50
24
4,331
84
301
187
9,704
Atlantic coastal forest (Brazil)
Southwestern Australia Madagascar
Plants
Cape region (South Africa)
9
19
19
5,682
California Floristic Province
30
16
17
2,125
6
56
0
2,551
75
16
51
3,500
New Caledonia South-Central China
on isolated islands, such as New Zealand, New Caledonia, and the Hawaiian Islands, where evolutionary diversification over long periods has resulted in rich biotas composed of plant and animal species found nowhere else in the world.
Human population growth in hotspots Because of the great number of endemic species that hotspots contain, conserving their biological diversity must be an important component of efforts to safeguard the world’s biological
heritage. Or, to look at it another way, by protecting just 1.4% of the world’s land surface, 44% of the world’s vascular plants and 35% of its terrestrial vertebrates can be preserved. Unfortunately, hotspots contain not only many endemic species, but also growing human populations. In 1995, these areas contained 1.1 billion people—20% of the world’s population—sometimes at high densities (figure 60.4a). More important, human populations were growing in all but one of these hotspots both because birth rates are much higher than
Figure 60.4 Human populations in hotspots. a. Human population density and (b) population growth rate in biodiversity hotspots.
?
Inquiry question Why do population density and growth rates differ among hotspots?
Western Ghats & Sri Lanka
Chocó
Philippines
Tropical Andes
Caribbean
Madagascar & Indian Ocean Islands
Sundaland
Guinean Forests of West Africa
Mediterranean Basin
Brazilian Cerrado
California Floristic Province
Mesoamerica
Guinean Forests of West Africa
Eastern Arc Mountains & Coastal Forests
Indo-Burma
Philippines
Atlantic Forest Region
Sundaland
Caucasus
New Caledonia
Polynesia & Micronesia
Cape Floristic Province
Mesoamerica
Succulent Karoo
Wallacea
Wallacea
Eastern Arc Mountains & Coastal Forests
Atlantic Forest Region
Chocó
Southwestern Australia
Cape Floristic Province
Indo-Burma
Tropical Andes
Mountains of South-Central China
Central Chile
Western Ghats & Sri Lanka
Madagascar & Indian Ocean Islands
Central Chile
Mountains of South-Central China Southwestern Australia New Zealand New Caledonia Brazilian Cerrado
Mediterranean Basin
World population density: 42 people per square km.
Polynesia & Micronesia Caribbean California Floristic Province New Zealand Caucasus
Succulent Karoo
1% 2% 3% 4%
0 100 200 300 Population Density (people per square km.)
a. 1260
part
World population growth rate: 1.2 % per year
Population Growth (annual rate)
b.
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1260
11/20/09 3:08:19 PM
death rates and because rates of immigration into these areas are often high. Overall, the rate of growth exceeded the global average in 19 hotspots (figure 60.4b). In some hotspots, the rate of growth is nearly twice that of the rest of the world. Not surprisingly, many of these areas are experiencing high rates of habitat destruction as land is cleared for agriculture, housing, and economic development. More than 70% of the original area of each hotspot has already disappeared, and in 14 hotspots, 15% or less of the original habitat remains. In Madagascar, it is estimated that 90% of the original forest has already been lost—this on an island where 85% of the species are found nowhere else in the world. In the forests of the Atlantic coast of Brazil, the extent of deforestation is even higher: 95% of the original forest is gone. Population pressure is not the only cause of habitat destruction in hotspots. Commercial exploitation to meet the demands of more affluent people in the developed world also plays an important role. For example, large-scale logging of tropical rain forests occurs in countries around the world to provide lumber, most of which ends up in the United States, western Europe, and Japan. Similarly, many forests in Central and South America are cleared to make way for cattle ranches that produce cheap meat for fast-food restaurants. Hotspots in more affluent countries are often at risk because they occur in areas where land has great value for real estate and commercial purposes, such as in Florida and California in the United States.
Learning Outcomes Review 60.1
The direct economic value of biodiversity includes resources for our survival Many species have direct value as sources of food, medicine, clothing, biomass (for energy and other purposes), and shelter. Most of the world’s food crops, for example, are derived from a small number of plants that were originally domesticated from wild plants in tropical and semiarid regions. As a result, many of our most important crops, such as corn, wheat, and rice, contain relatively little genetic variation (equivalent to a founder effect; see chapter 20), whereas their wild relatives have great diversity. In the future, genetic variation from wild strains of these species may be needed if we are to improve yields or find a way to breed resistance to new pests. In fact, recent agricultural breeding experiments have illustrated the value of conserving wild relatives of common crops. For example, by breeding commercial varieties of tomato with a small, oddly colored wild tomato species from the mountains of Peru, scientists were able to increase crop yields by 50%, while increasing both nutritional content and color. About 70% of the world’s population depends directly on wild plants as their source of medicine. In addition, about 40% of the prescription and nonprescription drugs used today have active ingredients extracted from plants or animals. Aspirin, the world’s most widely used drug, was first extracted from the leaves of the tropical willow, Salix alba. The rosy periwinkle from Madagascar has yielded potent drugs for combating childhood leukemia (figure 60.5), and drugs effective in treating
The most recent losses of biodiversity have resulted from human activities, in both prehistoric and historical times. Endemic species are found in only a single region on Earth; regions with a high number of endemic species, known as hotspots, are particularly threatened by human encroachment and their preservation is critical. ■
Why does so much resource exploitation occur in areas that are biodiversity hotspots?
60.2
The Value of Biodiversity
Learning Outcomes 1. 2.
Distinguish between the direct and indirect economic value of biodiversity. Explain what is meant by the aesthetic value of biodiversity.
Why should we worry about loss of biodiversity? The reason is that biodiversity is valuable to us in a number of ways: ■ ■ ■
Direct economic value of products we obtain from species of plants, animals, and other groups Indirect economic value of benefits produced by species without our consuming them Ethical and aesthetic values
www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1261
a.
b.
Figure 60.5 Plants of pharmaceutical importance. a. Two drugs extracted from the rosy periwinkle (Catharanthus roseus), vinblastine and vincristine, effectively treat common forms of childhood leukemia, increasing chances of survival from 20% to over 95%. b. Cancer-fighting drugs, such as taxol, have been developed from the bark of the Pacific yew (Taxus brevifolia). chapter
60 Conservation Biology
1261
11/20/09 3:08:19 PM
Indirect economic value is derived from ecosystem services Diverse biological communities are of vital importance to healthy ecosystems. They help maintain the chemical quality of natural water, buffer ecosystems against storms and drought, preserve soils and prevent loss of minerals and nutrients, moderate local and regional climate, absorb pollution, and promote the breakdown of organic wastes and the cycling of minerals. In chapter 58, we discussed the evidence that the stability and productivity of ecosystems is related to species richness. By destroying biodiversity, we are creating conditions of instability and lessened productivity and promoting desertification, waterlogging, mineralization, and many other undesirable outcomes throughout the world.
Mangrove, Thailand Economic Value (US$ per hectare)
several forms of cancer and other diseases have been produced from the Pacific yew. Overall, 62% of cancer drugs were developed from products derived from plants and animals. Only recently have biologists perfected the techniques that make possible the transfer of genes from one species to another. We are just beginning to use genes obtained from other species to our advantage (see chapter 15). So-called “gene prospecting” of the genomes of plants and animals for useful genes has only begun. We have been able to examine only a minute proportion of the world’s organisms to see whether any of their genes have useful properties for humans. By conserving biodiversity, we maintain the option of finding useful benefits in the future. Unfortunately, many of the most promising species occur in habitats, such as tropical rain forests, that are being destroyed at an alarming rate.
80,000 60,000 40,000 20,000 0
Intact
Shrimp Farming
a.
The value of intact habitats
Case study: New York City watersheds Probably the most famous example of the value of intact ecosystems is provided by the watersheds of New York City. Ninety percent of the water for the New York area’s 9 million residents comes from the Catskill Mountains and the nearby headwaters of the Delaware River (figure 60.7). Water that runs off from over 4000 km2 of rural, mountainous areas is collected into reservoirs and then transported by aqueduct more than 136.8 km to New York City at a rate of 4.9 billion liters per day. 1262
part
Tropical Forest, Cameroon 3,000 Economic Value (US$ per hectare)
Economists have recently been able to compare the societal value, in monetary terms, of intact habitats compared with the value of destroying those habitats. Surprisingly, in most studies conducted so far, intact ecosystems are more valuable than the products derived by destroying them. In Thailand, as one example, coastal mangrove habitats are commonly cleared so that shrimp farms can be established. Although the shrimp produced are valuable, their value is vastly outweighed by the benefits in timber, charcoal production, offshore fisheries, and storm protection provided by the mangroves (figure 60.6a). Similarly, intact tropical rain forest in Cameroon, West Africa, provides fruit and other forest materials. Clearing the forest for agriculture or palm plantations leads to streampolluting erosion as well as increased flooding. Combining all the costs and benefits of the three options, maintaining intact forests has the highest economic value (figure 60.6b).
2,000 1,000 0 21,000
Reduced-impact Logging
22,000
Small-scale Farming Plantation
b.
Figure 60.6 The economic value of maintaining habitats. a. Mangroves in Thailand are more valuable than shrimp farms. b. Rain forests in Cameroon provide more economic benefits if they are left standing than if they are destroyed and the land used for other purposes.
?
Inquiry question If shrimp farms established on cleared mangrove habitats make money, how can clearing mangroves not be an economic plus?
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1262
11/20/09 3:08:28 PM
Catskill/Delaware Watersheds
MA Hudson River
Catskill Aqueduct West and East Delaware Aqueducts
Croton Watershed
Delaware Aqueduct
PA
CT
NY
Delaware River Croton Aqueduct
d
un
o dS
n
g on
NJ
rain catchments NYC (9 million residents)
30 km
Isla
L
New York City
Atlantic Ocean
Figure 60.7 New York City’s water source. New York gets its water from distant rain catchments. Preserving the ecological integrity of these areas is cheaper than building new water treatment plants. In the 1990s, New York City faced a dilemma. New federal water regulations were requiring ever cleaner water, even as development and pollution in the source areas of the water were threatening to compromise water quality. The city had two choices: either work to protect the functioning ecosystem so that it could produce clean water, or construct filtration plants to clean it on arrival. Economic analysis made the choice clear: Building the plants would cost $6 billion, with annual operating costs of $300 million, whereas spending a billion dollars over 10 years could preserve the ecosystem and maintain water purity. The decision was easy.
Economic trade-offs These examples provide some idea of the value of the services that ecosystems provide. But maintaining ecosystems is not always more valuable than converting them to other uses. Certainly, when the United States was being settled and land was plentiful, ecosystem conversion was beneficial. Even today, habitat destruction sometimes is economically desirable. Nonetheless, we still have only a rudimentary knowledge of the many ways intact ecosystems provide services. Often, it is not until they are lost that the value becomes clear, as unexpected negative effects, such as increased flooding and pollution, decreased rainfall, or vulnerability to hurricanes become apparent. www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1263
The same argument can be made for preserving particular species within ecosystems. Given how little we know about the biology of most species, particularly in the tropics, it is impossible to predict all the consequences of removing a species. Imagine taking a parts list for an airplane and randomly changing a digit in one of the part numbers. You might change a seat cushion into a roll of toilet paper—or you might just as easily change a key bolt holding up a wing into a pencil. By removing biodiversity, we are gambling with the future of the ecosystems on which we depend and whose functioning we understand very little. In recent years, the field of ecological economics has developed to study how the societal benefits provided by species and ecosystems can be appropriately valued. The problem is twofold. First, until recently, we have not had a good estimate of the monetary value of services provided by ecosystems, a situation which, as you’ve just seen, is now changing. The second problem, however, is that the people who gain the benefits of environmental degradation are often not the same as the people who pay the costs. For instance, in the Thai mangrove example, the shrimp farmers reap the financial rewards, while the local people bear the costs. The same is true of factories that produce air or water pollution. Environmental economists are devising ways to appropriately value and regulate the use of the environment in ways that maximize the benefits relative to the costs to society as a whole.
Ethical and aesthetic values are based on our conscience and our consciousness Many people believe that preserving biodiversity is an ethical issue because every species is of value in its own right, even if humans are not able to exploit or benefit from it. These people feel that along with the power to exploit and destroy other species comes responsibility: As the only organisms capable of eliminating large numbers of species and entire ecosystems, and as the only organisms capable of reflecting on what we are doing, humans should act as guardians or stewards for the diversity of life around us. Almost no one would deny the aesthetic value of biodiversity—a wild mountain range, a beautiful flower, or a noble elephant—but how do we place a value on beauty or on the renewal many of us feel when we are in natural surroundings? Perhaps the best we can do is to consider the deep sense of loss we would feel if it no longer existed.
Learning Outcomes Review 60.2 The direct value of biodiversity includes resources for our survival, such as natural products and medicines that enhance our lives and can be used in a sustainable way. Indirect value includes economic benefits provided by healthy ecosystems, such as availability of clean water and recreational benefits. The aesthetic value of biodiversity refers to our sense of beauty and peace when experiencing a natural environment. ■
What arguments could you use to convince shrimp farmers to stop operations and remediate the area they are using? chapter
60 Conservation Biology
1263
11/20/09 3:08:29 PM
Factors Responsible for Extinction
60.3
Learning Outcomes 1. 2.
List the major causes of habitat destruction. Explain how these causes can interact to bring about extinction.
A variety of causes, independently or in concert, are responsible for extinctions (table 60.3). Historically, overexploitation was the major cause of extinction; although it is still a factor, habitat loss is the major problem for most groups today, and introduced species rank second. Many other factors can contribute to species extinctions as well, including disruption of ecosystem interactions, pollution, loss of genetic variation, and catastrophic disturbances, either natural or human-caused. More than one of these factors may affect a species. In fact, a chain reaction is possible in which the action of one factor predisposes a species to be more severely affected by another factor. For example, habitat destruction may lead to decreased birth rates and increased mortality rates. As a result, populations become smaller and more fragmented, making them more vulnerable to disasters such as floods or forest fires, which may eliminate populations. Also, as the habitat becomes more fragmented, populations become isolated, so that genetic interchange ceases and areas devastated by disasters are not recolonized. Finally, as populations become very small, inbreeding increases, and genetic variation is lost through genetic drift, further decreasing population fitness. Which factor acts as the final coup de grace may be irrelevant; many factors, and the interactions between them, may have contributed to a species’ eventual extinction.
TA B L E 6 0 . 3
golden toad (Bufo periglenes) which was last seen in the wild in 1989.
Amphibians are on the decline: A case study In 1963, herpetologist Jay Savage was hiking through pristine cloud forest in Costa Rica. Reaching a windswept ridge, he couldn’t believe his eyes. Before him was a huge aggregation of breeding toads. What was so amazing was the color of the toads: bright, eye-dazzling orange, unlike anything he had ever seen before (figure 60.8). The color of the toads was so amazing and unexpected that Savage briefly considered the possibility that his colleagues had played a practical joke, getting to the clearing before him and somehow coloring normal toads orange. Realizing that this could not be, he went on to study the toads, eventually describing a species new to science, the golden toad, Bufo periglenes. For the next 24 years, large numbers of toads were seen during the breeding season each spring. Their home was legally recognized as the Monteverde Cloud Forest Reserve, a well-protected, intact, and functioning ecosystem, seemingly
Causes of Extinctions P E R C E N TA G E
Group
Figure 60.8 An extinct species. A breeding assemblage of the
Habitat Loss
O F
S P E C I E S
I N F L U E N C E D
B Y
A
G I V E N
F A C T O R
Overexploitation
Species Introduction
Other
Unknown
*
E X T I N C T I O N S Mammals
19
23
20
2
36
Birds
20
11
22
2
45
5
32
42
0
21
35
4
30
4
48
Reptiles Fish T H R E A T E N E D
E X T I N C T I O N S
Mammals
68
54
6
20
—
Birds
58
30
28
2
—
Reptiles
53
63
17
9
—
Fish
78
12
28
2
—
*
Some species may be influenced by more than one factor; thus, some rows may exceed 100%.
1264
part
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1264
11/20/09 3:08:30 PM
51 86
47 46
191 74
53
66 45
68
48
61 52 50
208
55
110
163 78
47
#
threatened amphibian species
Venezuela
Panama
Madagascar
Australia
Dendrobates leucomelas
Atelopus zeteki
Mantella aurantiaca
Litoria caerulea
Figure 60.9 Amphibian extinction crisis. Boxes indicate the number of threatened species around the world. These numbers are rapidly being revised upward as scientists focus their attention on little-known species, many of which turn out to be in grave danger.
a successful model of conservation. Then, in 1988, few toads were seen, and in 1989, only a single male was observed. Since then, despite exhaustive efforts, no more golden toads have been found. Despite living in a well-protected ecosystem, with no obvious threats from pollution, introduced species, overexploitation, or any other factor, the species appears to have gone extinct, right under the eyes of watchful scientists and conservationists. How could this happen?
Frogs in trouble At the first World Herpetological Congress in 1989 in Canterbury, England, frog experts from around the world met to discuss conservation issues relating to frogs and toads. At this meeting, it became clear that the golden toad story was not unique. Experts reported case after case of similar losses: Frog populations that had once been abundant were now decreasing or entirely gone. Since then, scientists have devoted a great deal of time and effort to determining whether frogs and other amphibian species truly are in trouble and, if so, why. Unfortunately, the situation appears to be even worse than originally suspected. Amphibian experts recently reported that 43% of all amphibian www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1265
species have experienced decreases in population size, and one third of all amphibian species are threatened with extinction in countries as different as Ecuador, Venezuela, Australia, and the United States (figure 60.9). Moreover, these numbers are probably underestimates; little information exists from many areas of the world, such as Southeast Asia and central Africa. Indeed researchers think that as many as 100 species from the island nation of Sri Lanka have recently gone extinct, perhaps not surprisingly because 95% of that nation’s rain forests have also disappeared in recent times.
Cause for concern Amphibian declines are worrisome for several reasons. First, many of the species—including the golden toad—have declined in pristine, well-protected habitats. If species are becoming extinct in such areas, it brings into question our ability to preserve global biological diversity. Second, many amphibian species are particularly sensitive to the state of the environment because of their moist skin, which allows chemicals from the environment to pass into the body, and their use of aquatic habitats for larval stages, which requires unpolluted water. In other words, amphibians may be analogous to the canaries formerly used in coal mines to detect chapter
60 Conservation Biology
1265
11/20/09 3:08:31 PM
problems with air quality: If the canaries keeled over, the miners knew they had to get out. Third, no single cause for amphibian declines is apparent. Although a single cause would be of concern, it would also suggest that a coordinated global effort could reverse the trend, as happened with chlorofluorocarbons and decreasing ozone levels (see chapter 59). However, different species are afflicted by different problems, including habitat destruction, the effects of global warming, pollution, decreased stratospheric ozone levels, disease epidemics, and introduced species. The implication is that the global environment is deteriorating in many different ways. Could amphibians be global “canaries,” serving as indicators that the world’s environment is in serious trouble?
rain forest cover
Africa
Habitat loss devastates species richness As table 60.3 indicates, habitat loss is the most important cause of modern-day extinction. Given the tremendous amounts of ongoing destruction of all types of habitat, from rain forest to ocean floor, this should come as no surprise. Natural habitats may be adversely affected by humans in four ways: destruction, pollution, disruption, and habitat fragmentation.
In addition to these causes, global climate change, discussed in the previous chapter, is an insidious threat that combines many of these factors. As climate changes, habitats will change—or disappear entirely, as is the case for polar bears (Thalarctos maritimus), which require ice floes on which to hunt their seal prey. Some studies estimate that as many as 30% of all species may be imperiled by global warming.
Destruction of habitat A proportion of the habitat available to a particular species may simply be destroyed. This destruction is a common occurrence in the “clear-cut” harvesting of timber, in the burning of tropical forest to produce grazing land, and in urban and industrial development. Deforestation has been, and continues to be, by far the most pervasive form of habitat disruption (figure 60.10). Many tropical forests are being cut or burned at a rate of 1% or more per year. To estimate the effect of reductions in habitat available to a species, biologists often use the well-established observation that larger areas support more species (see figure 58.22). Although this relationship varies according to geographic area, type of organism, and type of area, in general a 10-fold increase in area leads to approximately a doubling in the number of species. This relationship suggests, conversely, that if the area of a habitat is reduced by 90%, so that only 10% remains, then half of all species will be lost. Evidence for this hypothesis comes from a study in Finland of extinction rates of birds on habitat islands (that is, islands of a particular type of habitat surrounded by unsuitable habitat) where the population extinction rate was found to be inversely proportional to island size (figure 60.11). 1266
part
Before human colonization
1950
1985
2000
Figure 60.10 Extinction and habitat destruction. The rain forest covering the eastern coast of Madagascar, an island off the coast of East Africa, has been progressively destroyed and fragmented as the island’s human population has grown. Ninety percent of the eastern coast’s original forest cover is now gone. Many species have become extinct, and many others are threatened, including 16 of Madagascar’s 31 primate species.
Population Extinction Rate (per year)
1. 2. 3. 4.
0.5
0.4
0.3
0.2
0.1 0.0 10−2
1 Area (km2)
102
Figure 60.11 Extinction and island area. The data present percent extinction rates for populations as a function of habitat area for birds on a series of Finnish habitat islands. Smaller islands experience far greater extinction rates.
?
Inquiry question Why does extinction rate increase with decreasing island size?
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1266
11/20/09 3:08:36 PM
Figure 60.12 Fragmentation of woodland habitat. From the time of settlement of Cadiz Township, Wisconsin, the forest has been progressively reduced from a nearly continuous cover to isolated woodlots covering less than 1% of the original area. 1831
1882
1902
Pollution Habitat may be degraded by pollution to the extent that some species can no longer survive there. Degradation occurs as a result of many forms of pollution, from acid rain to pesticides. Aquatic environments are particularly vulnerable; for example, many northern lakes in both Europe and North America have been essentially sterilized by acid rain (see chapter 59).
Disruption Human activities may disrupt a habitat enough to make it untenable for some species. For example, visitors to caves in Alabama and Tennessee caused significant population declines in bats over an 8-year period, some as great as 100%. When visits were fewer than one per month, less than 20% of bats were lost, but caves having more than four visits per month suffered population declines of 86% to 95%. More generally, humans often alter the interactions that occur among species, such as the predator–prey or symbiotic relationships discussed in chapter 57. These disruptions can have far-ranging effects throughout an ecosystem. For example, when pollinating insects are killed off by insecticides, many plants do not reproduce, thus affecting all the animals that depend on the plants and their seeds for food.
Habitat fragmentation Loss of habitat by a species frequently results not only in lowered population numbers, but also in fragmentation of the population into unconnected patches (figure 60.12). A habitat also may become fragmented in nonobvious ways, as when roads and habitation intrude into forest. The effect is to carve the populations living in the habitat into a series of smaller populations, often with disastrous consequences because of the relationship between range size and extinction rate. Although detailed data
1950
are not available, fragmentation of wildlife habitat in developed temperate areas is thought to be very substantial. As habitats become fragmented and shrink in size, the relative proportion of the habitat that occurs on the boundary, or edge, increases. Edge effects can significantly degrade a population’s chances of survival. Changes in microclimate (such as temperature, wind, humidity) near the edge may reduce appropriate habitat for many species more than the physical fragmentation suggests. In isolated fragments of rain forest, for example, trees on the edge are exposed to direct sunlight. As a result, these trees experience hotter and drier conditions than those normally encountered in the cool, moist forest interior, leading to negative effects on their survival and growth. In one study, the biomass of trees within 100 m of the forest edge decreased by 36% in the first 17 years after fragment isolation. Also, increasing habitat edges opens up opportunities for some parasite and predator species that are more effective at edges. As fragments decrease in size, the proportion of habitat that is distant from any edge decreases, and consequently, more and more of the habitat is within the range of these species. Habitat fragmentation is blamed for local extinctions in a wide range of species. The impact of habitat fragmentation can be seen clearly in a study conducted in Manaus, Brazil, where the rain forest was commercially logged. Landowners agreed to preserve patches of rain forest of various sizes, and censuses of these patches were taken before the logging started, while they were still part of a continuous forest. After logging, species began to disappear from the now-isolated patches (figure 60.13). First to go were the monkeys, which have large home ranges. Birds that prey on the insects flushed out by marching army ants followed, disappearing from patches too small to maintain enough army ant colonies to support them. As expected, the
Figure 60.13 A study of habitat fragmentation. Landowners in Manaus, Brazil, agreed to preserve patches of rain forest of different sizes to examine the effect of patch size on species extinction. Biodiversity was monitored in the isolated patches before and after logging. Fragmentation led to significant species loss within patches. Army ants were one of the species that disappeared from smaller patches. chapter
rav32223_ch60_1256-1280.indd 1267
60 Conservation Biology
1267
11/20/09 3:08:41 PM
Case study: Songbird declines Every year since 1966, the U.S. Fish and Wildlife Service has organized thousands of amateur ornithologists and birdwatchers in an annual bird count called the Breeding Bird Survey. In recent years, a shocking trend has emerged. While year-round residents that prosper around humans, such as robins, starlings, and blackbirds, have increased their numbers and distribution over the last 30 years, forest songbirds have declined severely. The decline has been greatest among long-distance migrants such as thrushes, orioles, tanagers, vireos, buntings, and warblers. These birds nest in northern forests in the summer, but spend their winters in South or Central America or the Caribbean Islands. In many areas of the eastern United States, more than three-quarters of the tropical migrant bird species have declined significantly. Rock Creek Park in Washington, D.C., for example, has lost 90% of its long-distance migrants in the past 20 years. Nationwide, American redstarts declined about 50% in the single decade of the 1970s. Studies of radar images from National Weather Service stations in Texas and Louisiana indicate that only about half as many birds fly over the Gulf of Mexico each spring as did in the 1960s. This suggests a total loss of about half a billion birds. The culprit responsible for this widespread decline appears to be habitat fragmentation and loss. Fragmentation of breeding habitat and nesting failures in the summer nesting grounds of the United States and Canada have had a major negative effect on the breeding of woodland songbirds. Many of the most threatened species are adapted to deep woods and need an area of 25 acres or more per pair to breed and raise their young. As woodlands are broken up by roads and developments, it is becoming increasingly difficult for them to find enough contiguous woods to nest successfully. A second and perhaps even more important factor is the availability of critical winter habitat in Central and South America. Studies of the American redstart clearly indicate that birds with better winter habitat have a superior chance of successfully migrating back to their breeding grounds in the spring. In a recent study, scientists were able to determine the quality of the habitat that particular birds used during the winter by examining levels of the stable carbon isotope 13C in their blood. Plants growing in the best habitats in Jamaica and Honduras (mangroves and wetland forests) have low levels of 13C, and so do the redstarts that feed on the insects that live in them. Of these wet-forest birds, 65% maintained or gained weight over the winter. By contrast, plants growing in substandard dry scrub have high levels of 13C, and so do the redstarts that feed in those habitats. Scrub-dwelling birds lost up to 11% of their body mass over the winter. Now here’s the key: Birds that winter in 1268
part
the substandard scrub leave later in the spring on the long flight to northern breeding grounds, arrive later at their summer homes, and have fewer young (figure 60.14). The proportion of 13C in birds arriving in New Hampshire breeding grounds increases as spring wears on and scruboverwintering stragglers belatedly arrive. Thus, loss of mangrove habitat in the neotropics is having a quantifiable negative influence. As the best habitat disappears, overwintering birds fare poorly, and this leads to decreased reproduction and population declines. Unfortunately, the Caribbean lost about 10% of its mangroves in the 1980s, and continues to lose about 1% per year. This loss of key habitat appears to be a driving force in the looming extinction of some songbirds.
Overexploitation wipes out species quickly Species that are hunted or harvested by humans have historically been at grave risk of extinction, even when the species is initially very abundant. A century ago, the skies of North America were darkened by huge flocks of passenger pigeons, but after being hunted as free and tasty food, they were driven to extinction. The bison that used to migrate in enormous herds
Stable Carbon Isotope Values Ratio (13C:12C)
extinction rate was negatively related to patch size, but even the largest patches (100 hectares) lost half of their bird species in less than 15 years. Because some species, such as monkeys, require large patches, large fragments are indispensable if we wish to preserve high levels of biodiversity. The take-home lesson is that preservation programs will need to provide suitably large habitat fragments to avoid this effect.
May 12
May 17
May 22
May 27
June 1
Figure 60.14 The American redstart (Setophaga ruticilla) a migratory songbird. The numbers of this species are in serious decline. The graph presents data on the ratio of 13C to 12 C in male redstarts arriving at summer breeding grounds. Early arrivals, which have higher reproductive success, have lower proportions of 13C to 12C, indicating they wintered in more favorable mangrove–wetland forest habitats.
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1268
11/20/09 3:08:42 PM
Commercial motivation for exploitation The existence of a commercial market often leads to overexploitation of a species. The international trade in furs, for example, has severely reduced the numbers of chinchilla, vicuña, otter, and many cat species. The harvesting of commercially valuable trees provides another example: Almost all West Indies mahogany trees (Swietenia mahogani) have been logged, and the extensive cedar forests of Lebanon, once widespread at high elevations, now survive in only a few isolated groves. A particularly telling example of overexploitation is the commercial harvesting of fish in the North Atlantic. During the 1980s, fishing fleets continued to harvest large amounts of cod off the coast of Newfoundland, even as the population numbers declined precipitously. By 1992, the cod population had dropped to less than 1% of its original numbers. The American and Canadian governments have closed the fishery, but no one can predict whether the fish populations will recover. The Atlantic bluefin tuna has experienced a 90% population decline in the past 10 years. The swordfish has declined even further. In both cases, the drop has led to even more intense fishing of the remaining populations.
Case study: Whales Whales, the largest living animals that ever evolved, are rare in the world’s oceans today, their numbers driven down by commercial whaling. Before the advent of cheap, high-grade oils manufactured from petroleum in the early 20th century, oil made from whale blubber was an important commercial product in the worldwide marketplace. In addition, the fine, latticelike structure termed “baleen” used by baleen whales to filter-feed plankton from seawater was used in women’s undergarments. Because a whale is such a large animal, each individual captured is of significant commercial value. In the 18th century, right whales were the first to bear the brunt of commercial whaling. They were called “right” whales because they were slow, easy to capture, did not sink when killed and provided up to 150 barrels of blubber oil and abundant baleen, making them the right whale for a commercial whaler to hunt. As the right whale declined, whalers turned to the gray, humpback, and bowhead whales. As their numbers declined, whalers turned to the blue, the largest of all whales, and when those were decimated, to the fin, then the Sei, and then the sperm whales. As each species of whale became the focus of commercial whaling, its numbers began a steep decline (figure 60.15). Hunting of right whales was made illegal in 1935. By then, they had been driven to the brink of extinction, their numbers less than 5% of what they had been. Although protected ever since, their numbers have not recovered in either the North Atlantic or the North Pacific. By 1946, several other whale species faced imminent extinction, and whaling nations formed the International Whaling Commission (IWC) to regulate commercial whale hunting. Like a fox guarding the henhouse, the IWC for decades did little to limit whale harvests, and whale numbers continued to decline steeply. www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1269
Finally, in 1974, when the numbers of all but the small minke whales had been driven down, the IWC banned hunting of blue, gray, and humpback whales, and instituted partial bans on other species. The rule was violated so often, however, that the IWC in 1986 instituted a worldwide moratorium on all commercial killing of whales. Although some commercial whaling continues, often under the guise of harvesting for scientific studies, annual whale harvests have dropped dramatically in the last 20 years. Some species appear to be recovering, but others are not. Humpback numbers have more than doubled since the early 1960s, increasing nearly 10% annually, and Pacific gray whales have fully recovered to their previous numbers of about 20,000 animals, after having been hunted to fewer than 1000. Right, sperm, fin, and blue whales have not recovered, and no one knows whether they ever will.
Introduced species threaten native species and habitats Colonization, a natural process by which a species expands its geographic range, occurs in many ways: A flock of birds gets blown off course, a bird eats a fruit and defecates its seed miles away, or lowered sea levels connect two previously isolated landmasses, allowing species to freely move back and forth. Such events—particularly those leading to successful establishment of a new population—probably occur rarely, but when they do, the resulting change to natural communities can be large. The reason is that colonization brings together species with no history of interaction. Consequently, ecological interactions may
Number of Whales Caught (in thousands)
across the central plains of North America only narrowly escaped the same fate.
30 25 20
blue fin humpback sei sperm minke
15 10 5 0 1910
1920
1930
1940
1950 Year
1960
1970
1980
1990
Figure 60.15 World catch of some whale species in the 20th century. Each species is hunted in turn until its numbers fall so low that hunting it becomes commercially unprofitable.
?
Inquiry question Why might whale populations fail to recover once hunting is stopped? chapter
60 Conservation Biology
1269
11/20/09 3:08:43 PM
Figure 60.16 Zebra mussels (Dreissena polymorpha) clogging a pipe. These mussels were introduced from Europe, and are now a major problem in North American rivers.
be particularly strong because the species have not evolved ways of adjusting to the presence of one another, such as adaptations to avoid predation or to minimize competitive effects. The paleontological record documents many cases in which geologic changes brought previously isolated species together, such as when the Isthmus of Panama emerged above the sea approximately 3 mya, connecting the previously isolated fauna and flora of North and South America. In some cases, the result has been an increase in species diversity, but in other cases, invading species have led to the extinction of natives.
Human influence on colonization Unfortunately, what was naturally a rare process has become all too common in recent years, thanks to the actions of humans. Species introductions due to human activities occur in many ways, sometimes intentionally, but usually not. Plants and animals can be transported in the ballast of large ocean vessels; in nursery plants; as stowaways in boats, cars, and planes; as beetle larvae within wood products—even as seeds or spores in the mud stuck to the bottom of a shoe. Overall, some researchers estimate that as many as 50,000 species have been introduced into the United States.
The effects of introductions on humans have been enormous. In the United States alone, nonnative species cost the economy an estimated $140 billion per year. For example, dozens of foreign weeds in Colorado have covered more than a million acres. Just three of these species cost wheat farmers tens of millions of dollars. At the same time, leafy spurge, a plant from Europe, outcompetes native grasses, ruining rangeland for cattle at a price tag of $144 million per year. The zebra mussel, a mollusk native to the Black Sea region, is a huge problem throughout much of the eastern and central United States, where it can attain densities as high as 700,000/m2, clogging pipes, including those for water and power plants, and causing an estimated $3 to $5 billion damage a year (figure 60.16). Introduced species can also affect human health. For example, West Nile fever was probably introduced from Africa or the Middle East to the United States in the late 1990s. The effect of species introductions on native ecosystems is equally dramatic. Islands have been particularly affected. For example, as mentioned in chapter 57, a single lighthouse keeper’s cat wiped out an entire species, the Stephens Island wren. Rats had a devastating effect throughout the South Pacific where bird species nested on the ground and had no defense against the voracious predators to which they were evolutionarily naive. More recently, the brown tree snake, introduced to the island of Guam, essentially eliminated all species of forest birds. In Hawaii, the problem has been slightly different: Introduced mosquitoes brought with them malaria, to which the native species had evolved no resistance. The result is that more than 100 species (>70% of the native fauna) either became extinct or are now restricted to higher and cooler elevations where the mosquitoes don’t occur (figure 60.17). The effects of introduced species are not always direct, but instead may reverberate throughout an ecosystem. For example, the Argentine ant has spread through much of the southern United States, greatly reducing populations of most native ant species with which it comes in contact. The extinction of these ant species has had a dramatic negative effect on the coast horned lizard (Phrynosoma coronatum), which feeds on the larger native species. In their absence, the lizards have shifted to less-preferred prey species. In addition, the native ant species consume seeds, and in the process, play an important
Figure 60.17 The akiapolaau (Hemignathus munroi) and the Palila (Loxioides bailleui), endangered Hawaiian birds. More than two-thirds of Hawaii’s native bird species are now extinct or have been greatly reduced in population size. Bird faunas on islands around the world have experienced similar declines after human arrival.
1270
part
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1270
11/20/09 3:08:43 PM
role in seed dispersal. Argentine ants, by contrast, do not eat seeds. In South Africa, where the Argentine ant has also appeared, at least one plant species has experienced decreased reproductive success due to the loss of its dispersal agent. The most dramatic effects of introduced species, however, occur when entire ecosystems are transformed. Some plant species can completely overrun a habitat, displacing all native species and turning the area into a monoculture (that is, an area occupied by a single species). In California, the yellow star thistle now covers 4 million hectares of what was once highly productive grassland. In Hawaii, a small tree native to the Canary Islands, Myrica faya, has spread widely. Because it is able to fix nitrogen at high rates, it has caused a 90-fold increase in the nitrogen content of the soil, thus allowing other, nitrogenrequiring species to invade.
Efforts to combat introduced species Once an introduced species becomes established, eradicating it is often extremely difficult, expensive, and time-consuming. Some efforts—such as the removal of goats and rabbits from certain small islands—have been successful, but many other efforts have failed. The best hope for stopping the ravages of introduced species is to prevent them from being introduced in the first place. Although easier said than done, government agencies are now working strenuously to put into place procedures that can intercept species in transit, before they have the opportunity to become established.
Case study: Lake Victoria cichlids Lake Victoria, an immense, shallow, freshwater sea about the size of Switzerland in the heart of equatorial East Africa, used to be home to an incredibly diverse collection of over 300 species of cichlid fishes (see figure 22.15). These small, perchlike fish range from 5 to 13 cm in length, with males having endless varieties of color. Today, most of these cichlid species are threatened, endangered, or extinct. What happened to bring about the abrupt loss of so many endemic cichlid species? In 1954, the Nile perch, a commercial fish with a voracious appetite, was purposely introduced on the Ugandan shore of Lake Victoria. Nile perch, which grow to over a meter in length, were to form the basis of a new fishing industry (figure 60.18). For decades, these perch did not seem to have a significant effect; over 30 years later, in 1978, Nile perch still made up less than 2% of the fish harvested from the lake. Then something happened to cause the Nile perch population to explode and to spread rapidly through the lake, eating their way through the cichlids. By 1986, Nile perch constituted nearly 80% of the total catch of fish from the lake and the endemic cichlid species were virtually gone. Over 70% of cichlid species disappeared, including all open-water species. So what happened to kick-start the mass extinction of the cichlids? The trigger seems to have been eutrophication. Before 1978, Lake Victoria had high oxygen levels at all depths, down to the bottom layers more than 60 m deep. However, by 1989 high inputs of nutrients from agricultural runoff and sewage from towns and villages had led to algal blooms that severely depleted oxygen levels in deeper parts of the lake. Cichlids feed on algae, and initially their population numbers are thought to www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1271
Figure 60.18 Nile perch (Lates niloticus). This predatory fish, which can reach a length of 2 m and a mass of 200 kg, was introduced into Lake Victoria as a potential food source. It is responsible for the virtual extinction of hundreds of species of cichlid fishes. have risen in response to this increase in their food supply, but unlike the conditions during similar algal blooms of the past, the Nile perch was present to take advantage of the situation. With a sudden increase in its food supply (cichlids), the numbers of Nile perch exploded, and they simply ate all available cichlids. Since 1990, the situation has been compounded by the introduction into Lake Victoria of a floating water weed from South America, the water hyacinth Eichhornia crassipes. Reproducing quickly under eutrophic conditions, thick mats of water hyacinth soon covered entire bays and inlets, choking off the coastal habitats of non-open-water cichlids.
Disruption of ecosystems can cause an extinction cascade Species often become vulnerable to extinction when their web of ecological interactions becomes seriously disrupted. Because of the many relationships linking species in an ecosystem (see chapter 58), human activities that affect one species can have ramifications throughout an ecosystem, ultimately affecting many other species. A recent case in point involves the sea otters that live in the cold waters off Alaska and the Aleutian Islands. Otter populations have declined sharply in recent years. In a 500-mile stretch of coastline, otter numbers have dropped from 53,000 in the 1970s to an estimated 6000, a plunge of nearly 90%. Investigating this catastrophic decline, marine ecologists uncovered a chain of interactions among the species of the ocean and kelp forest ecosystems, a falling-domino series of lethal effects that illustrates the concepts of both top-down and bottom-up trophic cascades discussed in chapter 58.
Case study: Alaskan near-shore habitat The first in a series of events leading to the sea otter’s decline seems to have been the heavy commercial harvesting of whales, chapter
60 Conservation Biology
1271
11/20/09 3:08:47 PM
described earlier in this chapter. Without whales to keep their numbers in check, ocean zooplankton thrived, leading in turn to proliferation of a species of fish called pollock that feeds on the abundant zooplankton. Given this ample food supply, the pollock proved to compete very successfully with other northern Pacific fish, such as herring and ocean perch, so that levels of these other fish fell steeply in the 1970s. Then the falling chain of dominoes began to accelerate. The decline in the nutritious forage fish led to an ensuing crash in Alaskan populations of sea lions and harbor seals, for which pollock did not provide sufficient nourishment. This decline may also have been hastened by orcas (also called killer whales) switching from feeding on the less-available whales to feeding on seals and sea lions; the numbers of these pinniped species have fallen precipitously since the 1970s. When pinniped numbers crashed, some orcas, faced with a food shortage, turned to the next best thing: sea otters. In one bay where the entrance from the sea was too narrow and shallow for orcas to enter, only 12% of the sea otters have disappeared, while in a similar bay that orcas could enter easily, two-thirds of the otters disappeared in a year’s time. Without otters to eat them, the population of sea urchins exploded, eating the kelp and thus “deforesting” the kelp forests and denuding the ecosystem (figure 60.19). As a result, fish species that live in the kelp forest, such as sculpins and greenlings, are declining.
Loss of keystone species As discussed in chapter 57, a keystone species is a species that exerts a greater influence on the structure and functioning of an ecosystem than might be expected solely on the basis of its abundance. The sea otters of figure 60.19 are a keystone species of the kelp forest ecosystem, and their removal can have disastrous consequences. No hard-and-fast line allows us to clearly identify keystone species. Rather, it is a qualitative concept, a statement that indicates a species plays a particularly important role in its community. Keystone species are usually characterized by the strength of their effect on their community.
Case study: Flying foxes The severe decline of many species of “flying foxes,” a type of bat (figure 60.20), in the Old World tropics is an example of how the loss of a keystone species can dramatically affect the other species living within an ecosystem, sometimes even leading to a cascade of further extinctions. These bats have very close relationships with important plant species on the islands of the Pacific and Indian Oceans. The family Pteropodidae contains nearly 200 species, approximately one-quarter of them in the genus Pteropus, and is widespread on the islands of the South Pacific,where they are the most important— and often the only—pollinators and seed dispersers.
Figure 60.19 Disruption of the kelp forest ecosystem. Overharvesting by commercial whalers altered the balance of fish in the ocean ecosystem, inducing killer whales to feed on sea otters, a keystone species of the kelp forest ecosystem.
1. Whales Overharvesting of plankton-eating whales may have caused an increase in plankton-eating pollock populations.
4. Killer whales With the decline in their prey populations of sea lions and seals, killer whales turned to a new source of food: sea otters.
2. Nutritious fish Populations of nutritious fish like ocean perch and herring declined, likely due to competition with pollock.
3. Sea lions and harbor seals Sea lion and harbor seal populations drastically declined in Alaska, probably because the less-nutritious pollock could not sustain them.
5. Sea otters Sea otter populations declined so dramatically that they disappeared in some areas.
7. Kelp forests Severely thinned by the sea urchins, the kelp beds no longer support a diversity of fish species, which may lead to a decline in populations of eagles that feed on the fish.
6. Sea urchins Usually the preferred food of sea otters, sea urchin populations now exploded and fed on kelp.
rav32223_ch60_1256-1280.indd 1272
11/20/09 3:08:48 PM
Small populations are particularly vulnerable Because of the factors just discussed, populations of many species are fragmented and reduced in size. Such populations are particularly prone to extinction.
Demographic factors Small populations are vulnerable to events that decrease survival or reproduction. For example, by nature of their size, small populations are ill-equipped to withstand catastrophes, such as a flood, forest fire, or disease epidemic. One example is provided by the history of the heath hen. Although the species was once common throughout the eastern United States, hunting pressure in the 18th and 19th centuries eventually eliminated all but one population, on the island of Martha’s Vineyard near Cape Cod, Massachusetts. Protected in a nature preserve, the population was increasing in number until a fire destroyed most of the preserve’s habitat. The small surviving population was then ravaged the next year by an unusual congregation of predatory birds, followed shortly thereafter by a disease epidemic. The last sighting of a heath hen, a male, was in 1932 (figure 60.21a) . When populations become extremely small, bad luck can spell the end. For example, the dusky seaside sparrow (figure 60.21b), a now-extinct subspecies that was found on the east coast of Florida, dwindled to a population of five individuals, all of which happened to be males. In a large population, the probability that all individuals will be of one sex is infinitesimal. But in small populations, just by the luck of the draw, it is possible that 5 or 10 or even 20 consecutive births will all be individuals of one sex, and that can be enough to send a species to extinction. In addition, when populations are small, individuals may have trouble finding each other (the Allee effect discussed in chapter 56), thus leading the population into a downward spiral toward extinction.
Figure 60.20 The importance of keystone species. Flying foxes, a type of fruit-eating bat, are keystone species on many Old World tropical islands. It pollinates many plants and is a key disperser of seeds. Its elimination due to hunting and habitat loss is having a devastating effect on the ecosystems of many South Pacific Islands.
A study in Samoa found that 80% to 100% of the seeds landing on the ground during the dry season were deposited by flying foxes, which eat the fruits and defecate the seeds, often moving them great distances in the process. Many species are entirely dependent on these bats for pollination. Some have evolved features such as night-blooming flowers that prevent any other potential pollinators from taking over the role of the fruit bats. In Guam, the two local species of flying fox have recently been driven extinct or nearly so, with a substantial impact on the ecosystem. Botanists have found that some plant species are not fruiting or are doing so only marginally, producing fewer fruits than normal. Fruits are not being dispersed away from parent plants, so seedlings are forced to compete, usually unsuccessfully, with adult trees. Flying foxes are being driven to extinction by human hunters who kill them for food and for sport, and by orchard farmers who consider them pests. Flying foxes are particularly vulnerable because they live in large and obvious groups of up to a million individuals. Because they move in regular and predictable patterns and can be easily tracked to their home roost, hunters can easily kill thousands at a time. Programs aimed at preserving particular species of flying foxes are only just beginning. One particularly successful example is the program to save the Rodrigues fruit bat, Pteropus rodricensis, which occurs only on Rodrigues Island in the Indian Ocean near Madagascar. The population dropped from about 1000 individuals in 1955 to fewer than 100 by 1974, largely due to the loss of the fruit bat’s forest habitat to farming. Since 1974, the species has been legally protected, and the forest area of the island is being increased through a treeplanting program. Eleven captive-breeding colonies have been established, and the bat population is now increasing rapidly. The combination of legal protection, habitat restoration, and captive breeding has in this instance produced a very effective preservation program. www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1273
a. b.
Figure 60.21 Alive no more. a. A museum specimen of the heath hen (Tympanuchus cupido cupido) which went extinct in 1932. b. This male was one of the last dusky seaside sparrows (Ammodramus maritimus nigrescens). chapter
60 Conservation Biology
1273
11/20/09 3:08:56 PM
Lack of genetic variability Small populations face a second dilemma. Because of their low numbers, such populations are prone to the loss of genetic variation as a result of genetic drift (figure 60.22). Indeed, many small populations contain little or no genetic variability. The result of such genetic homogeneity can be catastrophic. Genetic variation is beneficial to a population both because of heterozygote advantage (see chapter 20) and because genetically variable individuals tend not to have two copies of deleterious recessive alleles. Populations lacking variation are often composed of sickly, unfit, or sterile individuals. Laboratory groups of rodents and fruit flies that are maintained at small population sizes often perish after a few generations as each generation becomes less robust and fertile than the preceding one. Although it is difficult to demonstrate that a species has gone extinct because of lack of genetic variation, studies of both zoo and natural populations clearly reveal that more genetically variable individuals have greater fitness. Furthermore, in the longer term, populations with limited genetic variation have diminished ability to adapt to changing environments.
Interaction of demographic and genetic factors As populations decrease in size, demographic and genetic factors combine to cause what has been termed an “extinction vortex.” That is, as a population gets smaller, it becomes more vulnerable to demographic catastrophes. In turn, genetic variation starts to be lost, causing reproductive rates to decline and population numbers to decline even further, and so on. Eventually, the population disappears entirely, but attributing its demise to one particular factor would be misleading.
Case study: Prairie chickens The greater prairie chicken, a close relative of the now-extinct heath hen, is a showy, 2-lb bird renowned for its flamboyant mating rituals (figure 60.23). Abundant in many midwestern states, the prairie chickens in Illinois have in the past six decades undergone a population collapse.
Polymorphism (%)
40 30 20 10 0 1
100
1,000 10,000 100,000 1,000,000 Population Size (log)
Figure 60.22 Loss of genetic variability in small populations. The percentage of genes that are polymorphic in isolated populations of the tree Halocarpus bidwillii in the mountains of New Zealand is a sensitive function of population size.
? 1274
Inquiry question Why do small populations lose genetic variation?
part
Figure 60.23 A mating ritual. The male greater prairie chicken (Tympanuchus cupido pinnatus) inflates bright orange air sacs, part of his esophagus, into balloons on each side of his head. As air is drawn into the sacs, it creates a three-syllable low frequency “boom-boom-boom” that can be heard for kilometers. Once, enormous numbers of birds occurred throughout the state, but with the 1837 introduction of the steel plow, the first that could slice through the deep, dense root systems of prairie grasses, the Illinois prairie began to be replaced by farmland. By the turn of the 20th century, the prairie had all but vanished, and by 1931, the heath hen had become locally extinct in Illinois. The greater prairie chicken fared little better, its numbers falling to 25,000 statewide in 1933 and then to 2000 by 1962. In surrounding states with less intensive agriculture, it continued to prosper. In 1962 and 1967, sanctuaries were established in Illinois to attempt to preserve the greater prairie chicken. But privately owned grasslands kept disappearing, along with their prairie chickens, and by the 1980s the birds were extinct in Illinois except for two preserves, and even there, their numbers kept falling. By 1990, the egg hatching rate, which at one time had averaged between 91% and 100%, had dropped to an extremely low 38%. By the mid-1990s, the count of males had dropped to as low as six in each sanctuary. What was wrong with the sanctuary populations? One suggestion was that because of very small population sizes and a mating ritual whereby one male may dominate a flock, the Illinois prairie chickens had lost so much genetic variability as to create serious genetic problems. To test this idea, biologists at the University of Illinois compared DNA from frozen tissue samples of birds that had died in Illinois between 1974 and 1993, and found that in recent years Illinois birds had indeed become genetically less diverse. The researchers then extracted DNA from tissue in the roots of feathers from stuffed birds collected in the 1930s from the same population. They found that Illinois birds had lost fully one-third of the genetic diversity of birds living in the same place before the population collapse of the 1970s. By contrast, prairie chicken populations in other states still contained much of the genetic variation that had disappeared from Illinois populations. Now the stage was set to halt the Illinois prairie chicken’s race toward extinction in Illinois. Wildlife managers began to
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1274
11/20/09 3:09:04 PM
transplant birds from genetically diverse populations of Minnesota, Kansas, and Nebraska to Illinois. Between 1992 and 1996, a total of 518 out-of-state prairie chickens were brought in to interbreed with the Illinois birds, and hatching rates were back up to 94% by 1998. It looks as though the prairie chickens have been saved from extinction in Illinois. The key lesson here is the importance of not allowing things to go too far—not to drop down to a single isolated population. Without the outlying genetically different populations, the prairie chickens in Illinois could not have been saved. When the last population of the dusky seaside sparrow lost its last female, there was no other source of females, and the subspecies went extinct.
Learning Outcomes Review 60.3 Habitat factors responsible for extinction include habitat destruction, pollution, disruption, and fragmentation. Overexploitation can reduce populations to low levels or eliminate them entirely. Introduced species can wreak havoc on native communities. Finally, small populations have less ability to rebound from catastrophes and are vulnerable to loss of genetic variation. Interaction of all these factors can hasten species’ decline into extinction. ■
Destroyed habitats can sometimes be restored Conservation biology typically concerns itself with preserving populations and species in danger of decline or extinction. Conservation, however, requires that there be something left to preserve; in many situations, conservation is no longer an option. Species, and in some cases whole communities, have disappeared or been irretrievably modified. The clear-cutting of the temperate forests of Washington State leaves little behind to conserve, as does converting a piece of land into a wheat field or an asphalt parking lot. Redeeming these situations requires restoration rather than conservation. Three quite different sorts of habitat restoration programs might be undertaken, depending on the cause of the habitat loss.
Pristine restoration In ecosystems where all species have been effectively removed, conservationists might attempt to restore the plants and animals that are the natural inhabitants of the area, if these species can be identified. When abandoned farmland is to be restored to prairie, as in figure 60.24, how would conservationists know what to plant?
Does it make sense to take endangered species out of the wild to preserve them if their habitat is allowed to disappear? Explain.
60.4
Approaches for Preserving Endangered Species and Ecosystems
Learning Outcomes 1. 2. 3.
Distinguish between restoration of species and restoration of ecosystem functioning. List the strategies for habitat restoration. Explain the rationale for captive breeding programs.
Once the cause of a species’ endangerment is known, it becomes possible to design a recovery plan. If the cause is commercial overharvesting, regulations can be issued to restrict harvesting and protect the threatened species. If the cause is habitat loss, plans can be instituted to restore the habitat. Loss of genetic variability in isolated subpopulations can be countered by transplanting individuals from genetically different populations. Populations in immediate danger of extinction can be captured, introduced into a captive-breeding program, and later reintroduced to other suitable habitat. All of these solutions are extremely expensive. But as Bruce Babbitt, Secretary of the Interior in the Clinton administration, noted, it is much more economical to prevent “environmental trainwrecks” from occurring than to clean them up afterward. Preserving ecosystems and monitoring species before they are threatened is the most effective means of protecting the environment and preventing extinctions. www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1275
a.
b.
Figure 60.24 Habitat restoration. The University of Wisconsin–Madison Arboretum has pioneered restoration ecology. a. The restoration of the prairie was at an early stage in November 1935. b. The prairie as it looks today. This picture was taken at approximately the same location as the 1935 photograph. chapter
60 Conservation Biology
1275
11/20/09 3:09:06 PM
Removing introduced species Sometimes the habitat has been destroyed by a single introduced species. In such a case, habitat restoration involves removing the introduced species. Restoration of the once-diverse cichlid fishes to Lake Victoria will require more than breeding and restocking the endangered species. The introduced water hyacinth and Nile perch populations will have to be brought under control or removed, and eutrophication will have to be reversed. It is important to act quickly if an introduced species is to be removed. When aggressive African bees (the so-called “killer bees”) were inadvertently released in Brazil, they remained confined to the local area for only one season. Now they occupy much of the western hemisphere.
Cleanup and rehabilitation Habitats seriously degraded by chemical pollution cannot be restored until the pollution is cleaned up. The successful restoration of the Nashua River in New England is one example of how a concerted effort can succeed in restoring a heavily polluted habitat to a relatively pristine condition. Once so heavily polluted by chemicals from dye manufacturing plants that it was different colors in different places, the river is now clean and used for many recreational activities.
Captive breeding programs have saved some species Recovery programs, particularly those focused on one or a few species, must sometimes involve direct intervention in natural populations to avoid an immediate threat of extinction.
Case study: The peregrine falcon American populations of birds of prey, such as the peregrine falcon, began an abrupt decline shortly after World War II. Of the approximately 350 breeding pairs east of the Mississippi River in 1942, all had disappeared by 1960. The culprit proved to be the chemical pesticide DDT (Chapter 59). The use of DDT was banned by federal law in 1972, causing levels in the eastern United States to fall quickly. However, no peregrine falcons were left in the eastern United States to reestablish a natural population. Falcons from other parts of the country were used to establish a 1276
part
captive-breeding program at Cornell University in 1970, with the intent of reestablishing the peregrine falcon in the eastern United States by releasing offspring of these birds. By the end of 1986, over 850 birds had been released in 13 eastern states, producing an astonishingly strong recovery (figure 60.25).
Case study: The California condor The number of California condors (Gymnogyps californianus), a large, vulture-like bird with a wingspan of nearly 3 m, has been declining gradually for the past 200 years. By 1985, condor numbers had dropped so low that the bird was on the verge of extinction. Six of the remaining 15 wild birds disappeared in that year alone. The entire breeding population of the species consisted of the birds remaining in the wild and an additional 21 birds in captivity. In a last-ditch attempt to save the condor from extinction, the remaining birds were captured and placed in a captivebreeding population. The breeding program was set up in zoos, with the goal of releasing offspring on a large, 5300-hectare ranch in prime condor habitat. Birds were isolated from human contact as much as possible, and closely related individuals were prevented from breeding. By early 2009, the captive population of California condors had reached over 160 individuals. After extensive prerelease training to avoid power poles and people, captive-reared condors have been released successfully in California at two sites in the mountains north of Los Angeles, as well as at the Grand Canyon. Many of the released birds are doing well, and the wild population now numbers nearly 200 birds. Biologists are particularly
100
Number of Pairs of Peregrines
Although it is in principle possible to reestablish each of the original species in their original proportions, rebuilding a community requires knowing the identities of all the original inhabitants and the ecologies of each of the species. We rarely have this much information, so no restoration is ever truly pristine. Increasingly, restoration biologists are working on restoring the functioning of an ecosystem, rather than trying to recreate the same community composition. This approach shifts the focus from restoring species to reconstructing the processes that operated in the natural habitat.
pairs observed pairs nesting pairs producing offspring
80
60
40
20
0 1980
1982
1984 1986 Year
1988
1990
Figure 60.25 Success of captive breeding. The peregrine falcon (Falco peregrinus) has been reestablished in the eastern United States by releasing captive-bred birds over a period of 10 years.
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1276
11/20/09 3:09:10 PM
excited by breeding activities that resulted in the first-ever offspring produced in the wild by captive-reared parents in both California and Arizona.
Case study: Yellowstone wolves The ultimate goal of captive-breeding programs is not simply to preserve interesting species, but rather to restore ecosystems to a balanced, functional state. Yellowstone Park has been an ecosystem out of balance, due in large part to the systematic extermination of the gray wolf (Canis lupus) in the park early in the 20th century. Without these predators to keep their numbers in check, herds of elk and deer expanded rapidly, damaging vegetation so that the elk themselves starve in time of scarcity. In an attempt to restore the park’s natural balance, two complete wolf packs from Canada were released into the park in 1995 and 1996. The wolves adapted well, breeding so successfully that by 2002 the park contained 16 free-ranging packs and more than 200 wolves. Although ranchers near the park have been unhappy about the return of the wolves, little damage to livestock has been noted, and the ecological equilibrium of Yellowstone Park seems well on the way to being regained. Elk are congregating in larger herds and are avoiding areas near rivers where they are vulnerable. As a result, riverside trees such as willows are increasing in number, in turn providing food for beavers, whose dams lead to the creation of ponds, a habitat type that had become rare in Yellowstone. This newly restored habitat, in turn, has led to increases in some species of birds such as the redstart that had been in decline for decades or disappeared entirely.
Current conservation approaches are multidimensional Historically, conservationists strived to solve the problems of habitat fragmentation by focusing solely on preserving as much land as possible in a pristine state in national parks and reserves. Increasingly, however, it has become apparent that the amount of land that can be preserved in such a state is limited; moreover, many areas that are not completely protected nonetheless provide suitable habitat for many species. As a result, conservation plans are becoming multidimensional, including not only pristine areas, but also surrounding areas in which some level of human disturbance is permitted. As discussed previously, isolated patches of habitat lose species far more rapidly than large preserves do. By including these other, less pristine areas, the total amount of area available for many species is increased. The key to managing such large tracts of land successfully over a long time is to operate them in a way compatible with local land use. For example, although no economic activity is allowed in the core pristine area, the remainder of the land may be used for nondestructive harvesting of resources. Even areas in which hunting of some species is allowed provide protection for many other species. Corridors of dispersal are also being provided that link the pristine areas, thus effectively increasing population sizes and allowing recolonization if a population disappears in one area due to a catastrophe. Corridors can also provide protection to species that move over great distances during the course of a year. Corridors in East Africa have protected the migration routes of ungulates. In Costa Rica, a corridor linking the lowland rain forest at the La Selva Biological Station to the montane rain forest in Braulio Carrillo National Park permits the altitudinal migration of many species of birds, mammals, and butterflies (figure 60.26).
Costa Rica
La Selva Biological Field Station
La Selva Biological Corridor
Forest Reserve
Braulio Carrillo National Park
Figure 60.26 Corridor connecting two reserves. a. The Organization of Tropical Studies’ La Selva Biological Station in Costa Rica is connected to Braulio Carrillo National Park. b. The corridor allows migration of birds, mammals, butterfl ies, and other animals from La Selva at 35 m above sea level to mountainous habitats up to 2900 m elevation. www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1277
chapter
60 Conservation Biology
1277
11/20/09 3:09:11 PM
In addition to this focus on maintaining large enough reserves, in recent years conservation biologists also have recognized that the best way to preserve biodiversity is to focus on preserving intact ecosystems, rather than particular species. For this reason, attention in many cases is turning to identifying those ecosystems most in need of preservation and devising the means to protect not only the species within the ecosystem, but the functioning of the ecosystem itself. This entails making sure that reserves are not only large enough, but also that they protect elements such as watersheds so that activities outside the reserve won’t threaten the ecosystem within it.
Learning Outcomes Review 60.4 Restoration of species may prevent extinction, but only if restoration of habitat or an entire ecosystem is also undertaken. Removal of introduced species and cleanup of pollutants are primary strategies for habitat restoration. In cases where extinction appears imminent, removal of individuals from the wild and preservation in captive breeding programs may be necessary while habitat is restored. ■
Can habitat restoration ever approach a pristine state? Why or why not?
Chapter Review 60.1 Overview of the Biodiversity Crisis Prehistoric humans were responsible for local extinctions. Shortly after humans arrived in North America after the last Ice Age, at least 75% of large mammals became extinct. The same pattern has been observed in other parts of the world. Extinctions have continued in historical time. The majority of historical extinctions have occurred within the last 150 years and on islands. The current mass extinction is the only such event triggered by one species, Homo sapiens, and the only one in which resources will not be widely available for evolutionary recovery afterward. Endemic species hotspots are especially threatened. Endemic species are found in one restricted range and are thus vulnerable to extinction. Hotspots are areas with many endemic species; many hotspots are the site of large human population growth and high rates of extinction.
60.2 The Value of Biodiversity The direct economic value of biodiversity includes resources for our survival. Many products are obtained from different species and ecosystems, including food, materials for clothing and shelter, and medicines. Indirect economic value is derived from ecosystem services. Intact ecosystems provide services such as maintaining water quality, preserving soils and nutrients, moderating local climates, and recycling nutrients. The value of intact ecosystems is often not apparent until they are lost. Ethical and aesthetic values are based on our conscience and our consciousness. Humans can and should make ethical decisions to protect the esthetic, ecological, and economic values of ecosystems.
60.3 Factors Responsible for Extinction Amphibians are on the decline: A case study. Almost half of all amphibian species have experienced decreases in population size. No single cause has been identified, which implies that global environmental changes may be responsible. Habitat loss devastates species richness. Habitat may be destroyed, polluted, disrupted, or fragmented. As habitats become more fragmented, the relative proportion of the 1278
part
remaining habitat that occurs on the boundary or edge increases rapidly, exposing species to parasites, nonnative invasive species, and predators (see figure 60.11). Overexploitation wipes out species quickly. Hunting and harvesting of wild species pose a risk of extinction. The collapse of the cod fisheries of the North Atlantic and the decline of whale species are only two of many examples. Introduced species threaten native species and habitats. Natural or accidental introductions of new species results in large and often negative changes to a community because of lack of checks and balances on introduced species’ growth in the form of species interactions. Disruption of ecosystems can cause an extinction cascade. Extinction cascades may occur either top-down or bottom-up through the trophic levels. Loss of a keystone species may increase competition and greatly alter ecosystem structure and function. Small populations are particularly vulnerable. Catastrophes, lack of mates, and loss of genetic variability all make reduced populations more likely to become extinct (see figure 60.22).
60.4 Approaches for Preserving Endangered Species and Ecosystems Destroyed habitats can sometimes be restored. Restoration by removal of introduced species is very difficult and is most successful if done very soon after a new species is introduced. Severely polluted or damaged habitats sometimes cannot be restored to original conditions, but they may be restored to provide different environmental services. Captive breeding programs have saved some species. Species may be bred in captivity and returned to the wild when the factors that caused their endangerment are no longer a threat. Preservation of habitat may be a key in successful reintroduction. Current conservation approaches are multidimensional. The best way to preserve biodiversity is to preserve intact ecosystems rather than individual species. The key to management of large tracts of land is to operate them in a way compatible with local human needs. Corridors of dispersal can link habitat fragments with one another and with larger habitats, allowing for increased population size, genetic exchange, and recolonization.
VIII Ecology and Behavior
rav32223_ch60_1256-1280.indd 1278
11/20/09 3:09:13 PM
Review Questions U N D E R S TA N D 1. Conservation hotspots are best described as a. b. c. d.
areas with large numbers of endemic species, in many of which species are disappearing rapidly. areas where people are particularly active supporters of biological diversity. islands that are experiencing high rates of extinction. areas where native species are being replaced with introduced species.
2. The economic value of indirect ecosystem services a. b. c. d.
is unlikely to exceed the economic value derived from uses after ecosystem conversion. has never been carefully determined. can greatly exceed the value derived after ecosystem conversion. is entirely aesthetic.
3. The amphibian decline is best described as a. b. c. d.
global disappearance of amphibian populations due to the pervasiveness of local habitat destruction. global shrinkage of amphibian populations due to global climate change. the unexplained disappearance of golden toads in Costa Rica. None of the above
4. Habitat fragmentation can negatively affect populations by a. b. c. d.
restricting gene flow among areas that were previously continuous. increasing the relative amount of edge in suitable habitat patches. creating patches that are too small to support a breeding population. all of the above.
5. When populations are drastically reduced in size, genetic diversity and heterozygosity a. b. c. d.
are likely to increase, enhancing the probability of extinction. are likely to decrease, enhancing the probability of extinction. are usually not factors that influence the probability of extinction. automatically respond in a way that protects populations from future changes.
6. A captive-breeding program followed by release to the wild a. b. c. d.
is very likely, all by itself, to save a species threatened by extinction. is only likely to succeed when genetic variation of wild populations is very low. may be successful when combined with proper regulations and habitat restoration. None of the above
A P P LY 1. Historically, island species have tended to become extinct faster than species living on a mainland. Which of the following reasons can be used to explain this phenomenon? a. b.
Island species have often evolved in the absence of predators and have no natural avoidance strategies. Humans have introduced diseases and competitors to islands, which negatively affect island populations.
www.ravenbiology.com
rav32223_ch60_1256-1280.indd 1279
c. d.
Island populations are usually smaller than mainland populations. All of the above
2. Ninety-nine percent of all the species that ever existed have gone extinct, a. b. c. d.
serving as evidence that current extinction rates are not higher than normal. but most of these losses have occurred in the last 400 years. which argues that the world just had too many species. None of the above
3. To effectively address the biodiversity crisis, the protection of individual species a. b. c. d.
must be used in concert with a principle of ecosystem management and restoration. is a sufficient management approach that merely needs to be expanded to more species. has no role to play in addressing the biodiversity crisis. usually conflicts with the principle of ecosystem management.
4. The introduction of a non-native predator to an ecosystem could cause extinction by a. b. c. d.
causing a top-down trophic cascade (see chapter 58). outcompeting a native carnivore (see chapter 57). transmitting parasites to which the native species are not adapted. all of the above.
SYNTHESIZE 1. If 99% of the species that ever existed are now extinct, why is there such concern over the extinction rates over the last several centuries? 2. Ecosystem conversion always has a cost and a benefit. Usually the benefit flows to a segment of society (a business or one group of people, for instance), but the costs are borne by all of society. That is what makes decisions about how and when to convert ecosystems difficult. However, is that a problem unique to conversion of ecosystems in the way we understand it today (for example, the conversion of the mangrove to a shrimp farm)? Are there other examples we can look to for guidance in how to make these decisions? 3. There is concern and evidence that amphibian populations are declining worldwide as a consequence of factors acting globally. Given that we know that species extinction is a natural process, how do we determine if there is a global decline that is different from normal species extinction? 4. Given what you learned in chapter 57 about interactions between species and in chapter 58 about interactions among trophic levels, how can the extinction of one species have farranging effects on an ecosystem? Is it possible to predict which species would be particularly likely to affect many other species if they were to go extinct? 5. All populations become small before going extinct. Is small population size really a cause of extinction, or just something that happens as a result of other factors that cause extinction?
chapter
60 Conservation Biology
1279
11/20/09 3:09:14 PM
This page intentionally left blank
Appendix A Answer Key CHAPTER 1 LEARNING OUTCOME QUESTIONS 1.1 No. The study of biology encompasses information/tools from chemistry, physics, geology, literally all of the “natural sciences.”
1.2 A scientific theory has been tested by experimentation. A(n) hypothesis is a starting point to explain a body of observations. When predictions generated using the hypothesis have been tested it gains the confidence associated with a theory. A theory still cannot be “proved” however as new data can always force us to reevaluate a theory.
2.3 An ionic bond results when there is a transfer of electrons resulting in positive and negative ions that are attracted to each other. A covalent bond is the result of two atoms sharing electrons. Polar covalent bonds involve unequal sharing of electrons. This produces regions of partial charge, but not ions. 2.4 C and H have about the same electronegativity, and thus form nonpolar covalent bonds. This would not result in a cohesive or adhesive fluid. 2.5 Since ice floats, a lake will freeze from the top down, not the bottom up. This means that water remains fluid on the bottom of the lake allowing living things to overwinter. 2.6 Since pH is a log scale, this would be a change of 100 fold in [H+].
1.3 No. Natural selection explains the patterns of living organisms we see at present, and allows us to work back in time, but it is not intended to explain how life arose. This does not mean that we can never explain this, but merely that natural selection does not do this.
1.4 Viruses do not fit well into our definition of living systems. It is a matter of controversy whether viruses should be considered “alive.” They lack the basic cellular machinery, but they do have genetic information. Some theories for the origin of cells view viruses as being a step from organic molecules to cell, but looking at current organisms, they do not fulfill our definition of life.
INQUIRY QUESTION Page 30 The buffer works over a broad range because it ionizes more completely as pH increases; in essence, there is more acid to neutralize the greater amount of base you are adding. At pH4 none of the buffer is ionized. Thus below that pH, base raises the pH without the ameliorating effects of the ionization of the buffer.
U N D E R S TA N D 1. b
2. d
3. b
4. a
5. c
6. d
7. b
INQUIRY QUESTIONS
A P P LY
Page 10 Reducing the factor by which the geometric progression increases
1. c 2. b 3. a 4. c 5. d 6. Chemical reactions involve changes in the electronic configuration of atoms. Radioactive decay involves the actual decay of the nucleus producing another atom and emitting radiation.
(lowering the value of the exponent) reduces the difference between numbers of people and amount of food production. It can be achieved by lowering family size or delaying childbearing.
Page 11 A snake would fall somewhere near the bird, as birds and snakes are closely related.
U N D E R S TA N D 1. b
2. c
3. a
4. b
5. d
6. b
7. c
3. c
4. d
5. d
6. d
7. a
8. c
A P P LY 1. d
2. d
SYNTHESIZE 1. For something to be considered living it would demonstrate organization, possibly including a cellular structure. The organism would gain and use energy to maintain homeostasis, respond to its environment, and to grow and reproduce. These latter properties would be difficult to determine if the evidence of life from other planets comes from fossils. Similarly, the ability of an alien organism to evolve could be difficult to establish. 2. a. The variables that were held the same between the two experiments include the broth, the flask, and the sterilization step. b. The shape of the flask influences the experiment because any cells present in the air can enter the flask with the broken neck, but they are trapped in the neck of the other flask. c. If cells can arise spontaneously, then cell growth will occur in both flasks. If cells can only arise from preexisting cells (cells in the air), then only the flask with the broken neck will grow cells. Breaking the neck exposes the broth to a source of cells. d. If the sterilization step did not actually remove all cells, then growth would have occurred in both flasks. This result would seem to support the hypothesis that life can arise spontaneously.
CHAPTER 2 LEARNING OUTCOME QUESTIONS 2.1 If the number of proton exceeds neutrons, there is no effect on charge; if the number of protons exceeds electrons, then the charge is (+).
2.2 Atoms are reactive when their outer electron shell is not filled with electrons. The noble gases have filled outer electrons shells, and are thus unreactive.
SYNTHESIZE 1. A cation is an element that tends to lose an electron from its outer energy level, leaving behind a net positive charge due to the presence of the protons in the atomic nucleus. Electrons are only lost from the outer energy level if that loss is energetically favorable, that is, if it makes the atom more stable by virtue of obtaining a filled outer energy level (the octet rule). You can predict which elements are likely to function as cations by calculating which of the elements will possess one (or two) electrons in their outer energy level. Recall that each orbital surrounding an atomic nucleus can only hold two electrons. Energy level K is a single s orbital and can hold two electrons. Energy level L consists of another s orbital plus three p orbitals—holding a total of eight electrons. Use the atomic number of each element to predict the total number of electrons present. Examples of other cations would include: hydrogen (H), lithium (Li), magnesium (Mg), and beryllium (Be). 2. Silicon has an atomic number of 14. This means that there are four unpaired electrons in its outer energy level (comparable to carbon). Based on this fact, you can conclude that silicon, like carbon, could form four covalent bonds. Silicon also falls within the group of elements with atomic masses less than 21, a property of the elements known to participate in the formation of biologically important molecules. Interestingly, silicon is much more prevalent than carbon on Earth. Although silicon dioxide is found in the cell walls of plants and single-celled organisms called diatoms, silicon-based life has not been identified on this planet. Given the abundance of silicon on Earth you can conclude that some other aspect of the chemistry of this atom makes it incompatible with the formation of molecules that make up living organisms. 3. Water is considered to be a critical molecule for the evolution of life on Earth. It is reasonable to assume that water on other planets could play a similar role. The key properties of water that would support its role in the evolution of life are:
• The ability of water to acts as a solvent. Molecules dissolved in water could move and interact in ways that would allow for the formation of larger, more complex molecules such as those found in living organisms. • The high specific heat of water. Water can modulate and maintain its temperature, thereby protecting the molecules or organisms within it from temperature extremes—an important feature on other planets.
A-1
rav32223_appx_A1-A34.indd A-1
11/30/09 6:35:58 PM
• The difference in density between ice and liquid water. The fact that ice floats is a simple, but important feature of water environments since it allows living organisms to remain in a liquid environment protected under a surface of ice. This possibility is especially intriguing given recent evidence of ice-covered oceans on Europa, a moon of the planet Jupiter.
CHAPTER 3 LEARNING OUTCOME QUESTIONS 3.1 Hydrolysis is the reverse reaction of dehydration. Dehydration is a synthetic reaction involving the loss of water and hydrolysis is cleavage by addition of water.
3.2 Starch and glycogen are both energy storage molecules. Their highly branched nature allows the formation of droplets, and the similarity in the bonds holding adjacent glucoses together mean that the enzyme we have to break down glycogen allow us to break down starch. The same enzymes do not allow us to break down cellulose. The structure of cellulose leads to the formation of tough fibers.
CHAPTER 4 LEARNING OUTCOME QUESTIONS 4.1 The statement about all cells coming from preexisting cells might need to be modified. It would really depend on whether these Martian life forms were based on a similar molecular/cellular basis as terrestrial life.
4.2 Bacteria and archaea both tend to be single cells that lack a membrane-bounded nucleus, and extensive internal endomembrane systems. They both have a cell wall, although the composition is different. They do not undergo mitosis, although the proteins involved in DNA replication and cell division are not similar. 4.3 Part of what gives different organs their unique identities are the specialized cell types found in each. That does not mean that there will not be some cell types common to all (epidermal cells for example) but that organs tend to have specialized cell types. 4.4 They don’t! 4.5 The nuclear genes that encode organellar proteins moved from the organelle
3.3 The sequence of bases would be complementary. Wherever there is an A in
to the nucleus. There is evidence for a lot of “horizontal gene transfer” across domains; this is an example of how that can occur.
the DNA there would be a U in the RNA, wherever there is a G in the DNA there would be a C in the RNA.
4.6 It provides structure and support for larger cells, especially in animal cells that lack a cell wall.
3.4 If an unknown protein has sequence similarity to a known protein, we can infer its function is also similar. If an unknown protein has known functional domains or motifs we can also use these to help predict function.
4.7 Microtubules and microfilaments are both involved in cell motility, and in movement of substance around cells. Intermediate filaments do not have this dynamic role, but are more structural.
3.5 Phospholipids have a charged group replacing one of the fatty acids in a triglyceride. This leads to an amphipathic molecule that has both hydrophobic and hydrophilic regions. This will spontaneously form bilayer membranes in water.
4.8 Cell junctions help to put together cells into higher level structures that are organized and joined in different ways. Different kinds of junctions can be used for different functional purposes.
U N D E R S TA N D 1. b
2. a
3. d
4. c
5. b
INQUIRY QUESTIONS 6. b
7. c
8. b
A P P LY 1. c
2. d
3. b
4. d
5. b
6. b
7. d
SYNTHESIZE 1. The four biological macromolecules all have different structure and function. In comparing carbohydrates, nucleic acids and proteins, we can think of these as being polymers with different monomers. In the case of carbohydrates, the polymers are all polymers of the simple sugar glucose. These are energy storage molecules (with many C-H bonds) and structural molecules such as cellulose that make tough fibers. Nucleic acids are formed of nucleotide monomers, each of which consists of ribose, phosphate, and a nitrogenous base. These molecules are informational molecules that encode information in the sequence of bases. The bases interact in specific ways: A base pairs with T and G base pairs with C. This is the basis for their informational storage. Proteins are formed of amino acid polymers. There are 20 different amino acids, and thus an incredible number of different proteins. These can have an almost unlimited number of functions. These functions arise from the amazing flexibility in structure of protein chains. 2. Nucleic Acids—Hydrogen bonds are important for complementary base-pairing between the two strands of nucleic acid that make up a molecule of DNA. Complementary base-pairing can also occur within the single nucleic acid strand of a RNA molecule. Proteins—Hydrogen bonds are involved in both the secondary and tertiary levels of protein structure. The α helices and β-pleated sheets of secondary structure are stabilized by hydrogen bond formation between the amino and carboxyl groups of the amino acid backbone. Hydrogen bond formation between R-groups helps stabilize the three-dimensional folding of the protein at the tertiary level of structure. Carbohydrates—Hydrogen bonds are less important for carbohydrates; however, these bonds are responsible for the formation of the fibers of cellulose that make up the cell walls of plants. Lipids—Hydrogen bonds are not involved in the structure of lipid molecules. The inability of fatty acids to form hydrogen bonds with water is key to their hydrophobic nature. 3. We have enzymes that can break down glycogen. Glycogen is formed from alpha-glucose subunits. Starch is also formed from alpha-glucose units, but cellulose is formed from beta-glucose units. The enzymes that break the alpha-glycosidic linkages cannot break the beta-glycosidic linkages. Thus we can degrade glycogen and starch but not cellulose.
A-2
Page 64 Stretch, dent, convolute, fold, add more than one nuclei, anything which would increase the amount of diffusion between the cytoplasm and the external environment.
Page 75 Both the cristae of mitochondria and the thylakoids of chloroplasts, where many of the reactions take place leading to the production of ATP, are highly folded. The convolutions allow for a large surface area increasing the efficiency of the mechanisms of oxidative phosphorylation.
Page 80 Ciliated cell in the trachea help to remove particulate matter from the respiratory tact where it can be expelled or swallowed and processed in the digestive tract.
U N D E R S TA N D 1. d
2. d
3. c
4. a
5. c
6. d
7. b
3. b
4. b
5. c
6. b
7. a
A P P LY 1. c
2. b
SYNTHESIZE 1. Your diagram should start at the SER and then move to the RER, Golgi apparatus, and finally to the plasma membrane. Small transport vesicles are the mechanism that would carry a phospholipids molecule between two membrane compartments. Transport vesicles are small “membrane bubbles” composed of a phospholipid bilayer. 2. If these organelles were free-living bacteria, they would have the features found in bacteria. Mitochondria and chloroplasts do both have DNA but no nucleus, and they lack the complex organelles found in eukaryotes. At first glance, the cristae may seem to be an internal membrane system, but they are actually infoldings of the inner membrane. If endosymbiosis occurred, this would be the plasma membrane of the endosymbiont, and the outer membrane would be the plasma membrane of the engulfing cell. Another test would be to compare DNA in these organelles with current bacteria. This has actually shown similarities that make us confident of the identity of the endosymbionts. 3. The prokaryotic and eukaryotic flagella are examples of an analogous trait. Both flagella function to propel the cell through its environment by converting chemical energy into mechanical force. The key difference is in the structure of the flagella. The bacterial flagellum is composed of a single protein emerging from a basal body anchored within the cell’s plasma membrane and using the potential energy of a proton gradient to cause a rotary movement. In contrast, the flagellum of the eukaryote is composed of
appendix A
rav32223_appx_A1-A34.indd A-2
11/30/09 6:35:59 PM
many different proteins assembled into a complex axoneme structure that uses ATP energy to cause an undulating motion. 4. Eukaryotic cells are distinguished from prokaryotic cells by the presence of a system of internal membrane compartments and membrane-bounded organelles such as mitochondria and chloroplasts. As outlined in Figure 4.19, the first step in the evolution of the eukaryotic cell was the infolding of the plasma membrane to create separate internal membranes such as the nuclear envelope and the endoplasmic reticulum. The origins of mitochondria and chloroplasts are hypothesized to be the result of a bit of cellular “indigestion” where aerobic or photosynthetic prokaryotes were engulfed, but not digested by the larger ancestor eukaryote. Given this information, there are two possible scenarios for the origin of Giardia. In the first scenario, the ancestor of Giardia split off from the eukaryotic lineage after the evolution of the nucleus, but before the acquisition of mitochondria. In the second scenario, the ancestor of Giardia split off after the acquisition of mitochondria, and subsequently lost the mitochondria. At present, neither of these two scenarios can be rejected. The first case was long thought to be the best explanation, but recently it has been challenged by evidence for the second case.
CHAPTER 5 LEARNING OUTCOME QUESTIONS 5.1 Cells would not be able to control their contents. Nonpolar molecules would be able to cross the membrane by diffusion, as would small polar molecules, but without proteins to control the passage of specific molecules, it would not function as a semipermeable membrane.
ture and does not require chemical energy; therefore, it is possible to conclude that membrane fluidity occurs as a consequence of passive diffusion. 2. The inner half of the bilayer of the various endomembranes becomes the outer half of the bilayer of the plasma membrane. 3. Lipids can be inserted into one leaflet to produce asymmetry. When lipids are synthesized in the SER, they can be assembled into asymmetric membranes. There are also enzymes that can flip lipids from one leaflet to the other.
CHAPTER 6 LEARNING OUTCOME QUESTIONS 6.1 At the bottom of the ocean, light is not an option as it does not penetrate that deep. However, there is a large source of energy in the form of reduced minerals, such as sulfur compounds, that can be oxidized. These are abundant at hydrothermal vents found at the junctions of tectonic plates. This supports whole ecosystems dependent on bacteria that oxidize reduced minerals available at the hydrothermal vents.
6.2 In a word: No. Enzymes only alter the rate of a reaction; they do not change the thermodynamics of the reaction. The action of an enzyme does not change the ΔG for the reaction. 6.3 In the text, it stated that the average person turns over approximately their body weight in ATP per day. This gives us enough information to determine approximately the amount of energy released: 100 kg = 1.0 x 105 g (1.0 × 105 g)/(507.18 g/mol)=197.2 mol (197.2 mol)(7.3 kcal/mol)=1,439 kcal
5.2 No. The nonpolar interior of the bilayer would not be soluble in the solvent. The molecules will organize with their nonpolar tails in the solvent, but the negative charge on the phosphates would repel other phosphates.
5.3 Transmembrane domains anchor protein in the membrane. They associate with the hydrophobic interior, thus they must be hydrophobic as well. If they slide out of the interior, they are repelled by water.
5.4 The concentration of the IV will be isotonic with your blood cell. If it were hypotonic, your blood cells would take on water and burst; if it were hypertonic, your blood cells would lose water and shrink. 5.5 Channel proteins are aqueous pores that allow facilitated diffusion. They cannot actively transport ions. Carrier proteins bind to their substrates and couple transport to some form of energy for active transport. 5.6 In all cases, there is recognition and specific binding of a molecule by a protein. In each case this binding is necessary for biological function.
INQUIRY QUESTIONS Page 94
As the name suggests for the fluid mosaic model, cell membranes have some degree of fluidity. The degree of fluidity varies with the composition of the membrane, but in all membranes, phospholipids are able to move about within the membrane. Also, due to the hydrophobic and hydrophilic opposite ends of phospholipid molecules, phospholipid bilayers form spontaneously. Therefore, if stressing forces happen to damage a membrane, adjacent phospholipids automatically move to fill in the opening.
Page 95 Integral membrane proteins are those that are embedded within the membrane structure and provide passageways across the membrane. Because integral membrane proteins must pass through both polar and nonpolar regions of the phospholipid bilayer, the protein portion held within the nonpolar fatty acid interior of the membrane must also be nonpolar. The amino acid sequence of an intregral protein would have polar amino acids at both ends, with nonpolar amino acids comprising the middle portion of the protein.
U N D E R S TA N D 1. d
2. a
3. d
4. d
5. b
3. d
4. c
5. d
6. d
7. a
A P P LY 1. c
2. b
SYNTHESIZE 1. Since the membrane proteins become intermixed in the absence of the energy molecule, ATP, one can conclude that chemical energy is not required for their movement. Since the proteins do not move and intermix when the temperature is cold, one can also conclude that the movement is temperature-sensitive. The passive diffusion of molecules also depends on tempera-
6.4 This is a question that cannot be definitely answered, but we can give some reasonable conjectures. First, DNA’s location is in the nucleus and not the cytoplasm, where most enzymes are found. Second, the double stranded structure of DNA is works well for information storage, but would not necessarily function well as an enzyme. Each base interacts with a base on the opposite strand, which makes for a very stable linear molecule, but does not encourage folding into the kind of complex 3-D shape found in enzymes. 6.5 Feedback inhibition is common in pathways that synthesize metabolites. In these anabolic pathways, when the end product builds up, it feeds back to inhibit its own production. Catabolic pathways are involved in the degradation of compounds. Feedback inhibition makes less biochemical sense in a pathway that degrades compounds as these are usually involved in energy metabolism, or recycling or removal of compounds. Thus the end product is destroyed or removed and cannot feed back.
INQUIRY QUESTION Page 113 If ATP hydrolysis supplies more energy than is needed to drive the endergonic reaction, the overall process is exergonic. The reactions result in a net release of energy, so the ΔG for the overall process is therefore negative.
U N D E R S TA N D 1. b
2. a
3. b
4. a
5. d
6. b
3. d
4. c
5. c
6. c
7. d
A P P LY 1. b
2. c
SYNTHESIZE 1. a. At 40°C the enzyme is at it optimum. The rate of the reaction is at its highest level. b. Temperature is a factor that influences enzyme function. This enzyme does not appear to function at either very cold or very hot temperatures. The shape of the enzyme is affected by temperature, and the enzyme’s structure is altered enough at extreme temperatures that it no longer binds substrate. Alternatively, the enzyme may be denatured— that is a complete loss of normal three-dimensional shape at extreme temperatures. Think about frying an egg: What happens to the proteins in the egg? c. Everyone’s body is slightly different. If the temperature optimum was very narrow, then the cells that make up a body would be vulnerable. Having a broad range of temperature optimums keeps the enzyme functioning. 2. a. The reaction rate would be slow because of the low concentration of the substrate ATP. The rate of reaction depends on substrate concentration.
appendix A
rav32223_appx_A1-A34.indd A-3
A-3
11/30/09 6:35:59 PM
b. ATP acts like a noncompetitive, allosteric inhibitor when ATP levels are very high. If ATP binds to the allosteric site, then the reaction should slow down. c. When ATP levels are high, the excess ATP molecules bind to the allosteric site and inhibit the enzyme. The allosteric inhibitor functions by causing a change in the shape of the active site in the enzyme. This reaction is an example of feedback regulation because ATP is a final product of the overall series of reactions associated with glycolysis. The cell regulates glycolysis by regulating this early step catalyzed by phosphofructokinase; the allosteric inhibitor is the “product” of glycolysis (and later stages) ATP.
CHAPTER 7 LEARNING OUTCOME QUESTIONS 7.1 Cells require energy for a wide variety of functions. The reactions involved in the oxidation of glucose are complex and linking these to the different metabolic functions that require energy would be inefficient. Thus cells make and use ATP as a reusable source of energy.
7.2 The location of glycolysis does not argue for or against the endosymbiotic origin of mitochondria. If could have been located in the mitochondria previously and moved to the cytoplasm, or could have always been located in the cytoplasm in eukaryotes.
7.3 For an enzyme like pyruvate decarboxylase the complex reduces the distance for the diffusion of substrates for the different stages of the reaction. If there are any unwanted side reactions they are prevented. Finally the reactions occur within a single unit and thus can be controlled in a coordinated fashion. The main disadvantage is that since the enzymes are all part of a complex their evolution is more constrained than if they were independent. 7.4 At the end of the Krebs cycle, the electrons removed from glucose are all carried by soluble electron carriers. Most of these are in NADH and a few are in FADH2. All of these are all fed into the electron transport chain under aerobic conditions where they are used to produce a proton gradient. 7.5 A hole in the outer membrane would allow protons in the intermembrane space to leak out. This would destroy the proton gradient across the inner membrane, stopping the phosphorylation of ADP by ATP synthase. 7.6 The inner membrane actually allows a small amount of leakage of protons back into the matrix, reducing the yield per NADH. The proton gradient can also be used to power other functions, such as the transport of pyruvate. The actual yield is also affected by the relative concentrations ADP, Pi, and ATP as the equilibrium constant for this reaction depends on this.
7.7 Glycolysis, which is the starting point for respiration from sugars is regulated at the enzyme phosphofructokinase. This enzyme is just before the 6-C skeleton is split into two 3-C molecules. The allosteric effectors for this enzyme include ATP and citrate. Thus the “end product” ATP, and an intermediate from the Krebs cycle, both feedback to inhibit the first part of this process.
7.8 The first obvious point is that the most likely type of ecosystem would be one where oxygen is nonexistent or limiting. This includes marine, aquatic, and soil environments. Any place where oxygen is in short supply is expected to be dominated by anaerobic organisms and respiration produces more energy than fermentation. 7.9 The short answer is no. The reason is two-fold. First the oxidation of fatty acids feeds acetyl units into the Krebs cycle. The primary output of the Krebs cycle is electrons that are fed into the electron transport chain to eventually produce ATP by chemiosmosis. The second reason is that the process of beta-oxidation that produces the acetyl units is oxygen dependent as well. This is because betaoxidation uses FAD as a cofactor for an oxidation, and the FADH2 is oxidized by the electron transport chain. 7.10 The evidence for the origins of metabolism is indirect. The presence of O2
in the atmosphere is the result of photosynthesis, so the record of when we went from a reducing to an oxidizing atmosphere chronicles the rise of oxygenic photosynthesis. Glycolysis is a universal pathway that is found in virtually all types of cells. This indicates that it is an ancient pathway that likely evolved prior to other types of energy metabolism. Nitrogen fixation probably evolved in the reducing atmosphere that preceded oxygenic photosynthesis as it is poisoned by oxygen, and aided by the reducing atmosphere.
INQUIRY QUESTION Page 142 During the catabolism of fats, each round of 2-oxidation uses one molecule of ATP and generates one molecule each of FADH2 and NADH. For a 16-carbon fatty acid, seven rounds of 2-oxidation would convert the fatty acid into eight molecules of acetyl-CoA. The oxidation of each acetyl-CoA in the Krebs
A-4
cycle produces 10 molecules of ATP. The overall ATP yield from a 16-carbon fatty acid would be: a net gain of 21 ATP from 7 rounds of 2-oxidation [gain of 4 ATP per round minus 1 per round to prime reactions] + 80 ATP from the oxidation of 8 acetyl-CoAs = 101 molecules of ATP.
U N D E R S TA N D 1. d
2. d
3. c
4. c
5. a
6. d
7. c
3. d
4. b
5. a
6. b
7. b
A P P LY 1. b
2. b
SYNTHESIZE 1. Molecules
Glycolysis
Cellular Respiration
Glucose
Is the starting material for the reaction
Does not directly use glucose; however, does use pyruvate derived from glucose
Pyruvate
The end product of glycolysis
The starting material for cellular respiration
Oxygen
Not required
Required for aerobic respiration, but not for anaerobic respiration
ATP
Produced through substrate-level phosphorylation
Produced through oxidative phosphorylation. More produced than in glycolysis
CO2
Not produced
Produced during pyruvate oxidation and Krebs cycle
2. The electron transport chain of the inner membrane of the mitochondria functions to create a hydrogen ion concentration gradient by pumping protons into the intermembrane space. In a typical mitochondrion, the protons can only diffuse back down their concentration gradient by moving through the ATP synthase and generating ATP. If protons can move through another transport protein then the potential energy of the hydrogen ion concentration gradient would be “lost” as heat. 3. If brown fat persists in adults, then the uncoupling mechanism to generate heat described above could result in weight loss under cold conditions. There is now some evidence to indicate that this may be the case.
CHAPTER 8 LEARNING OUTCOME QUESTIONS 8.1 Both chloroplasts and mitochondria have an outer membrane and an inner membrane. The inner membrane in both forms an elaborate structure. These inner membrane systems have electron transport chains that move protons across the membrane to allow for the synthesis of ATP by chemiosmosis. They also both have a soluble compartment in which a variety of enzymes carry out reactions.
8.2 All of the carbon in your body comes from carbon fixation by autotrophs. Thus, all of the carbon in your body was once CO2 in the atmosphere, before it was fixed by plants. 8.3 The action spectrum for photosynthesis refers to the most effective wavelengths. The absorption spectrum for an individual pigment shows how much light is absorbed at different wavelengths. 8.4 Before the discovery of photosystems, we assumed that each chlorophyll molecule absorbed photons resulting in excited electrons. 8.5 Without a proton gradient, synthesis of ATP by chemiosmosis would be impossible. However, NADPH could still be synthesized because electron transport would still occur as long as photons were still being absorbed to begin the process. 8.6 A portion of the Calvin cycle is the reverse of glycolysis (the reduction of 3-phosphoglycerate to glyceraldehyde-3-phosphate). 8.7 Both C4 plants and CAM plants fix carbon by incorporating CO2 into the
4-carbon malate, then use this to produce high local levels of CO2 for the Calvin cycle. The main difference is that in C4 plants, this occurs in different cells, and in CAM plants this occurs at different times.
INQUIRY QUESTIONS Page 150 Light energy is used in light-dependent reactions to reduce NADP+ and to produce ATP. Molecules of chlorophyll absorb photons of light energy, but only within narrow energy ranges (specific wavelengths of light). When all chloro-
appendix A
rav32223_appx_A1-A34.indd A-4
11/30/09 6:35:59 PM
behavior. In some cases the change is immediate—for example, the opening of an ion channel. In other cases the change requires more time before it occurs, such as when the MAP kinase pathway becomes activated multiple different kinases become activated and deactivated. Some signals only affect a cell for a short time (the channel example), but other signals can permanently change the cell by changing gene expression, and therefore the number and kind of proteins found in the cell.
phyll molecules are in use, no additional increase in light intensity will increase the rate at which they can absorb light energy.
Page 154 Saturation levels should be higher when light intensity is greater, up to a maximum level. If it were possible to minimize the size of photosystems by reducing the number of chlorophyll molecules in each, then the saturation level would also increase. Page 157 You could conclude that the two photosystems do not function sequentially.
U N D E R S TA N D 1. c
2. a
3. a
4. b
5. c
6. c
7. a
8. b
3. c
4. c
5. d
6. b
7. a
8. a
2. a. This system involves both autocrine and paracrine signaling because Netrin-1 can influence the cells within the crypt that are responsible for its production and the neighboring cells. b. The binding of Netrtin-1 to its receptor produces the signal for cell growth. This signal would be strongest in the regions of the tissue with the greatest amount of Netrin-1—that is, in the crypts. A concentration gradient of Netrin-1 exists such that the levels of this ligand are lowest at the tips of the villi. Consequently, the greatest amount of cell death would occur at the villi tips. c. Tumors occur when cell growth goes on unregulated. In the absence of Netrin-1, the Netrin-1 receptor can trigger cell death—controlling the number of cells that make up the epithelial tissue. Without this mechanism for controlling cell number, tumor formation is more likely.
A P P LY 1. d
2. b
SYNTHESIZE 1. In C3 plants CO2 reacts with ribulose 1,5-bisphosphate (RuBP) to yield 2 molecules of PGA. This reaction is catalyzed by the enzyme rubisco. Rubisco also catalyzes the oxidation of RuBP. Which reaction predominates depends on the relative concentrations of reactants. The reactions of the Calvin cycle reduce the PGA to G3P, which can be used to make a variety of sugars including RuBP. In C4 and CAM plants, an initial fixation reaction incorporates CO2 into malate. The malate then can be decarboxylated to pyruvate and CO2 to produce locally high levels of CO2. The high levels of CO2 get around the oxidation of RuBP by rubisco. In C4 plants malate is produced in one cell, then shunted into an adjacent cell that lacks stomata to produce high levels of CO2. CAM plants fix carbon into malate at night when their stomata are open, then use this during the day to fuel the Calvin cycle. Both are evolutionary innovations that have arisen in hot dry climates that allow plants to more efficiently fix carbon and prevent desiccation. 2. Figure 8.19 diagrams this relationship. The oxygen produced by photosynthesis is used as a final electron acceptor for electron transport in respiration. The CO2 that results from the oxidation of glucose (or fatty acids) is incorporated into organic compounds via the Calvin cycle. Respiration also produces water, while photosynthesis consumes water. 3. Yes. Plants use their chloroplasts to convert light energy into chemical energy. During light reactions ATP and NADPH are created, but these molecules are consumed during the Calvin cycle and are not available for the cell’s general use. The G3P produced by the Calvin cycle stores the chemical energy from the light reactions within its chemical bonds. Ultimately, this energy is stored in glucose and retrieved by the cell through the process of glycolysis and cellular respiration.
LEARNING OUTCOME QUESTIONS 9.1 Ligands bind to receptors based on complementary shapes. This interaction based on molecular recognition is similar to how enzymes interact with their ligands. 9.2 Hydrophobic molecule can cross the membrane and are thus more likely to have an internal receptor. 9.3 Intracellular receptors have direct effects on gene expression. This generally leads to effects with longer duration. 9.4 Ras protein occupies a central role in signaling pathways involving growth factors. A number of different kinds of growth factors act through Ras. So it is not surprising that this is mutated in a number of different cancers. 9.5 GPCRs are a very ancient and flexible receptor/signaling pathway. The genes encoding these receptors have been duplicated and then have diversified over evolutionary time so now there are many members of this gene family.
U N D E R S TA N D 2. b
3. c
4. d
5. b
6. d
3. b
4. d
5. d
6. c
7. c
8. a
A P P LY 1. b
2. c
LEARNING OUTCOME QUESTIONS 10.1 The concerted replication and segregation of chromosomes works well with one small chromosome, but would likely not work as well with many chromosomes.
10.2 No. 10.3 The first irreversible step is the commitment to DNA replication. 10.4 Loss of cohesins would mean that the products of DNA replication would not be kept together. This would make normal mitosis impossible, and thus lead to aneuploid cells and probably be lethal.
10.5 The segregation of chromatids that lose cohesin would be random as they could not longer be held at metaphase attached to opposite poles. This would likely lead to gain and loss of this chromosome in daughter cells due to improper partitioning.
10.6 Tumor suppressor genes are genetically recessive, while proto-oncogenes are dominant. Loss of function for a tumor suppressor gene leads to cancer while inappropriate expression or gain of function lead to cancer with proto-oncogenes.
U N D E R S TA N D 1. d
2. b
3. b
4. b
5. a
6. c
7. b
3. c
4. b
5. d
6. c
7. d
A P P LY
CHAPTER 9
1. b
CHAPTER 10
SYNTHESIZE 1. All signaling events start with a ligand binding to a receptor. The receptor initiates a chain of events that ultimately leads to a change in cellular
1. d
2. a
SYNTHESIZE 1. If Wee-1 were absent then there would be no way for the cell to phosphorylate Cdk. If Cdk is not phosphorylated, then it cannot be inhibited. If Cdk is not inhibited, then it will remain active. If Cdk remains active, then it will continue to signal the cell to move through the G2/M checkpoint, but now in an unregulated manner. The cells would undergo multiple rounds of cell division without the growth associated with G2. As a consequence, the daughter cells will become smaller and smaller with each division—hence the name of the protein! 2. Growth factor = ligand 1. Ligand binds to receptor (the growth factor will bind to a growth factor receptor). 2. A signal is transduced (carried) into the cytoplasm. 3. A signal cascade is triggered. Multiple intermediate proteins or second messengers will be affected. 4. A transcription factor will be activated to bind to a specific site on the DNA. 5. Transcription occurs and the mRNA enters the cytoplasm. 6. The mRNA is translated and a protein is formed. 7. The protein functions within the cytoplasm—possibly triggering S phase. If you study Figure 10.22 you will see a similar pathway for the formation of S phase proteins following receptor–ligand binding by a growth factor. In this diagram various proteins in the signaling pathway become phosphorylated
appendix A
rav32223_appx_A1-A34.indd A-5
A-5
11/30/09 6:35:59 PM
a. Nondisjunction occurs at the point when the chromosomes are being pulled to opposite poles. This occurs during anaphase. b. Use an image like Figure 11.8 and illustrate nondisjunction at anaphase I versus anaphase II Anaphase I nondisjunction:
and then dephosphorylated. Ultimately, the Rb protein that regulated the transcription factor E2F becomes phosphorylated. This releases the E2F and allows it to bind to the gene for S phase proteins and cyclins. 3. Proto-oncogenes tend to encode proteins that function in signal transduction pathways that control cell division. When the regulation of these proteins is aberrant, or they are stuck in the “on” state by mutation, it can lead to cancer. Tumor suppressor genes, on the other hand, tend to be in genes that encode proteins that suppress instead of activate cell division. Thus loss of function for a tumor suppressor gene leads to cancer.
Meiosis I
Meiosis II
CHAPTER 11 LEARNING OUTCOME QUESTIONS 11.1 Stem cells divide by mitosis to produce one cell that can undergo meiosis, and another stem cell.
11.2 No. Keeping sister chromatids together at the first division is key to this is reductive division. Homologues segregate at the first division, reducing the number of chromosomes by half. 11.3 An improper disjunction at anaphase I would result in 4 aneuploid gametes: 2 with an extra chromosome and 2 that are missing a chromosome. Nondisjunction at anaphase II would result in 2 normal gametes and 2 aneuploid gametes: 1 with an extra chromosome and 1 missing a chromosome. 11.4 The independent alignment of homologous pairs at metaphase I and the process of crossing over. The first shuffles the genome at the level of entire chromosomes, and the second shuffles the genome at the level of individual chromosomes.
INQUIRY QUESTION Page 217 No, at the conclusion of meiosis I each cell has a single copy of each
CHAPTER 12 LEARNING OUTCOME QUESTIONS 12.1 Both had an effect, but the approach is probably the most important. In theory, his approach would have worked for any plant, or even animal he chose. In practice, the ease of both cross and self-fertilization was helpful.
homologue. So, even if the attachment of sister chromatids were lost after a meiosis I division, the results would not be the same as mitosis.
12.2 ⅓ of tall F2 plants are true-breeding. 12.3 The events of meiosis I are much more important in explaining Mendel’s
U N D E R S TA N D
laws. During anaphase I homologues separate and are thus segregated, and the alignment of different homologous pairs at metaphase I is independent.
1. c
2. d
3. a
4. b
5. b
6. a
3. b
4. d
5. b
6. a
7. b
A P P LY 1. c
2. b
SYNTHESIZE 1. Compare your figure with Figure 11.8. a. There would be three homologous pairs of chromosomes for an organism with a diploid number of six. b. For each pair of homologues, you should now have a maternal and paternal pair. c. Many possible arrangements are possible. The key to your image is that it must show the homologues aligned pairwise—not single-file along the metaphase plate. The maternal and paternal homologues do not have to align on the same side of the cell. Independent assortment means that the pairs can be mixed. d. A diagram of metaphase II would not include the homologous pairs. The pairs have separated during anaphase of meiosis I. Your picture should diagram the haploid number of chromosomes, in this case three, aligned single-file along the metaphase plate. Remember that meiosis II is similar to mitosis. 2. The diploid chromosome number of a mule is 63. The mule receives 32 chromosomes from its horse parent (diploid 64: haploid 32) and another 31 chromosomes from its donkey parent (diploid 61: haploid 31). 32 + 31 = 63. The haploid number for the mule would be one half the diploid number 63 ÷ 2 = 31.5. Can there be a 0.5 chromosome? Even if the horse and donkey chromosomes can pair (no guarantee of that) there will be one chromosome without a partner. This will lead to aneuploid gametes that are not viable. 3. Independent assortment involves the random distribution of maternal versus paternal homologues into the daughter cells produced during meiosis I. The number of possible gametes is equal to 2n, where n is the haploid number of chromosomes. Crossing over involves the physical exchange of genetic material between homologous chromosomes, creating new combinations of genes on a single chromosome. Crossing over is a relatively rare event that affects large blocks of genetic material, so independent assortment likely has the greatest influence on genetic diversity. 4. Aneuploid gametes are cells that contain the wrong number of chromosomes. Aneuploidy occurs as a result of nondisjunction, or lack of separation of the chromosomes during either phase of meiosis.
A-6
12.4 Assuming independent assortment of all three genes, the cross is Aa Bb Cc × Aa Bb Cc and the prob(A_ B_ C_)=(¾) (¾) (¾)=27/64. 12.5 1:1:1:1 dom dom:dom rec:rec dom:rec rec. 12.6 6/16.
INQUIRY QUESTIONS Page 223
The ability to control whether the plants self-fertilized or crossfertilized was of paramount importance in Mendel’s studies. Results due to crossfertilization would have had confounding influences on the predicted number of offspring with a particular phenotype.
Page 227
Each of the affected females in the study had one unaffected parent, which means that each is heterozygous for the dominant trait. If each female marries an unaffected (recessive) male, each could produce unaffected offspring. The chance of having unaffected offspring is 50% in each case.
Page 228
Genetic defects that remain hidden or dormant as heterzygotes in the recessive state are more likely to be revealed in homozygous state among closely related individuals.
Page 235
Almost certainly, differences in major phenotypic traits of twins would be due to environmental factors such as diet.
U N D E R S TA N D 1. b
2. c
3. c
4. c
5. b
6. d
3. b
4. a
5. c
6. d
A P P LY 1. b
2. c
SYNTHESIZE 1. The approach to solving this type of problem is to identify the possible gametes. Separate the possible gamete combinations into the boxes along the top and side. Fill in the Punnet square by combining alleles from each parent. a. A monohybrid cross between individuals with the genotype Aa and Aa A
a
A
AA
Aa
a
aA
aa
Phenotypic ratio: 3 dominant to 1 recessive
appendix A
rav32223_appx_A1-A34.indd A-6
12/7/09 4:57:17 PM
b. A dihybrid cross between two individuals with the genotype AaBb AB
Ab
aB
ab
AB
AABB
AABb
AaBB
AaBb
Ab
AAbB
AAbb
AabB
Aabb
aB
aABB
aABb
aaBB
aaBb
ab
aAbB
aAbb
aabB
aabb
Phenotypic ratio: 9 dominant dominant to 3 dominant recessive to 3 recessive dominant to 1 recessive recessive Using Product Rule: Prob(A_ B_) = (¾)(¾) = 9/16 Prob(A_ bb) = (¾)(¼) = 3/16 Prob(aa B_) = (¼)(¾) = 3/16 Prob(aa bb) = (¼)(¼) = 1/16 c. A dihybrid cross between individuals with the genotype AaBb and aabb
ab
AB
Ab
aB
ab
aAbB
aAbb
aabB
aabb
Using Product Rule:
Prob(A_ B_) = (¼)(1) = 1/16 Prob(A_ bb) = (¼)(1) = 1/16 Prob(aa B_) = (¼)(1) = 1/16 Prob(aa bb) = (¼)(1) = 1/16 2. The segregation of different alleles for any gene occurs due to the pairing of homologous chromosomes, and the subsequent separation of these homologues during anaphase I. The independent assortment of traits, more accurately the independent segregation of different allele pairs, is due to the independent alignment of chromosomes during metaphase I of meiosis. 3. There seems to be the loss of a genotype as there are only 3 possible outcomes (2 yellow and 1 black). If the yellow gene has a dominant effect on coat color, but also causes lethality when homozygous, then this could explain the observations. So, a yellow mouse is heterozygous and crossing two yellow mice yields 1 homozygous yellow (dead):2 heterozygous (appears yellow):1 black. You could test this by crossing the yellow to homozygous black. You should get 1 yellow:1 black, and all black offspring should be true breeding, and all yellow should behave as above. 4. There are two genes involved, one of which is epistatic to the other. At one gene, there are two alleles: black and brown; at the other gene, there are two alleles: albino and colored. The albino gene is epistatic to the brown gene so when you are homozygous recessive for albino, you are albino regardless of whether you are black or brown at the other locus. This leads to the 4 albino in a Mendelian kind of crossing scheme.
Page 250 What has changed is the mother’s age. The older the woman, the higher the risk she has of nondisjunction during meiosis. Thus, she also has a much greater risk of producing a child with Down syndrome. Page 251 XY egg is fertilized by an X sperm. A normal X egg is fertilized by an XY sperm.
Page 253 Advanced maternal age, a previous child with birth defects, or a family history of birth defects.
U N D E R S TA N D 1. c
2. d
3. d
4. a
5. c
6. c
3. c
4. b
5. c
6. b
7. c
A P P LY 1. c
2. b
SYNTHESIZE 1. Theoretically, 25% of the children from this cross will be color blind. All of the color blind children will be male and 50% of the males will be color blind. 2. Parents of heterozygous plant were: green wrinkled X yellow round Frequency of recombinants is 36+29/1300=0.05 Map distance = 5 cM 3. Male calico cats are very rare. The coloration that is associated with calico cats is the product of X inactivation. X inactivation only occurs in females as a response to dosage levels of the X-linked genes. The only way to get a male calico is to be heterozygous for the color gene and to be the equivalent of a Klinefelters male (XXY).
CHAPTER 14 LEARNING OUTCOME QUESTIONS 14.1 The 20 different amino acid building blocks offers chemical complexity. This appears to offer informational complexity as well.
14.2 The proper tautomeric forms are necessary for proper base pairing, which is critical to DNA structure.
14.3 Prior to replication in light N there would be only one band. After one round of replication, there would be two bands with denatured DNA: one heavy and one light.
14.4 The 5 to 3 activity is used to remove RNA primers. The 3 to 5 activity is used to removed mispaired bases (proofreading).
14.5 A shortening of chromosome ends would eventually affect DNA that encodes important functions.
14.6 No. The number of DNA damaging agents, in addition to replication errors, would cause lethal damage (this has been tested in yeast).
CHAPTER 13
INQUIRY QUESTIONS
LEARNING OUTCOME QUESTIONS
Page 262 Because adenine always forms bonds with only thymine, and guanine
13.1 Females would be all wild type; males would be all white eyed. 13.2 Yes, should be viable and appear female. 13.3 The mt-DNA could be degraded by a nuclease similar to how bacteria
forms bonds with only cytosine, adenine and thymine will always have the same proportions, and likewise with guanine and cytosine.
deal with invading viruses. Alternatively, the mt-containing mitochondria could be excluded from the zygote.
Page 265 The covalent bonds create a strong backbone for the molecule making it difficult to disrupt. Individual hydrogen bonds are more easily broken allowing enzymes to separate the two strands without disrupting the inherent structure of the molecule.
13.4 No, not by genetic crosses. 13.5 Yes. First division nondisjunction yields four aneuploid gametes while
Page 269 DNA ligase is important in connecting Okazaki fragments during DNA replication. Without it, the lagging strand would not be complete.
second division yields only two aneuploid gametes.
Page 273 The linear structure of chromosomes creates the end problem discussed in the text. It is impossible to finish the ends of linear chromosomes using unidirectional polymerases that require RNA primers. The size of eukaryotic genomes also means that the time necessary to replicate the genome is much greater than in prokaryotes with smaller genomes. Thus the use of multiple origins of replication.
INQUIRY QUESTIONS Page 244 There would probably be very little if any recombination so the expected assortment ratios would have been skewed from the expected 9:3:3:1.
Page 247 About 10% of the progeny would have been recombinants, based on the relationship of 1 cM (map unit or centimorgan) equals 1% recombination frequency. When gene loci are separated by greater distances, the frequency of recombination between them increases to the extent that the number of recombinant gametes roughly equals the number of parental gametes. In that instance, the genes would exhibit independent assortment. With a recombination frequency of only 10%, it is doubtful that it would have led Mendel to the concept of independent assortment.
Page 275 Cells have a variety of DNA repair pathways that allow them to restore damaged DNA to its normal constitution. If DNA repair pathways are compromised, the cell will have a higher mutation rate. This can lead to higher rates of cancer in a multicellular organism such as humans.
U N D E R S TA N D 1. d
2. a
3. c
4. a
5. c
6. b
7. b
appendix A
rav32223_appx_A1-A34.indd A-7
A-7
11/30/09 6:35:59 PM
A P P LY 1. c
2. b
3. c
4. c
5. a
6. b
7. d
8. c
SYNTHESIZE 1. a. If both bacteria are heat-killed, then the transfer of DNA will have no effect since pathogenicity requires the production of proteins encoded by the DNA. Protein synthesis will not occur in a dead cell. b. The nonpathogenic cells will be transformed to pathogenic cells. Loss of proteins will not alter DNA. c. The nonpathogenic cells remain nonpathogenic. If the DNA is digested, it will not be transferred and no transformation will occur. 2. The region could be an origin of replication. Origins of replication are adenineand thymine-rich regions since only these nucleotides form two hydrogen bonds versus the three hydrogen bonds formed between guanine and cytosine, making it easier to separate the two strands of DNA. The RNA primer sequences would be 5-ACUAUUGCUUUAUAA-3. The sequence is antiparallel to the DNA sequence (review Figure 14.16) meaning that the 5 end of the RNA is matching up with the 3 end of the DNA. It is also important to remember that in RNA the thymine nucleotide is replaced by uracil (U). Therefore, the adenine in DNA will form a complementary base-pair with uracil. 3. a. DNA gyrase functions to relieve torsional strain on the DNA. If DNA gyrase were not functioning, the DNA molecule would undergo supercoiling, causing the DNA to wind up on itself, preventing the continued binding of the polymerases necessary for replication. b. DNA polymerase III is the primary polymerase involved in the addition of new nucleotides to the growing polymer and in the formation of the phosphodiester bonds that make up the sugar–phosphate backbone. If this enzyme were not functioning, then no new DNA strand would be synthesized and there would be no replication. c. DNA ligase is involved in the formation of phosphodiester bonds between Okazaki fragments. If this enzyme was not functioning, then the fragments would remain disconnected and would be more susceptible to digestion by nucleases. d. DNA polymerase I functions to remove and replace the RNA primers that are required for DNA polymerase III function. If DNA polymerase I was not available, then the RNA primers would remain and the replicated DNA would become a mix of DNA and RNA.
CHAPTER 15 LEARNING OUTCOME QUESTIONS 15.1 There is no molecular basis for recognition between amino acids and nucleotides. The tRNA is able to interact with nucleic acid by base pairing and an enzyme can covalently attach amino acids to it.
15.2 There would be no specificity to the genetic code. Each codon must specify a single amino acid, although amino acids can have more than one codon.
15.3 Transcription translation coupling cannot exist in eukaryotes where the two processes are separated in both space and time.
15.4 No. This is a result of the evolutionary history of eukaryotes but is not necessitated by genome complexity.
15.5 Alternative splicing offers flexibility in coding information. One gene can encode multiple proteins.
15.6 This tRNA would be able to “read” STOP codons. This could allow nonsense mutations to be viable, but would cause problems making longer than normal proteins. Most bacterial genes actually have more than one STOP at the end of the gene.
15.7 Attaching amino acids to tRNAs, bringing charged tRNAs to the ribosome, and ribosome translocation all require energy.
15.8 No. It depends on where the breakpoints are that created the inversion, or
Page 285 The promoter acts a binding site for RNA polymerase. The structure of the promoter provides information as to both where to bind, but also the direction of transcription. If the two sites were identical, the polymerase would need some other cue for the direction of transcription. Page 289 Splicing can produce multiple transcripts from the same gene. Page 297 Wobble not only explains the number of tRNAs that are observed due to the increased flexibility in the 5 position, it also accounts for the degeneracy that is observed in the Genetic Code. The degenerate base is the one in the wobble position.
U N D E R S TA N D 1. d
2. c
3. d
4. b
5. c
6. b
7. c
3. b
4. b
5. c
6. b
7. b
A P P LY 1. d
2. c
SYNTHESIZE 1. the predicted sequence of the mRNA for this gene 5–GCAAUGGGCUCGGCAUGCUAAUCC–3 the predicted amino acid sequence of the protein 5–GCA AUG GGC UCG GCA UGC UAA UCC–3 Met-Gly-Ser-Ala-Cys-STOP 2. A frameshift essentially turns the sequence of bases into a “random” sequence. If you consider the genetic code, 3 of the 64 codons are STOP, so the probability of hitting a STOP in a random sequence is 3/64 or about 1 every 20 codons. 3. a. mRNA = 5–GCA AUG GGC UCG GCA UUG CUA AUC C–3 The amino acid sequence would then be: Met-Gly-Ser-Ala-Leu-Leu-Iso-. There is no stop codon. This is an example of a frameshift mutation. The addition of a nucleotide alters the “reading frame,” resulting in a change in the type and number of amino acids in this protein. b. mRNA = 5–GCA AUG GGC UAG GCA UGC UAA UCC–3 The amino acid sequence would then be: Met-Gly-STOP. This is an example of a nonsense mutation. A single nucleotide change has resulted in the early termination of protein synthesis by altering the codon for Ser into a stop codon. c. mRNA = 5–GCA AUG GGC UCG GCA AGC UAA UCC –3 The amino acid sequence would then be: Met-Gly-Ser-Ala-Ser-STOP. This base substitution has affected the codon that would normally encode Cys (UGC) and resulted in the addition of Ser (AGC). 4. The split genes of eukaryotes offers the opportunity to control the splicing process, which does not exist in prokaryotes. This is also true for poly adenylation in eukaryotes. In prokaryotes, transcription/translation coupling offers the opportunity for the process of translation to have an effect on transcription.
CHAPTER 16 LEARNING OUTCOME QUESTIONS 16.1 The control of gene expression would be more like humans (fellow eukaryote) than E. coli.
16.2 The two helices both interact with DNA, so the spacing between the helices is important for both to be able to bind to DNA.
16.3 The operon would be on all of the time (constitutive expression). 16.4 The loss of a general transcription factor would likely be lethal as it would affect all transcription. The loss of a specific factor would affect only those genes controlled by the factor.
16.5 These genes are necessary for the ordinary functions of the cell. That is, the role of these genes is in ordinary housekeeping and not in any special functions.
duplication. For duplications it also depends on the genes that are duplicated.
16.6 RNA interference offers a way to specifically affect gene expression using
INQUIRY QUESTIONS
16.7 As there are many proteins in a cell doing a variety of functions, uncon-
Page 281 One would expect higher amounts of error in transcription over DNA replication. Proofreading is important in DNA replication because errors in DNA replication will be passed on to offspring as mutations. However, RNA’s have very short life spans in the cytoplasm therefore mistakes are not permanent.
trolled degradation of proteins would be devastating to the cell.
Page 308 The presence more than one gene in the operon allows for increased
Page 284 The very strong similarity among organisms indicates a common ancestry of the code.
control over the elements of the pathway and therefore the product. A single regulatory system can regulate several adjacent genes.
A-8
drugs made of siRNAs.
INQUIRY QUESTIONS
appendix A
rav32223_appx_A1-A34.indd A-8
11/30/09 6:36:00 PM
Page 315 Regulation occurs when various genes have the same regulatory sequences, which bind the same proteins. Page 324 Ubiqitin is added to proteins that need to be removed because they are nonfunctional or those that are degraded as part of a normal cellular cycle.
The protein may not be produced in every cell in a human. It is difficult to target the manufactured protein to only the cells where it is produced or needed. The protein could have unintended consequences in other cells in the patient’s body.
17.6 The pollen from the plant with the recombinant gene might fertilize a
U N D E R S TA N D 7. b
closely related wild plant. If the offspring are viable, the recombinant gene will be introduced into the wild population.
A P P LY
INQUIRY QUESTIONS
1. c
7. c
Page 331 A bacterial artificial chromosome or a yeast artificial chromosome
1. c
2. d
2. c
3. a
3. b
4. c
4. d
5. b
5. c
6. c
6. a
SYNTHESIZE
would be the best way to go as a plasmid vector only can stably hold up to 10 kb.
Page 332 No, cDNA is created using mRNA as a template, therefore, intron
1. Mutations that affect binding sites for proteins on DNA will control the expression of genes covalently linked to them. Introducing a wild type binding site on a plasmid will not affect this. We call this being cis-dominant. Mutations in proteins that bind to DNA would be recessive to a wild type gene introduced on a plasmid.
sequences would not be expressed.
2. Negative control of transcription occurs when the ability to initiate transcription is reduced. Positive control occurs when the ability to initiate transcription is enhanced. The lac operon is regulated by the presence or absence of lactose. The proteins encoded within the operon are specific to the catabolism (breakdown) of lactose. For this reason, operon expression is only required when there is lactose in the environment. Allolactose is formed when lactose is present in the cell. The allolactose binds to a repressor protein, altering its conformation and allowing RNA polymerase to bind. In addition to the role of lactose, there is also a role for the activator protein CAP in regulation of lac. When cAMP levels are high then CAP can bind to DNA and make it easier for RNA polymerase to bind to the promoter. The lac operon is an example of both positive and negative control.
1. b
The trp operon encodes protein manufacture of tryptophan in a cell. This operon must be expressed when cellular levels of tryptophan are low. Conversely, when tryptophan is available in the cell, there is no need to transcribe the operon. The tryptophan repressor must bind tryptophan before it can take on the right shape to bind to the operator. This is an example of negative control. 3. Forms that control gene expression that are unique to eukaryotes include alternative splicing, control of chromatin structure, control of transport of mRNA from the nucleus to the cytoplasm, control of translation by small RNAs, and control of protein levels by ubiquitin- directed destruction. Of these, most are obviously part of the unique features of eukaryotic cells. The only mechanisms that could work in prokaryotes would be translational control by small RNAs and controlled destruction of proteins. 4. Mutation is a permanent change in the DNA. Regulation is a short-term change controlled by the cell. Like mutations, regulation can alter the number of proteins in a cell, change the size of a protein, or eliminate the protein altogether. The key difference is that gene regulation can be reversed in response to changes in the cell’s environment. Mutations do not allow for this kind of rapid response.
Page 340 Yes, if you first used reverse transcriptase to make cDNA to amplify. This is called RT PCR.
U N D E R S TA N D 2. b
3. d
4. d
5. c
6. c
7. b
8. d
9. a
A P P LY 1. d
2. c
3. d
SYNTHESIZE 1. Genes coding for each of the subunits would need to be inserted into different plasmids that are integrated into different bacteria. The cultures would need to be grown separately and the different protein subunits would then need to be isolated and purified. If the subunits can self assemble in vitro, then the protein could be functional. It could be difficult to establish just the right conditions for the assembly of the multiple subunits. 2.
5–CTGATAGTCAGCTG–3
CHAPTER 18 LEARNING OUTCOME QUESTIONS 18.1 Banding sites on karyotypes depend on dyes binding to the condensed DNA that is wrapped around protein. The dyes bind to some regions, but not all and are therefore not evenly spaced along the genome in the way that sequential base-pairs are evenly spaced.
18.2 Sequencing is not a perfect process and a small number of errors would occur. Also, the number of base-pairs that can be sequenced in an individual sequencing reaction is limited. Multiple copies of the genome need to be cut in different places and sequenced so that the overlapping pieces can be assembled into an overall genome sequence. If there were not multiple, overlapping sequences, it would not be possible to determine the order of the smaller pieces that are sequenced.
18.3 One possibility is that transposable elements can move within the genome and create new genetic variability, subject to natural selection.
18.4 From the transcriptome, it is possible to predict the proteins that may be
CHAPTER 17
translated and available for use in part of an organism at a specific time in development.
LEARNING OUTCOME QUESTIONS
18.5 Yes. Additional protein could enhance the nutritional value of the potato for
17.1 EcoRI is a restriction enzyme that can be used to cut DNA at specific places.
human consumption. One caveat would be that the increased level of protein not change the texture or flavor of potatoes that a consumer is expecting.
Ligase is used to “glue” together pieces of DNA that have been cut with the same restriction enzyme. The two enzymes make it possible to add foreign DNA into an E. coli plasmid.
17.2 A cDNA library is constructed from mRNA. Unlike the gene itself, cDNA does not include the introns or regulatory elements.
17.3 Multiple rounds of DNA replication allow for an exponential increase in copies of the DNA. A heat-stable DNA polymerase makes this possible.
17.4 The gene coding for a functional protein must be mutated. Recombination allows for the “knockout” gene to be specifically targeted.
17.5 The protein must be completely pure so that the patient does not have an immune response to proteins from another organism. It is important that the protein have exactly the same structure when it is produced in a bacterial cell as in a human cell. Because post-translational modification is specific to eukaryotes, the human DNA may need to be modified before it is inserted in a bacterial genome to ensure the protein structure in identical to the human protein.
INQUIRY QUESTIONS Page 354 Repetitive elements are one of the main obstacles to assembling the DNA sequences in proper order. There is one copy of bcr (see with green probe) and one copy of abl (seen with red probe). The other bcr and abl genes are fused and the yellow color is the result of red plus green fluorescence combined).
Page 361 Repetitive elements are one of the main obstacles to assembling the DNA sequences in proper order because it is difficult to determine which sequences are overlapping. Page 366 Proteins exhibit post-translational modification and the formation of protein complexes. Additionally a single gene can code for multiple proteins using alternative splicing. Page 367 A proteome is all the proteins coded for by the genome, and the transcriptome is all the RNA present in a cell or tissue at a specific time.
appendix A
rav32223_appx_A1-A34.indd A-9
A-9
11/30/09 6:36:00 PM
Page 369 You may be able to take advantage of synteny between the rice and
A P P LY
corn genome (see Figure 18.14). Let’s assume that a drought-tolerance gene has already been identified and mapped in rice. Using what is known about synteny between the rice and corn genomes, you could find the region of the corn genome that corresponds to the rice drought-tolerance gene. This would narrow down the region of the corn genome that you might want to sequence to find your gene. A subsequent step might be to modify the corn gene that corresponds to the rice gene to see if you can increase drought tolerance.
1. d
U N D E R S TA N D 1. b
2. a
3. c
4. d
5. b
6. c
7. b
3. d
4. b
5. c
6. d
7. d
8. d
A P P LY 1. b
2. a
SYNTHESIZE 1. The STSs represent unique sequences in the genome. They can be used to align the clones into one contiguous sequence of the genome based on the presence or absence of an STS in a clone. The contig, with aligned clones, would look like this:
STS 1 STS 2 Clone E STS 2
STS 3
Clone B STS 3
STS 4 STS 5
Clone A STS 3 Clone D
STS 4 STS 5
STS 6
STS 4 STS 5
STS 6
Clone C STS 1 STS 2
STS 3
Contig 2. The anthrax genome has been sequenced. Investigators would look for differences in the genome between existing natural strains and those collected from a suspected outbreak. The genome of an infectious agent can be modified, or “weaponized,” to make it more deadly. Also, single-nucleotide polymorphisms could be used to identify the source of the anthrax. In the case of the Florida anthrax outbreak it was determined that the source was a research laboratory.
CHAPTER 19 LEARNING OUTCOME QUESTIONS 19.2 The early cell divisions are very rapid and do not involve an increase in size
2. a
3. b
4. a
5. c
6. c
7. c
SYNTHESIZE 1. The horizontal lines of the fate map represent cell divisions. Starting with the egg, four cell divisions are required to establish a population of cells that will become nervous tissue. It takes another eight to nine divisions to produce the final number of cells that will make up the nervous system of the worm. It takes seven to eight rounds of cell division to generate the population of cells that will become the gonads. Once established, another seven to eight cell divisions are required to produce the actual gonad cells. 2. Not every cell in a developing embryo will survive. The process of apoptosis is responsible for eliminating cells from the embryo. In C. elegans, the process of apoptosis is regulated by three genes: ced-3, ced-4, and ced-9. Both ced-3 and ced-4 encode proteases, enzymes that degrade proteins. Interestingly, the ced-3 protease functions to activate gene expression of the ced-4 protease. Together, these proteases will destroy the cell from the inside-out. The ced-9 gene functions to repress the activity of the protease-encoding genes, thereby preventing apoptosis. 3. a. N-cadherin plays a specific role in differentiating cells of the nervous system from ectodermal cells. Ectodermal cells express E-cadherin, but neural cells express N-cadherin. The difference in cell-surface cadherins means that the neural cells lose their contact with the surrounding ectodermal cells and establish new contacts with other neural cells. In the absence of N-cadherin, the nervous system would not form. If you assume that E-cadherin expression is also lost (as would occur normally in development) then these cells would lose all cell–cell contacts and would probably undergo apoptosis. b. Integrins mediate the connection between a cell and its surrounding environment, the extracellular matrix (ECM). The loss of integrins would result in the loss of cell adhesion to the ECM. These cells would not be able to move and therefore, gastrulation and other developmental processes would be disrupted. c. Integrins function by linking the cell’s cytoskeleton to the ECM. This connection is critical for cell movement. The deletion of the cytoplasmic domain of the integrin would not affect the ability of integrin to attach to the ECM, but it would prevent the cytoskeleton from getting a “grip.” This deletion would likely result in a disruption of development similar to the complete loss of integrin. 4. Adult cells from the patient would be cultured with factors that reprogram the nucleus into pluripotent cells. These cells would then be grown in culture with factors necessary to induce differentiation into a specific cell type that could be transplanted into the patient. This would be easiest for tissue like a liver that regenerates, but could in theory be used for a variety of cell types.
CHAPTER 20
between divisions. Interphase is greatly reduced allowing very fast cell divisions.
LEARNING OUTCOME QUESTIONS
19.3 This requires experimentation to isolate cell from contact, which would
20.1 Natural selection occurs when some individuals are better suited to their
prevent induction, or to follow a particular cells lineage.
environment than others. These individuals live longer and reproduce more, leaving more offspring with the traits that enabled their parents to thrive. In essence, genetic variation within a population provides the raw material on which natural selection can act.
19.4 The nucleus must be reprogrammed. What this means exactly on the molecular level is not clear, but probably involves changes in chromatin structure and methylation patterns.
19.5 Homeotic genes seem to have arisen very early in the evolutionary history of bilaterians. These have been duplicated and they have diversified with increasing morphological complexity. 19.6 Cell death can be a patterning mechanism. Your fingers were sculpted from a paddle-like structure by cell death.
INQUIRY QUESTION Page 378
The macho-1 gene product is a transcription factor that can activate the expression of several muscle-specific genes. Whether or not the fibroblast growth factor (FGF) signal is received from underlying endoderm precursor cells in the embryo determines how macho-1 acts. If the FGF signal is present, it activates a Ras/MAP kinase pathway which, together with macho-1, either suppresses muscle genes or activates the transcription of mesenchyme genes. Without the FGF signal, macho-1 alone triggers the transcription of muscle genes.
U N D E R S TA N D 1. b
2. d
A-10
3. c
4. d
5. b
6. c
7. b
20.2 To determine if a population is in Hardy Weinberg equilibrium, one would first need to determine the actual allele frequencies, which can be calculated based on the actual genotype frequencies. After assigning variables p and q to the actual allele frequencies, one would then use the Hardy Weinberg equation, p2 + 2pq + q2 = 1 in order to determine the expected genotype frequencies. If the actual and expected genotype frequencies are the same (or, at least not significantly different) then it is safe to say that the population is in Hardy Weinberg equilibrium. 20.3 There are five mechanisms of evolution—natural selection, mutation, gene flow (migration), genetic drift, and nonrandom mating. Any of these mechanisms can alter allele frequencies within a population, although usually a change in allele frequency results from more than one mechanism working in concert (for example, mutation will introduce a beneficial new allele into the population, and natural selection will select for that allele such that its frequency increases over the course of two or more generations). Natural selection, the first mechanism and probably the most influential in bringing about evolutionary change, is also the only mechanism to produce adaptive change, that is, change that results in the population being better adapted to its environment. Mutation is the only way in which new alleles can
appendix A
rav32223_appx_A1-A34.indd A-10
12/7/09 4:56:21 PM
be introduced—it is the ultimate source of all variation. Because it is a relatively rare event, mutation by itself is not a strong agent of allele frequency change; however, in concert with other mechanisms, especially natural selection, it can drastically change the allele frequencies in a population. Gene flow can introduce new alleles into a population from another population of the same species, thus changing the allele frequency within both the recipient and donor populations. Genetic drift is the random, chance factor of evolution—while the results of genetic drift can be negligible in a large population, small populations can see drastic changes in allele frequency due to this agent. Finally, nonrandom mating results in populations varying from Hardy Weinberg equilibrium not by changing allele frequencies but by changing genotype frequencies—nonrandom mating reduces the proportion of heterozygotes in a population.
mozygous or heterozygous black. If the 16 white cats died, they will not contribute recessive white genes to the next generation. Only heterozygous black cats will produce white kittens in a 3:1 ratio of black to white. Homozygous × homozygous black and homozygous × heterozygous black cats will have all black kittens. Since there are 36 homozygous black cats and 48 heterozygous black cats, with a new total of 84 cats, the new frequency of homozygous black cats is 36/84 or 43%, with the heterozygous black cats now comprising 57% of the population. If p2 = 0.43, then p = 0.65 (approximately), then 1–p = q, and q = 0.35. The frequency of white kittens in the next generation, q2, is 0.12 or 12%.
20.4 Reproductive success relative to other individuals within an organism’s
Page 406 Since the intermediate-sized water strider has the highest level of fitness, it would be expected that the intermediate size would become more prevalent in the population. If the number of eggs laid per day was not affected by body size, the small water striders would be favored because of their tendency to live longer than their larger counterparts.
population is referred to as that organism’s fitness. Its fitness is determined by its longevity, mating frequency, and the number of offspring it produces for each mating. None of these factors is always the most important in determining reproductive success—instead it is the cumulative effects of all three factors that determines an individual’s reproductive success. For example, an individual that has a very long life span but mates only infrequently might have lower fitness than a conspecific that lives only half as long but mates more frequently and with greater success. As seen with the water strider example in this section, traits that are favored for one component of fitness, say, for example, longevity, may be disadvantageous for other components of fitness, say, lifetime fecundity.
20.5 The dynamics among the different evolutionary mechanisms are very intricate, and it is often difficult, if not impossible, to discern which direction each process is operating within a population—it is much easier to simply see the final cumulative effects of the various agents of evolutionary change. However, there are cases in which more than one evolutionary process will operate in the same direction, with the resulting population changing, or evolving, more rapidly than it would have under only one evolutionary mechanism. For example, mutation may introduce a beneficial allele into a population; gene flow could then spread the new allele to other populations. Natural selection will favor this allele within each population, resulting in relatively rapid evolutionary adaptation of a novel phenotype.
20.6 In a population wherein heterozygotes had the lowest fitness, natural selection should favor both homozygous forms. This would result in disruptive selection, and a bimodal distribution of traits within the population. Over enough time, it could lead to a speciation event.
20.7 Directional selection occurs when one phenotype has an adaptive advantage over other phenotypes in the population, regardless of its relative frequency within the population. Frequency-dependent selection, on the other hand, results when either a common (positive frequency-dependent selection) or rare (negative frequency-dependent selection) has a selective advantage simply by virtue of its commonality or rarity. In other words, if a mutation introduces a novel allele into a population, directional selection may result in evolution because the allele is advantageous, not because it is rare.
20.8 Wild guppies have to balance natural selection, which, in the presence of a predator such as the pike cichlid, would tend to favor drab coloration, with sexual selection, wherein females prefer brightly colored males. Thus, in low-predation environments the male guppies tend to be brightly colored whereas in high-predation environments they are drably colored. Background color matching is a form of camouflage used by many species to avoid predation; again, however, in many cases this example of natural selection runs counter to sexual selection—males want to be inconspicuous to predators but attractive to potential mates. For example, to test the effects of predation on background color matching in a species of butterfly, one might raise captive populations of butterflies with a normal variation in coloration. After a few generations, add natural predators to half of the enclosures. After several generations, one would expect the butterflies in the predatory environment to have a high degree of background color matching in order to avoid predation, while the non-predatory environment would have promoted brightly-colored individuals where color would correlate with mating success.
20.9 Pleiotropic effects occur with many genes; in other words, a single gene has multiple effects on the phenotype of the individual. Whereas natural selection might favor a particular aspect of the pleiotropic gene, it might select against another aspect of the same gene; thus, pleiotropy often limits the degree to which a phenotype can be altered by natural selection. Epistasis occurs when the expression of one gene is controlled or altered by the existence or expression of another gene. Thus, the outcome of natural selection will depend not just on the genotype of one gene, but the other genotype as well.
INQUIRY QUESTIONS Page 399 In the example of Figure 20.3, the frequency of the recessive white genotype is 0.16. The remaining 84 cats (out of 100) in the population are ho-
Page 405 Differential predation might favor brown toads over green toads, green toads might be more susceptible to disease, or green toads might be less able to tolerate variations in climate, among other possibilities.
Page 407 Yes. The frequency of copper tolerance will decrease as distance from the mine increases. Page 411 The proportion of flies moving toward light (positive phototropism) would again begin to increase in successive generations. Page 411 The distribution of birth weights in the human population would expand somewhat to include more babies of higher and lower birth weights. Page 413 Guppy predators evidently locate their prey using visual cues. The more colorful the guppy, the more likely it is to be seen and thus the more likely it will become prey. Page 414 Thoroughbred horse breeders have been using selective breeding for certain traits over many decades, effectively removing variation from the population of thoroughbred horses. Unless mutation produces a faster horse, it remains unlikely that winning speeds will improve.
U N D E R S TA N D 1. a
2. b
3. d
4. a
5. d
6. a
7. d
A P P LY 1. d
2. d
3. a
SYNTHESIZE 1. The results depend on coloration of guppies increasing their conspicuousness to predators such that an individual’s probability of survival is lower than if it was a drab morph. In the laboratory it may be possible to conduct trials in simulated environments; we would predict, based on the hypothesis of predation, that the predator would capture more of the colorful morph than the drab morph when given access to both. Design of the simulated environment would obviously be critical, but results from such an experiment, if successful, would be a powerful addition to the work already accomplished. 2. On the large lava flows, where the background is almost entirely black, those individuals with black coloration within a population will have a selective advantage because they will be more cryptic to predators. On the other hand, on small flows, which are disrupted by light sand and green plants, dark individuals would be at an adaptive disadvantage for the same reason. You can read more about this in chapter 21 (21.2); the black peppered moths had an advantage on the trees lacking lichen, but a disadvantage on lichen-covered trees. 3. Ultimately, genetic variation is produced by the process of mutation. However, compared with the speed at which natural selection can reduce variation in traits that are closely related to fitness, mutation alone cannot account for the persistence of genetic variation in traits that are under strong selection. Other processes can account for the observation that genetic variation can persist under strong selection. They include gene flow. Populations are often distributed along environmental gradients of some type. To the extent that different environments favor slightly different variants of phenotypes that have a genetic basis, gene flow among areas in the habitat gradient can introduce new genetic variation or help maintain existing variation. Similarly, just as populations frequently encounter different selective environments across their range (think of the guppies living above and below the waterfalls in Trinidad), a single population also encounters variation in selective environments across time (oscillating selection). Traits favored this year may not be the same as those favored next year, leading to a switching of natural selection and the maintenance of genetic variation.
appendix A
rav32223_appx_A1-A34.indd A-11
A-11
11/30/09 6:36:00 PM
CHAPTER 21 LEARNING OUTCOME QUESTIONS 21.1 No. If eating hard seeds caused individuals to develop bigger beaks, then the phenotype is a result of the environment, not the genotype. Natural selection can only act upon those traits with a genetic component. Just as a body builder develops large muscles in his or her lifetime but does not have well-muscled offspring, birds that develop large beaks in their lifetime will not necessarily have offspring with larger beaks.
21.2 An experimental design that would test this hypothesis could be as simple as producing enclosures for the moths and placing equal numbers of both morphs into each enclosure and then presenting predatory birds to each enclosure. One enclosure could be used as a control. One enclosure would have a dark background while the other would have a light background. After several generations, measuring the phenotype frequency of the moths should reveal very clear trends—the enclosure with the dark background should consist of mostly dark moths, the enclosure with the light background mostly light moths, and the neutral enclosure should have an approximately equal ratio of light to dark moths.
21.3 If the trait that is being artificially selected for is due to the environment rather than underlying genotype, then the individuals selected that have that trait will not necessarily pass it on to their offspring.
21.4 The major selective agent in most cases of natural selection is the environment; thus, climatic changes, major continental shifts, and other major geological changes would result in dramatic changes in selective pressure; during these times the rate and direction of evolutionary change would likely be affected in many, if not most, species. On the other hand, during periods of relative environmental stability, the selective pressure does not change and we would not expect to see many major evolutionary events.
21.5 The only other explanation that could be used to explain homologous characteristics and vestigial structures could be mutation. Especially in the case of vestigial structures, if one resulted from a mutation that had pleiotropic effects, and the other effects of the genetic anomaly were selected for, then the vestigial structure would also be selected for, much like a rider on a Congressional Bill.
21.6 Convergence occurs when distantly related species experience similar environmental pressures and respond, through natural selection, in similar ways. For example, penguins (birds), sharks (fish), sea lions (mammals) and even the extinct ichthyosaur (reptile) all exhibit the fusiform shape. Each of these animals has similar environmental pressures in that they are all aquatic predators and need to be able to move swiftly and agilely through the water. Clearly their most recent common ancestor does not have the fusiform body shape; thus the similarities are due to convergence (environment) rather than homology (ancestry). However, similar environmental pressures will not always result in convergent evolution. Most importantly, in order for a trait to appear for the first time in a lineage, there must have been a mutation; however, mutations are rare events, and even rarer is a beneficial mutation. There may also be other species that already occupy a particular niche; in these cases it would be unlikely that natural selection would favor traits that would increase the competition between two species.
21.7 It is really neither a hypothesis nor a theory. Theories are the building blocks of scientific knowledge, they have withstood the most rigorous testing and review. Hypotheses, on the other hand, are tentative answers to a question. Unfortunately, a good hypothesis must be testable and falsifiable, and stating that humans came from Mars is not realistically testable or falsifiable; thus, it is, in the realm of biological science, a nonsense statement.
INQUIRY QUESTIONS Page 419 The figure demonstrates that the beak depth of offspring can be predicted by the average beak depth of the parent’s bills. Thus, one would expect the offspring to have the same beak depth if their parents’ mean beak depth is the same. This is only correct if males and females do not differ in beak depth. In species for which the sexes differ (such as height in humans), then one would need to know both the depth and the sex of the parents and the calculation would be more complicated.
Page 421 Such a parallel trend would suggest that similar processes are operating in both localities. Thus, one would conduct a study to identify similarities. In this case, both areas have experienced coincident reductions in air pollution, which most likely is the cause of the parallel evolutionary trends. Page 422 Assuming that small and large individuals would breed with each other, then middle-sized offspring would still be born (the result of matings between small and large flies). Nonetheless, there would also be many small and large individuals (the result of small × small and large × large matings). Thus, the
A-12
frequency distribution of body sizes would be much broader than the distributions in the figures.
Page 426 This evolutionary decrease could occur for many reasons. For example, maybe Nannippus adapted to forested habitats and thus selection favored smaller size, as it had in the ancestral horses, before horses moved into open, grassland habitats. Another possibility is that there were many species of horses present at that time, and different sized horses ate different types of food. By evolving small size, Nannippus may have been able to eat a type of food not eaten by the others.
U N D E R S TA N D 1. d
2. b
3. b
4. a
5. b
6. b
7. b
A P P LY 1. a
2. d
3. d
SYNTHESIZE 1. Briefly, they are: A. There must be variation among individuals within a population. B. Variation among individuals must be related to differences among individuals in their success in producing offspring over their lifetime. C. Variation related to lifetime reproductive success must have a genetic (heritable) basis. 2. Figure 21.2a shows in an indirect way that beak depth varies from year to year. Presumably this is a function of variation among individuals in beak size. However, the most important point of 21.2a is that it shows the result of selection. That is, if the three conditions hold, we might expect to see average beak depth change accordingly as precipitation varies from year to year. Figure 21.2b is more directly relevant to the conditions noted for natural selection to occur. The figure shows that beak size varies among individuals, and that it tends to be inherited. 3. The relationship would be given by a cloud of points with no obvious linear trend in any direction different from a zero slope. In other words, it would be a horizontal line through an approximately circular cloud of points. Such data would suggest that whether a parent(s) has a large or small beak has no bearing on the beak size of its offspring. 4. Assuming that small and large individuals would breed with each other, then middle-sized offspring would still be born (the result of matings between small and large flies). Nonetheless, there would also be many small and large individuals (the result of small × small and large × large matings). Thus, the frequency distribution of body sizes would be much broader than the distributions in the figures. In some experiments, reproductive isolation evolves in which small and large individuals evolve mating preferences that prevent them from interbreeding, leading to the production of two different-sized species. This would be a laboratory example of sympatric speciation. Most studies, however, have failed to produce such reproductive isolation; rather, a single population remains through time with great variation. 5. The evolution of horses was not a linear event; instead it occurred over 55 million years and included descendents of 34 different genera. By examining the fossil record, one can see that horse evolution did not occur gradually and steadily; instead several major evolutionary events occurred in response to drastic changes in environmental pressures. The fossil record of horse evolution is remarkably detailed, and shows that while there have been trends toward certain characteristics, change has not been fluid and constant over time, nor has it been entirely consistent across all of the horse lineages. For example, some lineages experienced rapid increases in body size over relatively short periods of geological time, while other lineages actually saw decreases in body size.
CHAPTER 22 LEARNING OUTCOME QUESTIONS 22.1 The Biological Species Concept states that different species are capable of mating and producing viable, fertile offspring. If sympatric species are unable to do so, they will remain reproductively isolated and thus distinct species. Along the same lines, gene flow between populations of the same species allow for homogenization of the two populations such that they remain the same species.
22.2 In order for reinforcement to occur and complete the process of speciation, two populations must have some reproductive barriers in place prior to sympatry. In the absence of this initial reproductive isolation we would expect rapid exchange
appendix A
rav32223_appx_A1-A34.indd A-12
11/30/09 6:36:00 PM
of genes and thus homogenization resulting from gene flow. On the other hand, if two populations are already somewhat reproductively isolated (due to hybrid infertility or a prezygotic barrier such as behavioral isolation), then we would expect natural selection to continue improving the fitness of the non-hybrid offspring, eventually resulting in speciation.
22.3 Reproductive isolation that occurs due to different environments is a factor of natural selection; the environmental pressure favors individuals best suited for that environment. As isolated populations continue to develop, they accumulate differences due to natural selection that eventually will result in two populations so different that they are reproductively isolated. Reinforcement, on the other hand, is a process that specifically relates to reproductive isolation. It occurs when natural selection favors non-hybrids because of hybrid infertility or are simply less fit than their parents. In this way, populations that may have been only partly reproductively isolated become completely reproductively isolated.
22.4 Polyploidy occurs instantaneously; in a single generation, the offspring of two different parental species may be reproductively isolated; however, if it is capable of self-fertilization then it is, according to the Biological Species Concept, a new species. Disruptive selection, on the other hand, requires many generations as reproductive barriers between the two populations must evolve and be reinforced before the two would be considered separate species.
22.5 In the archipelago model, adaptive radiation occurs as each individual island population adapts to its different environmental pressures. In sympatric speciation resulting from disruptive selection, on the other hand, traits are selected for that are not necessarily best suited for a novel environment but are best able to reduce competition with other individuals. It is in the latter scenario wherein adaptive radiation due to a key innovation is most likely to occur.
22.6 It depends on what species concept you are using to define a given species. Certainly evolutionary change can be punctuated, but in times of changing environmental pressures we would expect adaptation to occur. The adaptations, however, do not necessarily have to lead to the splitting of a species—instead one species could simply change in accordance with the environmental changes to which it is subjected. This would be an example of non-branching, as opposed to branching, evolution; but again, whether the end-result organism is a different species from its ancestral organism that preceded the punctuated event is subject to interpretation.
22.7 Unlike the previous major mass extinction events, the current mass extinction is largely attributable to human activity, including but not limited to habitat degradation, pollution, and hunting.
INQUIRY QUESTIONS Page 447 Speciation can occur under allopatric conditions because isolated populations are more likely to diverge over time due to drift or selection. Adaptive radiation tends to occur in places inhabited by only a few other species or where many resources in a habitat are unused. Different environmental conditions typical of adaptive radiation tend to favor certain traits within a population. Allopatric conditions would then generally favor adaptive radiation. In character displacement, natural selection in each species favors individuals able to use resources not used by the other species. Two species might have evolved from two populations of the same species located in the same environment (sympatric species). Individuals at the extremes of each population are able to resources not used by the other group. Competition for a resource would be reduced for these individuals, possibly favoring their survival and leading to selection for the tendency to use the new resource. Character displacement tends to compliment sympatric speciation.
Page 452 If one area experiences an unfavorable change in climate, a mobile species can move to another area where the climate was like it was before the change. With little environmental change to drive natural selection within that species, stasis would be favored.
U N D E R S TA N D 1. a
2. c
3. a
4. b
5. a
6. a
3. d
4. a
5. b
6. b
7. d
8. b
A P P LY 1. b
2. a
SYNTHESIZE 1. If hybrids between two species have reduced viability or fertility, then natural selection will favor any trait that prevents hybrid matings. The reason is that individuals that don’t waste time, energy, or resources on such matings will have greater fitness if they instead spend the time, energy, and resources on mating with members of their own species. For this reason, natural selection
will favor any trait that decreases the probability of hybridization. By contrast, once hybridization has occurred, the time, energy, and resources have already been expended. Thus, there is no reason that less fit hybrids would be favored over more fit ones. The only exception is for species that invest considerable time and energy in incubating eggs and rearing the young; for those species, selection may favor reduced viability of hybrids because parents of such individuals will not waste further time and energy on them. 2. The biological species concept, despite its limitations, reveals the continuum of biological processes and the complexity and dynamics of organic evolution. At the very least, the biological species concept provides a mechanism for biologists to communicate about taxa and know that they are talking about the same thing! Perhaps even more significantly, discussion and debate about the meaning of “species” fuels a deeper understanding about biology and evolution in general. It is unlikely that we will ever have a single unifying concept of species given the vast diversity of life, both extinct and extant. 3. The principle is the same as in character displacement. In sympatry, individuals of the two species that look alike may mate with each other. If the species are not completely interfertile, then individuals hybridizing will be at a selective disadvantage. If a trait appears in one species that allows that species to more easily recognize members of its own species and thus avoid hybridization, then individuals bearing that trait will have higher fitness and that trait will spread through the population. 4. I would expect the two species to have more similar morphology when they are found alone (allopatry) than when they are found together (sympatry), assuming that food resources were the same from one island to the next. This would be the result of character displacement expected under a hypothesis of competition for food when the two species occur in sympatry. A species pair that is more distantly related might not be expected to show the pattern of character displacement since they show greater differences in morphology (and presumably in ecology and behavior as well), which should reduce the potential for competition to drive character divergence.
CHAPTER 23 LEARNING OUTCOME QUESTIONS 23.1 Because of convergent evolution; two distantly related species subjected to the same environmental pressures may be more phenotypically similar than two species with different environmental pressures but a more recent common ancestor. Other reasons for the possible dissimilarity between closely related species include oscillating selection and rapid adaptive radiations in which species rapidly adapt to a new available niche.
23.2 In some cases wherein characters diverge rapidly relative to the frequency of speciation, it can be difficult to construct a phylogeny using cladistics because the most parsimonious phylogeny may not be the most accurate. In most cases, however, cladistics is a very useful tool for inferring phylogenetic relationships among groups of organisms.
23.3 Yes, in some instances this is possible. For example, assume two populations of a species become geographically isolated from one another in similar environments, and each population diverges and speciation occurs, with one group retaining its ancestral traits and the other deriving new traits. The ancestral group in each population may be part of the same biological species but would be considered polyphyletic because to include their common ancestor would also necessitate including the other, more derived species (which may have diverged enough to be reproductively isolated).
23.4 Not necessarily; it is possible that the character changed since the common ancestor and is present in each group due to convergence. While the most recent common ancestor possessing the character is the most parsimonious, and thus the most likely, explanation, it is possible, especially for small clades, that similar environmental pressures resulted in the emergence of the same character state repeatedly during the course of the clade’s evolution.
23.5 Hypothetically it is possible; however, the viral analyses and phylogenetic analyses have provided strong evidence that HIV emergence was the other way around; it began as a simian disease and mutated to become a human form, and that this has occurred several times.
INQUIRY QUESTIONS Page 461 In parsimony analyses of phylogenies, the least complex explanation is favored. High rates of evolutionary change and few character states complicate matters. High rates of evolutionary change, such as occur when mutations arise in noncoding portions of DNA, can be misleading when constructing phylogenies. Mutations arising in noncoding DNA are not eliminated by natural selection in appendix A
rav32223_appx_A1-A34.indd A-13
A-13
11/30/09 6:36:00 PM
the same manner as mutations in coding (functional) DNA. Also, evolution of new character states can be very high in nonfunctional DNA and this can lead to genetic drift. Since DNA has only four nucleotides (four character states) it is highly likely that two species could evolve the same derived character at a particular base position. This leads to a violation of the assumptions of parsimony—that the fewest evolutionary events lead to the best hypothesis of phylogenetic relationships—and resulting phylogenies are inaccurate.
Page 462 The only other hypothesis is that the most recent common ancestor of birds and bats was also winged. Of course, this scenario is much less parsimonious (and thus much more unlikely) than the convergence hypothesis, especially given the vast number of reptiles and mammals without wings. Most phylogenies are constructed based on the rule of parsimony; in the absence of fossil evidence of other winged animals and molecular data supporting a closer relationship between birds and bats than previously thought, there is no way to test the hypothesis that bird and bat wings are homologous rather than analogous. Page 471 If the victim had contracted HIV from a source other than the patient, the most recent common ancestor of the two strains would be much more distant. As it is, the phylogeny shows that the victim and patient strains share a relatively recent ancestor, and that the victim’s strain is derived from the patient’s strain.
U N D E R S TA N D 1. d
2. b
3. a
4. b
5. a
6. d
7. b
8. c
2. d
CHAPTER 24 24.1 There should be a high degree of similarity between the two genomes because
3. d
4. a
SYNTHESIZE 1. Naming of groups can be variable; names provided here are just examples. Jaws—shark, salamander, lizard, tiger, gorilla, human (jawed vertebrates); lungs—salamander, lizard, tiger, gorilla, human (terrestrial tetrapods); amniotic membrane—lizard, tiger, gorilla, human (amniote tetrapods); hair—tiger, gorilla, human (mammals); no tail—gorilla, human (humanoid primate); bipedal—human (human). 2. It would seem to be somewhat of a conundrum, or potentially circular; choosing a closely related species as an outgroup when we do not even know the relationships of the species of interest. One way of guarding against a poor choice for an outgroup is to choose several species as outgroups and examine how the phylogenetic hypothesis for the group of interest changes as a consequence of using different outgroups. If the choice of outgroup makes little difference, then that might increase one’s confidence in the phylogenetic hypotheses for the species of interest. On the other hand, if the choice makes a big difference (different phylogenetic hypotheses result when choosing different outgroups), that might at least lead to the conclusion that one cannot be confident in inferring a robust phylogenetic hypothesis for the group of interest without collecting more data. 3. Recognizing that birds are reptiles potentially provides insight to the biology of both birds and reptiles. For example, some characteristics of birds are clearly of reptilian origin, such as feathers (modified scales), nasal salt secreting glands, and strategies of osmoregulation/excretion (excreting nitrogenous waste products as uric acid) representing ancestral traits, that continue to serve birds well in their environments. On the other hand, some differences from other reptiles (again, feathers) seem to have such profound significance biologically, that they overwhelm similarities visible in shared ancestral characteristics. For example, no extant nonavian reptiles can fly, or are endothermic and these two traits have created a fundamental distinction in the minds of many biologists. Indeed, many vertebrate biologists prefer to continue to distinguish birds from reptiles rather than emphasize their similarities even though they recognize the power of cladistic analysis in helping to shape classification. Ultimately, it may be nothing much more substantial than habit which drives the preference of some biologists to traditional classification schemes. 4. In fact, such evolutionary transitions (the loss of the larval mode, and the re-evolution of a larval mode from direct development) are treated with equal weight under the simplest form of parsimony. However, if it is known from independent methods (for example, developmental biology) that one kind of change is less likely than another (loss versus a reversal), these should and can be taken into account in various ways. The simplest way might be to assign weights based on likelihoods; two transitions from larval development to direct development is equal to one reversal from direct development back to a larval mode. In fact, there are such methods, and they are similar in spirit to the statistical approaches used to build specific models of evolutionary change rather than rely on simple parsimony.
A-14
6. The biological species concept focuses on processes, in particular those which result in the evolution of a population to the degree that it becomes reproductively isolated from its ancestral population. The process of speciation as utilized by the biological species concept occurs through the interrelatedness of evolutionary mechanisms such as natural selection, mutation, and genetic drift. On the other hand, the phylogenetic species concept focuses not on process but on history, on the evolutionary patterns that led to the divergence between populations. Neither species concept is more right or more wrong; species concepts are, by their very nature, subjective and potentially controversial.
LEARNING OUTCOME QUESTIONS
A P P LY 1. c
5. The structures are both homologous, as forelimbs, and convergent, as wings. In other words, the most recent common ancestor of birds, pterosaurs and bats had a forelimb similar in morphology to that which these organisms possess—it has similar bones and articulations. Thus, the forelimb itself among these organisms is homologous. The wing, however, is clearly convergent; the most recent common ancestor surely did not have wings (or all other mammals and reptiles would have had to have lost the wing, which violates the rule of parsimony). The wing of flying insects is purely convergent with the vertebrate wing, as the forelimb of the insect is not homologous with the vertebrate forelimb.
they are relatively closely related. There could be differences in the relative amounts of non-coding DNA. Genes that are necessary for bony skeletal development might be found in the bony fish. The cartilaginous fish might lack those genes or have substantial sequences in the genes needed for skeletal development in bony fish.
24.2 There would now be three copies of the chromosome from the same species. This would cause a problem for the cell during meiosis I as there would not be an even number of homologs of the chromosome to pair up and segregate.
24.3 Compare the sequence of the pseudogene with other species. If, for example, it is a pseudogene of an olfactory gene that is found in mice or chimps, the sequences will be much more similar than in a more distantly related species. If horizontal gene transfer explains the origins of the gene, there may not be a very similar gene in closely related species. You might use the BLAST algorithm discussed in chapter 18 to identify similar sequences and then construct a phylogenetic tree to compare the relationships among the different species.
24.4 A SNP can change a single amino acid in the coded peptide. If the new R group is very different, the protein may fold in a different way and not function effectively. SNPs in the FOXP2 gene may, in part, explain why humans have speech and chimps do not. Other examples that you may remember from earlier in the text include cystic fibrosis and sickle cell anemia.
24.5 One approach would be to create a mutation in the non-coding gene and ask whether or not this changes the phenotype. You would need to be sure that both copies of the nonprotein-coding gene were “knocked out.”
24.6 Much of the non-coding DNA could contain retrotransposons that replicate and insert the new DNA into the genome, enlarging the genome. Since the number of genes does not change, polyploidy is not a good explanation.
24.7 An effective drug might bind only to the region of the pathogen protein that is distinct from the human protein. The drug could render the pathogen protein ineffective without making the human ill. If the seven amino acids that differ are scattered throughout the genome, they might have a minimal effect on the protein and it would be difficult to develop a drug that could detect small differences. It’s possible that the drug could inadvertently affect other areas of the protein as well.
24.8 One approach would be to create transgenic soy with additional protein coding genes.
INQUIRY QUESTIONS Page 478 Meiosis in a 3n cell would be impossible because three sets of chromosomes cannot be divided equally between two cells. In a 3n cell, all three homologous chromosomes would pair in prophase I, then align during anaphase I. As the homologous chromosomes separate, two of a triplet might go to one cell while the third chromosome would go to the other cell. The same would be true for each set of homologues. Daughter cells would have an unpredictable number of chromosomes.
Page 479 Polyploidization seems to induce the elimination of duplicated genes. Duplicate genes code for the same gene product. It is reasonable that duplicate genes would be eliminated to decrease the redundancy arising from the translation of several copies of the same gene.
appendix A
rav32223_appx_A1-A34.indd A-14
11/30/09 6:36:00 PM
Page 484 Ape and human genomes show very different patterns of gene transcription activity, even though genes encoding proteins are over 99% similar between chimps and humans. Different genes would be transcribed when comparing apes with humans, and the levels of transcription would vary widely.
2. d
3. d
4. b
3. d
4. a
5. b
6. a
A P P LY 1. a
2. d
INQUIRY QUESTIONS Page 495 Because there is a stop codon located in the middle of the CAL (cau-
U N D E R S TA N D 1. c
selected for and over time more of the fish would have eyes. Keep in mind that the probability of a mutation restoring Pax6 function is very low, but real.
SYNTHESIZE 1. The two amino acid difference between the FOXP2 protein in humans and closely related primates must alter the way the protein functions in the brain. The protein affects motor function in the brain allowing coordination of larynx, mouth and brain for speech in humans. For example, if the protein affects transcription, there could be differences in the genes that are regulated by FOXP2 in humans and chimps. 2. Human and chimp DNA is close to 99% similar, yet our phenotypes are conspicuously different in many ways. This suggests that a catalogue of genes is just the first step to identifying the mechanisms underlying genetically influenced diseases like cancer or cystic fibrosis. Clearly, gene expression, which might involve the actions of multiple noncoding segments of the DNA and other potentially complex regulatory mechanics, are important sources of how phenotypes are formed, and it is likely that many genetically determined diseases result from such complex underlying mechanisms, making the gene identification of genomics just the first step; a necessary but not nearly sufficient strategy. What complete genomes do offer is a starting point to correlating sequence differences among humans with genetic disease, as well as the opportunity to examine how multiple genes and regulatory sequences interact to cause disease. 3. Phylogenetic analysis usually assumes that most genetic and phenotypic variation arises from descent with modification (vertical inheritance). If genetic and phenotypic characteristics can be passed horizontally (that is, not vertically through genetic lineages) then using patterns of shared character variation to infer genealogical relationships will be subject to potentially significant error. We might expect that organisms with higher rates of HGT will have phylogenetic hypotheses that are less reliable or at least are not resolved as a neatly branching tree.
CHAPTER 25 LEARNING OUTCOME QUESTIONS 25.1 A change in the promoter of a gene necessary for wing development might lead to the repression of wing development in a second segment of a fly in a species that has double wings.
25.2 No. This cichlid would need to reproduce and over time give rise to a line of cichlid’s with extra-long jaws. Perhaps they would populate a different part of the lake and not reproduce with other cichlids. Over time they could become a new species. The extra-long jaw would have to offer some selective advantage or the trait would not persist in the population.
25.3 Yes, although this is not the only explanation. The coding regions could be identical but the promoter or other regulatory regions could have been altered by mutation, leading to altered patterns of gene expression. To test this hypothesis, the pitx1 gene should be sequenced in both fish and compared. 25.4 The pectoral fins are homoplastic because sharks and whales are only distantly related and pectoral fins are not found in whales’ more recent ancestors.
25.5 The duplication could persist if a mutation in the duplicated gene prevented its expression or altered the coding region, and either a regulatory or a coding change could lead to a new function.
25.6 A phylogenetic analysis of paleoAP3 and its gene duplicates demonstrated that the presence of AP3 correlates with petal formation. The specific domain of AP3 that is necessary for petal development was identified by making gene constructs of the AP3 gene where the C terminus of the protein was eliminated or was replaced with the C terminus from the duplicate gene. The C terminus was shown to be essential for petal formation.
25.7 There is no need for eyes in the dark. Perhaps the fish expend less energy when eyes are not produced and that offered a selective advantage in cavefish. In a habitat with light, a mutation that resulted in a functional Pax6 would likely be
liflower) gene coding sequence, the wild-type function of CAL must be concerned with producing branches rather than leaves. The wild type of Brassica oleracea consists of compact plants that add leaves rather than branches; branches are typical of the flowering heads of broccoli and cauliflower. Additional evolutionary events possibly include large flower heads, unusual head coloration, protective leaves covering flower heads, or head size variants, among other possibilities.
Page 501 Functional analysis involves the use of a variety of experiments designed to test the function of a specific gene in different species. By mixing and matching parts of the AP3 and PI genes and introducing them into ap3 mutant plants, it was found that the C terminus sequence of the AP3 protein is essential for specifying petal function. Without the 3 region of the AP3 gene, the Arabidopsis plant cannot make petals.
U N D E R S TA N D 1. c
2. b
3. a
4. a
3. d
4. b
5. b
6. d
7. b
8. c
9. c
10. d
A P P LY 1. b
2. a
SYNTHESIZE 1. Mutations in the promoter region of other genes allowed them to be recognized by Tbx5, which led to transcriptional control of these genes by Tbx5. 2. Development is a highly conserved and constrained process; small perturbations can have drastic consequences, and most of these are negative. Given the thousands or hundreds of thousands of variables that can change in even a simple developmental pathway, most perturbations lead to negative outcomes. Over millions of years, some of these changes will arise under the right circumstances to produce a benefit. In this way, developmental perturbations are not different from what we know about mutations in general. Beneficial mutations are rare, but with enough time they will emerge and spread under specific circumstances. Not all mutations provide a selective advantage. For example, reduced body armor increases the fitness of fish in freshwater, but it was not selected for in a marine environment where the armor was important for protection from predators. The new trait can persist at low levels for a very long time until a change in environmental conditions results in an increase in fitness for individuals exhibiting the trait. 3. The latter view represents our current understanding. There are many examples of small gene families (such as, Hox, MADS) whose apparent role in generating phenotypic diversity among major groupings of organisms is in altering the expression of other genes. Alterations in timing (heterochrony) or spatial pattern of expression (homeosis) can lead to shifts in developmental events, giving rise to new phenotypes. Many examples are presented in the chapter, such as the developmental variants of two species of sea urchins, one with a normal larval phase, and another with direct development. In this case the two species do not have different sets of developmental genes, rather the expression of those genes differ. Another example that makes the same point is the evolution of an image forming eye. Recent studies suggest, in contrast to the view that eyes across the animal kingdom evolved independently multiple times, that image-forming eyes from very distantly related taxa (such as, insects and vertebrates) may trace back to the common origin of the Pax6 gene. If that view is correct, then genes controlling major developmental patterns would seem to be highly conserved across long periods of time, with expression being the major form of variation. 4. Unless the Pax6 gene was derived multiple times, it is difficult to hypothesize multiple origins of eyes. Pax6 initiaties eye development in many species. The variation in eyes among animals is a result of which genes are expressed and when after Pax6 initiates eye development. 5. Maize relies on paleoAP3 and PI for flower development while tomato has three genes because of a duplication of paleoAP3. This duplication event in the ancestor of tomato, but not maize, is correlated with independent petal origin. 6. The direct developing sea urchin has an ancestor that had one or more mutations in genes that were needed to regulate the expression of other genes needed for larval stage development. When those genes were not expressed, there was no larval development and the genes necessary for adult development were expressed.
appendix A
rav32223_appx_A1-A34.indd A-15
A-15
11/30/09 6:36:01 PM
3. The most logical choice would be a species from the domain Archae. These are considered to be the oldest forms of life on our planet, and are known to have evolved to survive harsh environmental condition.
CHAPTER 26 LEARNING OUTCOME QUESTIONS 26.1 The evidence would be that the organism reproduces and posses a system to pass on information from generation to generation (heredity), regulates its internal processes and can maintain homeostasis, grows and develops, has some sort of cellular organization, and can respond to some stimuli.
4. Morphology may be influenced by processes such as convergent evolution. However, DNA acts as a molecular record of a species’ past. Combining what is being learned from both morphological and molecular data leads to more robust evolutionary hypotheses.
26.2 You can infer that both a squirrel and fox are in the class Mammalia but are in different orders. Thus they share many, but not all traits. They likely shared a common ancestor. However the taxonomic hierarchy does not show the evolutionary relationships among organisms the way a phylogeny would.
CHAPTER 27
26.3 The viral genome would now be part of the infected cell’s genome and the
27.1 Viruses use cellular machinery for replication. They do not make all of the
LEARNING OUTCOME QUESTIONS
viral genes could be expressed. One example of this is the chicken pox virus.
proteins necessary for complete replication.
26.4 Without atmospheric oxygen, organisms would still be anaerobic. There would
27.2 A prophage carrying such a mutation could not be induced to undergo the lytic cycle.
be no cellular respiration and no mitochondria in cells. Organisms would not be as effective at producing energy and they may not have evolved to be as large as some life forms today because they couldn’t meet the energy demands of the cells.
26.5 Insect vectors might carry DNA from moss to a flowering plant. 26.6 Closely related living organisms might have diverged from a common ancestor millions of years ago. Even though they are the closest living relatives, much evolutionary change could have occurred during the intervening years.
INQUIRY QUESTIONS Page 515 A clade is an evolutionary unit consisting of a common ancestor and all of its descendants. Evidence suggests that the Archaea are very different from all other organisms, which justifies including the Archaea in a separate domain. Phylogenetically, each domain forms a clade.
Page 522 Comparisons of a single gene could result in an inaccurate phylogenetic tree because it fails to take into account the effects of horizontal gene transfer. For example, the clade of Amborella trichopoda is a sister clade to all other flowering plants, but roughly ⅔ of its mitochondrial genes are present due to horizontal gene transfer from other land plants, including more distantly-related mosses.
Page 522 To determine if a moss gene had a function you would employ functional analysis, using a variety of experiments, to test for possible functions of the moss gene in Amborella.
U N D E R S TA N D 1. b 2. c 3. c 5. The protists are a bit of a catchall and are not monophyletic. Organisms that were clearly eukarotic but did not fit with plants, fungi, or animals were placed in the protists 6. c 7. c 8. d
A P P LY 1. Kindgom Fungi because some fungi have flagella and cell walls made of chitin. Fungi lack a nervous system 2. a 3. c 4. d 5. b 6. d
SYNTHESIZE 1. If the life is biochemically the same on one of these moons and Earth, then it is possible that life originated in one place and was moved to the other location by the action of meteorites and comets. As you have seen with convergent evolution, panspermia would still not be proven by such a finding. However, if the life was biochemically different it would suggest that life originated independently on the moons and Earth.
27.3 This therapy, at present, does not remove all detectable viruses. This cannot be considered a true cure. 27.4 In addition to a high mutation rate, the influenza genome consists of multiple RNA segments that can recombine during infection. This causes the main antigens for the immune system to shift rapidly. 27.5 Prions carry information in their three-dimensional structure. This 3-D information is different from the essentially one-dimensional genetic information in DNA.
U N D E R S TA N D 1. c
2. b
3. c
4. d
5. b
6. d
7. b
3. c
4. d
5. b
6. c
7. c
A P P LY 1. c
2. b
8. a
SYNTHESIZE 1. A set of genes that are involved in the response to DNA damage are normally induced by the same system. The protein involved destroys a repressor that keeps DNA repair genes unexpressed. Lambda has evolved to use this system to its advantage. 2. Since viruses require the replication machinery of a host cell to replicate, it is unlikely that they existed before the origin of the first cells. 3. This is a complex situation. Factors that act include the high mutation rate of the virus and the fact that the virus targets the very cells that mount an immune response. The influenza virus also requires a new vaccine every year due to rapids changes in the virus. The smallpox virus was a DNA virus that had antigenic determinants that did not change rapidly making a vaccine possible. 4. Emerging viruses are those that jump species and thus are new to humans. Recent examples include SARS and Ebola. 5. If excision of the lambda prophage is imprecise, then the phage produced will carry E. coli genes adjacent to the integration site.
CHAPTER 28 LEARNING OUTCOME QUESTIONS 28.1 Evidence would take the form of microfossils, evidence for altered isotopic
2.
ratios, or biomarkers such as hydrocarbons that do not arise by abiotic processes.
Echinoderms
Myriapods
Insects
Crustaceans
Nematodes
Annelids
Mollusks
Arthropods
28.2 Archaea have ether linked instead of ester linked phospholipids; their cell wall is made of unique material. 28.3 Compare their DNA. The many metabolic tests we have used for years have been supplanted by DNA analysis. 28.4 Transfer of genetic information in bacteria is directional: from donor to recipient and does not involve fusion of gametes. 28.5 Prokaryotes do not have a lot of morphological features, but do have diverse metabolic functions. 28.6 Pathogens tend to evolve to be less virulent. If they are too good at killing, their lifestyle is an evolutionary dead end. 28.7 Rotating a crop that has a symbiotic association with nitrogen fixing bacteria will return nitrogen to the soil depleted by other plants.
A-16
appendix A
rav32223_appx_A1-A34.indd A-16
12/7/09 5:20:11 PM
INQUIRY QUESTION
29.7 Both the red and green algae obtained their chloroplasts through endo-
Page 562 The simplest explanation is that the two STDs are occurring in dif-
symbiosis, possibly of the same lineage of photosynthetic bacteria. The red and green algae had diverged before the endosymbiotic events and the history recorded in their nuclear DNA is a different evolutionary history than that recorded in the plastids derived through emdosymbiosis.
ferent populations, and one population has rising levels of sexual activity, while the other has falling levels. However, the rise in incidence of an STD can reflect many parameters other than level of sexual activity. The virulence or infectivity of one or both disease agents may be changing, for example, or some aspect of exposed people may be changing in such a way as to alter susceptibility. Only a thorough public health study can sort this out.
2. a
3. c
4. c
5. d
6. a
7. b
3. b
4. c
5. d
6. b
7. a
A P P LY 1. c
2. b
helpful. Considering the similarities among a broader range of genes than just the conserved tyrosine kinase receptor would provide additional evidence.
29.9 It is unlikely that cellular and plasmodial slime molds are closely related.
U N D E R S TA N D 1. b
29.8 Comparative genomic studies of choanoflagellates and sponges would be
SYNTHESIZE 1. The study of carbon signatures in rocks using isotopic data assumes that ancient carbon fixation involves one of two pathways that each show a bias towards incorporation of carbon 12. If this bias were not present, it is not possible to infer early carbon fixation by this pathway. This pathway could have arisen even earlier and we would have no way to detect it. 2. The heat killing of the virulent S strain of Streptococcus released the genome of the virulent smooth strain into the environment. These strains of Streptococcus bacteria are capable of natural transformation. At least some of the rough strain cells took up smooth strain genes that encoded the polysaccharide coat from the environment. These genes entered into the rough strain genome by recombination, and then were expressed. These transformed cells were now smooth bacteria. 3. The multiple antibiotics are not a bad idea if all of the bacteria are killed. In the case of some persistent infections, this is an effective strategy. However, it does provide very strong selective pressure for rare genetic events that produce multiple resistances in a single bacteria species. For this reason, it is not a good idea for it to be the normal practice. The more bacteria that undergo this selection for multiple resistance, the more likely it will arise. This is helped by patients not taking the entire course as bacteria may survive by chance and proliferate with each generation providing the opportunity for new mutations. This is also complicated by the horizontal transfer of resistance via resistance plasmids, and the existence of transposable genetic elements that can move genes from one piece of DNA to another. 4. Most species on the planet are incapable of fixing nitrogen without the assistance of bacteria. Without nitrogen, amino acids and other compounds cannot be synthesized. Thus a loss of the nitrogen fixing bacteria due to increased UV radiation levels would reduce the ability of plants to grow, severely limiting the food sources of the animals.
CHAPTER 29
They both appear in the last section of this chapter because they have yet to be assigned to clades. The substantial differences in their cell biology are inconsistent with a close phylogenetic relationship.
INQUIRY QUESTION Page 570 Red and green algae obtained chloroplasts by engulfing photosynthetic bacteria by primary endosymbiosis; chloroplasts in these cells have two membranes. Brown algae obtained chloroplasts by engulfing cells of red algae through secondary endosymbiosis; chloroplasts in cells of brown algae have four membranes. Counting the number of cell membranes of chloroplasts indicates primary or secondary endosymbiosis.
U N D E R S TA N D 1. b 2. a 3. b 11. d 12. a
4. c
5. d
6. b
7. a
8. c
9. b, c
10. a, d
A P P LY 1. d
2. a
3. a
SYNTHESIZE 1. Cellular and plasmodial slime molds both exhibit group behavior and can produce mobile slime mold masses. However, these two groups are very distantly related phylogenetically. 2. The development of a vaccine, though challenging, will be the most promising in the long run. It is difficult to eradicate all the mosquito vectors and many eradication methods can be harmful to the environment. Treatments to kill the parasites are also difficult because the parasite is likely to become resistant to each new poison or drug. A vaccine would provide long-term protection without the need to use harmful pesticides or drugs where drug resistance is a real possibility. 3. For the first experiment, plate the cellular slime molds on a plate that has no bacteria. Spot cyclic-AMP and designated places on the plate and determine if the bacteria aggregate around the cAMP. For the second experiment, repeat the first experiment using plates that have a uniform coating of bacteria as well as plates with no bacteria. If the cellular slime molds aggregate on both plates, resource scarcity is not an issue. If the cells aggregate only in the absence of bacteria, you can conclude that the attraction to cAMP occurs only under starvation conditions.
LEARNING OUTCOME QUESTIONS 29.1 Mitochondria and chloroplasts contain their own DNA. Mitochondrial genes are transcribed within the mitochondrion, using mitochondrial ribosomes that are smaller than those of eukaryotic cells and quite similar to bacterial ribosomes. Antibiotics that inhibit protein translation in bacteria also inhibit protein translation in mitochondria. Also, both chloroplasts and mitochondria divide using binary fission like bacteria.
29.2 There are distinct clades in the Protista that do not share a common ancestor. The group of organisms commonly referred to as protists are actually a collection of a number of monophyletic clades. Pseudopodia provide a large surface area and substantial traction for stable movement.
29.3 Undulating membranes would be effective on surfaces with curvature that
CHAPTER 30 LEARNING OUTCOME QUESTIONS 30.1 Make sections and examine them under the microscope to look for tracheids. Only the tracheophytes will have tracheids. Gametes in plants are produced by mitosis. Human gametes are produced directly by meiosis.
30.2 Chlorophytes have chloroplasts which are not found in choanoflagellates. The lack of water is the major barrier for sperm that move through water to reach the egg. It is more difficult for sperm to reach the egg on land.
30.3 Moss are extremely desiccation tolerant and can withstand the lack of water.
may not always be smooth, including intestinal walls.
Also, freezing temperatures at the poles are less damaging when moss have a low water content.
29.4 Contractile vacuoles collect and remove excess water from within
30.4 The sporophyte generation has evolved to be the larger generation and
the Euglena.
therefore an effective means to transporting water and nutrients over greater distances would be advantageous.
29.5 The Plasmodium often becomes resistant to new poisons and drugs. 29.6 While the gametophytes are often much smaller than the sporophytes, you could be most confident in your answer if you counted the chromosomes in the cells of each. The diploid sporophyte will have twice as many chromosomes as the haploid gametophyte.
30.5 There was substantial climate change during that time period. Glaciers had spread, then melted and retreated. Drier climates could have contributed to the extinction of large club mosses. Refer to chapter 26 for more information on changes in Earth’s climate over geological time.
appendix A
rav32223_appx_A1-A34.indd A-17
A-17
11/30/09 6:36:01 PM
30.6 The silica can increase the strength of the hollow-tube stems and would
31.5 Parasitism is a subset of symbiotic relationships. Symbiotic relationships
also deter herbivores.
refer to two or more organisms of different species living in close relationship to each other to the benefit of one, both or neither. In parasitism, only one member of the symbiosis benefits and that is at the expense of the other.
30.7 The pollen tube grows towards the egg, carrying the sperm within the pollen tube.
30.8 The ovule rests, exposed on the scale (a modified leaf). 30.9 Animals that consume the fruit disperse the seed over longer distances than wind can disperse seed. The species can colonize a larger territory more rapidly.
INQUIRY QUESTIONS Page 592 The diploid sporophyte of Ulva produces sporangia in which meiosis occurs. The resultant haploid spores develop into either plus or minus strains of multicellular gametophytes which, in turn, produce haploid gametangia. The gametangia produce haploid gametes. Meiosis is involved in the formation of Ulva gametes, but not directly. Page 596 Tracheophytes developed vascular tissue, enabling them to have efficient water- and food-conducting systems. Vascular tissue allowed tracheophytes to grow larger, possibly then able to out-compete smaller, nonvascular land plants. A protective cuticle and stomata that can close during dry conditions also conferred a selective advantage.
31.6 A dikaryotic cell has two nuclei, each with a single set of chromosomes. A diploid cell has a single nucleus with two sets of chromosomes.
31.7 Preventing the spread of the fungal infection using fungicides and good cultivation practices could help. If farmworkers must tend to infected fields, masks that filter out the spores could protect the workers.
31.8 The fungi that ants consumed may have originally been growing on leaves. Over evolutionary time, mutations that altered ant behavior so the ants would bring leaves to a stash of fungi would have been favored and the tripartite symbiosis evolved.
31.9 Wind can spread spores over large distances, resulting in the spread of fungal disease.
U N D E R S TA N D 1. c
2. d
3. a
4. d
5. b
3. a
4. c
5. d
1. d
flowering plants. The embryo cannot derive nutrition from soil prior to root development, therefore without endosperm, the embryo is unlikely to survive.
SYNTHESIZE
1. d
2. d, c
4. c
5. a
6. c
7. b
8. d
9. a
10. d
A P P LY 2. d
3. b
4. c
5. c
6. a
7. b
8. a
9. a
SYNTHESIZE 1. Moss has a dominant gametophyte generation while lycophytes have a dominant sporophyte generation. Perhaps a comparison of the two genomes would provide insight into the genomic differences associated with the evolutionary shift from dominant gametophyte to dominant sporophyte. 2. Answers to this question may vary. However, gymnosperms are defined as “naked” seed plants. Therefore, an ovule that is not completely protected by sporophyte tissue would be characteristic of a gymnosperm. To be classified as an angiosperm, evidence of flower structures and double fertilization are key characteristics, although double fertilization has been observed in some gnetophytes. 3. The purpose of pollination is to bring together the male and female gametes for sexual reproduction. Sexual reproduction is designed to increase the genetic variability of a species. If a plant allows self-pollination, then the amount of genetic diversity will be reduced, but this is a better alternative than not reproducing at all. This would be especially useful in species in which the individuals are widely dispersed. 4. The benefit is that by developing a relationship with a specific pollinator, the plant species increases the chance that its pollen will be brought to another member of its species for pollination. If the pollinator is a generalist, then the pollinator might not travel to another member of the same species, and pollination would not occur. The drawback is that if something happens to the pollinator (extinction or drop in population size) then the plant species would be left with either a reduced or nonexistent means of pollination.
CHAPTER 31 LEARNING OUTCOME QUESTIONS 31.1 In fungi mitosis results in duplicated nuclei, but the nuclei remain within a single cell. This lack of cell division following mitosis is very unusual in animals. Hyphae are protected by chitin, which is not digested by fungal enzymes.
31.2 Microsporidians lack mitochondria which are found in Plasmodium. 31.3 Blastocladiomycetes are free-living and have mitochondria. Microsporidians are obligate parasites and lack mitochondria.
31.4 Zygospores are more likely to be produced when environmental conditions are not favorable. Sexual reproduction increases the chances of offspring with new combinations of genes that will have an advantage in a changing environment. Also, the zygospore can stay dormant until conditions improve.
A-18
7. d
A P P LY
Page 610 Endosperm provides nutrients for the developing embryo in most
U N D E R S TA N D
6. d
2. b
1. Fungi possess cell walls. Although the composition of these cell walls differs from that of the plants, cell walls are completely absent in animals. Fungi are also immobile (except for chytrids), and mobility is a key characteristic of the animals. 2. The mycorrhizal relationships between the fungi and plants allow plants to make use of nutrient poor soil. Without the colonization of land by plants, it is unlikely that animals would have diversified to the level they have achieved today. Lichens are important organisms in the colonization of land. Early land masses would have been composed primarily of barren rock, with little or no soil for plant colonization. As lichens colonize an area they begin the process of soil formation, which allows other plant 3. Antibiotics are designed to combat prokaryotic organisms and fungi are eukaryotic. In addition, fungi possess a cell wall that has a different chemical constitution (chitin) from that of prokaryotes.
CHAPTER 32 LEARNING OUTCOME QUESTIONS 32.1 The rules of parsimony state that the simplest phylogeny is most likely the true phylogeny. As there are living organisms that are both multicellular and unicellular, it stands to reason that the first organisms were unicellular, and multicellularity followed. Animals are also all heterotrophs; if they were the first type of life to have evolved, there would not have been any autotrophs on which they could feed.
32.2 Cephalization, the concentration of nervous tissue in a distinct head region, is intrinsically connected to the onset of bilateral symmetry. Bilateral symmetry promotes the development of a central nerve center, which in turn favors the nervous tissue concentration in the head. In addition, the onset of both cephalization and bilateral symmetry allows for the marriage of directional movement (bilateral symmetry) and the presence of sensory organs facing the direction in which the animal is moving (cephalization).
32.3 This allows systematists to classify animals based solely on derived characteristics. Using features that have only evolved once implies that the species that have that characteristic are more closely related to each other than they are to species that do not have the characteristic.
32.4 One hypothesis is that the rapid diversification in body plan was a biological response to the evolution of predation—the adaptation of traits that enabled predators to better find prey and prey to better elude predators. Another hypothesis is that the explosion of new body forms resulted from changes in the physical environment such as oxygen and mineral build up in the oceans.
U N D E R S TA N D 1. c
2. b
3. a
4. d
5. a
6. b
7. d
8. a
9. b
10. d
11. d
A P P LY 1. d 2. b 3. Determinate development indicates that it is a protostome and the fact that it molts places it within the Ecdysozoa. The presence of jointed appendages makes it an arthropod.
appendix A
rav32223_appx_A1-A34.indd A-18
11/30/09 6:36:01 PM
SYNTHESIZE 1. The tree should contain platyhelminthes and nemetera on one branch, a second branch should contain nematodes, and a third branch should contain the annelids and the hemichordates. This does not coincide with the information in Figure 32.4. Therefore, some of the different types of body cavities have evolved multiple times, and the body cavities are not good characteristics to infer phylogenetic relationships. 2. Answers may vary depending on the classification used. Many students will place the Echinoderms near the Cnidaria due to radial symmetry; others will place them closer to the Annelids.
CHAPTER 33 LEARNING OUTCOME QUESTIONS 33.1 The cells of a truly colonial organism, such as a colonial protist, are all structurally and functionally identical; however, sponge cells are differentiated and these cells coordinate to perform functions required by the whole organism. Unlike all other animals, however, sponges do appear much like colonial organisms in that they are not comprised of true tissues, and the cells are capable of differentiating from one type to another.
33.2 The importance of triploblasty relates to the placement of ctenophores on the animal phylogenetic tree. Until recently, ctenophores have been considered diploblasts, with platyhelminthes as the first triploblasts. New evidence, however, indicates that ctenophores are actually triploblastic. In addition, molecular evidence suggests that this phylum belongs at the base of the animal phylogeny—thus implying that the ancestor to all animals was triploblastic. 33.3 Tapeworms are parasitic platyhelminthes that live in the digestive system of their
mechanical and chemical digestion, some for storage, and yet others for absorption. Overall, the specialization yields greater efficiency than does a gastrovascular cavity.
34.3 The main advantage is coordination. A nervous system that serves the entire body allows for coordinated movement and coordinated physiological activities such as reproduction and excretion, even if those systems themselves are segmented. Likewise, a body-wide circulatory system enables efficient oxygen delivery to all of the body cells regardless of the nature of the organism’s individual segments. 34.4 Lophophorates are sessile suspension-feeding animals. Much of their body also remains submerged in the ocean floor. Thus, a traditional tubular digestive system would require either the mouth or the anus to be inaccessible to the water column—meaning the animal either could not feed or would have to excrete waste into a closed environment. The U-shaped gut allows them to both acquire nutrients from and excrete waste into their environment. 34.5 One of the defining features of the arthropods is the presence of a chitinous exoskeleton. As arthropods increase in size, the exoskeleton must increase in thickness disproportionately, in order to bear the pull of the animal’s muscles. This puts a limit on the size a terrestrial arthropod can reach, as the increased bulk of the exoskeleton would prohibit the animal’s ability to move. Water is denser than air and thus provides more support; for this reason aquatic arthropods are able to be larger than terrestrial arthropods. 34.6 Bilateral symmetry evolved relatively early in animal phylogeny, with the platyhelminthes. Echinoderms clearly branched off later in evolutionary history, as evidenced by their deuterostome development, and yet, as adults they exhibit radial (or, more accurately, pentaradial) symmetry. This might be a confusing factor when determining the phylogeny of animals, if not for the bilateral form the echinoderm larvae take. The bilaterally symmetrical larvae suggest that the echinoderm ancestor is in fact bilaterally symmetrical, rather than radially symmetrical.
host. Tapeworms have a scolex, or head, with hooks for attaching to the wall of their host’s digestive system. Another way in which the anatomy of a tapeworm relates to its way of life is their dorsoventrally flattened body and corresponding lack of a digestive system. Tapeworms live in their food; as such they absorb their nutrients directly through the body wall, and their flat bodies facilitate this form of nutrient delivery.
1. c
33.4 Ascaris lumbricoides, the intestinal roundworm, infects humans when the
1. b
human swallows food or water contaminated with roundworm eggs. The most effective ways of preventing the spread of intestinal roundworms is to increase sanitation, especially those in food handling, education, and cease using human feces as fertilizer. Not surprisingly, infection by these parasites is most common in areas without modern plumbing.
U N D E R S TA N D 1. c
2. a
3. b
4. b
5. d
6. d
7. c
A P P LY 1. c
2. c
3. d
SYNTHESIZE 1. Answers may vary. Phylum Acoela represents a reclassification of the platyhelminthes and phylum Cycliophora represents an entirely new kingdom. Since we have most likely not discovered all of the noncoelomate invertebrate species on the planet, and we are utilizing new molecular tools to examine the relationships of existing phyla, it is unlikely that the modern phylogeny presented in section 33.2 is complete. 2. Since the population size of a parasitic species may be very small (just a few individuals), possessing both male and female reproductive structures would allow the benefits of sexual reproduction. 3. Answers may vary. However, it is known that the tapeworm is not the ancestral form of platyhelminthes; instead it has lost its digestive tract due to its role as an intestinal parasite. As an intestinal parasite, the tapeworm relies on the digestive system of its host to break down nutrients into their building blocks for absorption.
CHAPTER 34 LEARNING OUTCOME QUESTIONS 34.1 Cephalopods are the most active of all mollusks, and this increased level of activity necessitates a more efficient oxygen delivery system. The extensive series of blood vessels, and thus more efficient gas exchange, in the cephalopod circulatory system allows the animal to move more rapidly and over longer periods of time.
34.2 With a flow-through digestive tract, food moves in only one direction. This allows for specialization within the tract; sections may be specialized for
U N D E R S TA N D 2. b
3. a
4. d
3. d
4. a
5. d
6. b
7. c
8. d
9. d
10. a
11. a
A P P LY 2. c
SYNTHESIZE 1. Clams and scallops are bivalves, which are filter feeders that siphon large amounts of water through their bodies to obtain food. They act as natural pollution-control systems for bays and estuaries. A loss of bivalves (from overfishing, predation, or toxic chemicals) would upset the aquatic ecosystem and allow pollution levels to rise. 2. Chitin is an example of convergent evolution since these organisms do not share a common chitin-equipped ancestor. Chitin is often used in structures that need to withstand the rigors of stress (chaetae, exoskeletons, zoecium, etc.).
CHAPTER 35 LEARNING OUTCOME QUESTIONS 35.1 Chordates have a truly internal skeleton (an endoskeleton), compared to the endoskeleton on echinoderms, which is functionally similar to the exoskeleton of arthropods. Whereas an echinoderm uses tube feet attached to an internal water vascular system for locomotion, a chordate has muscular attachments to its endoskeleton. Finally, chordates have a suite of four characteristics that are unique to the phylum—a nerve chord, a notochord, pharyngeal slits, and a postanal tail.
35.2 While mature and immature lancelets are similar in form, the tadpole-like tunicate larvae are markedly different from the sessile, vase-like adult form. Both tunicates and lancelets are chordates, but they differ from vertebrates in that they do not have vertebrae or internal bony skeletons. 35.3 The functions of an exoskeleton include protection and locomotion—arthropod exoskeletons, for example, provide a fulcrum to which the animals’ muscles attach. In order to resist the pull of increasingly large muscles, the exoskeleton must dramatically increase in thickness as the animal grows larger. There is thus a limit on the size of an organism with an exoskeleton—if it gets too large it will be unable to move due to the weight and heft of its exoskeleton. 35.4 Lobe-finned fish are able to move their fins independently, whereas rayfinned fish must move their fins simultaneously. This ability to “walk” with their fins indicates that lobe-finned fish are most certainly the ancestors of amphibians. 35.5 The challenges of moving onto land were plentiful for the amphibians. First, amphibians needed to be able to support their body weight and locomote on land; this challenge was overcome by the evolution of legs. Second, amphibians needed to be able to exchange oxygen with the atmosphere; this was accomplished appendix A
rav32223_appx_A1-A34.indd A-19
A-19
12/7/09 5:00:33 PM
by the evolution of more efficient lungs than their lungfish ancestors as well as cutaneous respiration. Third, since movement on land requires more energy than movement in the water, amphibians needed a more efficient oxygen delivery system to supply their larger muscles; this was accomplished by the evolution of doubleloop circulation and a partially divided heart. Finally, the first amphibians needed to develop a way of staying hydrated in a non-aquatic environment, and these early amphibians developed leathery skin that helped prevent desiccation.
35.6 Amphibians remain tied to the water for their reproduction; their eggs are jelly-like and if laid on the land will quickly desiccate. Reptile eggs, on the other hand, are amniotic eggs—they are watertight and contain a yolk, which nourishes the developing embryo, and a series of four protective and nutritive membranes. 35.7 There are two primary traits shared between birds and reptiles. First, both lay amniotic eggs. Second, they both possess scales (which cover the entire reptile body but solely the legs and feet of birds). Birds also share characteristics only with one group of reptiles—the crocodilians, such as a four-chambered heart.
35.8 The most striking convergence between birds and mammals is endothermy, the ability to regulate body temperature internally. Less striking is flight; found in most birds and only one mammal, the ability to fly is another example of convergent evolution. 35.9 Only the hominids comprise a monophyletic group. Prosimians, monkeys, and apes are all paraphyletic—they include the common ancestor but not all descendents: the clade that prosimians share with the common prosimian ancestor excludes all anthropoids, the clade that monkeys share with the common monkey ancestor excludes hominoids, and the clade that apes share with the common ape ancestor excludes hominids.
U N D E R S TA N D 1. c
2. c
3. a
4. c
5. a
6. d
7. a
2. c
include: guard cells, trichomes, and root hairs. Guard cells flank an epidermal opening called a stoma and regulate its opening and closing. Stomata are closed when water is scarce, thus conserving water. Trichomes are hairlike outgrowths of the epidermis of stems, leaves, and reproductive organs. Trichomes help to cool leaf surfaces and reduce evaporation from stomata. Root hairs are epidermal extensions of certain cells in young roots and greatly increase the surface area for absorption.
U N D E R S TA N D 1. d
2. d
3. c
4. b
3. d
4. c
5. a
6. c
7a
8. b
A P P LY 1. a
2. c
SYNTHESIZE 1. Roots lack leaves with axillary buds at nodes, although there may be lateral roots that originated from deep within the root. The vascular tissue would have a different pattern in roots and stems. If there is a vascular stele at the core with a pericycle surrounded by a Casparian strip, you are looking at a root. 2. Lenticels increase gas exchange. In wet soil, the opportunity for gas exchange decreases. Lenticels could compensate for decreased gas exchange, which would be adaptive. 3. The tree is likely to die because the phloem and vascular cambium is located near the surface. Removing a ring of bark results in the loss of the vascular cambium and phloem, leading to starvation and death.
8. d
CHAPTER 37
A P P LY 1. c
INQUIRY QUESTION Page 736 Three dermal tissue traits that are adaptive for a terrestrial lifestyle
3. b
LEARNING OUTCOME QUESTIONS 37.1 Only angiosperms have an endosperm which results from double fertiliza-
SYNTHESIZE 1. Increased insulation would have allowed birds to become endothermic and thus to be active at times that ectothermic species could not be active. High body temperature may also allow flight muscles to function more efficiently.
tion. The endosperm is the nutrient source in angiosperms. Gymnosperm embryos rely on megagametophytic tissue sources for nutrients.
37.2 These seeds might be sensitive to temperature and require a period of cold before germinating.
2. Birds evolved from one type of dinosaurs. Thus, in phylogenetic terms, birds are a type of dinosaur.
37.3 Fruits with fleshy coverings, often shiny black or bright blue or red, normally are favored by birds or other vertebrates.
3. Like the evolution of modern day horses, the evolution of hominids was not a straight and steady progression to today’s Homo sapiens. Hominid evolution started with an initial radiation of numerous species. From this group, there was a evolutionary trend of increasing size, similar to what is seen in the evolution of horses. However, like in horse evolution, there are examples of evolutionary decreases in body size as seen in Homo floresiensis. Hominid evolution also reveals the coexistence of related species, as seen with Homo neaderthalensis and Homo sapiens. Hominid evolution, like horse evolution, was not a straight and steady progression to the animal that exists today.
37.4 Retaining the seed in the ground might provide greater stability for the seedling until its root system is established.
INQUIRY QUESTIONS Page 758 The root meristem never forms, although the shoot meristem is fully functional. This plant is missisng the HOBBIT protein which normally allows auxin to induce the expression of a gene or genes needed for correct cell division to make a root meristem. Without the correct cell divisions, the meristem fails to form.
Page 758 The MONOPTEROS (MP) gene product cannot act as a transcription
CHAPTER 36
factor when it is bound by its repressor. With a MP protein that can no longer bind to its repressor, MP acts as a transcription factor and activates a root development gene. The phenotype of a plant with a mutation in the MP gene has roots.
LEARNING OUTCOME QUESTIONS
Page 761
36.1 Primary growth contributes to the increase in plant height, as well as branching. Secondary growth makes substantial contributions to the increase in girth of the plant, allowing for a much larger sporophyte generation.
36.2 Vessels transport water and are part of the xylem. The cells are dead with only the walls remaining. Cylinders of stacked vessels move water from the roots to the leaves of plants. Sieve tube members are part of the phloem and transport nutrients. Sieve tube members are living cells, but they lack a nucleus. The rely on neighboring companion cells to carry out some metabolic functions. Like vessels, sieve tube members are stacked to form a cylinder.
A monocot has a solitary cotyledon. Two cotyledons are illustrated here, thus the embryo is a eudicot.
Page 762
The prior sporophyte generation, as part of the ovary, is diploid. The degenerating gametophyte generation is haploid. The next sporophyte generation, the embryo, is diploid.
U N D E R S TA N D 1. c
2. a
3. d
4. a
5. d
3. b
4. d
5. c
1. c
difficult for a root hair to form in the region of elongation because its base would be pulled apart by the elongation of the cell wall.
SYNTHESIZE
sloughed off. The tips of stems do not encounter the same barriers and do not require the additional protection.
36.5 Both sides of the leaf are equally exposed to sunlight. In contrast, horizontal leaves have a top and a bottom. Palisade layers are tightly packed with minimum airspace between the cells which maximizes photosynthetic surface area.
A-20
7. a
8. c
9. c
A P P LY
36.3 The energy of the cell is used primarily to elongate the cell. It would be
36.4 Roots are constantly growing through soil where cells are damaged and
6. b
2. c
1. Place Fucus zygotes on a screen and shine a light from the bottom. If light is more important, the rhizoid will form towards the light, even though that is the opposite direction gravity would dictate. If gravity is more important, the rhizoid will form away from the direction of the light. 2. The endosperm has three times as many copies of each gene. If transcription occurs at a constant rate in both nutritive tissues, more will be produced in the endosperm because of the extra copies of the genes.
appendix A
rav32223_appx_A1-A34.indd A-20
12/7/09 5:01:15 PM
3. The seeds may need to be chilled before they can germinate. You can store them in the refrigerator for several weeks or months and try again. The surface of the seed may need to be scarified (damaged) before it can germinate. Usually this would happen from the effects of weather or if the seed goes through the digestive track of an animal where the seed coat is weakened by acid in the gut of the animal. You could substitute for natural scarification by rubbing your seeds on sand paper before germinating them. It is possible that your seed needs to be exposed to light or received insufficient water when you first planted it. You may need to soak your seed in water for a bit to imbibe it. Exposing the imbibed seed to sunlight might also increase the chances of germination.
CHAPTER 38 LEARNING OUTCOME QUESTIONS 38.1 Physical pressures include gravity and transpiration, as well as turgor pressure as an expanding cell presses against its cell wall. Increases in turgor pressure and other physical pressures are associated with increases water potential. Solute concentration determines whether water enters or leaves a cell via osmosis. The smallest amount of pressure on the side of the cell membrane with the greater solute concentration that is necessary to stop osmosis is the solute potential. Water potential is the sum of the pressure from physical forces and from the solute potential.
38.2 Proteins in the cell membrane allow diffusion to be selective. Other protein channels are involved in active transport across the membrane. Water moves through channels called aquaporins. For a review of membrane properties, see chapter 5.
38.3 The driving force for transpiration is the gradient between 100% humidity inside the leaf and the external humidity. When the external humidity is low, the rate of transpiration is high, limited primarily by the amount of water available for uptake through the root system. The minerals are used for metabolic activities. Some minerals can move into the phloem and be transported to metabolically active areas of the plants, but others, including calcium, cannot be relocated after they leave the xylem. 38.4 Once carbon dioxide is dissolved in water, it can be transported to photosynthetically active cells where it is used in carbon fixation in the Calvin Cycle (see chapter 8 for a review of photosynthesis). 38.5 Physical changes in the roots in response to oxygen deprivation may prevent further transport of water in the xylem. Although the leaves may be producing oxygen, it is not available to the roots.
38.6 Phloem liquid is rich in organic compounds including sucrose and plant hormones dissolved in water. Fluid in the xylem consists of minerals dissolved in water.
INQUIRY QUESTIONS Page 773
Before equilibrium, the solute potential of the solution is –0.5 MPa, and that of the cell is –0.2 MPa. Since the solution contains more solute than does the cell, water will leave the cell to the point that the cell is plasmolyzed. Initial turgor pressure (Ψp ) of the cell = 0.05 MPa, while that of the solution is 0 MPa. At equilibrium, both the solution and the cell will have the same Ψw. Ψcell = –0.2 MPa + 0.5 MPa = 0.3 MPa before equilibrium is reached. At equilibrium, Ψcell = Ψsolution =–0.5MPa, thus Ψw cell = –0.5 MPa. At equilibrium, the plasmolyzed cell ΨP = 0 MPa. Finally, using the relationship ΨW(cell) = Ψp + Ψs and ΨW(cell) = –0.5 MPa, ΨP(cel) = 0 MPa, then Ψs(cell) = –0.5 MPa.
Page 775
The fastest route for water movement through cells has the least hindrance, and thus is the symplast route. The route that exerts the most control over what substances enter and leave the cell is the transmembrane route, which is then the best route for moving nutrients into the plant.
Page 777 If a mutation increases the radius, r, of a xylem vessel threefold, then the movement of water through the vessel would increase 81-fold (r 4 = 34 = 81). A plant with larger diameter vessels can move much more water up its stems.
U N D E R S TA N D 1. a
2. c
3. d
4. a
5. c
6. d
7. b
8. a
9. b
10. b
2. c
4. The rate of transpiration is greater during the day than the night. Since water loss first occurs in the upper part of the tree where more leaves with stomata are located, the decrease in water volume in the xylem would first be observed in the upper portion, followed by the lower portion of the tree. 5. Spring year 1—The new carrot seedling undergoes photosynthesis in developing leaves and the sucrose moves towards the growing tip. Summer year 1—The developing leaves are sources of carbohydrate, which now moves to the developing root and also the growing young tip. Fall year 1—The carrot root is now the sink for all carbohydrates produced by the shoot. Spring year 2—Stored carbohydrate in the root begins to move upwards into the shoot. Summer year 2—The shoot is flowering and the developing flowers are the primary sink for carbohydrates from the root and also from photosynthesis in the leaves. Fall year 2—Seeds are developing and they are the primary sink. The root reserves have been utilized and any remaining carbohydrates from photosynthesis are transported to developing seeds.
CHAPTER 39 LEARNING OUTCOME QUESTIONS 39.1 Alkaline soil can affect the availability of nutrients in the soil for uptake by a plant.
39.2 Magnesium is found in the center of the chlorophyll molecule. Without sufficient magnesium, chlorophyll deficiencies will result in decreased photosynthesis and decreased yield per acre. 39.3 Nitrogen is essential for all amino acids, the building blocks of protein. Without sufficient levels of proteins that function as enzymes, membrane transporters, transcription factors, and structural components, plant growth and reproduction will be limited. 39.4 Increasing the amount of available nitrogen in the soil is one strategy. This can be accomplished with chemically produced ammonia for fertilizing, intercropping with nitrogen-fixing legumes, or using organic matter rich in nitrogen for enriching the soil. Efforts to reduce the relative amounts of atmospheric carbon dioxide would also be helpful. 39.5 Large poplar trees that are not palatable to animals offer a partial solution. Fencing in areas that are undergoing phytoremediation is another possibility, but it would be difficult to isolate all animals, especially birds. Plants that naturally deter herbivores with secondary compounds, including some mustard species (Brassica species) could be effective for phytoremediation.
INQUIRY QUESTION Page 797
At low and high temperature extremes, enzymes involved in plant respiration are denatured. Plants tend to acclimate to slower long-term changes in temperature, and rates of respiration are able to adjust. Short-term more dramatic changes might slow or halt respiration, especially if a temperature change is large enough to cause enzymes to denature.
U N D E R S TA N D 1. b
A P P LY 1. b
3. At the level of membrane transport, plants and animals are very similar. Plant cell walls allow plant cells to take up more water than most animal cells, which rupture without the supportive walls. At the level of epidermal cells there is substantial variation among animals. Amphibians exchange water across the skin. Plants have waterproof epidermal tissue but lose water through stomata. Humans sweat, but dogs do not. Some animals have adaptations for living in aquatic or high saline environment, as do plants. Vascular plants move vast amounts of water through the plant body via the xylem, using evaporation to fuel the transport. Animals with closed circulatory systems can move water throughout the organism and also excrete excess water through the urinary system, which is responsible for osmoregulation.
3. b
4. c
5. b
SYNTHESIZE 1. The solute concentration outside the root cells is greater than inside the cells. Thus the solute potential is more negative outside the cell and water moves out of the root cells and into the soil. Without access to water, your plant wilts. 2. Look for wilty plants since the rate of water movement across the membrane would decrease in the aquaporin mutants.
2. a
3. c
4. d
5. a
6. b
7. c
8. a
A P P LY 1. c 2. a 3. a 4. d 5. The macronutrient potassium constitutes 0.5–6% of the dry weight. Let’s assume that the potato is 90% water. The dry weight would be 10% of 1000 kg, or 100 kg. Next you calculate 0.5% of 100, which is 0.5 kg. You would do the same type of calculation for 6%. The micronutrient problems would also use the estimate of 100 kg dry weight. The conversion you need to use is that 1 ppm is the same as 1 mg/kg. So, 4 ppm of copper is the same as 4 mg/kg. Multiply this by 100 kg of dry weight potato and
appendix A
rav32223_appx_A1-A34.indd A-21
A-21
12/7/09 5:01:15 PM
you have 400 mg of copper. Since there are 1000 mg in a gram, 400 mg × 1 g/1000 mg = 0.4 g of copper in a ton of potato. The other micronutrient problems would be calculated in a similar manner.
SYNTHESIZE 1. Bacteria that are important for nitrogen fixation could be destroyed. Other microorganisms that make nutrients available to plants could also be destroyed. 2. Grow the tomatoes hydroponically in a complete nutrient solution minus boron and complete nutrient solution with varying concentrations of boron. Compare the coloration of the leaves, the rate of growth (number of new leaves per unit time), and number and size of fruits produced on plants in each treatment group. It would also be helpful to compare the dry weights of plants from each treatment group at the end of the study. 3. Other inputs include both the macronutrients and micronutrients. Nitrogen, potassium, and phosphorous are common macronutrients in fertilizers. Of course the plants also need to be watered.
align the plant with the light environment so photosynthesis is maximized which is advantageous for the plant.
41.2 The plant would not have normal gravitropic responses. Other environmental signals, including light, would determine the direction of plant growth. 41.3 Folding leaves can startle an herbivore that lands on the plant. The herbivore leaves and the plant is protected. 41.4 During the winter months the leaves would cease photosynthesis except on a few warm days. If the weather warmed briefly, water would move into the leaves and photosynthesis would begin. Unfortunately, the minute the temperature dropped, the leaves would freeze and be permanently damaged. Come the spring, the leaves would not be able to function and the tree would die. It is to the trees advantage to shed it’s leaves and grow new, viable leaves in the spring when the danger of freezing is past. 41.5 Abscisic acid could be isolated from root caps of several plants. The isolated abscisic acid could then be applied to the buds on stems of other plants of the same species. The growth of these buds (or lack of growth) could be compared with untreated controls to determine whether or not the abscisic acid had an effect.
CHAPTER 40
INQUIRY QUESTIONS
LEARNING OUTCOME QUESTIONS
Page 816
40.1 The lipid-based compounds help to create a water impermeable layer on the leaves.
40.2 A drug prepared from a whole plant or plant tissue would contain a number of different compounds, in addition to the active ingredient. Chemically synthesized or purified substances contain one or more known substances in known quantities.
40.3 It is unlikely that wasps will kill all the caterpillars. When attacked by a caterpillar, the plant releases a volatile substance that attracts the wasp. But, the wasp has to be within the vicinity of the signal when the plant releases the signal. As a result, some caterpillars will escape detection by wasps. 40.4 The local death of cells creates a barrier between the pathogen and the rest of the plant.
INQUIRY QUESTION Page 808 Ricin functions as a ribosome-binding protein that limits translation.
A number of red-light-mediated responses are linked to phytochrome action alone, including seed germination, shoot elongation, and plant spacing. Only some of the red-light-mediated responses leading to gene expression are dependent on the action of protein kinases. When phytochrome converts to the Pfr form, a protein kinase triggers phosphorylation that, in turn, initiates a signaling cascade that triggers the translation of certain light-regulated genes. Not all red-lightmediated responses are disrupted in a plant with a mutation in the protein kinase domain of phytochrome.
Page 819
Auxin is involved in the phototropic growth responses of plants, including the bending of stems and leaves toward light. Auxin increases the plasticity of plants cells and signals their elongation. The highest concentration of auxin would most likely occur at the tips of stems where sun exposure is maximal.
Page 827
A chemical substance, such as the hormone auxin, could trigger the elongation of cells on the shaded side of a stem, causing the stem to bend toward the light.
A very small quantity of rice was injected into Markov’s thigh from the modified tip of his assassin’s umbrella. Without translation of proteins in cells, enzymes and other gene products are no longer produced, causing the victim’s metabolism to shut down leading to death.
1. c
U N D E R S TA N D
1. b
1. d
2. b
3. b
4. d
5. c
6. a
3. d
4. b
5. c
6. a
7. c
8. a
9. d
A P P LY 1. c
2. d
SYNTHESIZE 1. Humans learn quickly and plants with toxins that made people ill would not become a dietary mainstay. If there was variation in the levels of toxin in the same species in different areas, humans would likely have continued to harvest plants from the area where plants had reduced toxin levels. As domestication continued, seeds would be collected from the plants with reduced toxin levels and grown the following year. 2. For parasitoid wasps to effectively control caterpillars, sufficiently large populations of wasps would need to be maintained in the area where the infestation occurred. As wasps migrate away from the area, new wasps would need to be introduced. The density of wasps is critical because the wasp has to be in the vicinity of the plant being attacked by the caterpillar when the plant releases its volatile signal. Maintaining sufficient density is a major barrier to success. 3. If a plant is flowering or has fruits developing, the systemin will move towards the fruit or flowers, providing protection for the developing seed. If the plant is a biennial, such as a carrot plant, in its first year of growth, systemin will likely be diverted to the root or other storage organ that will reserve food stores for the plant for the following year.
U N D E R S TA N D 2. a
3. d
4. d
5. b
6. d
3. b
4. c
5. c
6. b
A P P LY 2. a
7. d
SYNTHESIZE 1. You are observing etiolation. Etiolation is an energy conservation strategy to help plants growing in the dark reach the light before they die. They don’t green up until light becomes available, and they divert energy to internode elongation. This strategy is useful for potato shoots. The sprouts will be long so they can get to the surface more quickly. They will remain white until exposed to sunlight which will signal the production of chlorophyll. 2. Tropism refers to the growth of an organism in response to an environmental signal such as light. Taxis refers to the movement of an organism in response to an environmental signal. Since plants cannot move, they will not exhibit taxis, but they do exhibit tropisms. 3. Auxin accumulates on the lower side of a stem in a gravitropism, resulting in elongation of cells on the lower side. If auxin or vesicles containing auxin responded to a gravitational field, it would be possible to have a gravitropic response without amyloplasts. 4. Farmers are causing a thigmotropic response. In response to touch, the internodes of the seedlings will increase in diameter. The larger stems will be more resistant to wind and rain once they are moved to the field. The seedlings will be less likely to snap once they are moved to the more challenging environment.
CHAPTER 42 LEARNING OUTCOME QUESTIONS
CHAPTER 41 LEARNING OUTCOME QUESTIONS 41.1 Chlorphyll is essential for photosynthesis. Phytochromes regulate plant growth and development using light as a signal. Phytochrome mediated responses
A-22
42.1 Without flowering in angiosperms, sexual reproduction is not possible and the fitness of a plant drops to zero.
42.2 Set up an experiment in a controlled growth chamber with a day/night light regiment that promotes flowering. Then interrupt the night length with a brief exposure to light. If day length is the determining factor, the brief flash of light will
appendix A
rav32223_appx_A1-A34.indd A-22
12/7/09 5:01:16 PM
not affect flowering. If night length is the determining factor, the light flash may affect the outcome. For example, if the plant requires a long night, interrupting the night will prevent flowering. If the plant flowers whether or not you interrupt the night with light, it may be a short night plant. In that case, you would want to set up a second experiment where you lengthen the night length. That should prevent the plant from flowering.
42.3 Flowers can attract pollinators, enhancing the probability of reproduction. 42.4 No because the gametes are formed by meiosis which allows for new combinations of alleles to combine. You may want to review Mendel’s law of independent assortment.
42.5 When conditions are uniform and the plant is well adapted to those constant conditions, genetic variation would not be advantageous. Rather, vegetative reproduction will ensure that the genotypes that are well adapted to the current conditions are maintained.
42.6 A biennial life cycle allows an organism to store up substantial reserves to be used to support reproduction during the second season. The downside to this strategy is that the plant might not survive the winter between the two growing seasons and its fitness would be reduced to zero.
INQUIRY QUESTIONS Page 843
Strict levels of CONSTANS (CO) gene protein are maintained according to the circadian clock. Phytochrome, the pigment that perceives photoperiod, regulates the transcription of CO. By examining posttranslational regulation of CO, it might be possible to determine whether protein levels are modulated by means other than transcription. An additional level of control might be needed to ensure that the activation of floral meristem genes coincides with the activation of genes that code for individual flower organs.
Page 846
Flower production employs up to four genetically-regulated pathways. These pathways ensure than the plant flowers when it has reached adult size, when temperature and light regimes are optimal, and when nutrition is sufficient to support flowering. All of these factors combine to ensure the success of flowering and the subsequent survival of the plant species.
Page 846
Once vernalization occurred and nutrition was optimal, flowering could occur in the absence of flower-repressing genes, even if the plant had not achieved adult size. Thus flowering might occur earlier than normal.
U N D E R S TA N D 1. a
2. c
3. a
4. d
5. d
2. c
LEARNING OUTCOME QUESTIONS 43.1 Organs may be made of multiple tissue types. For example, the heart contains muscle, connective tissue and epithelial tissue.
43.2 The epithelium in glandular tissue produces secretions, the epithelium has microvilli on the apical surface that increase surface area for absorption. 43.3 Blood is a form of connective tissue because it contains abundant extracellular material: the plasma. 43.4 The function of heart cell requires their being electrically connected. The gap junctions allow the flow of ions between cells. 43.5 Neurons may be a meter long, but this is a very thin projection that still can allow diffusion of materials along its length. They do require specialized transport along microtubules to move proteins from the cell body to the synapse. 43.6 The organ systems may overlap. Consider the respiratory and circulatory systems. These systems are interdependent. 43.7 Yes. 43.8 The distinction should be between the ability to generate metabolic heat to modulate temperature, and the lack of that ability. Thus ectotherms and endotherms have replaced cold-blooded and warm-blooded.
INQUIRY QUESTIONS Page 880
After two minutes of shivering, the thoracic muscles have warmed up enough to engage in full contractions. The muscle contractions that allow the full range of motion of the wings utilize kinetic energy in the movement of the wings, rather than releasing the energy as heat, which occurred in the shivering response.
Page 882
Small mammals, with a proportionately larger surface area, dissipate heat readily, which is helpful in a warm environment, but detrimental in a cold environment. In cold conditions, small mammals must seek shelter or have adaptations, such as insulating hair, to maintain body temperature. Because of a greater volume and proportionately less surface area, large mammals are better adapted to cold environments since it takes much longer for them to lose body heat. Hot environments pose a greater challenge for them for the same reason.
U N D E R S TA N D 1. a
6. c
7. d
8. c
9. b
10. c
11. a
A P P LY 1. b
CHAPTER 43
4. d
5. b
SYNTHESIZE 1. Pointsettias are short day plants. The lights from the cars on the new highway interrupt the long night and prevent flowering. 2. Spinach is a long day plant and you want to harvest the vegetative, not the reproductive parts of the plant. Spinach will flower during the summer as the days get longer. Only leaves will be produced during the spring. If you grow and harvest your spinach in the early spring, you will be able to harvest the leaves before the plant flowers and begins to senesce. 3. Cross-pollination increases the genetic diversity of the next generation. But, self-pollination is better than no pollination. The floral morphology of columbine favors cross-pollination, but self-pollination is a backup option. Should this back up option be utilized, there is still one more opportunity for cross-pollination to override self-pollination because the pollen tube from the other plant can still grow through the style more rapidly than the pollen tube from the same plant. 4. Potatoes grown from true seed take longer to produce new potatoes than potatoes grown from tubers. Seeds are easier to store between growing seasons and require much less storage space than whole potatoes. The seed-grown potatoes will have greater genetic diversity than the asexually propagated potato tubers. If environmental conditions vary from year to year, the seed grown potatoes may have a better yield because different plants will have an advantage under different environmental conditions. The tubergrown potatoes will be identical. If conditions are optimal for that genotype, the tuber-grown potatoes will outperform the more variable seed-grown potatoes. But, if conditions are not optimal for the asexually propagated potatoes, the seed-grown potatoes may have the higher yield.
3. c
4. d
5. a
6. d
7. b
3. c
4. c
5. d
6. a
7. c
8. b
A P P LY 1. b
3. b
2. c
2. b
SYNTHESIZE 1. Yes, both the gut and the skin include epithelial tissue. A disease that affects epithelial cells could affect both the digestive system and the skin. For example, cystic fibrosis affects the ion transport system in epithelial membranes. It is manifested in the lungs, gut, and sweat glands. 2. The digestive, circulatory, and respiratory systems are grouped together because they all provide necessary nutrients for the body. The digestive system is responsible for the acquisition of nutrients from food; the respiratory system provides oxygen and removes waste (carbon monoxide). The circulatory system transports nutrients to the cells of the body and removes metabolic wastes. 3. Hunger is a negative feedback stimulus. Hunger stimulates an individual to eat which in turn causes a feeling of fullness that removes hunger. Hunger is the stimulus; eating is the response that removes the stimulus. 4. The internal environment is constantly changing. As you move through your day, muscle activity raises your body temperature, but when you sit down to eat or rest, your temperature cools. The body must constantly adjust to changes in activity or the environment.
CHAPTER 44 LEARNING OUTCOME QUESTIONS 44.1 The somatic nervous system is under conscious control. 44.2 A positive current inwards (influx of Na+) depolarizes the membrane while a positive current outward (efflux of K+) repolarizes the membrane.
44.3 Tobacco contains the compound nicotine, which can bind some acetylcholine receptors. This leads to the classic symptoms of addiction due to underlying habituation involving changes to receptor numbers and responses. appendix A
rav32223_appx_A1-A34.indd A-23
A-23
12/7/09 5:01:16 PM
44.4 Reflex arcs allow you to respond to a stimulus that is damaging before the information actually arises at your brain. 44.5 These two systems work in opposition. This may seem counterintuitive, but is the basis for much of homeostasis.
U N D E R S TA N D 1. a
2. c
3. a
4. a
5. d
6. d
7. a
3. c
4. a
5. a
6. c
7. d
A P P LY 1. d
2. b
SYNTHESIZE 1. TEA blocks K+ channels so that they will not permit the passage of K+ out of the cell, thereby not allowing the cell to return to the resting potential. Voltage-gated Na+ channels would still be functional and Na+ would still flow into the cell but there would be no repolarization. Na+ would continue to flow into the cell until an electrochemical equilibrium was reached for Na+, which is + 60 mV. After the membrane potential reached + 60 mV, there would be no net movement of Na+, but the membrane would also not be able to repolarize back to the resting membrane potential. The neuron would no longer be able to function. The effects on the postsynaptic cell would be somewhat similar if TEA were applied to the presynaptic cell. The presynaptic cell would depolarize and would continue to release neurotransmitter until it had exhausted its store of synaptic vesicles. As a result, the postsynaptic cell would be bombarded with neurotransmitters and would be stimulated continuously until the stores of presynaptic neurotransmitter were depleted. The postsynaptic cell however would recover, being able to repolarize its membrane, and return to the resting membrane potential. 2. Rising: Na+ gates open, K+ closed Falling: Na+ inactivation gate closes, K+ open Undershoot: Na+ activation gate closed, inactivation gate open, K+ gate closing. 3. Action potential arrives at the end of the axon. Ca2+ channels open. Ca2+ causes synaptic vesicles to fuse with the axon membrane at the synapse. Synaptic vesicles release their neurotransmitter. Neurotransmitter molecules diffuse across synaptic cleft. Postsynaptic receptor proteins bind neurotransmitter. Postsynaptic membrane depolarizes. If this were an inhibitory synapse, the binding of receptor protein and neurotransmitter would cause the postsynaptic membrane to hyperpolarize. 4. Cells exposed to a stimulus repeatedly may lose their ability to respond. This is known as habituation. Karen’s postsynaptic cells may have decreased the number of receptor proteins they produce because the stimulatory signal is so abundant. The result is that it now takes more stimuli to achieve the same result.
CHAPTER 45 LEARNING OUTCOME QUESTIONS 45.1 When the log values of the intensity of the stimulus and the frequency of the resulting action potentials are plotted against each other, a straight line results; this is referred to as a logarithmic relationship. 45.2 Proprioceptors detect the stretching of muscles and subsequently relay information about the relative position and movement of different parts of the organism’s body to the central nervous system. This knowledge is critical for the central nervous system; it must be able to respond to these data by signaling the appropriate muscular responses, allowing for balance, coordinated locomotion, and reflexive responses. 45.3 The lateral line system supplements the sense of hearing in fish and amphibian larvae by allowing the organism to detect minute changes in the pressure and vibrations of its environment. This is facilitated by the density of water; without an aquatic environment the adult, terrestrial amphibian will no longer be able to make use of this system. On land, sound waves are more easily detectable by the sense of hearing than are vibratory or pressure waves by the similar structures of a lateral line.
45.4 Many insects, such as the housefly, have chemoreceptors on their feet with which they can detect the presence of edible materials as they move through their environment. These insects can thus “taste” what they are walking on, and when they encounter an edible substrate they can then descend their proboscis and consume the food.
A-24
45.5 Individuals with complete red-green color blindness (those who have no red cones or no green cones, as opposed to those who lack only some red or green cones) would be highly unlikely to be able to learn to distinguish these colors. In order for an individual to perceive the colors in the red-green area of the spectrum, both red and green cones are required; without both cones there is no reference point by which individuals could compare the signals between the retina and the brain. If there are other cues available, such as color saturation or object shape and size, individuals with a less severe form of color blindness may be able to learn to distinguish these colors. In the absence of other references, however, it would be very difficult for individuals with even partial red-green color blindness to distinguish these colors. 45.6 The body temperature of an ectothermic organism is not necessarily the same as the ambient temperature; for example, other reptiles may bask in the sun, wherein on a chilly day the sun may warm the animal’s body temperature above the ambient temperature. In this situation, the heat-sensing organs of, for example, a pit viper would still be effective in hunting as it would be able to distinguish the differences between the environment and its ectothermic prey.
INQUIRY QUESTIONS Page 921
As the injured fish thrashed around, it would produce vibrations, rapid changes in the pressure of the water. The lateral line system in fish consists of canals filled with sensory cells that send a signal to the brain in response to the changes in water pressure.
Page 927
Both taste and smell utilize chemoreceptors as sensory receptors, wherein the binding of specific proteins to the receptor induces an action potential which is sent as a sensory signal to the brain. The chemicals detected by both systems must first be dissolved in extracellular fluid before they can be detected. One major difference between the two systems is that the olfactory system does not route a signal through the thalamus; instead, action potentials are routed directly to the olfactory cortex. Another difference is that olfactory receptors occur in larger numbers—tens of millions, as opposed to tens or hundreds of thousands for taste receptors.
Page 929
In humans, the ganglion cells attach to the front of the retinal cells, thus forcing the optic nerve to disrupt the continuity of the retina, leading to the formation of a “blind spot”. In mollusks, however, the ganglion cells attach to the back of the retina and thus the retina is uninterrupted, eliminating the blind spot.
U N D E R S TA N D 1. d
2. b
3. d
4. b
3. c
4. b
5. a
6. c
7. b
8. d
9. a
A P P LY 1. c
2. a
SYNTHESIZE 1. When blood pH becomes acidic, chemoreceptors in the circulatory and the nervous systems notify the brain and the body responds by increasing the breathing rate. This causes an increase in the release of carbon dioxide through the lungs. Decreased carbon dioxide levels in the blood cause a decrease in carbonic acid, which, in turn, causes the pH to rise. 2. In order to reach the retina and generate action potentials on the optic nerve, light must first pass through the ganglion and bipolar cells to reach the rods and cones that synapse with the bipolar cells. The bipolar cells then synapse with ganglion cells. These in turn send action potentials to the brain. Because the retina comprises three layers, with the rods and cones located farthest from the pupil, light must travel to the deepest level to set off reactions that move up through the more superficial levels and result in optic signals. 3. Without gravity to force the otoliths down toward the hair cells, the otolith organ will not function properly. The otolith membrane would not rest on the hair cells and would not move in response to movement of the body parallel or perpendicular to the pull of gravity. Consequently, the hair cell would not bend and so would not produce receptor potentials. Because the astronauts can see, they would have an impression of motion–they can see themselves move in relation to objects around them–but with their eyes closed, they would not know if they were moving in relation to their surroundings. Because their proprioceptors would still function, they would be able to sense when they moved their arms or legs, but they would not have the sensation of their enter body moving through space. The semicircular canals would not function equally well in zero-gravity conditions. Although the fluid in the semicircular canals is still able to move around, some sensation of angular movement would most likely occur, but the full function of the semicircular canals requires the force of gravity to aid in the directional movement of the fluid in the canals.
appendix A
rav32223_appx_A1-A34.indd A-24
12/7/09 5:01:16 PM
CHAPTER 46 LEARNING OUTCOME QUESTIONS 46.1 Neurotransmitters are released at a synapse and act on the post synaptic membrane. Hormones enter the circulatory system and are thus delivered to the entire body.
46.2 The response of a particular tissue depends first on the receptors on its surface, and second on the response pathways active in a cell. There can be different receptor subtypes that bind the same hormone, and the same receptor can stimulate different response pathways. 46.3 This might lower the amount of GH in circulation. As a treatment, it may have unwanted side effects. 46.4 With two hormones that have antagonistic effects, the body can maintain a fine level of blood sugar. 46.5 Reducing blood volume should also reduce blood pressure.
U N D E R S TA N D 1. b
2. d
3. c
4. b
5. d
6. b
7. a
2. c
47.4 Slow-twitch fibers are found primarily in muscles adapted for endurance rather than strength and power. Myoglobin provides oxygen to the muscles for the aerobic respiration of glucose, thus providing a higher ATP yield than anaerobic respiration. Increased mitochondria also increases the ATP productivity of the muscle by increasing availability of cellular respiration and thus allows for sustained aerobic activity. 47.5 Locomotion via alternation of legs requires a greater degree of nervous system coordination and balance; the animal needs to constantly monitor its center of gravity in order to maintain stability. In addition, a series of leaps will cover more ground per unit time and energy expenditure than will movement by alternation of legs.
INQUIRY QUESTIONS Page 969 The idea is very similar; both quadrupeds and insects such as grasshoppers have flexors and extensors that exert antagonistic control over many of their muscles. The main different is in the structure rather than function—in a grasshopper, the muscles are covered by the skeletal elements, while in organisms with an endoskeleton, the muscles overlie the bony skeleton.
Page 974
A P P LY 1. a
are overcome by the internal bony skeleton, which can support a greater size and weight without itself becoming too cumbersome.
3. c
4. b
5. b
6. b
7. b
SYNTHESIZE 1. If the target cell for a common hormone or paracrine becomes cancerous, it may become hypersensitive to the messenger. This may in turn cause over production of cells, which would result in tumor formation. By blocking the production of the hormone specific to that tissue (for example, breast or prostate tissue and sex steroids), it would be possible to slow the growth rate and decrease the size of the tumor. 2. The same hormone can affect two different organs in different ways because the second messengers triggered by the hormone have different targets inside the cell because the cells have different functions. Epinephrine affects the cells of the heart by increasing metabolism so that their contractions are faster and stronger. However, liver cells do not contract and so the second messenger in liver cells triggers the conversion of glycogen into glucose. That is why hormones are so valuable but also economical to the body. One hormone can be produced, one receptor can be made, and one second-messenger system can be used, but there can be two different targets inside the cell. 3. With hormones such as thyroxine, whose effects are slower and have a broader range of activity, a negative feedback system using one hormone adequately controls the system. However, for certain parameters that have a very narrow range and change constantly within that range, a regulatory system that uses up-and-down regulation is desirable. Too much or too little Ca2+ or glucose in the blood can have devastating effects on the body and so those levels must be controlled within a very narrow range. To rely on negative feedback loops would restrict the quick “on” and “off” responses needed to keep the parameters in a very narrow range.
CHAPTER 47 LEARNING OUTCOME QUESTIONS 47.1 There are three limitations terrestrial invertebrates experience due to an exoskeleton. First, animals with an exoskeleton can only grow by shedding, or molting, the exoskeleton, leaving them vulnerable to predation. Second, muscles that act upon the exoskeleton cannot strengthen and grow as they are confined within a defined space. Finally, the exoskeleton, in concert with the respiratory system of many terrestrial invertebrates, limits the size to which these animals can grow. In order for the exoskeleton of a terrestrial animal to be strong, it has to have a sufficient surface area, and thus it has to increase in thickness as the animal gets larger. The weight of a thicker exoskeleton would impose debilitating constraints on the animal’s ability to move.
Increasing the frequency of stimulation to a maximum rate will yield the maximum amplitude of a summated muscle contraction. The strength of a contraction increases because little or no relaxation time occurs between successive twitches.
Page 974
A rough estimate of the composition of calf muscle could be obtained by measuring the amount of time the calf muscle takes to reach maximum tension and compare that amount with the contraction speed of muscles of known fiber composition. Alternatively, a small sample of muscle could be extracted and examined for histological differences in fiber composition.
U N D E R S TA N D 1. d
2. b
3. c
4. a
5. c
6. a
3. d
4. b
5. b
6. b
7. b
8. a
A P P LY 1. d
2. b
SYNTHESIZE 1. Although a hydrostatic skeleton might have advantages in terms of ease of transport and flexibility of movement, the exoskeleton would probably do a better job at protecting the delicate instruments within. This agrees with our observations of these support systems on Earth. Worms and marine invertebrates use hydrostatic skeletons, although arthropods (“hard bodies”) use an exoskeleton. Worms are very flexible, but easily crushed. 2. The first 90 seconds of muscle activity are anaerobic in which the cells utilize quick sources of energy (creatine phosphate, lactic acid fermentation) to generate ATP. After that, the respiratory and circulatory systems will catch up and begin delivering more oxygen to the muscles which allows them to use aerobic respiration, which is a much more efficient method of generating ATP from glucose. 3. If acetylcholinesterase is inhibited, acetylcholine will continue to stimulate muscles to contract. As a result, muscle twitching, and eventually paralysis, will occur. In March 1995, canisters of Sarin were released into a subway system in Tokyo. Twelve people were killed and hundreds injured. 4. Natural selection is not goal-oriented. In other words, evolution does not anticipate environmental pressures and the structures that result from evolution by natural selection are those most well-suited the previous generations’ environment. Since vertebral wing development occurred several times during evolution, it is probable that the animals in question—birds, pterosaurs, and bats—all encountered different evolutionary pressures during wing evolution.
47.2 Vitamin D is important for the absorption of dietary calcium as well as the de-
CHAPTER 48
position of calcium phosphate in bone. Children undergo a great deal of skeletal growth and development; without sufficient calcium deposition their bones can become soft and pliable, leading to a condition known as rickets, which causes a bending or bowing of the lower limbs. In the elderly, bone remodeling without adequate mineralization of the bony tissue can lead to brittle bones, a condition known as osteoporosis.
48.1 The cells and tissues of a one-way digestive system are specialized such
47.3 First, unlike the chitinous exoskeleton, a bony endoskeleton is made of living tissue; thus, the endoskeleton can grow along with the organism. Second, because the muscles that act upon the bony endoskeleton are not confined within a rigid structure, they are able to strengthen and grow with increased use. Finally, the size limitations imposed by a heavy exoskeleton that covers the entire organism
LEARNING OUTCOME QUESTIONS that ingestion, digestion, and elimination can happen concurrently, making it more efficient in terms of food processing and energy utilization. With a gastrovascular cavity, however, all of the cells are exposed to all aspects of digestion.
48.2 Voluntary processes include bringing food into the mouth (food capture), mastication, and the initiation of swallowing. Salivation and the swallowing reflex are involuntary. appendix A
rav32223_appx_A1-A34.indd A-25
A-25
12/7/09 5:01:16 PM
in the gizzard. Bird diets are comparably diverse to mammalian diets; some birds are carnivores, others are insectivores or frugivores, still others omnivores.
48.3 The sandwich represents carbohydrate (bread), protein (chicken), and fat (mayonnaise). The breakdown of carbohydrates begins with salivary amylase in the mouth. The breakdown of proteins begins in the stomach with pepsinogen, and the emulsification of fats begins in the duodenum with the introduction of bile. So—it is the chicken that will begin its breakdown in the stomach.
48.4 Fats are broken down, by emulsification, into fatty acids and monoglycerides, both of which are nonpolar molecules. Nonpolar molecules are able to enter the epithelial cells by simple diffusion.
48.5 The success of any mutation depends upon the selective pressures that species is subjected to. Thus, if two different species are subjected to similar environmental conditions and undergo the same mutation, then, yes, the mutation should be similarly successful. If two species undergo the same mutation but are under different selective pressures, then the mutation may not be successful in both species.
48.6 The sight, taste, and, yes, smell of food are the triggers the digestive system needs to release digestive enzymes and hormones. The saliva and gastric secretions that are required for proper digestion and are triggered by the sense of smell would be affected by anosmia.
48.7 Any ingested compounds that might be dangerous are metabolized first by
CHAPTER 49 LEARNING OUTCOME QUESTIONS 49.1 Fick’s law states that the rate of diffusion (R) can be increased by increasing the surface area of a respiratory surface, increase the concentration difference between respiratory gases, and decreasing the distance the gases must diffuse: R = DA Δp. Continually beating cilia increase the concentration difference (Δp). d
49.2 Countercurrent flow systems maximize the oxygenation of the blood by increasing Δp, thus maintaining a higher oxygen concentration in the water than in the blood throughout the entire diffusion pathway. The lamellae, found within a fish’s gill filaments, facilitate this process by allowing water to flow in only one direction, counter to the blood flow within the capillary network in the gill.
49.3 Birds have a more efficient respiratory system than other terrestrial verte-
INQUIRY QUESTIONS
brates. Birds that live or fly at high altitudes are subjected to lower oxygen partial pressure and thus have evolved a respiratory system that is capable of maximizing the diffusion and retention of oxygen in the lungs. In addition, efficient oxygen exchange is crucial during flight; flying is more energetically taxing than most forms of locomotion and without efficient oxygen exchange birds would be unable to fly even short distances safely.
Page 985 If the epiglottis does not properly seal off the larynx and trachea, food
49.4 There are both structural and functional differences in bird and mamma-
can accidentally become lodged in the airway, causing choking.
lian respiration. Both mammals and birds have lungs, but only birds also have air sacs, which they use to move air in and out of the respiratory system, while only mammals have a muscular diaphragm used to move air and in and out of the lungs. Mammalian lungs are pliable, and gas exchange occurs within small closed-ended sacs in the mammalian lung called alveoli. In contrast, bird lungs are rigid, and gas exchange occurs in the unidirectional parabronchi. In addition, because air flow in mammals is bi-directional, there is a mixing of oxygenated and deoxygenated air, while the unidirectional air flow in birds increases the purity of the oxygen entering the capillaries. Mammalian respiration is less efficient than avian respiration; birds transfer more oxygen with each breath than do mammals. Finally, mammals only have one respiratory cycle whereas birds have two complete cycles.
the liver, thus reducing the risk to the rest of the body.
48.8 Even with normal leptin levels, individuals with reduced sensitivity in the brain to the signaling molecule may still become obese.
Page 986 The digestive system secretes a mucus layer that helps to protect the delicate tissues of the alimentary canal from acidic secretions.
Page 992 The amino acid sequences for lysozyme evolved convergently among ruminants and langur monkeys. Thus, if a phylogeny was constructed using solely the lysozyme molecular data, these species—ruminants and langur monkeys— would be adjacent to each other on the phylogenetic tree. Page 997 GIP and CCK send inhibitory signals to the hypothalamus upon food intake. If the hypothalamus sensors did not work properly, leptin levels would increase; increased leptin levels would result in a loss of appetite.
49.5 Most oxygen is transported in the blood bound to hemoglobin (forming
U N D E R S TA N D 1. b
2. c
3. c
4. b
3. c
4. c
5. d
6. d
7. c
A P P LY 1. d
2. b
SYNTHESIZE
oxyhemoglobin) while only a small percentage is dissolved in the plasma. Carbon dioxide, on the other hand, is predominantly transported as bicarbonate (having first been combined with water to form carbonic acid and then dissociated into bicarbonate and hydrogen ions). Carbon dioxide is also transported dissolved in the plasma and bound to hemoglobin.
INQUIRY QUESTIONS
1. Birds feed their young with food they acquire from the environment. The adult bird consumes the food but stores it in her crop. When she returns to the nest, she regurgitates the food into the mouths of the fledglings. Mammals on the other hand feed their young with milk that is produced in the mother’s mammary glands. Young feed by latching onto the mother’s nipples and sucking the milk. Mammals have no need for a crop in their digestive system because they don’t feed their young in the same way as birds.
Page 1002 Capillaries, the tiniest of the cardiovascular vessels, are located near
2. Leptin is produced by the adipose cells and serves as a signal for feeding behavior. Since low blood leptin levels signal the brain to initiate feeding, a treatment for obesity would need to raise leptin levels, thereby decreasing appetite.
sion is directly proportional to the pressure difference between the two sides of the membrane and to the area over which the diffusion occurs. In emphysema, alveolar walls break down and alveoli increase in size, effectively reducing the surface area for gas exchange. Emphysema thus reduces the diffusion of gases.
3. The liver plays many important roles in maintaining homeostasis. Two of those roles are detoxifying drugs and chemicals and producing plasma proteins. A drop in plasma protein levels is indicative of liver disease, which in turn could be caused by abuse of alcohol or other drugs.
Page 1013 Most veins have a bluish color and function to return oxygen-deplet-
4. The selective pressures that guide the adaptation of mutated alleles within a population were the same in these two groups of organisms. Both ruminants and langur monkeys eat tough, fibrous plant materials which are broken down by intestinal bacteria. The ruminants and langurs then absorb the nutrients from the cellulose by digesting those bacteria; this is accomplished through the use of these adapted lysozymes. Normal lysozymes, found in saliva and other secretions, work in a relatively neutral pH environment. These intestinal lysozymes, however, needed to adapt to an acidic environment, which explains the level of convergence.
every cell of the body. Because of their small size and large number, the surface area for gas exchange through them is maximized. This capillary arrangement also works well with the tiny alveoli of the lungs which also provide a large surface area for gas exchange. Since capillaries are in intimate contact with alveoli, rapid gas exchange is enhanced.
Page 1012 Fick’s law of diffusion states that for a dissolved gas, the rate of diffu-
ed blood to the heart. The pulmonary veins, however, are bright red because they return fully oxygenated blood from the lungs to the left atrium of the heart.
Page 1013 The difference in oxygen content between arteries and veins during rest and exercise shows how much oxygen was unloaded to the tissues.
Page 1014 Not really. A healthy individual still has a substantial oxygen reserve in the blood even after intense exercise.
Page 1014
It increases it. At any pH or temperature, the percentage of O2 saturation falls (e.g. more O2 is delivered to tissues) as pressure increases.
U N D E R S TA N D 1. c
2. d
3. d
4. d
5. b
6. a
7. d
8. c
5. Whereas mammalian dentition is adapted to process different food types, birds are able to process different types of food by breaking up food particles
A-26
appendix A
rav32223_appx_A1-A34.indd A-26
11/30/09 6:36:02 PM
A P P LY 1. d
2. c
SYNTHESIZE 3. a
4. c
5. a
6. c
SYNTHESIZE 1. Fish gills have not only a large respiratory surface area but also a countercurrent flow system, which maintains an oxygen concentration gradient throughout the entire exchange pathway, thus providing the most efficient system for the oxygenation of blood. Amphibian respiratory systems are not very efficient. They practice positive pressure breathing. Bird lungs are quite effective, in that they have a large surface area and one-way air flow; mammals, on the other hand, have only a large surface area but no mechanism to ensure the maintenance of a strong concentration gradient. 2. During exercise, cellular respiration increases the amount of carbon dioxide released, thus decreasing the pH of the blood. In addition, the increased cellular respiration increases temperature, as heat is released during glucose metabolism. Decreased pH and increased temperature both facilitate an approximately 20% increase in oxygen unloading in the peripheral tissues. 3. Unicellular prokaryotic organisms, protists, and many invertebrates are small enough such that gas exchange can occur over the body surface directly from the environment. Only larger organisms, where most cells are not in direct contact with the environment with which gases must be exchanged, require specialized structures for gas exchange.
CHAPTER 50 LEARNING OUTCOME QUESTIONS
1. Antidiuretic hormone (ADH) is secreted by the posterior pituitary but has its target cells in the kidney. In response to the presence of ADH, the kidneys increase the amount of water reabsorbed. This water eventually returns to the plasma where it causes an increase in volume and subsequent increase in blood pressure. Another hormone, aldosterone, also causes an increase in blood pressure by causing the kidney to retain Na+, which sets up a concentration gradient that also pulls water back into the blood. 2. Blood includes plasma (comprised primarily of water with dissolved proteins) and formed elements (red blood cells, white blood cells, and platelets). Lymph is comprised of interstitial fluid and found only within the lymphatic vessels and organs. Both blood and lymph are found in organisms with closed circulatory systems. Hemolymph is both the circulating fluid and the interstitial fluid found in organisms with open circulatory systems. 3. Many argue that the evolution of endothermy was less an adaptation to maintain a constant internal temperature and more an adaptation to function in environments low in oxygen. If this is the case, then yes, it makes sense that the evolution of the four-chambered heart, an adaptation that increases the availability of oxygen in the body tissues and which would be highly beneficial in an oxygen-poor environment, and the evolution of endothermy were related. These two adaptations can also be looked at as related in that the more efficient heart would be able to provide the oxygen necessary for the increased metabolic activity that accompanies endothermy. 4. The SA node acts as a natural pacemaker. If it is malfunctioning, one would expect a slow or irregular heartbeat or irregular electrical activity between the atria and the ventricles.
50.1 Following an injury to a vessel, vasoconstriction is followed by the accumulation of platelets at the site of injury and the subsequent formation of a platelet plug. This triggers a positive feedback enzyme cascade, attracting more platelets, clotting factors, and other chemicals, each of which continually attract additional clotting molecules until the clot is formed. The enzyme cascade also causes fibrinogen to come out of solution as fibrin, forming a fibrin clot that will eventually replace the platelet plug.
50.2 When the insect heart contracts, it forces hemolymph out through the
CHAPTER 51 LEARNING OUTCOME QUESTIONS 51.1 Water moves towards regions of higher osmolarity. 51.2 The are both involved in water conservation. 51.3 This may have arisen independently in both the mammalian and avian lineages, or lost from the reptilian lineage.
vessels and into the body cavities. When it relaxes, the resulting negative pressure gradient, combined with muscular contractions in the body, draws the blood back to the heart.
51.4 Nitrogenous waste is a problem because it is toxic, and it is a result of
50.3 The primary advantage of having two ventricles rather than one is the sepa-
51.5 This would increase the osmolarity within the tubule system, and thus
ration of oxygenated from deoxygenated blood. In fish and amphibians, oxygenated and deoxygenated blood mix, leading to less oxygen being delivered to the body’s cells.
51.6 Blocking aquaporin channels would prevent reabsorption of water from the
50.4 The delay following auricular allows the atrioventricular valves to close prior to ventricular contraction. Without that delay, the contraction of the ventricles would force blood back up through the valves into the atria.
50.5 During systemic gas exchange, only about 90% of the fluid that diffuses out of the capillaries returns to the blood vessels; the rest moves into the lymphatic vessels, which then return the fluid to the circulatory system via the left and right subclavian veins.
50.6 Breathing rate is regulated to ensure ample oxygen is available to the body. However, the heart rate must be regulated to ensure efficient delivery of the available oxygen to the body cells and tissues. For example, during exertion, respiratory rates will increase in order to increase oxygenation and allow for increased aerobic cellular respiration. But simply increasing the oxygen availability is not enough— the heart rate must also increase so that the additional oxygen can be quickly delivered to the muscles undergoing cellular respiration.
INQUIRY QUESTION Page 1021
Erythropoietin is a hormone that stimulates the production of erythrocytes from the myeloid stem cells. If more erythrocytes are produced, the oxygen-carrying capacity of the blood is increased. This could potentially enhance athletic performance and is why erythropoietin is banned from use during the Olympics and other sporting events.
U N D E R S TA N D 1. a
2. b
3. c
4. a
5. c
3. a
4. c
5. a
A P P LY 1. a
2. b
6. d
7. c
degrading old proteins. should decrease reabsorption of water. This would lead to loss of water. collecting duct.
U N D E R S TA N D 1. d
2. a
3. c
4. c
5. d
6. d
3. b
4. b
5. c
6. b
7. d
A P P LY 1. d
2. c
SYNTHESIZE 1a. Antidiuretic hormone (ADH) is produced in the hypothalamus and is secreted by the posterior pituitary. ADH targets the collecting duct of the nephron and stimulates the reabsorption of water from the urine by increasing the permeability of water in the walls of the duct. The primary stimulus for ADH secretion is an increase in the osmolarity of blood. 1b. Aldosterone is produced and secreted by the adrenal cortex in response to a drop in blood Na+ concentration. Aldosterone stimulates the distal convoluted tubules to reabsorb Na+, decreasing the excretion of Na+ in the urine. The reabsorption of Na+ is followed by Cl– and water, and so aldosterone has the net effect of retaining both salt and water. Aldosterone secretion however, is not stimulated by a decrease in blood osmolarity, but rather by a decrease in blood volume. A group of cells located at the base of the glomerulus, called the juxtaglomerular apparatus, detect drops in blood volume that then stimulates the renin-angiotensin-aldosterone system. 1c. Atrial natriuretic hormone (ANH) is produced and secreted by the right atrium of the heart, in response to an increase in blood volume. The secretion of ANH results in the reduction of aldosterone secretion. With the secretion of ANH, the distal convoluted tubules reduce the amount of Na+ that is reabsorbed, and likewise reduces the amount of Cl– and water that is reabsorbed. The final result is the reduction in blood volume.
appendix A
rav32223_appx_A1-A34.indd A-27
A-27
11/30/09 6:36:02 PM
His normal renal blood flow rate would be 21% of cardiac output, or 7.2 L/ min × 0.21 = 1.5 L/min. If John’s kidneys are not affected by his circulatory condition, his renal blood flow rate should be about 1.5 L/min.
CHAPTER 53
CHAPTER 52 LEARNING OUTCOME QUESTIONS 52.1 No, innate immunity shows some specificity for classes of molecules common to pathogens. 52.2 Hematopoetic stem cells. 52.3 T-cell receptors are rearranged to generate a large number of different receptors with specific binding abilities. Toll-like receptors are not rearranged, and recognize specific classes of molecules, not specific molecules.
52.4 Ig receptors are rearranged to generate many different specificities. TLR innate receptors are not rearranged and bind to specific classes of molecules. 52.5 Allergies are a case of the immune system overreacting while autoimmune disorders involve the immune system being compromised. 52.6 Diagnostic kits use monoclonal antibodies because they are against a single specific epitope of an antigen. They also use cells that can be grown in culture, and do not require immunizing an animal, bleeding them and then isolating the antibodies from their sera. 52.7 The main difference between Polio and influenza is the rate at which the viruses can change. The Polio virus is a RNA virus with a genome that consists of a single RNA. The viral surface proteins do not change rapidly allowing immunity via a vaccine. Influenza is an RNA virus with a high mutation rate, which means that surface proteins change rapidly. Influenza has a genome that consists of multiple RNAs, which allows recombination of the different viral RNA’s during infection with different strains.
INQUIRY QUESTIONS Page 1059 The viruses would be liberated into the body where they could infect numerous additional cells.
Page 1063 The antigenic properties of the two viruses must be similar enough that immunity to cowpox also enables protection against smallpox.
Page 1074 The common structure and mechanism of formation of B cell immunoglobulins (Igs) and T-cell receptors (TCRs) suggests a common ancestral form of adaptive immunity gave rise to the two cell lines existing today. Page 1078 A high level of HCG in a urine sample will block the binding of the antibody to HCG-coated particles and prevent any agglutination. Page 1079 Influenza frequently alters its surface antigens making it impossible to produce a vaccine with a long-term effect. Smallpox virus has a considerably more stable structure.
U N D E R S TA N D 1. b
2. a
3. b
4. c
5. c
6. b
7. c
3. c
4. a. b., then d., then c
A P P LY 1. d
2. c
5. c
6. b
7. a
SYNTHESIZE 1. It would be difficult to advertise this lotion as immune-enhancing. The skin serves as a barrier to infection because it is oily and acidic. Applying a lotion that is watery and alkaline will dilute the protective effects of the skin secretions, thereby inhibiting the immune functions. Perhaps it is time to look for another job. 2. The scratch has caused an inflammatory response. Although it is very likely that some pathogens entered her body through the broken skin, the response is actually generated by the injury to her tissue. The redness is a result of the increased dilation of blood vessels caused by the release of histamine. This also increases the temperature of the skin by bringing warm blood closer to the surface. Leakage of fluid from the vessels causes swelling in the area of the injury, which can cause pressure on the pain sensors in the skin. All of these serve to draw defensive cells and molecules to the injury site, thereby helping to defend her against infection. 3. There are a number of ways that this could be done. However, one method would be to show that viral genetic material never appears within the cells of those who claim immunity. Another method would involve testing for the presence of interferon, which is released by cells in response to viral infection.
A-28
4. These data imply that innate immunity is a very ancient defense mechanism. The presence of these proteins in Cnidarians indicates that they arose soon after multicellularity.
LEARNING OUTCOME QUESTIONS 53.1 Genetic sex determination essentially guarantees equal sex ratios; when sex ratios are not equal, the predominant sex is selected against because those individuals have more competition for mates. Temperature-dependent sex-determination can result in skewed sex ratios in which one sex or the other is selected against. Genetic sex determination, on the other hand, can provide much greater stability within the population, and consequently the genetic characteristics that provide that stability are selected for.
53.2 Estrous cycles occur in most mammals, and most mammalian species have relatively complex social organizations and mating behaviors. The cycling of sexual receptivity allows for these complex mating systems. Specifically, in social groups where male infanticide is a danger, synchronized estrous among females may be selected for as it would eliminate the ability of the male to quickly impregnate the group females. Physiologically, estrous cycles result in the maturation of the egg accompanying the hormones that promote sexual receptivity. 53.3 In mating systems where males compete for mates, sperm competition, a form of sexual selection, is very common. In these social groups, multiple males may mate with a given female, and thus those individuals who produced the highest number of sperm would have a reproductive advantage—a higher likelihood of siring the offspring. 53.4 The answer varies depending upon the circumstances. In a species that is very r-selected, in other words, one that reproduces early in life and often but does not invest much in the form of parental care, multiple offspring per pregnancy would definitely be favored by natural selection. In K-selected species where parental care is very high, on the other hand, single births might be favored because the likelihood of offspring survival is greater if the parental resources are not divided among the offspring. 53.5 The birth control pill works by hormonally controlling the ovulation cycle in women. By releasing progesterone continuously the pill prevents ovulation. Ovulation is a cyclical event and under hormonal control, thus it is easy for the process to be controlled artificially. In addition, the female birth control pill only has to halt the release of a single ovum. An analogous male birth control pill, on the other hand, would have to completely cease sperm production (and men produce millions of sperm each day), and such hormonal upheaval in the male could lead to infertility or other intolerable side effects.
INQUIRY QUESTIONS Page 1085
The ultimate goal of any organism is to maximize its relative fitness. Small females are able to reproduce but once they become very large they would be better able to maximize their reproductive success by becoming male, especially in groups where only a few males mate with all of the females. Protandry might evolve in species where there is a limited supply of mates and relatively little space; a male of such a species in close proximity to another male would have higher reproductive success by becoming female and mating with the available male than by waiting for a female (and then having to compete for her with the other male).
Page 1088 The evolutionary progression from oviparity to viviparity is a complex process; requiring the development of a placenta or comparable structure. Once a complex structure evolves, it is rare for an evolutionary reversal to occur. Perhaps more importantly, there are several advantages to viviparity over oviparity, especially in cold environments where eggs are vulnerable to mortality due to cold weather (and predation). In aquatic reptiles such as sea snakes, viviparity allows the female to remain at sea and avoid coming ashore, where both she and her eggs would be exposed to predators. Page 1094 Under normal circumstances, the testes produce hormones, testosterone and inhibin, which exert negative feedback inhibition on the hormones produced and secreted by the anterior pituitary (luteinizing hormone and folliclestimulating hormone). Following castration, testosterone and inhibin are no longer produced and thus the brain will overproduce LH and FSH. For this reason, hormone therapy is usually prescribed following castration.
U N D E R S TA N D 1. c
2. d
3. d
4. d
3. d
4. a
5. b
6. c
7. a
8. c
9. a
A P P LY 1. a
2. b
appendix A
rav32223_appx_A1-A34.indd A-28
12/7/09 5:02:06 PM
SYNTHESIZE 1. A mutation that makes SRY nonfunctional would mean that the embryo would lack the signal to form male structures during development. Therefore, the embryo would have female genitalia at birth.
2. Amphibians and fish that rely on external fertilization also have access to water. Lizards, birds, and mammals have adaptations that allow them to reproduce away from a watery environment. These adaptations include eggs that have protective shells or internal development, or both.
3. FSH and LH are produced by the anterior pituitary in both males and females. In both cases they play roles in the production of sex hormones and gametogenesis. However, FSH stimulates spermatogenesis in males and oogenesis in females, whereas LH promotes the production of testosterone in males and estradiol in females.
4. It could indeed work. The hormone hCG is produced by the zygote to prevent menstruation, which would in turn prevent implantation in the uterine lining. Blocking the hormone receptors would prevent implantation and therefore pregnancy.
5. Parthenogenic species reproduce from gametes that remain diploid. Sperm are haploid, whereas eggs do not complete meiosis (becoming haploid) until after fertilization. Therefore, only eggs could develop without DNA from an outside source. In addition, only eggs have the cellular structures needed for development. Therefore only females can undergo parthenogenesis.
2. Homeoboxes are sequences of conserved genes that play crucial roles in development of both mammals (Fifi) and Drosophila (the fruit fly). In fact, we know that they are more similar than dissimilar; research has demonstrated that both groups use the same transcription factors during organogenesis. The major difference between them is in the genes that are transcribed. Homeoboxes in mammals turn on genes that cause the development of mammalian structures, and those in insects would generate insect structures. 3. After fertilization, the zygote produces hCG, which inhibits menstruation and maintains the corpus luteum. At 10 weeks gestation, the placenta stops releasing hCG but it does continue to release estradiol and progesterone, which maintain the uterine lining and inhibit the pituitary production of FSH and LH. Without FSH and LH no ovulation and no menstruation occur. 4. Spemann and Mangold removed cells from the dorsal lip of one amphibian embryo and transplanted them to a different location on a second embryo. The transplanted cells caused cells that would normally form skin and belly to instead form somites and the structures associated with the dorsal area. Because of this and because the secondary dorsal structures contained both host and transplanted cells, Spemann and Mangold concluded that the transplanted cells acted as organizers for dorsal development.
CHAPTER 55 LEARNING OUTCOME QUESTIONS 55.1 Just as with morphological characteristics that enhance an individual’s fit-
CHAPTER 54 LEARNING OUTCOME QUESTIONS 54.1 Ca2+ ions act as second messengers and bring about changes in protein activity that result in blocking polyspermy and increasing the rate of protein synthesis within the egg.
54.2 In a mammal, the cells at the four-cell stage are still uncommitted and thus separating them will still allow for normal development. In frogs, on the other hand, yolk distribution results in displaced cleavage; thus, at the four-cell stage the cells do not each contain a nucleus which contains the genetic information required for normal development. 54.3 The cellular behaviors necessary for gastrulation differ across organisms; however, some processes are necessary for any gastrulation to occur. Specifically, cells must rearrange and migrate throughout the developing embryo. 54.4 No—neural crest cell fate is determined by its migratory pathway. 54.5 Marginal zone cells in both the ventral and dorsal regions express bone morphogenetic protein 4 (BMP4). The fate of these cells is determined by the number of receptors on the cell membrane to bind to BMP4; greater BMP4 binding will induce a ventral mesodermal fate. The organizer cells, which previously were thought to activate dorsal development, have been found to actually inhibit ventral development by secreting one of many proteins that block the BMP4 receptors on the dorsal cells.
54.6 Most of the differentiation of the embryo, in which the initial structure formation occurs, happens during the first trimester; the second and third trimesters are primarily times of growth and organ maturation, rather than the actual development and differentiation of structures. Thus, teratogens are most potent during this time of rapid organogenesis.
INQUIRY QUESTION Page 1127 High levels of estradiol and progesterone in the absence of pregnancy would still affect the body in the same way. High levels of both hormones would inhibit the release of FSH and LH, thereby preventing ovulation. This is how birth control pills work. The pills contain synthetic forms of either both estradiol and progesterone or just progesterone. The high levels of these hormones in the pill trick the body into thinking that it is pregnant and so the body does not ovulate.
U N D E R S TA N D 1. d
2. b
3. d
4. c
5. d
6. b
3. a
4. a
5. d
6. b
A P P LY 1. c
2. b
7. c
SYNTHESIZE 1. By starting with a series of embryos at various stages, you could try removing cells at each stage. Embryos that failed to compensate for the removal (evidenced by missing structures at maturity) would be those that lost cells after they had become committed; that is, when their fate has been determined.
ness, behavioral characteristics can also affect an individual’s survivability and reproductive success. Understanding the evolutionary origins of many behaviors allows biologists insights into animal behavior, including that of humans.
55.2 A male songbird injected with testosterone prior to the usual mating season would likely begin singing prior to the usual mating season. However, since female mating behavior is largely controlled by hormones (estrogen) as well, most likely that male will not have increased fitness (and may actually have decreased fitness, if the singing stops before the females are ready to mate, or if the energetic expenditure from singing for two additional weeks is compensated by reduced sperm production). 55.3 The genetic control over pair-bonding in prairie voles has been fairly well-established. The fact that males sometimes seek extra-pair copulations indicates that the formation of pair-bonds is under not only genetic control but also behavioral control. 55.4 In species where males travel farther from the nest (and thus have larger range sizes), there should be significant sex differences in spatial memory. However, in species without sexual differences in range sizes should not express sex differences in spatial memory. To test the hypothesis you could perform maze tests on males and females of species with sex differences in range size as well as those species without range size differences between the sexes. (NOTE: such experiments have been performed and do support the hypothesis that there is a significant correlation between range size and spatial memory, so in species with sex differences in range size there are indeed sex differences in spatial memory. See Jones, CM et al., 2003. “The Evolution of Sex Differences in Spatial Ability.” Behavioral Neuroscience. 117(3): 403-411)
55.5 Although there may be a link between IQ and genes in humans, there is most certainly also an environmental component to IQ. The danger of assigning a genetic correlation to IQ lies in the prospect of selective “breeding” and the emergence of “designer babies.” 55.6 One experiment that has been implemented in testing counting ability among different primate and bird species is to present the animal with a number and have him match the target number to one of several arrays containing that number of objects. In another experiment, the animal may be asked to select the appropriate number of individual items within an array of items that equals the target number. 55.7 Butterflies and birds have extremely different anatomy and physiology and thus most likely use very different navigation systems. Birds generally migrate bi-directionally; moving south during the cold months and back north during the warmer months. Usually, then, migrations are multi-generational events and it could be argued that younger birds can learn migratory routes from older generations. Butterflies, on the other hand, fly south to breed and die. Their offspring must then fly north having never been there before. 55.8 In addition to chemical reproductive barriers, many species also employ behavioral and morphological reproductive barriers, such that even if a female moth is attracted by the pheromones of a male of another species, the two may be behaviorally or anatomically incompatible. 55.9 The benefits of territorial behavior must outweigh the potential costs, which may include physical danger due to conflict, energy expenditure, and the loss of foraging or mating time. In a flower that is infrequently encountered, the appendix A
rav32223_appx_A1-A34.indd A-29
A-29
12/7/09 5:02:48 PM
honeycreeper would lose more energy defending the resource than it could gain by utilizing the resource. On the other hand, there is usually low competitive pressure for highly abundant resources, thus the bird would expend unnecessary energy defending a resource to which its access is not limited.
55.10 The males should exhibit mate choice, as they are the sex with the greater parental investment and energy expenditure; thus, like females of most species, they should be the “choosier” sex.
55.11 Generally, reciprocal behaviors are low-cost while behaviors due to kin selection may be low- or high-cost. Protecting infants from a predator is definitely a high-risk / potentially high-cost behavior; thus it would seem that the behavior is due to kin selection. The only way to truly test this hypothesis, however, is to conduct genetic tests or, in a particularly well-studied population, consult a pedigree. Living in a group is associated with both costs and benefits. The primary cost is increased competition for resources, while the primary benefit is protection from predation. Altruism toward kin is considered selfish because helping individuals closely related to you will directly affect your inclusive fitness. Most armies more closely resemble insect societies than vertebrate societies. Insect societies consist of multitudes of individuals congregated for the purpose of supporting and defending a select few individuals. One could think of these few protected and revered individuals as the society the army is charged with protecting. These insect societies, like human armies, are composed of individuals each “assigned” to a particular task. Most vertebrate societies, on the other hand, are less altruistic and express increased competition and aggression between group members. In short, vertebrate societies are comprised of individuals whose primary concern is usually their own fitness, while insect societies are comprised of individuals whose primary concern is the colony itself.
INQUIRY QUESTIONS Page 1135 Selection for learning ability would cease, and thus change from one generation to the next in maze learning ability; would only result from random genetic drift.
Page 1136 Normal fosB alleles produce a protein that in turn affects enzymes that affect the brain. Ultimately, these enzymes trigger maternal behavior. In the absence of the enzymes, normal maternal behavior does not occur.
Page 1140 Peter Marler’s experiments addressed this question and determined that both instinct and learning are instrumental in song development in birds. Page 1148 Many factors affect the behavior of an animal other than its attempts to maximize energy intake. For example, avoiding predation is also important. Thus, it may be that larger prey take longer to subdue and ingest, thus making the crabs more vulnerable to predators. Hence, the crabs may trade off decreased energy gain for decreased vulnerability for predators. Many other similar explanations are possible. Page 1150 A question that is the subject of much current research. Ideas include the possibility that males with longer tails are in better condition (because males in poor condition couldn’t survive the disadvantage imposed by the tail). The advantage to a female mating with a male in better condition might be either that the male is less likely to be parasitized, and thus less likely to pass that parasite on to the female, or the male may have better genes, which in turn would be passed on to the offspring. Another possibility is the visual system for some reason is better able to detect males with long tails, and thus long-tailed males are preferred by females simply because the longer tails are more easily detected and responded to. Page 1151 Yes, the larger the male, the larger the prenuptial gift, which provides energy that the female converts into egg production. Page 1158 If more birds are present, then each one can spend less time watching for predators, and thus have more time for foraging.
U N D E R S TA N D 1. b 2. a 3. a 11. c 12. d
4. c
5. a
6. c
7. d
8. a
9. b
10. a
A P P LY 1. Presumably, the model is basic, taking into account only size and energetic value of mussels. However, it may be that larger mussels are in places where shore crabs would be exposed to higher levels of predation or greater physiological stress. Similarly, it could be that the model underestimated time costs or energy returns as a function of mussel size. In the case of large mussels being in a place where shore crabs are exposed to costs not considered by the model, one could test the hypothesis in several ways. First, how are the sizes of mussels distributed in space? If they are completely interspersed that would tend to reject the hypothesis. Alternatively, if the mussels were differentially distributed such that the hypothesis was
A-30
reasonable, mussels could be experimentally relocated (change their distribution in space) and the diets would be expected to shift to match more closely the situation predicted by the model. 2. The four new pairs may have been living in surrounding habitat that was of lower quality, or they may have been individuals that could not compete for a limited number of suitable territories for breeding. Often, the best territories are won by the most aggressive or largest or otherwise best competitors, meaning that the new territory holders would likely have been less fierce competitors. If new residents were weaker competitors (due to aggression or body size), then the birds not removed would have been able to expand their territories to acquire even more critical resources. 3. The key here is that if the tail feathers are a handicap, then by reducing the handicap in these males should enhance their survival compared with males with naturally shorter tail feathers. The logic is simple. If the mail with long tail feathers is superior such that it can survive the negative effect of the long tail feathers, then that superior phenotype should be “exposed” with the removal or reduction of the tail feathers. Various aspects of performance could be measured since it is thought that the tail feathers hinder flying. Can males with shorter tails fly faster? Can males with shorter tails turn better? Ultimately, whether males with shorter tails survive better than males with un-manipulated tails can be measured. 4. Both reciprocity and kin selection explain the evolution of altruistic acts by examining the hidden benefits of the behavior. In both cases, altruism actually benefits the individual performing the act in terms of its fitness effects. If it didn’t, it would be very hard to explain how such behavior could be maintained because actions that reduce the fitness of an individual should be selected against. Definition of the behavior reflects the apparent paradox of the behavior because it focuses on the cost and not the benefit that also accrues to the actor.
SYNTHESIZE 1. The best experiment for determining whether predatory avoidance of certain coloration patterns would involve rearing a predator without an opportunity to learn avoidance and subsequently presenting the predator with prey with different patterns. If the predator avoids the black and yellow coloration more frequently than expected then the avoidance is most likely innate. If the predator does not express any preference but upon injury from a prey with the specific coloration does begin to express a preference, then the avoidance is most likely learned. In this case, the learning would be operant conditioning; the predator has learned to associate the coloration with pain and thus subsequently avoids prey with that coloration. To measure the adaptive significance of black and yellow coloration, both poisonous (or stinging) and harmless prey species with the coloration and without the coloration pattern could be presented to predators; if predators avoid both the harmful and the harmless prey, the coloration is evolutionary significant. 2. In many cases the organisms in question are unavailable for or unrealistic to study in a laboratory setting. Model organisms allow behavioral geneticists to overcome this obstacle by determining general patterns and then applying these patterns and findings to other, similar organisms. The primary disadvantage of the model system is, of course, the vast differences that are usually found between groups of taxa; however, when applying general principles, in particular those of genetic behavioral regulation, the benefits of using a model outweigh the costs. Phylogenetic analysis is the best way to determine the scale of applicability when using model organisms. 3. Extra-pair copulations and mating with males that are outside a female’s territory are, by and large, more beneficial than costly to the female. By mating with males outside her territory, she reduces the likelihood that a male challenging the owner of her territory would target her offspring; males of many species are infanticidal but would not likely attack infants that could be their own. Historical data have actually shown that in many cases, females are more attracted to infanticidal males if those males win territory prior to their infanticidal behavior.
CHAPTER 56 LEARNING OUTCOME QUESTIONS 56.1 It depends upon the type of species in question. Conformers are able to adapt to their environment by adjusting their body temperature and making other physiological adjustments. Over a longer period of time, individuals within a nonconforming species might not adjust to the changing environment but we would expect the population as a whole to adapt due to natural selection.
appendix A
rav32223_appx_A1-A34.indd A-30
12/7/09 5:02:48 PM
56.2 If the populations in question comprised a source-sink metapopulations, then the lack of immigration into the sink populations would, most likely, eventually result in the extinction of those populations. The source populations would likely then increase their geographic ranges. 56.3 It depends upon the initial sizes of the populations in question; a small population with a high survivorship rate will not necessarily grow faster than a large population with a lower survivorship rate. 56.4 A species with high levels of predation would likely exhibit an earlier age at first reproduction and shorter inter-birth intervals in order to maximize its fitness under the selective pressure of the predation. On the other hand, species with few predators have the luxury of waiting until they are more mature before reproducing and can increase the inter-birth interval (and thus invest more in each offspring) because their risk of early mortality is decreased. 56.5 Many different factors might affect the carrying capacity of a population. For example, climate changes, even on a relatively small scale, could have large effects on carrying capacity by altering the available water and vegetation, as well as the phenology and distribution of the vegetation. Regardless of the type of change in the environment, however, most populations will move toward carrying capacity; thus, if the carrying capacity is lowered, the population should decrease, and if the carrying capacity is raised, the population should increase.
Page 1176 The answer depends on whether food is the factor regulating population size. If it is, then the number of young produced at a given population size would increase and the juvenile mortality rate would decrease. However, if other factors, such as the availability of water or predators, regulated population size, then food supplementation might have no effect. Page 1177 If hare population levels were kept high, then we would expect lynx populations to stay high as well because lynx populations respond to food availability. If lynx populations were maintained at a high level, we would expect hare populations to remain low because increased reproduction of hares would lead to increased food for the lynxes. Page 1179 If human populations are regulated by density-dependent factors, then as the population approaches the carrying capacity, either birthrates will decrease or death rates will increase, or both. If populations are regulated by density-independent factors, then if environmental conditions change, then either both rates will decline, death rates will increase, or both. Page 1179 The answer depends on whether age-specific birth and death rates stay unchanged. If they do, then the Swedish distribution would remain about the same. By contrast, because birthrates are far outstripping death rates, the Kenyan distribution will become increasingly unbalanced as the bulge of young individuals enter their reproductive years and start producing even more offspring.
56.6 A given population can experience both positive and negative density-dependent effects, but not at the same time. Negative density-dependent effects, such as low food availability or high predation pressure, would decrease the population size. On the other hand, positive density-dependent effects, such as is seen with the Allee effect, results in a rapid increase in population size. Since a population cannot both increase and decrease at the same time, the two cannot occur concurrently. However, the selective pressures on a population are on a positive-negative continuum, and the forces shaping population size can not only vary in intensity but can also change direction from negative to positive or positive to negative.
Page 1181 Both are important causes and the relative importance of the two depends on which resource we are discussing. One thing is clear: The world cannot support its current population size if everyone lived at the level of resource consumption of people in the United States.
56.7 The two are closely tied together, and both are extremely important if the
1. d
human population is not to exceed the Earth’s carrying capacity. As population growth increases, the human population approaches the planet’s carrying capacity; as consumption increases, the carrying capacity is lowered—thus, both trends must be reversed.
INQUIRY QUESTIONS Page 1164
Very possibly. How fast a lizard runs is a function of its body temperature. Researchers have shown that lizards in shaded habitats have lower temperatures and thus lower maximal running speeds. In such circumstances, lizards often adopt alternative escape tactics that rely less on rapidly running away from potential predators.
Page 1169 Because of their shorter generation times, smaller species tend to reproduce more quickly, and thus would be able to respond more quickly to increased resources in the environment. Page 1171 Based on the survivorship curve of meadow grass, the older the plant, the less likely it is to survive. It would be best to choose a plant that is very young to ensure the longest survival as a house plant. A survivorship curve that is shaped like a Type I curve, in which most individuals survive to an old age and then die would also lead you to select a younger plant. A type III survivorship curve, in which only a few individuals manage to survive to an older age, would suggest the selection of a middle-aged plant that had survived the early stages of life since it would also be more likely to survive to old age. Page 1172 It depends on the situation. If only large individuals are likely to reproduce (as is the case in some territorial species, in which only large males can hold a territory), then a few large offspring would be favored; alternatively, if body size does not affect survival or reproduction, then producing as many offspring as possible would maximize the representation of an individual’s genes in subsequent generations. In many cases, intermediate values are favored by natural selection. Page 1174 Because when the population is below carrying capacity, the population increases in size. As it approaches the carrying capacity, growth rate slows down either from increased death rates, decreased birthrates, or both, becoming zero as the population hits the carrying capacity. Similarly, populations well above the carrying capacity will experience large decreases in growth rate, resulting either from low birthrates or high death rates, that also approach zero as the population hits the carrying capacity. Page 1175 There are many possible reasons. Perhaps resources become limited, so that females are not able to produce as many offspring. Another possibility is that space is limited so that, at higher populations, individuals spend more time in interactions with other individuals and squander energy that otherwise could be invested in producing and raising more young.
U N D E R S TA N D 1. b
2. c
3. a
4. b
3. b
4. c
5. d
6. b
7. c
A P P LY 2. c
SYNTHESIZE 1. The genetic makeup of isolated populations will change over time based on the basic mechanisms of evolutionary change; for example, natural selection, mutation, assortative mating, and drift. These same processes affect the genetic makeup of populations in a metapopulation, but the outcomes are likely to be much more complicated. For example, if immigration between a source and a sink population is very high, then local selection in a sink population may be swamped by the regular flow of individuals carrying alleles of lower fitness from a source population where natural selection may not be acting against those alleles; divergence might be slowed or even stopped under some circumstances. On the other hand, if sinks go through repeated population declines such that they often are made up of a very small number of individuals, then they may lose considerable genetic diversity due to drift. If immigration from source populations is greater than zero but not large, these small populations might begin to diverge substantially from other populations in the metapopulation due to drift. The difference is that in the metapopulation, such populations might actually be able to persist and diverge, rather than just going extinct due to small numbers of individuals and no ability to be rescued by neighboring sources. 2. The probability that an animal lives to the next year should decline with age (Note that in Figure 55.11, all the curves decrease with age) so the cost of reproduction for an old animal would, all else being equal, be lower than for a young animal. The reason is that the cost of reproduction is measured by changes in fitness. Imagine a very old animal that has almost no chance in surviving to another reproductive event; it should spend all its effort on a current reproductive effort since its future success is likely to be zero anyway. 3. If offspring size does not affect offspring quality, then it is in the parent’s interest to produce absolutely as many small offspring as possible. In doing so, it would be maximizing its fitness by increasing the number of related individuals in the next generation. 4. By increasing the mean generation time (increasing the age at which an individual can begin reproducing; age at first reproduction), keeping all else equal, one would expect that the population growth rate would be reduced. That comes simply from the fact of reducing the number of individuals that are producing offspring in the adult age classes; lower population birth rates would lead to a reduced population growth rate. As to which would have a larger influence, that is hard to say. If the change in generation time (increased age at first reproduction) had an overall larger effect on the total number of offspring an individual female had than a reduced fecundity at any age, then population growth rate would probably be more sensitive to the
appendix A
rav32223_appx_A1-A34.indd A-31
A-31
12/7/09 5:02:49 PM
change in generation time. Under different scenarios, the comparison of these two effects could become more complicated, however. Suffice it to say that population growth control can come from more than one source: fecundity and age at first reproduction.
CHAPTER 57 LEARNING OUTCOME QUESTIONS 57.1 The answer depends upon the habitat of the community in question. Some habitats are more hospitable to animals, and others to plants. The abundance of plants and animals in most habitats is also closely tied; thus the variation in abundance of one would affect the variation in abundance of the other. 57.2 It depends upon whether we are talking about fundamental niche or realized niche. Two species can certainly have identical fundamental niches and coexist indefinitely, because they could develop different realized niches within the fundamental niche. In order for two species with identical realized niches to coexist indefinitely, the resources within the niche must not be limited. 57.3 This is an example of Batesian mimicry, in which a non-poisonous species evolves coloration similar to a poisonous species. 57.4 In an ecosystem with limited resources and multiple prey species, one prey species could out-compete another to extinction in the absence of a predator. In the presence of the predator, however, the prey species that would have otherwise be driven to extinction by competitive exclusion is able to persist in the community. The predators that lower the likelihood of competitive exclusion are known as keystone predators. 57.5 Selective harvesting of individual trees would be preferable from a community point of view. According to the Intermediate Disturbance Hypothesis, moderate degrees of disturbance, as in selective harvesting, increase species richness and biodiversity more than severe disturbances, such as clear-cutting.
INQUIRY QUESTIONS Page 1187 The different soil types require very different adaptations, and thus different species are adapted to each soil type.
Page 1191 The kangaroo rats competed with all the other rodent species for resources, keeping the size of other rodent populations smaller. In the absence of competition when the kangaroo rats were removed, there were more resources available which allowed the other rodent populations to increase in size.
doesn’t taste as good or is harder to catch, simply because it is still provides a better return than chasing after a very rare preferred species. While the predator has switched, there might be enough time for the preferred species to rebound. All of these dynamics will depend upon the time it takes a predator to reduce the population size of its prey relative to the time it takes for those prey populations to rebound once the predator pressure is removed. 3. Although the mechanism might be known in this system, hidden interactions might affect interpretations in many ways because ecological systems are complex. For example, what if some other activity of the rodents besides their reduction of large seeds leading to an increase in the number of small seeds was responsible for the positive effect of rodents on ants? One way to test the specific mechanism would be to increase the abundance of small seeds experimentally independent of any manipulation of rodents. Under the current hypothesis, an increase in ant population size would be expected and should be sustained, unlike the initial increase followed by a decrease seen when rodents are removed. 4. By itself, the pattern shown in Figure 56.7 suggests character displacement, but alternative hypotheses are possible. For example, what if the distribution of seeds available on the two islands where the species are found alone is different from that seen where they are found in sympatry? If there were no large and small seeds seen on Los Hermanos or Daphne, just medium-sized ones, then it would be hard to conclude that the bill size on San Cristobal has diverged relative to the other islands just due to competition. This is a general criticism of inferring the process of character displacement with just comparing the size distributions in allopatry and sympatry. In this case, however, the Galápagos system has been very well studied. It has been established that the size distribution of seeds available is not measurably different. Furthermore, natural selection-induced changes seen in the bill size of birds on a single island, in response to drought-induced changes in seed size lend further support to the role of competition in establishing and maintaining these patterns. 5. It is possible, as the definition of an ecosystem depends upon scale. In some ecosystems, there may be other, smaller ecosystems operating within it. For example, within a rainforest ecosystem, there are small aquatic ecosystems, ecosystems within the soil, ecosystems upon an individual tree. Research seems to indicate that most species behave individualistically, but there are some instances where groups of species do depend upon one another and do function holistically. We would expect this kind of dual community structure especially in areas of overlap between distinct ecosystems, where ecotones exist.
Page 1192 This could be accomplished in a variety of ways. One option would be to provide refuges to give some Paramecium a way of escaping the predators. Another option would be to include predators of the Didinium, which would limit their populations (see Ecosystem chapter).
CHAPTER 58
Page 1201 By removing the kangaroo rats from the experimental enclosures
58.1 Yes, fertilization with natural materials such as manure is less disruptive to
and measuring the effects on both plants and ants. At first, the number of small seeds available to ants increases due to the absence of rodents. However, over time, plants that produce large seeds outcompete plants that produce small seeds, and thus fewer small seeds are produced and available to ants; hence, ant populations decline.
U N D E R S TA N D 1. a
2. a
3. d
4. a
5. b
3. d
4. d
5. d
6. d
7. c
8. c
A P P LY 1. d
2. b
SYNTHESIZE
LEARNING OUTCOME QUESTIONS the ecosystem than is chemical fertilization. Many chemical fertilizers, for example, contain higher levels of phosphates than does manure and thus chemical fertilization has disrupted the natural global phosphorus cycle.
58.2 Both matter and energy flow through ecosystems by changing form, but neither can be created or destroyed. Both matter and energy also flow through the trophic levels within an ecosystem. The flow of matter such as carbon atoms is more complex and multi-leveled than is energy flow, largely because it is truly a cycle. The atoms in the carbon cycle truly cycle through the ecosystem, with no clear beginning or end. The carbon is changed during the process of cycling from a solid to a gaseous state and back again. On the other hand, energy flow is unidirectional. The ultimate source of the energy in an ecosystem is the sun. The solar energy is captured by the primary producers at the first trophic level and is changed in form from solar to chemical energy. The chemical energy is transferred from one trophic level to another, until only heat, low quality energy, remains.
1. Experiments are useful means to test hypotheses about ecological limitations, but they are generally limited to rapidly reproducing species that occur in relatively small areas. Alternative means of studying species’ interactions include detailed studies of the mechanisms by which species might interact; sometimes, for long-lived species, instead of monitoring changes in population size, which may take a very long time, other indices can be measured, such as growth or reproductive rate. Another means of assessing interspecific interactions is to study one species in different areas, in only some of which a second species occurs. Such studies must be interpreted cautiously, however, because there may be many important differences between the areas in addition to the difference in the presence or absence of the second species.
58.4 It depends on whether the amount of sunlight captured by the primary producers was affected. Currently, only approximately 1% of the solar energy in Earth’s atmosphere is captured by primary producers for photosynthesis. If less sunlight reached Earth’s surface, but a correlating increase in energy capture accompanied the decrease in sunlight, then the primary productivity should not be affected.
2. Adding differentially preferred prey species might have the same effect as putting in a refuge for prey in the single species system. One way to think about it is that if a highly preferred species becomes rare due to removal by the predator, then a predator might switch to a less desirable species, even if it
58.5 The equilibrium model of island biogeography describes the relationship between species richness and not only island size but also distance from the mainland. A small island closer to the mainland would be expected to have more species than would a larger island that is farther from the mainland.
A-32
58.3 Yes, there are certainly situations in ecosystems in which the top predators in one trophic chain affect the lower trophic levels, while within the same ecosystem the primary producers affect the higher trophic levels within another trophic chain.
appendix A
rav32223_appx_A1-A34.indd A-32
12/7/09 5:02:49 PM
things. Therefore, increasing complexity might increase the ability of lizards to partition the habitat in more ways, allow more species to escape their predators or seek refuge from harsh physical factors (such as, cold or hot temperatures), provide a greater substrate for potential prey in terms of food resources, for instance. If we want to know the exact mechanisms for the relationship, we would need to conduct experiments to test specific hypotheses. For example, if we hypothesize that some species that require greater structural complexity in order to persist in a particular habitat, we could modify the habitat (reduce plant structure) and test whether species originally present were reduced in numbers or became unable to persist.
INQUIRY QUESTIONS Page 1218
At each link in the food chain, only a small fraction of the energy at one level is converted into mass of organisms at the next level. Much energy is dissipated as heat or excreted.
Page 1219 In the inverted pyramid, the primary producers reproduce quickly and are eaten quickly, so that at any given time, a small population of primary producers exist relative to the heterotroph population. Page 1220 Because the trout eat the invertebrates which graze the algae. With fewer grazers, there is more algae. Page 1220 The snakes might reduce the number of fish, which would allow an increase in damselflies, which would reduce the number of chironomids and increase the algae. In other words, lower levels of the food chain would be identical for the “snake and fish” and “no fish and no snake” treatments. Both would differ from the enclosures with only fish. Page 1222 Herbivores consume much of the algal biomass even as primary productivity increases. Increases in primary productivity can lead to increased herbivore populations. The additional herbivores crop the biomass of the algae even while primary productivity increases. Page 1222 More light means more photosynthesis. More plant material means more herbivores, which translates into more predator biomass. Page 1223 Introduce them yourself. For example, each spring, you could place a premeasured number of seeds of a particular invasive species in each plot. Such an experiment would have the advantage of more precisely controlling the opportunity for invasion, but also would be less natural, which is one of the advantages of the Cedar Creek study site: the plots are real ecosystems, interacting with their surrounding environment in natural ways.
CHAPTER 59 LEARNING OUTCOME QUESTIONS 59.1 If the Earth rotated in the opposite direction, the Coriolis Effect would be reversed. In other words, winds descending between 30° north or 30° south and the equator would still be moving more slowly than the underlying surface so it would be deflected; however, they would be deflected to the left in the northern hemisphere and to the right in the southern hemisphere. The pattern would be reversed between 30° and 60° because the winds would be moving more rapidly than the underlying surface, and would thus be deflected again in the opposite directions from normal—to the left in the northern hemisphere and to the right in the southern hemisphere. All of this would result in Trade Winds that blew from west to east and “Westerlies” that were actually “Easterlies,” blowing east to west.
59.2 As with elevation, latitude is a primary determinant of climate and precipitation, which together largely determine the vegetational structure of a particular area, which in turn defines biomes.
Page 1224 (a) Perhaps because an intermediate number of predators is enough to keep numbers of superior competitors down. (b) Perhaps because there are more habitats available and thus more different ways of surviving in the environment. (c) Hard to say. Possibly more stable environments permit greater specialization, thus permitting coexistence of more species.
59.3 The spring and fall overturns that occur in freshwater lakes found in temperate climates result in the oxygen-poor water near the bottom of the lake getting re-mixed with the oxygen-rich water near the top of the lake, essentially eliminating, at least temporarily, the thermocline layer. In the tropics, there is less temperature fluctuation; thus the thermocline layer is more permanent and the oxygen depletion (and resulting paucity of animal life) is sustained.
U N D E R S TA N D
59.4 Regions affected by the ENSO, or El Niño Southern Oscillation events, experience cyclical warming events in the waters around the coastline. The warmed water lowers the primary productivity, which stresses and subsequently decreases the populations of fish, seabirds, and sea mammals.
1. d
2. d
3. b
4. a
3. d
4. d
5. a
6. b
7. a
8. a
9. c
A P P LY 1. d
2. a
SYNTHESIZE 1. Because the length of food chains appears to be ultimately limited by the amount of energy entering a system, and the characteristic loss of usable energy (about 90%) as energy is transferred to each higher level, it would be reasonable to expect that the ectotherm-dominated food chains would be longer than the endotherm-dominated chains. In fact, there is some indirect evidence for this from real food chains, and it is also predicted by some advanced ecological models. However, whether in reality such is the case, is difficult to determine due to all of the complex factors that determine food chain length and structure. Moreover, there are many practical difficulties associated with measuring actual food chain length in natural systems. 2. It is critical to distinguish, as this chapter points out, between energy and mass transfer in trophic dynamics of ecosystems. The standing biomass of phytoplankton is not necessarily a reliable measure of the energy contained in the trophic level. If phytoplankton are eaten as quickly as they are produced, they may contribute a tremendous amount of energy, which can never be directly measured by a static biomass sample. The standing crop therefore, is an incomplete measure of the productivity of the trophic level. 3. As Figure 58.17 suggests, trophic structure and dynamics are interrelated and are primary determinants of ecosystem characteristics and behavior. For example, if a particularly abundant herbivore is threatened, energy that is abundant at the level of primary productivity in an ecosystem may be relatively unavailable to higher trophic levels (e.g., carnivores). That is, the herbivores are an important link in transducing energy through an ecosystem. Cascading effects, whether they are driven from the bottom up or from the top down are a characteristic of energy transfer in ecosystems, and that translates into the reality that effects on any particular species are unlikely to be limited to that species itself. 4. There are many ways to answer this question, but the obvious place to start is to think about the many ways plant structural diversity potentially affects animals that are not eating the plants directly. For example, plants may provide shelter, refuges, food for prey, substrate for nesting, among other
59.5 CFCs, or chlorofluorocarbons, are an example of point-source pollution. CFCs and other types of point-source pollutants are, in general, easier to combat because their sources are more easily identified and thus the pollutants more easily eliminated. 59.6 Global climate change and ozone depletion may be interconnected. However, while climate change and ozone depletion are both global environmental concerns due to the impact each has on human health, the environment, economics, and politics, there are some different approaches to combating and understanding each dilemma. Ozone depletion results in an increase in the ultraviolet radiation reaching the earth’s surface. Global climate change, on the other hand, results in long-term changes in sea level, ice flow, and storm activity.
INQUIRY QUESTIONS Page 1232
Because of the tilt of the Earth’s axis and the spherical shape of the planet, the light (and heat) from the sun hits the equator and nearby latitudes more directly than it does at the poles.
Page 1236 Increased precipitation and temperature allows for the sustainability of a larger variety and biomass of vegetation, and primary productivity is a measure of the rate at which plants convert solar energy into chemical energy.
U N D E R S TA N D 1. d
2. b
3. a
4. c
3. c
4. b
5. c
6. c
7. a
8. c
A P P LY 1. d
2. b
SYNTHESIZE 1. The Earth is tilted on its axis such that regions away from the equator receive less incident solar radiation per unit surface area (because the angle of incidence is oblique). The northern and southern hemispheres alternate between angling towards vs. away from the Sun on the Earth’s annual orbit. These two facts mean that the annual mean temperature will decline as you move away from the equator, and that variation in the mean temperatures of
appendix A
rav32223_appx_A1-A34.indd A-33
A-33
12/7/09 5:02:49 PM
the northern and southern hemispheres will be complementary to each other; when one is hot, the other will be cold. 2. Energy absorbed by the Earth is maximized at the equator because of the angle of incidence. Because there are large expanses of ocean at the equator, warmed air picks up moisture and rises. As it rises, equatorial air, now saturated with moisture, cools and releases rain, the air falling back to Earth’s surface displaced north and south to approximately 30°. The air, warming as it descends, absorbs moisture from the land and vegetation below, resulting in desiccation in the latitudes around 30°. 3. Even though there have been global climate changes in the past, conservation biologists are concerned about the current warming trend for two reasons. First, the warming rate is rapid, thus the selective pressures on the most vulnerable organisms may be too strong for the species to adapt. Second, the natural areas that covered most of the globe during past climatic changes are now in much more limited, restricted areas, thus greatly impeding the ability of organisms to migrate to more suitable habitats. 4. Two characteristics can lead to a phenomenon known as biological magnification. First, if a pesticide actually persists in the bodies of target species (that is, it doesn’t degrade after having its effect), then depending on its chemical composition, it might actually be sequestered in the bodies of animals that eat the target species. Because large numbers of prey are consumed at each trophic level (due to the 10% rate of transfer of energy), large amounts of the pesticide may be passed up the food chain. So, persistence and magnification can lead to toxic exposures at the top of food chains.
CHAPTER 60 LEARNING OUTCOME QUESTIONS 60.1 Unfortunately, most of the Earth’s biodiversity hotspots are also areas of the greatest human population growth; human population growth is accompanied by increased resource utilization and exploitation.
60.2 I would tell the shrimp farmers that if they were to shut down the shrimp farm and remediate the natural mangrove swamp on which their property sits, other, more economically lucrative businesses could be developed, such as timber, charcoal production, and offshore fishing. 60.3 Absolutely. The hope of conservation biologists is that even if a species is endangered to the brink of extinction due to habitat degradation, the habitat may someday be restored. The endangered species can be bred in captivity (which also allows for the maintenance of genetic diversity within the species) and either reintroduced to a restored habitat, or even introduced to another suitable habitat. 60.4 It depends upon the reason for the degradation of the habitat in the first place, but yes, in some cases, habitat restoration can approach a pristine state. For example, the Nashau River in New England was heavily polluted, but habitat restoration efforts returned it to a relatively pristine state. However, because habitat degradation affects so many species within the ecosystem, and the depth and complexity of the trophic relationships within the ecosystem are difficult if not impossible to fully understand, restoration is rarely if ever truly pristine.
INQUIRY QUESTIONS Page 1260 Many factors affect human population trends, including resource availability, governmental support for settlement in new areas or for protecting natural areas, and the extent to which governments attempt to manage population growth.
Page 1262 The mangroves provide many economic services. For example, without them, fisheries become less productive and storm damage increases. However, because the people who benefit from these services do not own the mangroves, governmental action is needed to ensure that the value of what are economists call “common goods” is protected. Page 1266 On smaller islands, populations tend to be smaller. As we discuss later in this chapter, small populations are vulnerable to many problems, which individually or in concert can heighten the risk of extinction. Page 1269 As discussed in this chapter, populations that are small face many problems that can reinforce one another and eventually cause extinction. Page 1274 As we discussed in chapter 21, allele frequencies change randomly in a process called genetic drift. The smaller the population size, the greater these random fluctuations will be. Thus, small populations are particularly prone to one allele being lost from a population due to these random changes.
A-34
U N D E R S TA N D 1. a
2. c
3. d
4. d
3. a
4. d
5. b
6. c
A P P LY 1. d
2. d
SYNTHESIZE 1. Although it is true that extinction is a natural part of the existence of a species, several pieces of evidence suggest that current rates of extinction are much elevated over the natural background level and the disappearance is associated with human activities (which many of the most pronounced extinction events in the history of the Earth were not). It is important to appreciate the length of time over which the estimate of 99% is made. The history of life on Earth extends back billions of years. Certainly, clear patterns of the emergence and extinction of species in the fossil record extend back many hundreds of millions of years. Since the average time of species’ existence is short relative to the great expanse of time over which we can estimate the percentage of species that have disappeared, the perception might be that extinction rates have always been high, when in fact the high number is driven by the great expanse of time of measurement. We have very good evidence that modern extinction rates (over human history) are considerably elevated above background levels. Furthermore, the circumstances of the extinctions may be very different because they are also associated with habitat and resource removal; thus potentially limiting the natural processes that replace extinct species. 2. The problem is not unique and not new. It represents a classic conflict that is the basic source of societal laws and regulations, especially in the management of resources. For example, whether or not to place air pollution scrubbers on the smoke stacks of coal-fired power plants is precisely the same issue. In this case, it is not ecosystem conversion, per se, but the fact that the businesses that run the power plants benefit from their operation, but the public “owns” and relies on the atmosphere is a conflict between public and private interests. Some of the ways to navigate the dilemma is for society to create regulations to protect the public interest. The problem is difficult and clearly does not depend solely on economic valuation of the costs and benefits because there can be considerable debate about those estimates. One only has to look at the global climate change problem to suggest how hard it will be to make progress in an expedient manner. 3. This is not a trivial undertaking, which is why, since the first concerns were raised in the late 1980s, it has taken nearly 15 years to collect evidence showing a decline is likely. Although progress has been made on identifying potential causes, much work remains to be done. Many amphibians are secretive, relatively long-lived, and subject to extreme population fluctuations. Given those facts about their biology, documenting population fluctuations (conducting censuses of the number of individuals in populations) for long periods of time is the only way to ultimately establish the likely fate of populations, and that process is time-consuming and costly. 4. Within an ecosystem, every species is dependent upon and depended upon by any number of other species. Even the smallest organisms, bacteria, are often specific about the species they feed upon, live within, parasitize, etc. So, the extinction of a single species anywhere in the ecosystem will affect not only the organisms it directly feeds upon and that directly feed upon it, but also those related more distantly. In the simplest terms, if, for example, a species of rodent goes extinct, the insects and vegetation upon which it feeds would no longer be under the same predation pressure and thus could grow out of control, outcompeting other species and leading to their demise. In addition, the predators of the rodent would have to find other prey, which would result in competition with those species’ predators. And so on, and so on. The affects could be catastrophic to the entire ecosystem. By looking at the trophic chains in which a particular organism is involved, one could predict the affects its extinction would have on other species. 5. Population size is not necessarily a direct cause of extinction, but it certainly is an indirect cause. Smaller populations have a number of problems that themselves can lead directly to extinction, such as loss of diversity (and thus increased susceptibility to pathogens) and greater vulnerability to natural catastrophes.
appendix A
rav32223_appx_A1-A34.indd A-34
12/7/09 5:02:49 PM
Glossary
A ABO blood group A set of four phenotypes produced by different combinations of three alleles at a single locus; blood types are A, B, AB, and O, depending on which alleles are expressed as antigens on the red blood cell surface. abscission In vascular plants, the dropping of leaves, flowers, fruits, or stems at the end of the growing season, as the result of the formation of a layer of specialized cells (the abscission zone) and the action of a hormone (ethylene). absorption spectrum The relationship of absorbance vs. wavelength for a pigment molecule. This indicates which wavelengths are absorbed maximally by a pigment. For example, chlorophyll a absorbs most strongly in the violetblue and red regions of the visible light spectrum. acceptor stem The 3 end of a tRNA molecule; the portion that amino acids become attached to during the tRNA charging reaction. accessory pigment A secondary light-absorbing pigment used in photosynthesis, including chlorophyll b and the carotenoids, that complement the absorption spectrum of chlorophyll a. aceolomate An animal, such as a flatworm, having a body plan that has no body cavity; the space between mesoderm and endoderm is filled with cells and organic materials. acetyl-CoA The product of the transition reaction between glycolysis and the Krebs cycle. Pyruvate is oxidized to acetyl-CoA by NAD+, also producing CO2, and NADH. achiasmate segregation The lining up and subsequent separation of homologues during meiosis I without the formation of chiasmata between homologues; found in Drosophila males and some other species. acid Any substance that dissociates in water to increase the hydrogen ion (H+) concentration and thus lower the pH. actin One of the two major proteins that make up vertebrate muscle; the other is myosin. action potential A transient, all-or-none reversal of the electric potential across a membrane; in neurons, an action potential initiates transmission of a nerve impulse. action spectrum A measure of the efficiency of different wavelengths of light for photosynthesis. In plants it corresponds to the absorption spectrum of chlorophylls. activation energy The energy that must be processed by a molecule in order for it to undergo a specific chemical reaction. active site The region of an enzyme surface to which a specific set of substrates binds, lowering the activation energy required for a particular chemical reaction and so facilitating it.
active transport The pumping of individual ions or other molecules across a cellular membrane from a region of lower concentration to one of higher concentration (i.e., against a concentration gradient); this transport process requires energy, which is typically supplied by the expenditure of ATP. adaptation A peculiarity of structure, physiology, or behavior that promotes the likelihood of an organism’s survival and reproduction in a particular environment. adapter protein Any of a class of proteins that acts as a link between a receptor and other proteins to initiate signal transduction. adaptive radiation The evolution of several divergent forms from a primitive and unspecialized ancestor. adenosine triphosphate (ATP) A nucleotide consisting of adenine, ribose sugar, and three phosphate groups; ATP is the energy currency of cellular metabolism in all organisms. adherins junction An anchoring junction that connects the actin filaments of one cell with those of adjacent cells or with the extracellular matrix. ATP synthase The enzyme responsible for producing ATP in oxidative phosphorylation; it uses the energy from a proton gradient to catalyze the reaction ADP + Pi → ATP. adenylyl cyclase An enzyme that produces large amounts of cAMP from ATP; the cAMP acts as a second messenger in a target cell. adhesion The tendency of water to cling to other polar compounds due to hydrogen bonding. adipose cells Fat cells, found in loose connective tissue, usually in large groups that form adipose tissue. Each adipose cell can store a droplet of fat (triacylglyceride). adventitious Referring to a structure arising from an unusual place, such as stems from roots or roots from stems. aerenchyma In plants, loose parenchymal tissue with large air spaces in it; often found in plants that grow in water. aerobic Requiring free oxygen; any biological process that can occur in the presence of gaseous oxygen. aerobic respiration The process that results in the complete oxidation of glucose using oxygen as the final electron acceptor. Oxygen acts as the final electron acceptor for an electron transport chain that produces a proton gradient for the chemiosmotic synthesis of ATP. aleurone In plants, the outer layer of the endosperm in a seed; on germination, the aleurone produces α-amylase that breaks down the carbohydrates of the endosperm to nourish the embryo. alga, pl. algae A unicellular or simple multicellular photosynthetic organism lacking multicellular sex organs.
allantois A membrane of the amniotic egg that functions in respiration and excretion in birds and reptiles and plays an important role in the development of the placenta in most mammals. allele One of two or more alternative states of a gene. allele frequency A measure of the occurrence of an allele in a population, expressed as proportion of the entire population, for example, an occurrence of 0.84 (84%). allometric growth A pattern of growth in which different components grow at different rates. allelopathy The release of a substance from the roots of one plant that block the germination of nearby seeds or inhibits the growth of a neighboring plant. allopatric speciation The differentiation of geographically isolated populations into distinct species. allopolyploid A polyploid organism that contains the genomes of two or more different species. allosteric activator A substance that binds to an enzyme’s allosteric site and keeps the enzyme in its active configuration. allosteric inhibitor A noncompetitive inhibitor that binds to an enzyme’s allosteric site and prevents the enzyme from changing to its active configuration. allosteric site A part of an enzyme, away from its active site, that serves as an on/off switch for the function of the enzyme. alpha (α) helix A form of secondary structure in proteins where the polypeptide chain is wound into a spiral due to interactions between amino and carboxyl groups in the peptide backbone. alternation of generations A reproductive cycle in which a haploid (n) phase (the gametophyte), gives rise to gametes, which, after fusion to form a zygote, germinate to produce a diploid (2n) phase (the sporophyte). Spores produced by meiotic division from the sporophyte give rise to new gametophytes, completing the cycle. alternative splicing In eukaryotes, the production of different mRNAs from a single primary transcript by including different sets of exons. altruism Self-sacrifice for the benefit of others; in formal terms, the behavior that increases the fitness of the recipient while reducing the fitness of the altruistic individual. alveolus, pl. alveoli One of many small, thinwalled air sacs within the lungs in which the bronchioles terminate. amino acid The subunit structure from which proteins are produced, consisting of a central carbon atom with a carboxyl group (– COOH), an amino group (– NH2), a hydrogen, and a side group (R group); only the side group differs from one amino acid to another.
G-1
rav32223_gloss_G1-G24.indd G-1
11/20/09 3:51:58 PM
aminoacyl-tRNA synthetase Any of a group of enzymes that attach specific amino acids to the correct tRNA during the tRNA-charging reaction. Each of the 20 amino acids has a corresponding enzyme. amniocentesis Indirect examination of a fetus by tests on cell cultures grown from fetal cells obtained from a sample of the amniotic fluid or tests on the fluid itself. amnion The innermost of the extraembryonic membranes; the amnion forms a fluid-filled sac around the embryo in amniotic eggs. amniote A vertebrate that produces an egg surrounded by four membranes, one of which is the amnion; amniote groups are the reptiles, birds, and mammals. amniotic egg An egg that is isolated and protected from the environment by a more or less impervious shell during the period of its development and that is completely selfsufficient, requiring only oxygen. ampulla In echinoderms, a muscular sac at the base of a tube foot that contracts to extend the tube foot. amyloplast A plant organelle called a plastid that specializes in storing starch. anabolism The biosynthetic or constructive part of metabolism; those chemical reactions involved in biosynthesis. anaerobic Any process that can occur without oxygen, such as anaerobic fermentation or H2S photosynthesis. anaerobic respiration The use of electron transport to generate a proton gradient for chemiosmotic synthesis of ATP using a final electron acceptor other than oxygen. analogous Structures that are similar in function but different in evolutionary origin, such as the wing of a bat and the wing of a butterfly. anaphase In mitosis and meiosis II, the stage initiated by the separation of sister chromatids, during which the daughter chromosomes move to opposite poles of the cell; in meiosis I, marked by separation of replicated homologous chromosomes. anaphase-promoting complex (APC) A protein complex that triggers anaphase; it initiates a series of reactions that ultimately degrades cohesin, the protein complex that holds the sister chromatids together. The sister chromatids are then released and move toward opposite poles in the cell. anchoring junction A type of cell junction that mechanically attaches the cytoskeleton of a cell to the cytoskeletons of adjacent cells or to the extracellular matrix. androecium The floral whorl that comprises the stamens. aneuploidy The condition in an organism whose cells have lost or gained a chromosome; Down syndrome, which results from an extra copy of human chromosome 21, is an example of aneuploidy in humans. angiosperms The flowering plants, one of five phyla of seed plants. In angiosperms, the ovules at the time of pollination are completely enclosed by tissues. animal pole In fish and other aquatic vertebrates with asymmetrical yolk distribution in their eggs, the hemisphere of the blastula comprising cells relatively poor in yolk.
G-2
anion A negatively charged ion. annotation In genomics, the process of identifying and making note of “landmarks” in a DNA sequence to assist with recognition of coding and transcribed regions. anonymous markers Genetic markers in a genome that do not cause a detectable phenotype, but that can be detected using molecular techniques. antenna complex A complex of hundreds of pigment molecules in a photosystem that collects photons and feeds the light energy to a reaction center. anther In angiosperm flowers, the pollen-bearing portion of a stamen. antheridium, pl. antheridia A sperm-producing organ. anthropoid Any member of the mammalian group consisting of monkeys, apes, and humans. antibody A protein called immunoglobulin that is produced by lymphocytes in response to a foreign substance (antigen) and released into the bloodstream. anticodon The three-nucleotide sequence at the end of a transfer RNA molecule that is complementary to, and base-pairs with, an amino-acid–specifying codon in messenger RNA. antigen A foreign substance, usually a protein or polysaccharide, that stimulates an immune response. antiporter A carrier protein in a cell’s membrane that transports two molecules in opposite directions across the membrane. anus The terminal opening of the gut; the solid residues of digestion are eliminated through the anus. aorta (Gr. aeirein, to lift) The major artery of vertebrate systemic blood circulation; in mammals, carries oxygenated blood away from the heart to all regions of the body except the lungs. apical meristem In vascular plants, the growing point at the tip of the root or stem. apoplast route In plant roots, the pathway for movement of water and minerals that leads through cell walls and between cells. apoptosis A process of programmed cell death, in which dying cells shrivel and shrink; used in all animal cell development to produce planned and orderly elimination of cells not destined to be present in the final tissue. aposematic coloration An ecological strategy of some organisms that “advertise” their poisonous nature by the use of bright colors. aquaporin A membrane channel that allows water to cross the membrane more easily than by diffusion through the membrane. aquifers Permeable, saturated, underground layers of rock, sand, and gravel, which serve as reservoirs for groundwater. archegonium, pl. archegonia The multicellular egg-producing organ in bryophytes and some vascular plants. archenteron The principal cavity of a vertebrate embryo in the gastrula stage; lined with endoderm, it opens up to the outside and represents the future digestive cavity. arteriole A smaller artery, leading from the arteries to the capillaries. artificial selection Change in the genetic structure of populations due to selective breeding by humans. Many domestic animal breeds and crop varieties have been produced through artificial selection.
ascomycetes A large group comprising part of the “true fungi.” They are characterized by separate hyphae, asexually produced conidiospores, and sexually produced ascospores within asci. ascus, pl. asci A specialized cell, characteristic of the ascomycetes, in which two haploid nuclei fuse to produce a zygote that divides immediately by meiosis; at maturity, an ascus contains ascospores. asexual reproduction The process by which an individual inherits all of its chromosomes from a single parent, thus being genetically identical to that parent; cell division is by mitosis only. A site In a ribosome, the aminoacyl site, which binds to the tRNA carrying the next amino acid to be added to a polypeptide chain. assembly The phase of a virus’s reproductive cycle during which the newly made components are assembled into viral particles. assortative mating A type of nonrandom mating in which phenotypically similar individuals mate more frequently. aster In animal cell mitosis, a radial array of microtubules extending from the centrioles toward the plasma membrane, possibly serving to brace the centrioles for retraction of the spindle. atom The smallest unit of an element that contains all the characteristics of that element. Atoms are the building blocks of matter. atrial peptide Any of a group of small polypeptide hormones that may be useful in treatment of high blood pressure and kidney failure; produced by cells in the atria of the heart. atrioventricular (AV) node A slender connection of cardiac muscle cells that receives the heartbeat impulses from the sinoatrial node and conducts them by way of the bundle of His. atrium An antechamber; in the heart, a thin-walled chamber that receives venous blood and passes it on to the thick-walled ventricle; in the ear, the tympanic cavity. autonomic nervous system The involuntary neurons and ganglia of the peripheral nervous system of vertebrates; regulates the heart, glands, visceral organs, and smooth muscle. autopolyploid A polyploid organism that contains a duplicated genome of the same species; may result from a meiotic error. autosome Any eukaryotic chromosome that is not a sex chromosome; autosomes are present in the same number and kind in both males and females of the species. autotroph An organism able to build all the complex organic molecules that it requires as its own food source, using only simple inorganic compounds. auxin (Gr. auxein, to increase) A plant hormone that controls cell elongation, among other effects. auxotroph A mutation, or the organism that carries it, that affects a biochemical pathway causing a nutritional requirement. avirulent pathogen Any type of normally pathogenic organism or virus that utilizes host resources but does not cause extensive damage or death. axil In plants, the angle between a leaf’s petiole and the stem to which it is attached. axillary bud In plants, a bud found in the axil of a stem and leaf; an axillary bud may develop into a new shoot or may become a flower. axon A process extending out from a neuron that conducts impulses away from the cell body.
glossary
rav32223_gloss_G1-G24.indd G-2
11/20/09 3:51:58 PM
B
b6–f complex See cytochrome b6–f complex. bacteriophage A virus that infects bacterial cells; also called a phage. Barr body A deeply staining structure, seen in the interphase nucleus of a cell of an individual with more than one X chromosome, that is a condensed and inactivated X. Only one X remains active in each cell after early embryogenesis. basal body A self-reproducing, cylindrical, cytoplasmic organelle composed of nine triplets of microtubules from which the flagella or cilia arise. base Any substance that dissociates in water to absorb and therefore decrease the hydrogen ion (H+) concentration and thus raise the pH. base-pair A complementary pair of nucleotide bases, consisting of a purine and a pyrimidine. basidium, pl. basidia A specialized reproductive cell of the basidiomycetes, often club-shaped, in which nuclear fusion and meiosis occur. basophil A leukocyte containing granules that rupture and release chemicals that enhance the inflammatory response. Important in causing allergic responses. Batesian mimicry A survival strategy in which a palatable or nontoxic organism resembles another kind of organism that is distasteful or toxic. Both species exhibit warning coloration. B cell A type of lymphocyte that, when confronted with a suitable antigen, is capable of secreting a specific antibody protein. behavioral ecology The study of how natural selection shapes behavior. biennial A plant that normally requires two growing seasons to complete its life cycle. Biennials flower in the second year of their lives. bilateral symmetry A single plane divides an organism into two structural halves that are mirror images of each other. bile salts A solution of organic salts that is secreted by the vertebrate liver and temporarily stored in the gallbladder; emulsifies fats in the small intestine. binary fission Asexual reproduction by division of one cell or body into two equal or nearly equal parts. binomial distribution The distribution of phenotypes seen among the progeny of a cross in which there are only two alternative alleles. binomial name The scientific name of a species that consists of two parts, the genus name and the specific species name, for example, Apis mellifera. biochemical pathway A sequence of chemical reactions in which the product of one reaction becomes the substrate of the next reaction. The Krebs cycle is a biochemical pathway. biodiversity The number of species and their range of behavioral, ecological, physiological, and other adaptations, in an area. bioenergetics The analysis of how energy powers the activities of living systems. biofilm A complex bacterial community comprising different species; plaque on teeth is a biofilm. biogeography The study of the geographic distribution of species.
biological community All the populations of different species living together in one place; for example, all populations that inhabit a mountain meadow. biological species concept (BSC) The concept that defines species as groups of populations that have the potential to interbreed and that are reproductively isolated from other groups. biomass The total mass of all the living organisms in a given population, area, or other unit being measured. biome One of the major terrestrial ecosystems, characterized by climatic and soil conditions; the largest ecological unit. bipolar cell A specialized type of neuron connecting cone cells to ganglion cells in the visual system. Bipolar cells receive a hyperpolarized stimulus from the cone cell and then transmit a depolarization stimulus to the ganglion cell. biramous Two-branched; describes the appendages of crustaceans. blade The broad, expanded part of a leaf; also called the lamina. blastocoel The central cavity of the blastula stage of vertebrate embryos. blastodisc In the development of birds, a disclike area on the surface of a large, yolky egg that undergoes cleavage and gives rise to the embryo. blastomere One of the cells of a blastula. blastopore In vertebrate development, the opening that connects the archenteron cavity of a gastrula stage embryo with the outside. blastula In vertebrates, an early embryonic stage consisting of a hollow, fluid-filled ball of cells one layer thick; a vertebrate embryo after cleavage and before gastrulation. Bohr effect The release of oxygen by hemoglobin molecules in response to elevated ambient levels of CO2. bottleneck effect A loss of genetic variability that occurs when a population is reduced drastically in size. Bowman’s capsule In the vertebrate kidney, the bulbous unit of the nephron, which surrounds the glomerulus. β-oxidation The oxygen-dependent reactions where 2-carbon units of fatty acids are cleaved and combined with CoA to produce acetyl-CoA, which then enters the Krebs cycle. This occurs cyclically until the entire fatty acid is oxidized. β sheet A form of secondary structure in proteins where the polypeptide folds back on itself one or more times to form a planar structure stabilized by hydrogen bonding between amino and carboxyl groups in the peptide backbone. Also known as a β-pleated sheet. book lung In some spiders, a unique respiratory system consisting of leaflike plates within a chamber over which gas exchange occurs. bronchus, pl. bronchi One of a pair of respiratory tubes branching from the lower end of the trachea (windpipe) into either lung. bud An asexually produced outgrowth that develops into a new individual. In plants, an embryonic shoot, often protected by young leaves; buds may give rise to branch shoots. buffer A substance that resists changes in pH. It releases hydrogen ions (H+) when a base is added and absorbs H+ when an acid is added.
C C3 photosynthesis The main cycle of the dark reactions of photosynthesis, in which CO2 binds to ribulose 1,5-bisphosphate (RuBP) to form two 3-carbon phosphoglycerate (PGA) molecules. C4 photosynthesis A process of CO2 fixation in photosynthesis by which the first product is the 4-carbon oxaloacetate molecule. cadherin One of a large group of transmembrane proteins that contain a Ca2+-mediated binding between cells; these proteins are responsible for cell-to-cell adhesion between cells of the same type. callus Undifferentiated tissue; a term used in tissue culture, grafting, and wound healing. Calvin cycle The dark reactions of C3 photosynthesis; also called the Calvin–Benson cycle. calyx The sepals collectively; the outermost flower whorl. CAM plant Plants that use C4 carbon fixation at night, then use the stored malate to generate CO2 during the day to minimize dessication. Cambrian explosion The huge increase in animal diversity that occurred at the beginning of the Cambrian period. cAMP response protein (CRP) See catabolite activator protein (CAP) cancer The unrestrained growth and division of cells; it results from a failure of cell division control. capillary The smallest of the blood vessels; the very thin walls of capillaries are permeable to many molecules, and exchanges between blood and the tissues occur across them; the vessels that connect arteries with veins. capsid The outermost protein covering of a virus. capsule In bacteria, a gelatinous layer surrounding the cell wall. carapace (Fr. from Sp. carapacho, shell) Shieldlike plate covering the cephalothorax of decapod crustaceans; the dorsal part of the shell of a turtle. carbohydrate An organic compound consisting of a chain or ring of carbon atoms to which hydrogen and oxygen atoms are attached in a ratio of approximately 2:1; having the generalized formula (CH2O)n; carbohydrates include sugars, starch, glycogen, and cellulose. carbon fixation The conversion of CO2 into organic compounds during photosynthesis; the first stage of the dark reactions of photosynthesis, in which carbon dioxide from the air is combined with ribulose 1,5-bisphosphate. carotenoid Any of a group of accessory pigments found in plants; in addition to absorbing light energy, these pigments act as antioxidants, scavenging potentially damaging free radicals. carpel A leaflike organ in angiosperms that encloses one or more ovules. carrier protein A membrane protein that binds to a specific molecule that cannot cross the membrane and allows passage through the membrane. carrying capacity The maximum population size that a habitat can support. cartilage A connective tissue in skeletons of vertebrates. Cartilage forms much of the skeleton of embryos, very young vertebrates, and some adult vertebrates, such as sharks and their relatives. glossary
rav32223_gloss_G1-G24.indd G-3
G-3
11/20/09 3:51:58 PM
Casparian strip In plants, a band that encircles the cell wall of root endodermal cells. Adjacent cells’ strips connect, forming a layer through which water cannot pass; therefore, all water entering roots must pass through cell membranes and cytoplasm. catabolism In a cell, those metabolic reactions that result in the breakdown of complex molecules into simpler compounds, often with the release of energy. catabolite activator protein (CAP) A protein that, when bound to cAMP, can bind to DNA and activate transcription. The level of cAMP is inversely related to the level of glucose, and CAP/cAMP in E. coli activates the lac (lactose) operon. Also called cAMP response protein (CRP). catalysis The process by which chemical subunits of larger organic molecules are held and positioned by enzymes that stress their chemical bonds, leading to the disassembly of the larger molecule into its subunits, often with the release of energy. cation A positively charged ion. cavitation In plants and animals, the blockage of a vessel by an air bubble that breaks the cohesion of the solution in the vessel; in animals more often called embolism. CD4+ cell A subtype of helper T cell that is identified by the presence of the CD4 protein on its surface. This cell type is targeted by the HIV virus that causes AIDS. cecum In vertebrates, a blind pouch at the beginning of the large intestine. cell cycle The repeating sequence of growth and division through which cells pass each generation. cell determination The molecular “decision” process by which a cell becomes destined for a particular developmental pathway. This occurs before overt differentiation and can be a stepwise process. cell-mediated immunity Arm of the adaptive immune system mediated by T cells, which includes cytotoxic cells and cells that assist the rest of the immune system. cell plate The structure that forms at the equator of the spindle during early telophase in the dividing cells of plants and a few green algae. cell-surface marker A glycoprotein or glycolipid on the outer surface of a cell’s membrane that acts as an identifier; different cell types carry different markers. cell-surface receptor A cell surface protein that binds a signal molecule and converts the extracellular signal into an intracellular one. cellular blastoderm In insect embryonic development, the stage during which the nuclei of the syncitial blastoderm become separate cells through membrane formation. cellular respiration The metabolic harvesting of energy by oxidation, ultimately dependent on molecular oxygen; carried out by the Krebs cycle and oxidative phosphorylation. cellulose The chief constituent of the cell wall in all green plants, some algae, and a few other organisms; an insoluble complex carbohydrate formed of microfibrils of glucose molecules. cell wall The rigid, outermost layer of the cells of plants, some protists, and most bacteria; the cell wall surrounds the plasma membrane.
G-4
central nervous system (CNS) That portion of the nervous system where most association occurs; in vertebrates, it is composed of the brain and spinal cord; in invertebrates, it usually consists of one or more cords of nervous tissue, together with their associated ganglia. central vacuole A large, membrane-bounded sac found in plant cells that stores proteins, pigments, and waste materials, and is involved in water balance. centriole A cytoplasmic organelle located outside the nuclear membrane, identical in structure to a basal body; found in animal cells and in the flagellated cells of other groups; divides and organizes spindle fibers during mitosis and meiosis. centromere A visible point of constriction on a chromosome that contains repeated DNA sequences that bind specific proteins. These proteins make up the kinetochore to which microtubules attach during cell division. cephalization The evolution of a head and brain area in the anterior end of animals; thought to be a consequence of bilateral symmetry. cerebellum The hindbrain region of the vertebrate brain that lies above the medulla (brainstem) and behind the forebrain; it integrates information about body position and motion, coordinates muscular activities, and maintains equilibrium. cerebral cortex The thin surface layer of neurons and glial cells covering the cerebrum; well developed only in mammals, and particularly prominent in humans. The cerebral cortex is the seat of conscious sensations and voluntary muscular activity. cerebrum The portion of the vertebrate brain (the forebrain) that occupies the upper part of the skull, consisting of two cerebral hemispheres united by the corpus callosum. It is the primary association center of the brain. It coordinates and processes sensory input and coordinates motor responses. chaetae Bristles of chitin on each body segment that help anchor annelid worms during locomotion. channel protein (ion channel) A transmembrane protein with a hydrophilic interior that provides an aqueous channel allowing diffusion of species that cannot cross the membrane. Usually allows passage of specific ions such as K+, Na+, or Ca2+ across the membrane. chaperone protein A class of enzymes that help proteins fold into the correct configuration and can refold proteins that have been misfolded or denatured. character displacement A process in which natural selection favors individuals in a species that use resources not used by other species. This results in evolutionary change leading to species dissimilar in resource use. character state In cladistics, one of two or more distinguishable forms of a character, such as the presence or absence of teeth in amniote vertebrates. charging reaction The reaction by which an aminoacyl-tRNA synthetase attaches a specific amino acid to the correct tRNA using energy from ATP. chelicera, pl. chelicerae The first pair of appendages in horseshoe crabs, sea spiders, and arachnids—the chelicerates, a group of arthropods. Chelicerae usually take the form of pincers or fangs.
chemical synapse A close association that allows chemical communication between neurons. A chemical signal (neurotransmitter) released by the first neuron binds to receptors in the membrane of the second neurons. chemiosmosis The mechanism by which ATP is generated in mitochondria and chloroplasts; energetic electrons excited by light (in chloroplasts) or extracted by oxidation in the Krebs cycle (in mitochondria) are used to drive proton pumps, creating a proton concentration gradient; when protons subsequently flow back across the membrane, they pass through channels that couple their movement to the synthesis of ATP. chiasma An X-shaped figure that can be seen in the light microscope during meiosis; evidence of crossing over, where two chromatids have exchanged parts; chiasmata move to the ends of the chromosome arms as the homologues separate. chitin A tough, resistant, nitrogen-containing polysaccharide that forms the cell walls of certain fungi, the exoskeleton of arthropods, and the epidermal cuticle of other surface structures of certain other invertebrates. chlorophyll The primary type of light-absorbing pigment in photosynthesis. Chlorophyll a absorbs light in the violet-blue and the red ranges of the visible light spectrum; chlorophyll b is an accessory pigment to chlorophyll a, absorbing light in the blue and red-orange ranges. Neither pigment absorbs light in the green range, 500–600 nm. chloroplast A cell-like organelle present in algae and plants that contains chlorophyll (and usually other pigments) and carries out photosynthesis. choanocyte A specialized flagellated cell found in sponges; choanocytes line the body interior. chorion The outer member of the double membrane that surrounds the embryo of reptiles, birds, and mammals; in placental mammals, it contributes to the structure of the placenta. chorionic villi sampling A technique in which fetal cells are sampled from the chorion of the placenta rather than from the amniotic fluid; this less invasive technique can be used earlier in pregnancy than amniocentesis. chromatid One of the two daughter strands of a duplicated chromosome that is joined by a single centromere. chromatin The complex of DNA and proteins of which eukaryotic chromosomes are composed; chromatin is highly uncoiled and diffuse in interphase nuclei, condensing to form the visible chromosomes in prophase. chromatin-remodeling complex A large protein complex that has been found to modify histones and DNA and that can change the structure of chromatin, moving or transferring nucleosomes. chromosomal mutation Any mutation that affects chromosome structure. chromosome The vehicle by which hereditary information is physically transmitted from one generation to the next; in a bacterium, the chromosome consists of a single naked circle of DNA; in eukaryotes, each chromosome consists of a single linear DNA molecule and associated proteins.
glossary
rav32223_gloss_G1-G24.indd G-4
11/20/09 3:51:59 PM
chromosomal theory of inheritance The theory stating that hereditary traits are carried on chromosomes. cilium A short cellular projection from the surface of a eukaryotic cell, having the same internal structure of microtubules in a 9 + 2 arrangement as seen in a flagellum. circadian rhythm An endogenous cyclical rhythm that oscillates on a daily (24-hour) basis. circulatory system A network of vessels in coelomate animals that carries fluids to and from different areas of the body. cisterna A small collecting vessel that pinches off from the end of a Golgi body to form a transport vesicle that moves materials through the cytoplasm. cisternal space The inner region of a membranebounded structure. Usually used to describe the interior of the endoplasmic reticulum; also called the lumen. clade A taxonomic group composed of an ancestor and all its descendents. cladistics A taxonomic technique used for creating hierarchies of organisms that represent true phylogenetic relationship and descent. class A taxonomic category between phyla and orders. A class contains one or more orders, and belongs to a particular phylum. classical conditioning The repeated presentation of a stimulus in association with a response that causes the brain to form an association between the stimulus and the response, even if they have never been associated before. clathrin A protein located just inside the plasma membrane in eukaryotic cells, in indentations called clathrin-coated pits. cleavage In vertebrates, a rapid series of successive cell divisions of a fertilized egg, forming a hollow sphere of cells, the blastula. cleavage furrow The constriction that forms during cytokinesis in animal cells that is responsible for dividing the cell into two daughter cells. climax vegetation Vegetation encountered in a self-perpetuating community of plants that has proceeded through all the stages of succession and stabilized. cloaca In some animals, the common exit chamber from the digestive, reproductive, and urinary system; in others, the cloaca may also serve as a respiratory duct. clone-by-clone sequencing A method of genome sequencing in which a physical map is constructed first, followed by sequencing of fragments and identifying overlap regions. clonal selection Amplification of a clone of immune cells initiated by antigen recognition. cloning Producing a cell line or culture all of whose members contain identical copies of a particular nucleotide sequence; an essential element in genetic engineering. closed circulatory system A circulatory system in which the blood is physically separated from other body fluids. coacervate A spherical aggregation of lipid molecules in water, held together by hydrophobic forces. coactivator A protein that functions to link transcriptional activators to the transcription complex consisting of RNA polymerase II and general transcription factors.
cochlea In terrestrial vertebrates, a tubular cavity of the inner ear containing the essential organs for hearing. coding strand The strand of a DNA duplex that is the same as the RNA encoded by a gene. This strand is not used as a template in transcription, it is complementary to the template. codominance Describes a case in which two or more alleles of a gene are each dominant to other alleles but not to each other. The phenotype of a heterozygote for codominant alleles exhibit characteristics of each of the homozygous forms. For example, in human blood types, a cross between an AA individual and a BB individual yields AB individuals. codon The basic unit of the genetic code; a sequence of three adjacent nucleotides in DNA or mRNA that codes for one amino acid. coelom In animals, a fluid-filled body cavity that develops entirely within the mesoderm. coenzyme A nonprotein organic molecule such as NAD that plays an accessory role in enzymecatalyzed processes, often by acting as a donor or acceptor of electrons. coevolution The simultaneous development of adaptations in two or more populations, species, or other categories that interact so closely that each is a strong selective force on the other. cofactor One or more nonprotein components required by enzymes in order to function; many cofactors are metal ions, others are organic coenzymes. cohesin A protein complex that holds sister chromatids together during cell division. The loss of cohesins at the centromere allow the anaphase movement of chromosomes. collenchyma cell In plants, the cells that form a supporting tissue called collenchyma; often found in regions of primary growth in stems and in some leaves. colloblast A specialized type of cell found in members of the animal phylum Ctenophora (comb jellies) that bursts on contact with zooplankton, releasing an adhesive substance to help capture this prey. colonial flagellate hypothesis The proposal first put forth by Haeckel that metazoans descended from colonial protists; supported by the similarity of sponges to choanoflagellate protists. commensalism A relationship in which one individual lives close to or on another and benefits, and the host is unaffected; a kind of symbiosis. community All of the species inhabiting a common environment and interacting with one another. companion cell A specialized parenchyma cell that is associated with each sieve-tube member in the phloem of a plant. competitive exclusion The hypothesis that two species with identical ecological requirements cannot exist in the same locality indefinitely, and that the more efficient of the two in utilizing the available scarce resources will exclude the other; also known as Gause’s principle. competitive inhibitor An inhibitor that binds to the same active site as an enzyme’s substrate, thereby competing with the substrate. complementary Describes genetic information in which each nucleotide base has a complementary partner with which it forms a base-pair.
complementary DNA (cDNA) A DNA copy of an mRNA transcript; produced by the action of the enzyme reverse transcriptase. complement system The chemical defense of a vertebrate body that consists of a battery of proteins that become activated by the walls of bacteria and fungi. complete digestive system A digestive system that has both a mouth and an anus, allowing unidirectional flow of ingested food. compound eye An organ of sight in many arthropods composed of many independent visual units called ommatidia. concentration gradient A difference in concentration of a substance from one location to another, often across a membrane. condensin A protein complex involved in condensation of chromosomes during mitosis and meiosis. cone (1) In plants, the reproductive structure of a conifer. (2) In vertebrates, a type of lightsensitive neuron in the retina concerned with the perception of color and with the most acute discrimination of detail. conidia An asexually produced fungal spore. conjugation Temporary union of two unicellular organisms, during which genetic material is transferred from one cell to the other; occurs in bacteria, protists, and certain algae and fungi. consensus sequence In genome sequencing, the overall sequence that is consistent with the sequences of individual fragments; computer programs are used to compare sequences and generate a consensus sequence. conservation of synteny The preservation over evolutionary time of arrangements of DNA segments in related species. contig A contiguous segment of DNA assembled by analyzing sequence overlaps from smaller fragments. continuous variation Variation in a trait that occurs along a continuum, such as the trait of height in human beings; often occurs when a trait is determined by more than one gene. contractile vacuole In protists and some animals, a clear fluid-filled vacuole that takes up water from within the cell and then contracts, releasing it to the outside through a pore in a cyclical manner; functions primarily in osmoregulation and excretion. conus arteriosus The anteriormost chamber of the embryonic heart in vertebrate animals. convergent evolution The independent development of similar structures in organisms that are not directly related; often found in organisms living in similar environments. cork cambium The lateral meristem that forms the periderm, producing cork (phellem) toward the surface (outside) of the plant and phelloderm toward the inside. cornea The transparent outer layer of the vertebrate eye. corolla The petals, collectively; usually the conspicuously colored flower whorl. corpus callosum The band of nerve fibers that connects the two hemispheres of the cerebrum in humans and other primates. corpus luteum A structure that develops from a ruptured follicle in the ovary after ovulation. glossary
rav32223_gloss_G1-G24.indd G-5
G-5
11/20/09 3:51:59 PM
cortex The outer layer of a structure; in animals, the outer, as opposed to the inner, part of an organ; in vascular plants, the primary ground tissue of a stem or root. cotyledon A seed leaf that generally stores food in dicots or absorbs it in monocots, providing nourishment used during seed germination. crassulacean acid metabolism (CAM) A mode of carbon dioxide fixation by which CO2 enters open leaf stomata at night and is used in photosynthesis during the day, when stomata are closed to prevent water loss. crista A folded extension of the inner membrane of a mitochondrion. Mitochondria contain numerous cristae. cross-current flow In bird lungs, the latticework of capillaries arranged across the air flow, at a 90° angle. crossing over In meiosis, the exchange of corresponding chromatid segments between homologous chromosomes; responsible for genetic recombination between homologous chromosomes. ctenidia Respiratory gills of mollusks; they consist of a system of filamentous projections of the mantle that are rich in blood vessels. cuticle A waxy or fatty, noncellular layer (formed of a substance called cutin) on the outer wall of epidermal cells. cutin In plants, a fatty layer produced by the epidermis that forms the cuticle on the outside surface. cyanobacteria A group of photosynthetic bacteria, sometimes called the “blue-green algae,” that contain the chlorophyll pigments most abundant in plants and algae, as well as other pigments. cyclic AMP (cAMP) A form of adenosine monophosphate (AMP) in which the atoms of the phosphate group form a ring; found in almost all organisms, cAMP functions as an intracellular second messenger that regulates a diverse array of metabolic activities. cyclic photophosphorylation Reactions that begin with the absorption of light by reaction center chlorophyll that excites an electron. The excited electron returns to the photosystem, generating ATP by chemiosmosis in the process. This is found in the single bacterial photosystem, and can occur in plants in photosystem I. cyclin Any of a number of proteins that are produced in synchrony with the cell cycle and combine with certain protein kinases, the cyclin-dependent kinases, at certain points during cell division. cyclin-dependent kinase (Cdk) Any of a group of protein kinase enzymes that control progress through the cell cycle. These enzymes are only active when complexed with cyclin. The cdc2 protein, produced by the cdc2 gene, was the first Cdk enzyme discovered. cytochrome Any of several iron-containing protein pigments that serve as electron carriers in transport chains of photosynthesis and cellular respiration. cytochrome b6–f complex A proton pump found in the thylakoid membrane. This complex uses energy from excited electrons to pump protons from the stroma into the thylakoid compartment. cytokinesis Division of the cytoplasm of a cell after nuclear division.
G-6
cytokine Signaling molecules secreted by immune cells that affect other immune cells. cytoplasm The material within a cell, excluding the nucleus; the protoplasm. cytoskeleton A network of protein microfilaments and microtubules within the cytoplasm of a eukaryotic cell that maintains the shape of the cell, anchors its organelles, and is involved in animal cell motility. cytosol The fluid portion of the cytoplasm; it contains dissolved organic molecules and ions. cytotoxic T cell A special T cell activated during cell-mediated immune response that recognizes and destroys infected body cells.
D deamination The removal of an amino group; part of the degradation of proteins into compounds that can enter the Krebs cycle. deductive reasoning The logical application of general principles to predict a specific result. In science, deductive reasoning is used to test the validity of general ideas. dehydration reaction A type of chemical reaction in which two molecules join to form one larger molecule, simultaneously splitting out a molecule of water; one molecule is stripped of a hydrogen atom, and another is stripped of a hydroxyl group (– OH), resulting in the joining of the two molecules, while the H and – OH released may combine to form a water molecule. dehydrogenation Chemical reaction involving the loss of a hydrogen atom. This is an oxidation that combines loss of an electron with loss of a proton. deletion A mutation in which a portion of a chromosome is lost; if too much information is lost, the deletion can be fatal. demography The properties of the rate of growth and the age structure of populations. denaturation The loss of the native configuration of a protein or nucleic acid as a result of excessive heat, extremes of pH, chemical modification, or changes in solvent ionic strength or polarity that disrupt hydrophobic interactions; usually accompanied by loss of biological activity. dendrite A process extending from the cell body of a neuron, typically branched, that conducts impulses toward the cell body. deoxyribonucleic acid (DNA) The genetic material of all organisms; composed of two complementary chains of nucleotides wound in a double helix. dephosphorylation The removal of a phosphate group, usually by a phosphatase enzyme. Many proteins can be activated or inactivated by dephosphorylation. depolarization The movement of ions across a plasma membrane that locally wipes out an electrical potential difference. derived character A characteristic used in taxonomic analysis representing a departure from the primitive form. dermal tissue In multicellular organisms, a type of tissue that forms the outer layer of the body and is in contact with the environment; it has a protective function. desmosome A type of anchoring junction that links adjacent cells by connecting their cytoskeletons with cadherin proteins.
derepression Seen in anabolic operons where the operon that encodes the enzymes for a biochemical pathway is repressed in the presence of the end product of the pathway and derepressed in the absence of the end product. This allows production of the enzymes only when they are necessary. determinate development A type of development in animals in which each embryonic cell has a predetermined fate in terms of what kind of tissue it will form in the adult. deuterostome Any member of a grouping of bilaterally symmetrical animals in which the anus develops first and the mouth second; echinoderms and vertebrates are deuterostome animals. diacylglycerol (DAG) A second messenger that is released, along with inositol-1,4,5trisphosphate (IP3), when phospholipase C cleaves PIP2. DAG can have a variety of cellular effects through activation of protein kinases. diaphragm (1) In mammals, a sheet of muscle tissue that separates the abdominal and thoracic cavities and functions in breathing. (2) A contraceptive device used to block the entrance to the uterus temporarily and thus prevent sperm from entering during sexual intercourse. diapsid Any of a group of reptiles that have two pairs of temporal openings in the skull, one lateral and one more dorsal; one lineage of this group gave rise to dinosaurs, modern reptiles, and birds. diastolic pressure In the measurement of human blood pressure, the minimum pressure between heartbeats (repolarization of the ventricles). Compare with systolic pressure. dicer An enzyme that generates small RNA molecules in a cell by chopping up double-stranded RNAs; dicer produces miRNAs and siRNAs. dicot Short for dicotyledon; a class of flowering plants generally characterized as having two cotyledons, net-veined leaves, and flower parts usually in fours or fives. dideoxynucleotide A nucleotide lacking – OH groups at both the 2 and 3 positions; used as a chain terminator in the enzymatic sequencing of DNA. differentiation A developmental process by which a relatively unspecialized cell undergoes a progressive change to a more specialized form or function. diffusion The net movement of dissolved molecules or other particles from a region where they are more concentrated to a region where they are less concentrated. dihybrid An individual heterozygous at two different loci; for example A/a B/b. dihybrid cross A single genetic cross involving two different traits, such as flower color and plant height. dikaryotic In fungi, having pairs of nuclei within each cell. dioecious Having the male and female elements on different individuals. diploid Having two sets of chromosomes (2n); in animals, twice the number characteristic of gametes; in plants, the chromosome number characteristic of the sporophyte generation; in contrast to haploid (n). directional selection A form of selection in which selection acts to eliminate one extreme from an array of phenotypes.
glossary
rav32223_gloss_G1-G24.indd G-6
11/20/09 3:51:59 PM
disaccharide A carbohydrate formed of two simple sugar molecules bonded covalently. disruptive selection A form of selection in which selection acts to eliminate rather than favor the intermediate type. dissociation In proteins, the reversible separation of protein subunits from a quaternary structure without altering their tertiary structure. Also refers to the dissolving of ionic compounds in water. disassortative mating A type of nonrandom mating in which phenotypically different individuals mate more frequently. diurnal Active during the day. DNA-binding motif A region found in a regulatory protein that is capable of binding to a specific base sequence in DNA; a critical part of the protein’s DNA-binding domain. DNA fingerprinting An identification technique that makes use of a variety of molecular techniques to identify differences in the DNA of individuals. DNA gyrase A topoisomerase involved in DNA replication; it relieves the torsional strain caused by unwinding the DNA strands. DNA library A collection of DNAs in a vector (a plasmid, phage, or artificial chromosome) that taken together represent a complex mixture of DNAs, such as the entire genome, or the cDNAs made from all of the mRNA in a specific cell type. DNA ligase The enzyme responsible for formation of phosphodiester bonds between adjacent nucleotides in DNA. DNA microarray An array of DNA fragments on a microscope slide or silicon chip, used in hybridization experiments with labeled mRNA or DNA to identify active and inactive genes, or the presence or absence of particular sequences. DNA polymerase A class of enzymes that all synthesize DNA from a preexisting template. All synthesize only in the 5-to-3 direction, and require a primer to extend. DNA vaccine A type of vaccine that uses DNA from a virus or bacterium that stimulates the cellular immune response. domain (1) A distinct modular region of a protein that serves a particular function in the action of the protein, such as a regulatory domain or a DNA-binding domain. (2) In taxonomy, the level higher than kingdom. The three domains currently recognized are Bacteria, Archaea, and Eukarya. Domain Archaea In the three-domain system of taxonomy, the group that contains only the Archaea, a highly diverse group of unicellular prokaryotes. Domain Bacteria In the three-domain system of taxonomy, the group that contains only the Bacteria, a vast group of unicellular prokaryotes. Domain Eukarya In the three-domain system of taxonomy, the group that contains eukaryotic organisms including protists, fungi, plants, and animals. dominant An allele that is expressed when present in either the heterozygous or the homozygous condition. dosage compensation A phenomenon by which the expression of genes carried on sex chromosomes is kept the same in males and females, despite a different number of sex chromosomes. In mammals, inactivation of one of the X chromosomes in female cells accomplishes dosage compensation.
double fertilization The fusion of the egg and sperm (resulting in a 2n fertilized egg, the zygote) and the simultaneous fusion of the second male gamete with the polar nuclei (resulting in a primary endosperm nucleus, which is often triploid, 3n); a unique characteristic of all angiosperms. double helix The structure of DNA, in which two complementary polynucleotide strands coil around a common helical axis. duodenum In vertebrates, the upper portion of the small intestine. duplication A mutation in which a portion of a chromosome is duplicated; if the duplicated region does not lie within a gene, the duplication may have no effect.
E ecdysis Shedding of outer, cuticular layer; molting, as in insects or crustaceans. ecdysone Molting hormone of arthropods, which triggers when ecdysis occurs. ecology The study of interactions of organisms with one another and with their physical environment. ecosystem A major interacting system that includes organisms and their nonliving environment. ecotype A locally adapted variant of an organism; differing genetically from other ecotypes. ectoderm One of the three embryonic germ layers of early vertebrate embryos; ectoderm gives rise to the outer epithelium of the body (skin, hair, nails) and to the nerve tissue, including the sense organs, brain, and spinal cord. ectomycorrhizae Externally developing mycorrhizae that do not penetrate the cells they surround. ectotherms Animals such as reptiles, fish, or amphibians, whose body temperature is regulated by their behavior or by their surroundings. electronegativity A property of atomic nuclei that refers to the affinity of the nuclei for valence electrons; a nucleus that is more electronegative has a greater pull on electrons than one that is less electronegative. electron transport chain The passage of energetic electrons through a series of membraneassociated electron-carrier molecules to proton pumps embedded within mitochondrial or chloroplast membranes. See chemiosmosis. elongation factor (Ef-Tu) In protein synthesis in E. coli, a factor that binds to GTP and to a charged tRNA to accomplish binding of the charged tRNA to the A site of the ribosome, so that elongation of the polypeptide chain can occur. embryo A multicellular developmental stage that follows cell division of the zygote. embryonic stem cell (ES cell) A stem cell derived from an early embryo that can develop into different adult tissues and give rise to an adult organism when injected into a blastocyst. emergent properties Novel properties arising from the way in which components interact. Emergent properties often cannot be deduced solely from knowledge of the individual components. emerging virus Any virus that originates in one organism but then passes to another; usually refers to transmission to humans. endergonic Describes a chemical reaction in which the products contain more energy than the reactants, so that free energy must be put
into the reaction from an outside source to allow it to proceed. endocrine gland Ductless gland that secretes hormones into the extracellular spaces, from which they diffuse into the circulatory system. endocytosis The uptake of material into cells by inclusion within an invagination of the plasma membrane; the uptake of solid material is phagocytosis, and that of dissolved material is pinocytosis. endoderm One of the three embryonic germ layers of early vertebrate embryos, destined to give rise to the epithelium that lines internal structures and most of the digestive and respiratory tracts. endodermis In vascular plants, a layer of cells forming the innermost layer of the cortex in roots and some stems. endomembrane system A system of connected membranous compartments found in eukaryotic cells. endometrium The lining of the uterus in mammals; thickens in response to secretion of estrogens and progesterone and is sloughed off in menstruation. endomycorrhizae Mycorrhizae that develop within cells. endonuclease An enzyme capable of cleaving phosphodiester bonds between nucleotides located internally in a DNA strand. endoplasmic reticulum (ER) Internal membrane system that forms a netlike array of channels and interconnections within the cytoplasm of eukaryotic cells. The ER is divided into rough (RER) and smooth (SER) compartments. endorphin One of a group of small neuropeptides produced by the vertebrate brain; like morphine, endorphins modulate pain perception. endosperm A storage tissue characteristic of the seeds of angiosperms, which develops from the union of a male nucleus and the polar nuclei of the embryo sac. The endosperm is digested by the growing sporophyte either before maturation of the seed or during its germination. endospore A highly resistant, thick-walled bacterial spore that can survive harsh environmental stress, such as heat or dessication, and then germinate when conditions become favorable. endosymbiosis Theory that proposes that eukaryotic cells evolved from a symbiosis between different species of prokaryotes. endotherm An animal capable of maintaining a constant body temperature. See homeotherm. energy level A discrete level, or quantum, of energy that an electron in an atom possesses. To change energy levels, an electron must absorb or release energy. enhancer A site of regulatory protein binding on the DNA molecule distant from the promoter and start site for a gene’s transcription. enthalpy In a chemical reaction, the energy contained in the chemical bonds of the molecule, symbolized as H; in a cellular reaction, the free energy is equal to the enthalpy of the reactant molecules in the reaction. entropy A measure of the randomness or disorder of a system; a measure of how much energy in a system has become so dispersed (usually as evenly distributed heat) that it is no longer available to do work. glossary
rav32223_gloss_G1-G24.indd G-7
G-7
11/20/09 3:51:59 PM
enzyme A protein that is capable of speeding up specific chemical reactions by lowering the required activation energy. enzyme–substrate complex The complex formed when an enzyme binds with its substrate. This complex often has an altered configuration compared with the nonbound enzyme. epicotyl The region just above where the cotyledons are attached. epidermal cell In plants, a cell that collectively forms the outermost layer of the primary plant body; includes specialized cells such as trichomes and guard cells. epidermis The outermost layers of cells; in plants, the exterior primary tissue of leaves, young stems, and roots; in vertebrates, the nonvascular external layer of skin, of ectodermal origin; in invertebrates, a single layer of ectodermal epithelium. epididymis A sperm storage vessel; a coiled part of the sperm duct that lies near the testis. epistasis Interaction between two nonallelic genes in which one of them modifies the phenotypic expression of the other. epithelium In animals, a type of tissue that covers an exposed surface or lines a tube or cavity. equilibrium A stable condition; the point at which a chemical reaction proceeds as rapidly in the reverse direction as it does in the forward direction, so that there is no further net change in the concentrations of products or reactants. In ecology, a stable condition that resists change and fairly quickly returns to its original state if disturbed by humans or natural events. erythrocyte Red blood cell, the carrier of hemoglobin. erythropoiesis The manufacture of blood cells in the bone marrow. E site In a ribosome, the exit site that binds to the tRNA that carried the previous amino acid added to the polypeptide chain. estrus The period of maximum female sexual receptivity, associated with ovulation of the egg. ethology The study of patterns of animal behavior in nature. euchromatin That portion of a eukaryotic chromosome that is transcribed into mRNA; contains active genes that are not tightly condensed during interphase. eukaryote A cell characterized by membranebounded organelles, most notably the nucleus, and one that possesses chromosomes whose DNA is associated with proteins; an organism composed of such cells. eutherian A placental mammal. eutrophic Refers to a lake in which an abundant supply of minerals and organic matter exists. evolution Genetic change in a population of organisms; in general, evolution leads to progressive change from simple to complex. excision repair A nonspecific mechanism to repair damage to DNA during synthesis. The damaged or mismatched region is excised, and DNA polymerase replaces the region removed. exergonic Describes a chemical reaction in which the products contain less free energy than the reactants, so that free energy is released in the reaction. exhalant siphon In bivalve mollusks, the siphon through which outgoing water leaves the body. exocrine gland A type of gland that releases its secretion through a duct, such as a digestive gland or a sweat gland.
G-8
exocytosis A type of bulk transport out of cells in which a vacuole fuses with the plasma membrane, discharging the vacuole’s contents to the outside. exon A segment of DNA that is both transcribed into RNA and translated into protein. See intron. exonuclease An enzyme capable of cutting phosphodiester bonds between nucleotides located at an end of a DNA strand. This allows sequential removal of nucleotides from the end of DNA. exoskeleton An external skeleton, as in arthropods. experiment A test of one or more hypotheses. Hypotheses make contrasting predictions that can be tested experimentally in control and test experiments where a single variable is altered. expressed sequence tag (EST) A short sequence of a cDNA that unambiguously identifies the cDNA. expression vector A type of vector (plasmid or phage) that contains the sequences necessary to drive expression of inserted DNA in a specific cell type. exteroceptor A receptor that is excited by stimuli from the external world. extremophile An archaean organism that lives in extreme environments; different archaean species may live in hot springs (thermophiles), highly saline environments (halophiles), highly acidic or basic environments, or under high pressure at the bottom of oceans.
F 5 cap In eukaryotes, a structure added to the 5 end of an mRNA consisting of methylated GTP attached by a 5 to 5 bond. The cap protects this end from degradation and is involved in the initiation of translation. facilitated diffusion Carrier-assisted diffusion of molecules across a cellular membrane through specific channels from a region of higher concentration to one of lower concentration; the process is driven by the concentration gradient and does not require cellular energy from ATP. family A taxonomic grouping of similar species above the level of genus. fat A molecule composed of glycerol and three fatty acid molecules. feedback inhibition Control mechanism whereby an increase in the concentration of some molecules inhibits the synthesis of that molecule. fermentation The enzyme-catalyzed extraction of energy from organic compounds without the involvement of oxygen. fertilization The fusion of two haploid gamete nuclei to form a diploid zygote nucleus. fibroblast A flat, irregularly branching cell of connective tissue that secretes structurally strong proteins into the matrix between the cells. first filial (F1) generation The offspring resulting from a cross between a parental generation (P); in experimental crosses, these parents usually have different phenotypes. First Law of Thermodynamics Energy cannot be created or destroyed, but can only undergo conversion from one form to another; thus, the amount of energy in the universe is unchangeable. fitness The genetic contribution of an individual to succeeding generations. relative fitness refers to the fitness of an individual relative to other individuals in a population.
fixed action pattern A stereotyped animal behavior response, thought by ethologists to be based on programmed neural circuits. flagellin The protein composing bacterial flagella, which allow a cell to move through an aqueous environment. flagellum A long, threadlike structure protruding from the surface of a cell and used in locomotion. flame cell A specialized cell found in the network of tubules inside flatworms that assists in water regulation and some waste excretion. flavin adenine dinucleotide (FAD, FADH2) A cofactor that acts as a soluble (not membranebound) electron carrier (can be reversibly oxidized and reduced). fluorescent in situ hybridization (FISH) A cytological method used to find specific DNA sequences on chromosomes with a specific fluorescently labeled probe. food security Having access to sufficient, safe food to avoid malnutrition and starvation; a global human issue. foraging behavior A collective term for the many complex, evolved behaviors that influence what an animal eats and how the food is obtained. founder effect The effect by which rare alleles and combinations of alleles may be enhanced in new populations. fovea A small depression in the center of the retina with a high concentration of cones; the area of sharpest vision. frameshift mutation A mutation in which a base is added or deleted from the DNA sequence. These changes alter the reading frame downstream of the mutation. free energy Energy available to do work. free radical An ionized atom with one or more unpaired electrons, resulting from electrons that have been energized by ionizing radiation being ejected from the atom; free radicals react violently with other molecules, such as DNA, causing damage by mutation. frequency-dependent selection A type of selection that depends on how frequently or infrequently a phenotype occurs in a population. fruit In angiosperms, a mature, ripened ovary (or group of ovaries), containing the seeds. functional genomics The study of the function of genes and their products, beyond simply ascertaining gene sequences. functional group A molecular group attached to a hydrocarbon that confers chemical properties or reactivities. Examples include hydroxyl (– OH), carboxylic acid (– COOH) and amino groups (– NH2). fundamental niche Also referred to as the hypothetical niche, this is the entire niche an organism could fill if there were no other interacting factors (such as competition or predation).
G G0 phase The stage of the cell cycle occupied by cells that are not actively dividing. G1 phase The phase of the cell cycle after cytokinesis and before DNA replication called the first “gap” phase. This phase is the primary growth phase of a cell.
glossary
rav32223_gloss_G1-G24.indd G-8
11/20/09 3:51:59 PM
G1/S checkpoint The primary control point at which a cell “decides” whether or not to divide. Also called START and the restriction point. G2 phase The phase of the cell cycle between DNA replication and mitosis called the second “gap” phase. During this phase, the cell prepares for mitosis. G2/M checkpoint The second cell-division control point, at which division can be delayed if DNA has not been properly replicated or is damaged. gametangium, pl. gametangia A cell or organ in which gametes are formed. gamete A haploid reproductive cell. gametocytes Cells in the malarial sporozoite life cycle capable of giving rise to gametes when in the correct host. gametophyte In plants, the haploid (n), gameteproducing generation, which alternates with the diploid (2n) sporophyte. ganglion, pl. ganglia An aggregation of nerve cell bodies; in invertebrates, ganglia are the integrative centers; in vertebrates, the term is restricted to aggregations of nerve cell bodies located outside the central nervous system. gap gene Any of certain genes in Drosophila development that divide the embryo into large blocks in the process of segmentation; hunchback is a gap gene. gap junction A junction between adjacent animal cells that allows the passage of materials between the cells. gastrodermis In eumetazoan animals, the layer of digestive tissue that develops from the endoderm. gastrula In vertebrates, the embryonic stage in which the blastula with its single layer of cells turns into a three-layered embryo made up of ectoderm, mesoderm, and endoderm. gastrulation Developmental process that converts blastula into embryo with three embryonic germ layers: endoderm, mesoderm, and ectoderm. Involves massive cell migration to convert the hollow structure into a three-layered structure. gene The basic unit of heredity; a sequence of DNA nucleotides on a chromosome that encodes a protein, tRNA, or rRNA molecule, or regulates the transcription of such a sequence. gene conversion Alteration of one homologous chromosome by the cell’s error-detection and repair system to make it resemble the sequence on the other homologue. gene expression The conversion of the genotype into the phenotype; the process by which DNA is transcribed into RNA, which is then translated into a protein product. gene pool All the alleles present in a species. gene-for-gene hypothesis A plant defense mechanism in which a specific protein encoded by a viral, bacterial, or fungal pathogen binds to a protein encoded by a plant gene and triggers a defense response in the plant. general transcription factor Any of a group of transcription factors that are required for formation of an initiation complex by RNA polymerase II at a promoter. This allows a basal level that can be increased by the action of specific factors. generalized transduction A form of gene transfer in prokaryotes in which any gene can be transferred between cells. This uses a lytic bacteriophage as a carrier where the virion is accidentally packaged with host DNA.
genetic counseling The process of evaluating the risk of genetic defects occurring in offspring, testing for these defects in unborn children, and providing the parents with information about these risks and conditions. genetic drift Random fluctuation in allele frequencies over time by chance. genetic map An abstract map that places the relative location of genes on a chromosome based on recombination frequency. genome The entire DNA sequence of an organism. genomic imprinting Describes an exception to Mendelian genetics in some mammals in which the phenotype caused by an allele is exhibited when the allele comes from one parent, but not from the other. genomic library A DNA library that contains a representation of the entire genome of an organism. genomics The study of genomes as opposed to individual genes. genotype The genetic constitution underlying a single trait or set of traits. genotype frequency A measure of the occurrence of a genotype in a population, expressed as a proportion of the entire population, for example, an occurrence of 0.25 (25%) for a homozygous recessive genotype. genus, pl. genera A taxonomic group that ranks below a family and above a species. germination The resumption of growth and development by a spore or seed. germ layers The three cell layers formed at gastrulation of the embryo that foreshadow the future organization of tissues; the layers, from the outside inward, are the ectoderm, the mesoderm, and the endoderm. germ-line cells During zygote development, cells that are set aside from the somatic cells and that will eventually undergo meiosis to produce gametes. gill (1) In aquatic animals, a respiratory organ, usually a thin-walled projection from some part of the external body surface, endowed with a rich capillary bed and having a large surface area. (2) In basidiomycete fungi, the plates on the underside of the cap. globular protein Proteins with a compact tertiary structure with hydrophobic amino acids mainly in the interior. glomerular filtrate The fluid that passes out of the capillaries of each glomerulus. glomerulus A cluster of capillaries enclosed by Bowman’s capsule. glucagon A vertebrate hormone produced in the pancreas that acts to initiate the breakdown of glycogen to glucose subunits. gluconeogenesis The synthesis of glucose from noncarbohydrates (such as proteins or fats). glucose A common six-carbon sugar (C6H12O6); the most common monosaccharide in most organisms. glucose repression In E. coli, the preferential use of glucose even when other sugars are present; transcription of mRNA encoding the enzymes for utilizing the other sugars does not occur. glycocalyx A “sugar coating” on the surface of a cell resulting from the presence of polysaccharides on glycolipids and glycoproteins embedded in the outer layer of the plasma membrane.
glycogen Animal starch; a complex branched polysaccharide that serves as a food reserve in animals, bacteria, and fungi. glycolipid Lipid molecule modified within the Golgi complex by having a short sugar chain (polysaccharide) attached. glycolysis The anaerobic breakdown of glucose; this enzyme-catalyzed process yields two molecules of pyruvate with a net of two molecules of ATP. glycoprotein Protein molecule modified within the Golgi complex by having a short sugar chain (polysaccharide) attached. glyoxysome A small cellular organelle or microbody containing enzymes necessary for conversion of fats into carbohydrates. glyphosate A biodegradable herbicide that works by inhibiting EPSP synthetase, a plant enzyme that makes aromatic amino acids; genetic engineering has allowed crop species to be created that are resistant to glyphosate. Golgi apparatus (Golgi body) A collection of flattened stacks of membranes in the cytoplasm of eukaryotic cells; functions in collection, packaging, and distribution of molecules synthesized in the cell. G protein A protein that binds guanosine triphosphate (GTP) and assists in the function of cell-surface receptors. When the receptor binds its signal molecule, the G protein binds GTP and is activated to start a chain of events within the cell. G protein-coupled receptor (GPCR) A receptor that acts through a heterotrimeric (three component) G protein to activate effector proteins. The effector proteins then function as enzymes to produce second messengers such as cAMP or IP3. gradualism The view that species change very slowly in ways that may be imperceptible from one generation to the next but that accumulate and lead to major changes over thousands or millions of years. Gram stain Staining technique that divides bacteria into gram-negative or gram-positive based on retention of a violet dye. Differences in staining are due to cell wall construction. granum (pl. grana) A stacked column of flattened, interconnected disks (thylakoids) that are part of the thylakoid membrane system in chloroplasts. gravitropism Growth response to gravity in plants; formerly called geotropism. ground meristem The primary meristem, or meristematic tissue, that gives rise to the plant body (except for the epidermis and vascular tissues). ground tissue In plants, a type of tissue that performs many functions, including support, storage, secretion, and photosynthesis; may consist of many cell types. growth factor Any of a number of proteins that bind to membrane receptors and initiate intracellular signaling systems that result in cell growth and division. guard cell In plants, one of a pair of sausageshaped cells flanking a stoma; the guard cells open and close the stomata. guttation The exudation of liquid water from leaves due to root pressure. glossary
rav32223_gloss_G1-G24.indd G-9
G-9
11/20/09 3:51:59 PM
gymnosperm A seed plant with seeds not enclosed in an ovary; conifers are gymnosperms. gynoecium The aggregate of carpels in the flower of a seed plant.
H habitat The environment of an organism; the place where it is usually found. habituation A form of learning; a diminishing response to a repeated stimulus. halophyte A plant that is salt-tolerant. haplodiploidy A phenomenon occurring in certain organisms such as wasps, wherein both haploid (male) and diploid (female) individuals are encountered. haploid Having only one set of chromosomes (n), in contrast to diploid (2n). haplotype A region of a chromosome that is usually inherited intact, that is, it does not undergo recombination. These are identified based on analysis of SNPs. Hardy-Weinberg equilibrium A mathematical description of the fact that allele and genotype frequencies remain constant in a randommating population in the absence of inbreeding, selection, or other evolutionary forces; usually stated: if the frequency of allele a is p and the frequency of allele b is q, then the genotype frequencies after one generation of random mating will always be p2 + 2pq + q2 = 1. Haversian canal Narrow channels that run parallel to the length of a bone and contain blood vessels and nerve cells. heat A measure of the random motion of molecules; the greater the heat, the greater the motion. Heat is one form of kinetic energy. heat of vaporization The amount of energy required to change 1 g of a substance from a liquid to a gas. heavy metal Any of the metallic elements with high atomic numbers, such as arsenic, cadmium, lead, etc. Many heavy metals are toxic to animals even in small amounts. helicase Any of a group of enzymes that unwind the two DNA strands in the double helix to facilitate DNA replication. helix-turn-helix motif A common DNA-binding motif found in regulatory proteins; it consists of two α-helices linked by a nonhelical segment (the “turn”). helper T cell A class of white blood cells that initiates both the cell-mediated immune response and the humoral immune response; helper T cells are the targets of the AIDS virus (HIV). hemoglobin A globular protein in vertebrate red blood cells and in the plasma of many invertebrates that carries oxygen and carbon dioxide. hemopoietic stem cell The cells in bone marrow where blood cells are formed. hermaphroditism Condition in which an organism has both male and female functional reproductive organs. heterochromatin The portion of a eukaryotic chromosome that is not transcribed into RNA; remains condensed in interphase and stains intensely in histological preparations. heterochrony An alteration in the timing of developmental events due to a genetic change; for example, a mutation that delays flowering in plants.
G-10
heterokaryotic In fungi, having two or more genetically distinct types of nuclei within the same mycelium. heterosporous In vascular plants, having spores of two kinds, namely, microspores and megaspores. heterotroph An organism that cannot derive energy from photosynthesis or inorganic chemicals, and so must feed on other plants and animals, obtaining chemical energy by degrading their organic molecules. heterozygote advantage The situation in which individuals heterozygous for a trait have a selective advantage over those who are homozygous; an example is sickle cell anemia. heterozygous Having two different alleles of the same gene; the term is usually applied to one or more specific loci, as in “heterozygous with respect to the W locus” (that is, the genotype is W/w). Hfr cell An E. coli cell that has a high frequency of recombination due to integration of an F plasmid into its genome. histone One of a group of relatively small, very basic polypeptides, rich in arginine and lysine, forming the core of nucleosomes around which DNA is wrapped in the first stage of chromosome condensation. histone protein Any of eight proteins with an overall positive charge that associate in a complex. The DNA duplex coils around a core of eight histone proteins, held by its negatively charged phosphate groups, forming a nucleosome. holoblastic cleavage Process in vertebrate embryos in which the cleavage divisions all occur at the same rate, yielding a uniform cell size in the blastula. homeobox A sequence of 180 nucleotides located in homeotic genes that produces a 60-aminoacid peptide sequence (the homeodomain) active in transcription factors. homeodomain motif A special class of helix-turnhelix motifs found in regulatory proteins that control development in eukaryotes. homeosis A change in the normal spatial pattern of gene expression that can result in homeotic mutants where a wild-type structure develops in the wrong place in or on the organism. homeostasis The maintenance of a relatively stable internal physiological environment in an organism; usually involves some form of feedback self-regulation. homeotherm An organism, such as a bird or mammal, capable of maintaining a stable body temperature independent of the environmental temperature. See endotherm. homeotic gene One of a series of “master switch” genes that determine the form of segments developing in the embryo. hominid Any primate in the human family, Hominidae. Homo sapiens is the only living representative. hominoid Collectively, hominids and apes; the monkeys and hominoids constitute the anthropoid primates. homokaryotic In fungi, having nuclei with the same genetic makeup within a mycelium. homologue One of a pair of chromosomes of the same kind located in a diploid cell; one copy of each pair of homologues comes from each gamete that formed the zygote.
homologous (1) Refers to similar structures that have the same evolutionary origin. (2) Refers to a pair of the same kind of chromosome in a diploid cell. homoplasy In cladistics, a shared character state that has not been inherited from a common ancestor exhibiting that state; may result from convergent evolution or evolutionary reversal. The wings of birds and of bats, which are convergent structures, are examples. homosporous In some plants, production of only one type of spore rather than differentiated types. Compare with heterosporous. homozygous Being a homozygote, having two identical alleles of the same gene; the term is usually applied to one or more specific loci, as in “homozygous with respect to the W locus” (i.e., the genotype is W/W or w/w). horizontal gene transfer (HGT) The passing of genes laterally between species; more prevalent very early in the history of life. hormone A molecule, usually a peptide or steroid, that is produced in one part of an organism and triggers a specific cellular reaction in target tissues and organs some distance away. host range The range of organisms that can be infected by a particular virus. Hox gene A group of homeobox-containing genes that control developmental events, usually found organized into clusters of genes. These genes have been conserved in many different multicellular animals, both invertebrates and vertebrates, although the number of clusters changes in lineages, leading to four clusters in vertebrates. humoral immunity Arm of the adaptive immune system involving B cells that produce soluble antibodies specific for foreign antigens. humus Partly decayed organic material found in topsoil. hybridization The mating of unlike parents. hydration shell A “cloud” of water molecules surrounding a dissolved substance, such as sucrose or Na+ and Cl– ions. hydrogen bond A weak association formed with hydrogen in polar covalent bonds. The partially positive hydrogen is attracted to partially negative atoms in polar covalent bonds. In water, oxygen and hydrogen in different water molecules form hydrogen bonds. hydrolysis reaction A reaction that breaks a bond by the addition of water. This is the reverse of dehydration, a reaction that joins molecules with the loss of water. hydrophilic Literally translates as “water-loving” and describes substances that are soluble in water. These must be either polar or charged (ions). hydrophobic Literally translates as “water-fearing” and describes nonpolar substances that are not soluble in water. Nonpolar molecules in water associate with each other and form droplets. hydrophobic exclusion The tendency of nonpolar molecules to aggregate together when placed in water. Exclusion refers to the action of water in forcing these molecules together. hydrostatic skeleton The skeleton of most soft-bodied invertebrates that have neither an internal nor an external skeleton. They use the relative incompressibility of the water within their bodies as a kind of skeleton.
glossary
rav32223_gloss_G1-G24.indd G-10
11/20/09 3:51:59 PM
hyperosmotic The condition in which a (hyperosmotic) solution has a higher osmotic concentration than that of a second solution. Compare with hypoosmotic. hyperpolarization Above-normal negativity of a cell membrane during its resting potential. hypersensitive response Plants respond to pathogens by selectively killing plant cells to block the spread of the pathogen. hypertonic A solution with a higher concentration of solutes than the cell. A cell in a hypertonic solution tends to lose water by osmosis. hypha, pl. hyphae A filament of a fungus or oomycete; collectively, the hyphae constitute the mycelium. hypocotyl The region immediately below where the cotyledons are attached. hypoosmotic The condition in which a (hypoosmotic) solution has a lower osmotic concentration than that of a second solution. Compare with hyperosmotic. hypothalamus A region of the vertebrate brain just below the cerebral hemispheres, under the thalamus; a center of the autonomic nervous system, responsible for the integration and correlation of many neural and endocrine functions. hypotonic A solution with a lower concentration of solutes than the cell. A cell in a hypotonic solution tends to take in water by osmosis.
I icosahedron A structure consisting of 20 equilateral triangular facets; this is commonly seen in viruses and forms one kind of viral capsid. imaginal disk One of about a dozen groups of cells set aside in the abdomen of a larval insect and committed to forming key parts of the adult insect’s body. immune response In vertebrates, a defensive reaction of the body to invasion by a foreign substance or organism. See antibody and B cell. immunoglobulin An antibody molecule. immunological tolerance Process where immune system learns to not react to self-antigens. in vitro mutagenesis The ability to create mutations at any site in a cloned gene to examine the mutations’ effects on function. inbreeding The breeding of genetically related plants or animals; inbreeding tends to increase homozygosity. inclusive fitness Describes the sum of the number of genes directly passed on in an individual’s offspring and those genes passed on indirectly by kin (other than offspring) whose existence results from the benefit of the individual’s altruism. incomplete dominance Describes a case in which two or more alleles of a gene do not display clear dominance. The phenotype of a heterozygote is intermediate between the homozygous forms. For example, crossing red-flowered with white-flowered four o’clocks yields pink heterozygotes. independent assortment In a dihybrid cross, describes the random assortment of alleles for each of the genes. For genes on different chromosomes this results from the random orientations of different homologous pairs during metaphase I of meiosis. For genes on
the same chromosome, this occurs when the two loci are far enough apart for roughly equal numbers of odd- and even-numbered multiple crossover events. indeterminate development A type of development in animals in which the first few embryonic cells are identical daughter cells, any one of which could develop separately into a complete organism; their fate is indeterminate. inducer exclusion Part of the mechanism of glucose repression in E. coli in which the presence of glucose prevents the entry of lactose such that the lac operon cannot be induced. induction (1) Production of enzymes in response to a substrate; a mechanism by which binding of an inducer to a repressor allows transcription of an operon. This is seen in catabolic operons and results in production of enzymes to degrade a compound only when it is available. (2) In embryonic development, the process by which the development of a cell is influenced by interaction with an adjacent cell. inductive reasoning The logical application of specific observations to make a generalization. In science, inductive reasoning is used to formulate testable hypotheses. industrial melanism Phrase used to describe the evolutionary process in which initially lightcolored organisms become dark as a result of natural selection. inflammatory response A generalized nonspecific response to infection that acts to clear an infected area of infecting microbes and dead tissue cells so that tissue repair can begin. inhalant siphon In bivalve mollusks, the siphon through which incoming water enters the body. inheritance of acquired characteristics Also known as Lamarckism; the theory, now discounted, that individuals genetically pass on to their offspring physical and behavioral changes developed during the individuals’ own lifetime. inhibitor A substance that binds to an enzyme and decreases its activity. initiation factor One of several proteins involved in the formation of an initiation complex in prokaryote polypeptide synthesis. initiator tRNA A tRNA molecule involved in the beginning of translation. In prokaryotes, the initiator tRNA is charged with N-formylmethionine (tRNAfMet); in eukaryotes, the tRNA is charged simply with methionine. inorganic phosphate A phosphate molecule that is not a part of an organic molecule; inorganic phosphate groups are added and removed in the formation and breakdown of ATP and in many other cellular reactions. inositol-1,4,5-trisphosphate (IP3) Second messenger produced by the cleavage of phosphatidylinositol-4,5-bisphosphate. insertional inactivation Destruction of a gene’s function by the insertion of a transposon. instar A larval developmental stage in insects. integrin Any of a group of cell-surface proteins involved in adhesion of cells to substrates. Critical to migrating cells moving through the cell matrix in tissues such as connective tissue. intercalary meristem A type of meristem that arises in stem internodes in some plants, such as corn and horsetails; responsible for elongation of the internodes.
interferon In vertebrates, a protein produced in virus-infected cells that inhibits viral multiplication. intermembrane space The outer compartment of a mitochondrion that lies between the two membranes. interneuron (association neuron) A nerve cell found only in the middle of the spinal cord that acts as a functional link between sensory neurons and motor neurons. internode In plants, the region of a stem between two successive nodes. interoceptor A receptor that senses information related to the body itself, its internal condition, and its position. interphase The period between two mitotic or meiotic divisions in which a cell grows and its DNA replicates; includes G1, S, and G2 phases. intracellular receptor A signal receptor that binds a ligand inside a cell, such as the receptors for NO, steroid hormones, vitamin D, and thyroid hormones. intron Portion of mRNA as transcribed from eukaryotic DNA that is removed by enzymes before the mature mRNA is translated into protein. See exon. inversion A reversal in order of a segment of a chromosome; also, to turn inside out, as in embryogenesis of sponges or discharge of a nematocyst. ionizing radiation High-energy radiation that is highly mutagenic, producing free radicals that react with DNA; includes X-rays and γ-rays. isomer One of a group of molecules identical in atomic composition but differing in structural arrangement; for example, glucose and fructose. isosmotic The condition in which the osmotic concentrations of two solutions are equal, so that no net water movement occurs between them by osmosis. isotonic A solution having the same concentration of solutes as the cell. A cell in an isotonic solution takes in and loses the same amount of water. isotope Different forms of the same element with the same number of protons but different numbers of neutrons.
J jasmonic acid An organic molecule that is part of a plant’s wound response; it signals the production of a proteinase inhibitor.
K karyotype The morphology of the chromosomes of an organism as viewed with a light microscope. keratin A tough, fibrous protein formed in epidermal tissues and modified into skin, feathers, hair, and hard structures such as horns and nails. key innovation A newly evolved trait in a species that allows members to use resources or other aspects of the environment that were previously inaccessible. kidney In vertebrates, the organ that filters the blood to remove nitrogenous wastes and regulates the balance of water and solutes in blood plasma. kilocalorie Unit describing the amount of heat required to raise the temperature of a kilogram of water by 1°C; sometimes called a Calorie, equivalent to 1000 calories. glossary
rav32223_gloss_G1-G24.indd G-11
G-11
11/20/09 3:51:59 PM
kinase cascade A series of protein kinases that phosphorylate each other in succession; a kinase cascade can amplify signals during the signal transduction process. kinesis Changes in activity level in an animal that are dependent on stimulus intensity. See kinetic energy. kinetic energy The energy of motion. kinetochore Disk-shaped protein structure within the centromere to which the spindle fibers attach during mitosis or meiosis. See centromere. kingdom The second highest commonly used taxonomic category. kin selection Selection favoring relatives; an increase in the frequency of related individuals (kin) in a population, leading to an increase in the relative frequency in the population of those alleles shared by members of the kin group. knockout mice Mice in which a known gene is inactivated (“knocked out”) using recombinant DNA and ES cells. Krebs cycle Another name for the citric acid cycle; also called the tricarboxylic acid (TCA) cycle.
L labrum The upper lip of insects and crustaceans situated above or in front of the mandibles. lac operon In E. coli, the operon containing genes that encode the enzymes to metabolize lactose. lagging strand The DNA strand that must be synthesized discontinuously because of the 5to-3 directionality of DNA polymerase during replication, and the antiparallel nature of DNA. Compare leading strand. larva A developmental stage that is unlike the adult found in organisms that undergo metamorphosis. Embryos develop into larvae that produce the adult form by metamorphosis. larynx The voice box; a cartilaginous organ that lies between the pharynx and trachea and is responsible for sound production in vertebrates. lateral line system A sensory system encountered in fish, through which mechanoreceptors in a line down the side of the fish are sensitive to motion. lateral meristems In vascular plants, the meristems that give rise to secondary tissue; the vascular cambium and cork cambium. Law of Independent Assortment Mendel’s second law of heredity, stating that genes located on nonhomologous chromosomes assort independently of one another. Law of Segregation Mendel’s first law of heredity, stating that alternative alleles for the same gene segregate from each other in production of gametes. leading strand The DNA strand that can be synthesized continuously from the origin of replication. Compare lagging strand. leaf primordium, pl. primordia A lateral outgrowth from the apical meristem that will eventually become a leaf. lenticels Spongy areas in the cork surfaces of stem, roots, and other plant parts that allow interchange of gases between internal tissues and the atmosphere through the periderm. leucine zipper motif A motif in regulatory proteins in which two different protein subunits associate to form a single DNA-binding site; the proteins are connected by an association between hydrophobic regions containing leucines (the “zipper”).
G-12
leucoplast In plant cells, a colorless plastid in which starch grains are stored; usually found in cells not exposed to light. leukocyte A white blood cell; a diverse array of nonhemoglobin-containing blood cells, including phagocytic macrophages and antibody-producing lymphocytes. lichen Symbiotic association between a fungus and a photosynthetic organism such as a green alga or cyanobacterium. ligand A signaling molecule that binds to a specific receptor protein, initiating signal transduction in cells. light-dependent reactions In photosynthesis, the reactions in which light energy is captured and used in production of ATP and NADPH. In plants this involves the action of two linked photosystems. light-independent reactions In photosynthesis, the reactions of the Calvin cycle in which ATP and NADPH from the light-dependent reactions are used to reduce CO2 and produce organic compounds such as glucose. This involves the process of carbon fixation, or the conversion of inorganic carbon (CO2) to organic carbon (ultimately carbohydrates). lignin A highly branched polymer that makes plant cell walls more rigid; an important component of wood. limbic system The hypothalamus, together with the network of neurons that link the hypothalamus to some areas of the cerebral cortex. Responsible for many of the most deep-seated drives and emotions of vertebrates, including pain, anger, sex, hunger, thirst, and pleasure. linked genes Genes that are physically close together and therefore tend to segregate together; recombination occurring between linked genes can be used to produce a map of genetic distance for a chromosome. linkage disequilibrium Association of alleles for 2 or more loci in a population that is higher than expected by chance. lipase An enzyme that catalyzes the hydrolysis of fats. lipid A nonpolar hydrophobic organic molecule that is insoluble in water (which is polar) but dissolves readily in nonpolar organic solvents; includes fats, oils, waxes, steroids, phospholipids, and carotenoids. lipid bilayer The structure of a cellular membrane, in which two layers of phospholipids spontaneously align so that the hydrophilic head groups are exposed to water, while the hydrophobic fatty acid tails are pointed toward the center of the membrane. lipopolysaccharide A lipid with a polysaccharide molecule attached; found in the outer membrane layer of gram-negative bacteria; the outer membrane layer protects the cell wall from antibiotic attack. locus The position on a chromosome where a gene is located. long interspersed element (LINE) Any of a type of large transposable element found in humans and other primates that contains all the biochemical machinery needed for transposition. long terminal repeat (LTR) A particular type of retrotransposon that has repeated elements at its ends. These elements make up 8% of the human genome.
loop of Henle In the kidney of birds and mammals, a hairpin-shaped portion of the renal tubule in which water and salt are reabsorbed from the glomerular filtrate by diffusion. lophophore A horseshoe-shaped crown of ciliated tentacles that surrounds the mouth of certain spiralian animals; seen in the phyla Brachiopoda and Bryozoa. lumen A term for any bounded opening; for example, the cisternal space of the endoplasmic reticulum of eukaryotic cells, the passage through which blood flows inside a blood vessel, and the passage through which material moves inside the intestine during digestion. luteal phase The second phase of the female reproductive cycle, during which the mature eggs are released into the fallopian tubes, a process called ovulation. lymph In animals, a colorless fluid derived from blood by filtration through capillary walls in the tissues. lymphatic system In animals, an open vascular system that reclaims water that has entered interstitial regions from the bloodstream (lymph); includes the lymph nodes, spleen, thymus, and tonsils. lymphocyte A type of white blood cell. Lymphocytes are responsible for the immune response; there are two principal classes: B cells and T cells. lymphokine A regulatory molecule that is secreted by lymphocytes. In the immune response, lymphokines secreted by helper T cells unleash the cell-mediated immune response. lysis Disintegration of a cell by rupture of its plasma membrane. lysogenic cycle A viral cycle in which the viral DNA becomes integrated into the host chromosome and is replicated during cell reproduction. Results in vertical rather than horizontal transmission. lysosome A membrane-bounded vesicle containing digestive enzymes that is produced by the Golgi apparatus in eukaryotic cells. lytic cycle A viral cycle in which the host cell is killed (lysed) by the virus after viral duplication to release viral particles.
M macroevolution The creation of new species and the extinction of old ones. macromolecule An extremely large biological molecule; refers specifically to proteins, nucleic acids, polysaccharides, lipids, and complexes of these. macronutrients Inorganic chemical elements required in large amounts for plant growth, such as nitrogen, potassium, calcium, phosphorus, magnesium, and sulfur. macrophage A large phagocytic cell that is able to engulf and digest cellular debris and invading bacteria. madreporite A sievelike plate on the surface of echinoderms through which water enters the water–vascular system. MADS box gene Any of a family of genes identified by possessing shared motifs that are the predominant homeotic genes of plants; a small number of MADS box genes are also found in animals.
glossary
rav32223_gloss_G1-G24.indd G-12
11/20/09 3:51:59 PM
major groove The larger of the two grooves in a DNA helix, where the paired nucleotides’ hydrogen bonds are accessible; regulatory proteins can recognize and bind to regions in the major groove. major histocompatibility complex (MHC) A set of protein cell-surface markers anchored in the plasma membrane, which the immune system uses to identify “self.” All the cells of a given individual have the same “self ” marker, called an MHC protein. Malpighian tubules Blind tubules opening into the hindgut of terrestrial arthropods; they function as excretory organs. mandibles In crustaceans, insects, and myriapods, the appendages immediately posterior to the antennae; used to seize, hold, bite, or chew food. mantle The soft, outermost layer of the body wall in mollusks; the mantle secretes the shell. map unit Each 1% of recombination frequency between two genetic loci; the unit is termed a centimorgan (cM) or simply a map unit (m.u.). marsupial A mammal in which the young are born early in their development, sometimes as soon as eight days after fertilization, and are retained in a pouch. mass extinction A relatively sudden, sharp decline in the number of species; for example, the extinction at the end of the Cretaceous period in which the dinosaurs and a variety of other organisms disappeared. mass flow hypothesis The overall process by which materials move in the phloem of plants. mast cells Leukocytes with granules containing molecules that initiate inflammation. maternal inheritance A mode of uniparental inheritance from the female parent; for example, in humans mitochondria and their genomes are inherited from the mother. matrix In mitochondria, the solution in the interior space surrounded by the cristae that contains the enzymes and other molecules involved in oxidative respiration; more generally, that part of a tissue within which an organ or process is embedded. medusa A free-floating, often umbrella-shaped body form found in cnidarian animals, such as jellyfish. megapascal (MPa) A unit of measure used for pressure in water potential. megaphyll In plants, a leaf that has several to many veins connecting it to the vascular cylinder of the stem; most plants have megaphylls. mesoglea A layer of gelatinous material found between the epidermis and gastrodermis of eumetazoans; it contains the muscles in most of these animals. mesohyl A gelatinous, protein-rich matrix found between the choanocyte layer and the epithelial layer of the body of a sponge; various types of amoeboid cells may occur in the mesohyl. metacercaria An encysted form of a larval liver fluke, found in muscle tissue of an infected animal; if the muscle is eaten, cysts dissolves in the digestive tract, releasing the flukes into the body of the new host. methylation The addition of a methyl group to bases (primarily cytosine) in DNA. Cytosine methylation is correlated with DNA that is not expressed. meiosis I The first round of cell division in meiosis; it is referred to as a “reduction
division” because homologous chromosomes separate, and the daughter cells have only the haploid number of chromosomes. meiosis II The second round of division in meiosis, during which the two haploid cells from meiosis I undergo a mitosis-like division without DNA replication to produce four haploid daughter cells. membrane receptor A signal receptor present as an integral protein in the cell membrane, such as GPCRs, chemically gated ion channels in neurons, and RTKs. Mendelian ratio The characteristic dominantto-recessive phenotypic ratios that Mendel observed in his genetics experiments. For example, the F2 generation in a monohybrid cross shows a ratio of 3:1; the F2 generation in a dihybrid cross shows a ratio of 9:3:3:1. menstruation Periodic sloughing off of the bloodenriched lining of the uterus when pregnancy does not occur. meristem Undifferentiated plant tissue from which new cells arise. meroblastic cleavage A type of cleavage in the eggs of reptiles, birds, and some fish. Occurs only on the blastodisc. mesoderm One of the three embryonic germ layers that form in the gastrula; gives rise to muscle, bone and other connective tissue, the peritoneum, the circulatory system, and most of the excretory and reproductive systems. mesophyll The photosynthetic parenchyma of a leaf, located within the epidermis. messenger RNA (mRNA) The RNA transcribed from structural genes; RNA molecules complementary to a portion of one strand of DNA, which are translated by the ribosomes to form protein. metabolism The sum of all chemical processes occurring within a living cell or organism. metamorphosis Process in which a marked change in form takes place during postembryonic development as, for example, from tadpole to frog. metaphase The stage of mitosis or meiosis during which microtubules become organized into a spindle and the chromosomes come to lie in the spindle’s equatorial plane. metastasis The process by which cancer cells move from their point of origin to other locations in the body; also, a population of cancer cells in a secondary location, the result of movement from the primary tumor. methanogens Obligate, anaerobic archaebacteria that produce methane. microarray DNA sequences are placed on a microscope slide or chip with a robot. The microarray can then be probed with RNA from specific tissues to identify expressed DNA. microbody A cellular organelle bounded by a single membrane and containing a variety of enzymes; generally derived from endoplasmic reticulum; includes peroxisomes and glyoxysomes. microevolution Refers to the evolutionary process itself. Evolution within a species. Also called adaptation. micronutrient A mineral required in only minute amounts for plant growth, such as iron, chlorine, copper, manganese, zinc, molybdenum, and boron.
microphyll In plants, a leaf that has only one vein connecting it to the vascular cylinder of the stem; the club mosses in particular have microphylls. micropyle In the ovules of seed plants, an opening in the integuments through which the pollen tube usually enters. micro-RNA (miRNA) A class of RNAs that are very short and only recently could be detected. See also small interfering RNAs (siRNAs). microtubule In eukaryotic cells, a long, hollow protein cylinder, composed of the protein tubulin; these influence cell shape, move the chromosomes in cell division, and provide the functional internal structure of cilia and flagella. microvillus Cytoplasmic projection from epithelial cells; microvilli greatly increase the surface area of the small intestine. middle lamella The layer of intercellular material, rich in pectic compounds, that cements together the primary walls of adjacent plant cells. mimicry The resemblance in form, color, or behavior of certain organisms (mimics) to other more powerful or more protected ones (models). miracidium The ciliated first-stage larva inside the egg of the liver fluke; eggs are passed in feces, and if they reach water they may be eaten by a host snail in which they continue their life cycle. missense mutation A base substitution mutation that results in the alteration of a single amino acid. mitochondrion The organelle called the powerhouse of the cell. Consists of an outer membrane, an elaborate inner membrane that supports electron transport and chemiosmotic synthesis of ATP, and a soluble matrix containing Krebs cycle enzymes. mitogen-activated protein (MAP) kinase Any of a class of protein kinases that activate transcription factors to alter gene expression. A mitogen is any molecule that stimulates cell division. MAP kinases are activated by kinase cascades. mitosis Somatic cell division; nuclear division in which the duplicated chromosomes separate to form two genetically identical daughter nuclei. molar concentration Concentration expressed as moles of a substance in 1 L of pure water. mole The weight of a substance in grams that corresponds to the atomic masses of all the component atoms in a molecule of that substance. One mole of a compound always contains 6.023 × 1023 molecules. molecular clock method In evolutionary theory, the method in which the rate of evolution of a molecule is constant through time. molecular cloning The isolation and amplification of a specific sequence of DNA. monocot Short for monocotyledon; flowering plant in which the embryos have only one cotyledon, the floral parts are generally in threes, and the leaves typically are parallel-veined. monocyte A type of leukocyte that becomes a phagocytic cell (macrophage) after moving into tissues. monoecious A plant in which the staminate and pistillate flowers are separate, but borne on the same individual. monomer The smallest chemical subunit of a polymer. The monosaccharide α-glucose is the monomer found in plant starch, a polysaccharide. glossary
rav32223_gloss_G1-G24.indd G-13
G-13
11/20/09 3:51:59 PM
monophyletic In phylogenetic classification, a group that includes the most recent common ancestor of the group and all its descendants. A clade is a monophyletic group. monosaccharide A simple sugar that cannot be decomposed into smaller sugar molecules. monosomic Describes the condition in which a chromosome has been lost due to nondisjunction during meiosis, producing a diploid embryo with only one of these autosomes. monotreme An egg-laying mammal. morphogen A signal molecule produced by an embryonic organizer region that informs surrounding cells of their distance from the organizer, thus determining relative positions of cells during development. morphogenesis The development of an organism’s body form, namely its organs and anatomical features; it may involve apoptosis as well as cell division, differentiation, and changes in cell shape. morphology The form and structure of an organism. morula Solid ball of cells in the early stage of embryonic development. mosaic development A pattern of embryonic development in which initial cells produced by cleavage divisions contain different developmental signals (determinants) from the egg, setting the individual cells on different developmental paths. motif A substructure in proteins that confers function and can be found in multiple proteins. One example is the helix-turn-helix motif found in a number of proteins that is used to bind to DNA. motor (efferent) neuron Neuron that transmits nerve impulses from the central nervous system to an effector, which is typically a muscle or gland. M phase The phase of cell division during which chromosomes are separated. The spindle assembles, binds to the chromosomes, and moves the sister chromatids apart. M phase-promoting factor (MPF) A Cdk enzyme active at the G2/M checkpoint. Müllerian mimicry A phenomenon in which two or more unrelated but protected species resemble one another, thus achieving a kind of group defense. multidrug-resistant (MDR) strain Any bacterial strain that has become resistant to more than one antibiotic drug; MDR Staphylococcus strains, for example, are responsible for many infection deaths. multienzyme complex An assembly consisting of several enzymes catalyzing different steps in a sequence of reactions. Close proximity of these related enzymes speeds the overall process, making it more efficient. multigene family A collection of related genes on a single chromosome or on different chromosomes. muscle fiber A long, cylindrical, multinucleated cell containing numerous myofibrils, which is capable of contraction when stimulated. mutagen An agent that induces changes in DNA (mutations); includes physical agents that damage DNA and chemicals that alter DNA bases.
G-14
mutation A permanent change in a cell’s DNA; includes changes in nucleotide sequence, alteration of gene position, gene loss or duplication, and insertion of foreign sequences. mutualism A symbiotic association in which two (or more) organisms live together, and both members benefit. mycelium, pl. mycelia In fungi, a mass of hyphae. mycorrhiza, pl. mycorrhizae A symbiotic association between fungi and the roots of a plant. myelin sheath A fatty layer surrounding the long axons of motor neurons in the peripheral nervous system of vertebrates. myofilament A contractile microfilament, composed largely of actin and myosin, within muscle. myosin One of the two protein components of microfilaments (the other is actin); a principal component of vertebrate muscle.
N natural killer cell A cell that does not kill invading microbes, but rather, the cells infected by them. natural selection The differential reproduction of genotypes; caused by factors in the environment; leads to evolutionary change. nauplius A larval form characteristic of crustaceans. negative control A type of control at the level of DNA transcription initiation in which the frequency of initiation is decreased; repressor proteins mediate negative control. negative feedback A homeostatic control mechanism whereby an increase in some substance or activity inhibits the process leading to the increase; also known as feedback inhibition. nematocyst A harpoonlike structure found in the cnidocytes of animals in the phylum Cnidaria, which includes the jellyfish among other groups; the nematocyst, when released, stings and helps capture prey. nephridium, pl. nephridia In invertebrates, a tubular excretory structure. nephrid organ A filtration system of many freshwater invertebrates in which water and waste pass from the body across the membrane into a collecting organ, from which they are expelled to the outside through a pore. nephron Functional unit of the vertebrate kidney; one of numerous tubules involved in filtration and selective reabsorption of blood; each nephron consists of a Bowman’s capsule, an enclosed glomerulus, and a long attached tubule; in humans, called a renal tubule. nephrostome The funnel-shaped opening that leads to the nephridium, which is the excretory organ of mollusks. nerve A group or bundle of nerve fibers (axons) with accompanying neurological cells, held together by connective tissue; located in the peripheral nervous system. nerve cord One of the distinguishing features of chordates, running lengthwise just beneath the embryo’s dorsal surface; in vertebrates, differentiates into the brain and spinal cord. neural crest A special strip of cells that develops just before the neural groove closes over to form the neural tube in embryonic development.
neural groove The long groove formed along the long axis of the embryo by a layer of ectodermal cells. neural tube The dorsal tube, formed from the neural plate, that differentiates into the brain and spinal cord. neuroglia Nonconducting nerve cells that are intimately associated with neurons and appear to provide nutritional support. neuromuscular junction The structure formed when the tips of axons contact (innervate) a muscle fiber. neuron A nerve cell specialized for signal transmission; includes cell body, dendrites, and axon. neurotransmitter A chemical released at the axon terminal of a neuron that travels across the synaptic cleft, binds a specific receptor on the far side, and depending on the nature of the receptor, depolarizes or hyperpolarizes a second neuron or a muscle or gland cell. neurulation A process in early embryonic development by which a dorsal band of ectoderm thickens and rolls into the neural tube. neutrophil An abundant type of granulocyte capable of engulfing microorganisms and other foreign particles; neutrophils comprise about 50–70% of the total number of white blood cells. niche The role played by a particular species in its environment. nicotinamide adenine dinucleotide (NAD) A molecule that becomes reduced (to NADH) as it carries high-energy electrons from oxidized molecules and delivers them to ATP-producing pathways in the cell. NADH dehydrogenase An enzyme located on the inner mitochondrial membrane that catalyzes the oxidation by NAD+ of pyruvate to acetylCoA. This reaction links glycolysis and the Krebs cycle. nitrification The oxidization of ammonia or nitrite to produce nitrate, the form of nitrogen taken up by plants; some bacteria are capable of nitrification. nociceptor A naked dendrite that acts as a receptor in response to a pain stimulus. nocturnal Active primarily at night. node The part of a plant stem where one or more leaves are attached. See internode. node of Ranvier A gap formed at the point where two Schwann cells meet and where the axon is in direct contact with the surrounding intercellular fluid. nodule In plants, a specialized tissue that surrounds and houses beneficial bacteria, such as root nodules of legumes that contain nitrogen-fixing bacteria. nonassociative learning A learned behavior that does not require an animal to form an association between two stimuli, or between a stimulus and a response. noncompetitive inhibitor An inhibitor that binds to a location other than the active site of an enzyme, changing the enzyme’s shape so that it cannot bind the substrate. noncyclic photophosphorylation The set of light-dependent reactions of the two plant photosystems, in which excited electrons are shuttled between the two photosystems, producing a proton gradient that is used for the
glossary
rav32223_gloss_G1-G24.indd G-14
11/20/09 3:51:59 PM
chemiosmotic synthesis of ATP. The electrons are used to reduce NADP to NADPH. Lost electrons are replaced by the oxidation of water producing O2. nondisjunction The failure of homologues or sister chromatids to separate during mitosis or meiosis, resulting in an aneuploid cell or gamete. nonextreme archaea Archaean groups that are not extremophiles, living in more moderate environments on Earth today. nonpolar Said of a covalent bond that involves equal sharing of electrons. Can also refer to a compound held together by nonpolar covalent bonds. nonsense codon One of three codons (UAA, UAG, and UGA) that are not recognized by tRNAs, thus serving as “stop” signals in the mRNA message and terminating translation. nonsense mutation A base substitution in which a codon is changed into a stop codon. The protein is truncated because of premature termination. Northern blot A blotting technique used to identify a specific mRNA sequence in a complex mixture. See Southern blot. notochord In chordates, a dorsal rod of cartilage that runs the length of the body and forms the primitive axial skeleton in the embryos of all chordates. nucellus Tissue composing the chief pair of young ovules, in which the embryo sac develops; equivalent to a megasporangium. nuclear envelope The bounding structure of the eukaryotic nucleus. Composed of two phospholipid bilayers with the outer one connected to the endoplasmic reticulum. nuclear pore One of a multitude of tiny but complex openings in the nuclear envelope that allow selective passage of proteins and nucleic acids into and out of the nucleus. nuclear receptor Intracellular receptors are found in both the cytoplasm and the nucleus. The site of action of the hormone–receptor complex is in the nucleus where they modify gene expression. nucleic acid A nucleotide polymer; chief types are deoxyribonucleic acid (DNA), which is doublestranded, and ribonucleic acid (RNA), which is typically single-stranded. nucleoid The area of a prokaryotic cell, usually near the center, that contains the genome in the form of DNA compacted with protein. nucleolus In eukaryotes, the site of rRNA synthesis; a spherical body composed chiefly of rRNA in the process of being transcribed from multiple copies of rRNA genes. nucleosome A complex consisting of a DNA duplex wound around a core of eight histone proteins. nucleotide A single unit of nucleic acid, composed of a phosphate, a five-carbon sugar (either ribose or deoxyribose), and a purine or a pyrimidine. nucleus In atoms, the central core, containing positively charged protons and (in all but hydrogen) electrically neutral neutrons; in eukaryotic cells, the membranous organelle that houses the chromosomal DNA; in the central nervous system, a cluster of nerve cell bodies. nutritional mutation A mutation affecting a synthetic pathway for a vital compound, such as an amino acid or vitamin; microorganisms with a nutritional mutation must be grown on medium that supplies the missing nutrient.
O ocellus, pl. ocelli A simple light receptor common among invertebrates. octet rule Rule to describe patterns of chemical bonding in main group elements that require a total of eight electrons to complete their outer electron shell. Okazaki fragment A short segment of DNA produced by discontinuous replication elongating in the 5-to-3 direction away from the replication. olfaction The function of smelling. ommatidium, pl. ommatidia The visual unit in the compound eye of arthropods; contains lightsensitive cells and a lens able to form an image. oncogene A mutant form of a growth-regulating gene that is inappropriately “on,” causing unrestrained cell growth and division. oocyst The zygote in a sporozoan life cycle. It is surrounded by a tough cyst to prevent dehydration or other damage. open circulatory system A circulatory system in which the blood flows into sinuses in which it mixes with body fluid and then reenters the vessels in another location. open reading frame (ORF) A region of DNA that encodes a sequence of amino acids with no stop codons in the reading frame. operant conditioning A learning mechanism in which the reward follows only after the correct behavioral response. operator A regulatory site on DNA to which a repressor can bind to prevent or decrease initiation of transcription. operculum A flat, bony, external protective covering over the gill chamber in fish. operon A cluster of adjacent structural genes transcribed as a unit into a single mRNA molecule. opisthosoma The posterior portion of the body of an arachnid. oral surface The surface on which the mouth is found; used as a reference when describing the body structure of echinoderms because of their adult radial symmetry. orbital A region around the nucleus of an atom with a high probability of containing an electron. The position of electrons can only be described by these probability distributions. order A category of classification above the level of family and below that of class. organ A body structure composed of several different tissues grouped in a structural and functional unit. organelle Specialized part of a cell; literally, a small cytoplasmic organ. orthologues Genes that reflect the conservation of a single gene found in an ancestor. oscillating selection The situation in which selection alternately favors one phenotype at one time, and a different phenotype at a another time, for example, during drought conditions versus during wet conditions. osculum A specialized, larger pore in sponges through which filtered water is forced to the outside of the body. osmoconformer An animal that maintains the osmotic concentration of its body fluids at about the same level as that of the medium in which it is living.
osmosis The diffusion of water across a selectively permeable membrane (a membrane that permits the free passage of water but prevents or retards the passage of a solute); in the absence of differences in pressure or volume, the net movement of water is from the side containing a lower concentration of solute to the side containing a higher concentration. osmotic concentration The property of a solution that takes into account all dissolved solutes in the solution; if two solutions with different osmotic concentrations are separated by a water-permeable membrane, water will move from the solution with lower osmotic concentration to the solution with higher osmotic concentration. osmotic pressure The potential pressure developed by a solution separated from pure water by a differentially permeable membrane. The higher the solute concentration, the greater the osmotic potential of the solution; also called osmotic potential. ossicle Any of a number of movable or fixed calcium-rich plates that collectively make up the endoskeleton of echinoderms. osteoblast A bone-forming cell. osteocyte A mature osteoblast. outcrossing Breeding with individuals other than oneself or one’s close relatives. ovary (1) In animals, the organ in which eggs are produced. (2) In flowering plants, the enlarged basal portion of a carpel that contains the ovule(s); the ovary matures to become the fruit. oviduct In vertebrates, the passageway through which ova (eggs) travel from the ovary to the uterus. oviparity Refers to a type of reproduction in which the eggs are developed after leaving the body of the mother, as in reptiles. ovoviviparity Refers to a type of reproduction in which young hatch from eggs that are retained in the mother’s uterus. ovulation In animals, the release of an egg or eggs from the ovary. ovum, pl. ova The egg cell; female gamete. oxidation Loss of an electron by an atom or molecule; in metabolism, often associated with a gain of oxygen or a loss of hydrogen. oxidation–reduction reaction A type of paired reaction in living systems in which electrons lost from one atom (oxidation) are gained by another atom (reduction). Termed a redox reaction for short. oxidative phosphorylation Synthesis of ATP by ATP synthase using energy from a proton gradient. The proton gradient is generated by electron transport, which requires oxygen. oxygen debt The amount of oxygen required to convert the lactic acid generated in the muscles during exercise back into glucose. oxytocin A hormone of the posterior pituitary gland that affects uterine contractions during childbirth and stimulates lactation. ozone O3, a stratospheric layer of the Earth’s atmosphere responsible for filtering out ultraviolet radiation supplied by the Sun. glossary
rav32223_gloss_G1-G24.indd G-15
G-15
11/20/09 3:52:00 PM
P
p53 gene The gene that produces the p53 protein that monitors DNA integrity and halts cell division if DNA damage is detected. Many types of cancer are associated with a damaged or absent p53 gene. pacemaker A patch of excitatory tissue in the vertebrate heart that initiates the heartbeat. pair-rule gene Any of certain genes in Drosophila development controlled by the gap genes that are expressed in stripes that subdivide the embryo in the process of segmentation. paleopolyploid An ancient polyploid organism used in analysis of polyploidy events in the study of a species’ genome evolution. palisade parenchyma In plant leaves, the columnar, chloroplast-containing parenchyma cells of the mesophyll. Also called palisade cells. panspermia The hypothesis that meteors or cosmic dust may have brought significant amounts of complex organic molecules to Earth, kicking off the evolution of life. papilla A small projection of tissue. paracrine A type of chemical signaling between cells in which the effects are local and short-lived. paralogues Two genes within an organism that arose from the duplication of one gene in an ancestor. paraphyletic In phylogenetic classification, a group that includes the most recent common ancestor of the group, but not all its descendants. parapodia One of the paired lateral processes on each side of most segments in polychaete annelids. parasexuality In certain fungi, the fusion and segregation of heterokaryotic haploid nuclei to produce recombinant nuclei. parasitism A living arrangement in which an organism lives on or in an organism of a different species and derives nutrients from it. parenchyma cell The most common type of plant cell; characterized by large vacuoles, thin walls, and functional nuclei. parthenogenesis The development of an egg without fertilization, as in aphids, bees, ants, and some lizards. partial diploid (merodiploid) Describes an E. coli cell that carries an F plasmid with host genes. This makes the cell diploid for the genes carried by the F plasmid. partial pressure The components of each individual gas—such as nitrogen, oxygen, and carbon dioxide—that together constitute the total air pressure. passive transport The movement of substances across a cell’s membrane without the expenditure of energy. pedigree A consistent graphic representation of matings and offspring over multiple generations for a particular genetic trait, such as albinism or hemophilia. pedipalps A pair of specialized appendages found in arachnids; in male spiders, these are specialized as copulatory organs, whereas in scorpions they are large pincers. pelagic Free-swimming, usually in open water. pellicle A tough, flexible covering in ciliates and euglenoids. pentaradial symmetry The five-part radial symmetry characteristic of adult echinoderms.
G-16
peptide bond The type of bond that links amino acids together in proteins through a dehydration reaction. peptidoglycan A component of the cell wall of bacteria, consisting of carbohydrate polymers linked by protein cross-bridges. peptidyl transferase In translation, the enzyme responsible for catalyzing the formation of a peptide bond between each new amino acid and the previous amino acid in a growing polypeptide chain. perianth In flowering plants, the petals and sepals taken together. pericycle In vascular plants, one or more cell layers surrounding the vascular tissues of the root, bounded externally by the endodermis and internally by the phloem. periderm Outer protective tissue in vascular plants that is produced by the cork cambium and functionally replaces epidermis when it is destroyed during secondary growth; the periderm includes the cork, cork cambium, and phelloderm. peristalsis In animals, a series of alternating contracting and relaxing muscle movements along the length of a tube such as the oviduct or alimentary canal that tend to force material such as an egg cell or food through the tube. peroxisome A microbody that plays an important role in the breakdown of highly oxidative hydrogen peroxide by catalase. petal A flower part, usually conspicuously colored; one of the units of the corolla. petiole The stalk of a leaf. phage conversion The phenomenon by which DNA from a virus, incorporated into a host cell’s genome, alters the host cell’s function in a significant way; for example, the conversion of Vibrio cholerae bacteria into a pathogenic form that releases cholera toxin. phage lambda (λ) A well-known bacteriophage that has been widely used in genetic studies and is often a vector for DNA libraries. phagocyte Any cell that engulfs and devours microorganisms or other particles. phagocytosis Endocytosis of a solid particle; the plasma membrane folds inward around the particle (which may be another cell) and engulfs it to form a vacuole. pharyngeal pouches In chordates, embryonic regions that become pharyngeal slits in aquatic and marine chordates and vertebrates, but do not develop openings to the outside in terrestrial vertebrates. pharyngeal slits One of the distinguishing features of chordates; a group of openings on each side of the anterior region that form a passageway from the pharynx and esophagus to the external environment. pharynx A muscular structure lying posterior to the mouth in many animals; aids in propelling food into the digestive tract. phenotype The realized expression of the genotype; the physical appearance or functional expression of a trait. pheromone Chemical substance released by one organism that influences the behavior or physiological processes of another organism of the same species. Pheromones serve as sex attractants, as trail markers, and as alarm signals.
phloem In vascular plants, a food-conducting tissue basically composed of sieve elements, various kinds of parenchyma cells, fibers, and sclereids. phoronid Any of a group of lophophorate invertebrates, now classified in the phylum Brachiopoda, that burrows into soft underwater substrates and secretes a chitinous tube in which it lives out its life; it extends its lophophore tentacles to feed on drifting food particles. phosphatase Any of a number of enzymes that removes a phosphate group from a protein, reversing the action of a kinase. phosphodiester bond The linkage between two sugars in the backbone of a nucleic acid molecule; the phosphate group connects the pentose sugars through a pair of ester bonds. phospholipid Similar in structure to a fat, but having only two fatty acids attached to the glycerol backbone, with the third space linked to a phosphorylated molecule; contains a polar hydrophilic “head” end (phosphate group) and a nonpolar hydrophobic “tail” end (fatty acids). phospholipid bilayer The main component of cell membranes; phospholipids naturally associate in a bilayer with hydrophobic fatty acids oriented to the inside and hydrophilic phosphate groups facing outward on both sides. phosphorylation Chemical reaction resulting in the addition of a phosphate group to an organic molecule. Phosphorylation of ADP yields ATP. Many proteins are also activated or inactivated by phosphorylation. photoelectric effect The ability of a beam of light to excite electrons, creating an electrical current. photon A particle of light having a discrete amount of energy. The wave concept of light explains the different colors of the spectrum, whereas the particle concept of light explains the energy transfers during photosynthesis. photoperiodism The tendency of biological reactions to respond to the duration and timing of day and night; a mechanism for measuring seasonal time. photoreceptor A light-sensitive sensory cell. photorespiration Action of the enzyme rubisco, which catalyzes the oxidization of RuBP, releasing CO2; this reverses carbon fixation and can reduce the yield of photosynthesis. photosystem An organized complex of chlorophyll, other pigments, and proteins that traps light energy as excited electrons. Plants have two linked photosystems in the thylakoid membrane of chloroplasts. Photosystem II passes an excited electron through an electron transport chain to photosystem I to replace an excited electron passed to NADPH. The electron lost from photosystem II is replaced by the oxidation of water. phototropism In plants, a growth response to a light stimulus. pH scale A scale used to measure acidity and basicity. Defined as the negative log of H+ concentration. Ranges from 0 to 14. A value of 7 is neutral; below 7 is acidic and above 7 is basic. phycobiloprotein A type of accessory pigment found in cyanobacteria and some algae. Complexes of phycobiloprotein are able to absorb light energy in the green range.
glossary
rav32223_gloss_G1-G24.indd G-16
11/20/09 3:52:00 PM
phycologist A scientist who studies algae. phyllotaxy In plants, a spiral pattern of leaf arrangement on a stem in which sequential leaves are at a 137.5° angle to one another, an angle related to the golden mean. phylogenetic species concept (PSC) The concept that defines species on the basis of their phylogenetic relationships. phylogenetic tree A pattern of descent generated by analysis of similarities and differences among organisms. Modern gene-sequencing techniques have produced phylogenetic trees showing the evolutionary history of individual genes. phylogeny The evolutionary history of an organism, including which species are closely related and in what order related species evolved; often represented in the form of an evolutionary tree. phylum, pl. phyla A major category, between kingdom and class, of taxonomic classifications. physical map A map of the DNA sequence of a chromosome or genome based on actual landmarks within the DNA. phytochrome A plant pigment that is associated with the absorption of light; photoreceptor for red to far-red light. phytoestrogen One of a number of secondary metabolites in some plants that are structurally and functionally similar to the animal hormone estrogen. phytoremediation The process that uses plants to remove contamination from soil or water. pigment A molecule that absorbs light. pilus, pl. pili Extensions of a bacterial cell enabling it to transfer genetic materials from one individual to another or to adhere to substrates. pinocytosis The process of fluid uptake by endocytosis in a cell. pistil Central organ of flowers, typically consisting of ovary, style, and stigma; a pistil may consist of one or more fused carpels and is more technically and better known as the gynoecium. pith The ground tissue occupying the center of the stem or root within the vascular cylinder. pituitary gland Endocrine gland at the base of the hypothalamus composed of anterior and posterior lobes. Pituitary hormones affect a wide variety of processes in vertebrates. placenta, pl. placentae (1) In flowering plants, the part of the ovary wall to which the ovules or seeds are attached. (2) In mammals, a tissue formed in part from the inner lining of the uterus and in part from other membranes, through which the embryo (later the fetus) is nourished while in the uterus and through which wastes are carried away. plankton Free-floating, mostly microscopic, aquatic organisms. plant receptor kinase Any of a group of plant membrane receptors that, when activated by binding ligand, have kinase enzymatic activity. These receptors phosphorylate serine or threonine, unlike RTKs in animals that phosphorylate tyrosine. planula A ciliated, free-swimming larva produced by the medusae of cnidarian animals. plasma The fluid of vertebrate blood; contains dissolved salts, metabolic wastes, hormones, and a variety of proteins, including antibodies and albumin; blood minus the blood cells.
plasma cell An antibody-producing cell resulting from the multiplication and differentiation of a B lymphocyte that has interacted with an antigen. plasma membrane The membrane surrounding the cytoplasm of a cell; consists of a single phospholipid bilayer with embedded proteins. plasmid A small fragment of extrachromosomal DNA, usually circular, that replicates independently of the main chromosome, although it may have been derived from it. plasmodesmata In plants, cytoplasmic connections between adjacent cells. plasmodium Stage in the life cycle of myxomycetes (plasmodial slime molds); a multinucleate mass of protoplasm surrounded by a membrane. plasmolysis The shrinking of a plant cell in a hypertonic solution such that it pulls away from the cell wall. plastid An organelle in the cells of photosynthetic eukaryotes that is the site of photosynthesis and, in plants and green algae, of starch storage. platelet In mammals, a fragment of a white blood cell that circulates in the blood and functions in the formation of blood clots at sites of injury. pleiotropy Condition in which an individual allele has more than one effect on production of the phenotype. plesiomorphy In cladistics, another term for an ancestral character state. plumule The epicotyl of a plant with its two young leaves. point mutation An alteration of one nucleotide in a chromosomal DNA molecule. polar body Minute, nonfunctioning cell produced during the meiotic divisions leading to gamete formation in vertebrates. polar covalent bond A covalent bond in which electrons are shared unequally due to differences in electronegativity of the atoms involved. One atom has a partial negative charge and the other a partial positive charge, even though the molecule is electrically neutral overall. polarity (1) Refers to unequal charge distribution in a molecule such as water, which has a positive region and a negative region although it is neutral overall. (2) Refers to axial differences in a developing embryo that result in anterior– posterior and dorsal–ventral axes in a bilaterally symmetrical animal. polarize In cladistics, to determine whether character states are ancestral or derived. pollen tube A tube formed after germination of the pollen grain; carries the male gametes into the ovule. pollination The transfer of pollen from an anther to a stigma. polyandry The condition in which a female mates with more than one male. polyclonal antibody An antibody response in which an antigen elicits many different antibodies, each fitting a different portion of the antigen surface. polygenic inheritance Describes a mode of inheritance in which more than one gene affects a trait, such as height in human beings; polygenic inheritance may produce a continuous range of phenotypic values, rather than discrete either–or values.
polygyny A mating choice in which a male mates with more than one female. polymer A molecule composed of many similar or identical molecular subunits; starch is a polymer of glucose. polymerase chain reaction (PCR) A process by which DNA polymerase is used to copy a sequence of interest repeatedly, making millions of copies of the same DNA. polymorphism The presence in a population of more than one allele of a gene at a frequency greater than that of newly arising mutations. polyp A typically sessile, cylindrical body form found in cnidarian animals, such as hydras. polypeptide A molecule consisting of many joined amino acids; not usually as complex as a protein. polyphyletic In phylogenetic classification, a group that does not include the most recent common ancestor of all members of the group. polyploidy Condition in which one or more entire sets of chromosomes is added to the diploid genome. polysaccharide A carbohydrate composed of many monosaccharide sugar subunits linked together in a long chain; examples are glycogen, starch, and cellulose. polyunsaturated fat A fat molecule having at least two double bonds between adjacent carbons in one or more of the fatty acid chains. population Any group of individuals, usually of a single species, occupying a given area at the same time. population genetics The study of the properties of genes in populations. positive control A type of control at the level of DNA transcription initiation in which the frequency of initiation is increased; activator proteins mediate positive control. posttranscriptional control A mechanism of control over gene expression that operates after the transcription of mRNA is complete. postzygotic isolating mechanism A type of reproductive isolation in which zygotes are produced but are unable to develop into reproducing adults; these mechanisms may range from inviability of zygotes or embryos to adults that are sterile. potential energy Energy that is not being used, but could be; energy in a potentially usable form; often called “energy of position.” precapillary sphincter A ring of muscle that guards each capillary loop and that, when closed, blocks flow through the capillary. pre-mRNA splicing In eukaryotes, the process by which introns are removed from the primary transcript to produce mature mRNA; premRNA splicing occurs in the nucleus. pressure potential In plants, the turgor pressure resulting from pressure against the cell wall. prezygotic isolating mechanism A type of reproductive isolation in which the formation of a zygote is prevented; these mechanisms may range from physical separation in different habitats to gametic in which gametes are incapable of fusing. primary endosperm nucleus In flowering plants, the result of the fusion of a sperm nucleus and the (usually) two polar nuclei. glossary
rav32223_gloss_G1-G24.indd G-17
G-17
11/20/09 3:52:00 PM
primary growth In vascular plants, growth originating in the apical meristems of shoots and roots; results in an increase in length. primary immune response The first response of an immune system to a foreign antigen. If the system is challenged again with the same antigen, the memory cells created during the primary response will respond more quickly. primary induction Inductions between the three primary tissue types: mesoderm and endoderm. primary meristem Any of the three meristems produced by the apical meristem; primary meristems give rise to the dermal, vascular, and ground tissues. primary nondisjunction Failure of chromosomes to separate properly at meiosis I. primary phloem The cells involved in food conduction in plants. primary plant body The part of a plant consisting of young, soft shoots and roots derived from apical meristem tissues. primary productivity The amount of energy produced by photosynthetic organisms in a community. primary structure The specific amino acid sequence of a protein. primary tissues Tissues that make up the primary plant body. primary transcript The initial mRNA molecule copied from a gene by RNA polymerase, containing a faithful copy of the entire gene, including introns as well as exons. primary wall In plants, the wall layer deposited during the period of cell expansion. primase The enzyme that synthesizes the RNA primers required by DNA polymerases. primate Monkeys and apes (including humans). primitive streak In the early embryos of birds, reptiles, and mammals, a dorsal, longitudinal strip of ectoderm and mesoderm that is equivalent to the blastopore in other forms. primordium In plants, a bulge on the young shoot produced by the apical meristem; primordia can differentiate into leaves, other shoots, or flowers. principle of parsimony Principle stating that scientists should favor the hypothesis that requires the fewest assumptions. prions Infectious proteinaceous particles. procambium In vascular plants, a primary meristematic tissue that gives rise to primary vascular tissues. product rule See rule of multiplication. proglottid A repeated body segment in tapeworms that contains both male and female reproductive organs; proglottids eventually form eggs and embryos, which leave the host’s body in feces. prokaryote A bacterium; a cell lacking a membrane-bounded nucleus or membranebounded organelles. prometaphase The transitional phase between prophase and metaphase during which the spindle attaches to the kinetochores of sister chromatids. promoter A DNA sequence that provides a recognition and attachment site for RNA polymerase to begin the process of gene transcription; it is located upstream from the transcription start site.
G-18
prophase The phase of cell division that begins when the condensed chromosomes become visible and ends when the nuclear envelope breaks down. The assembly of the spindle takes place during prophase. proprioceptor In vertebrates, a sensory receptor that senses the body’s position and movements. prosimian Any member of the mammalian group that is a sister group to the anthropoids; prosimian means “before monkeys.” Members include the lemurs, lorises, and tarsiers. prosoma The anterior portion of the body of an arachnid, which bears all the appendages. prostaglandins A group of modified fatty acids that function as chemical messengers. prostate gland In male mammals, a mass of glandular tissue at the base of the urethra that secretes an alkaline fluid that has a stimulating effect on the sperm as they are released. protease An enzyme that degrades proteins by breaking peptide bonds; in cells, proteases are often compartmentalized into vesicles such as lysosomes. proteasome A large, cylindrical cellular organelle that degrades proteins marked with ubiquitin. protein A chain of amino acids joined by peptide bonds. protein kinase An enzyme that adds phosphate groups to proteins, changing their activity. protein microarray An array of proteins on a microscope slide or silicon chip. The array may be used with a variety of probes, including antibodies, to analyze the presence or absence of specific proteins in a complex mixture. proteome All the proteins coded for by a particular genome. proteomics The study of the proteomes of organisms. This is related to functional genomics as the proteome is responsible for much of the function encoded by a genome. protoderm The primary meristem that gives rise to the dermal tissue. proton pump A protein channel in a membrane of the cell that expends energy to transport protons against a concentration gradient; involved in the chemiosmotic generation of ATP. proto-oncogene A normal cellular gene that can act as an oncogene when mutated. protostome Any member of a grouping of bilaterally symmetrical animals in which the mouth develops first and the anus second; flatworms, nematodes, mollusks, annelids, and arthropods are protostomes. pseudocoel A body cavity located between the endoderm and mesoderm. pseudogene A copy of a gene that is not transcribed. pseudomurien A component of the cell wall of archaea; it is similar to peptidoglycan in structure and function but contains different components. pseudopod A nonpermanent cytoplasmic extension of the cell body. P site In a ribosome, the peptidyl site that binds to the tRNA attached to the growing polypeptide chain. punctuated equilibrium A hypothesis about the mechanism of evolutionary change proposing that long periods of little or no change are punctuated by periods of rapid evolution.
Punnett square A diagrammatic way of showing the possible genotypes and phenotypes of genetic crosses. pupa A developmental stage of some insects in which the organism is nonfeeding, immotile, and sometimes encapsulated or in a cocoon; the pupal stage occurs between the larval and adult phases. purine The larger of the two general kinds of nucleotide base found in DNA and RNA; a nitrogenous base with a double-ring structure, such as adenine or guanine. pyrimidine The smaller of two general kinds of nucleotide base found in DNA and RNA; a nitrogenous base with a single-ring structure, such as cytosine, thymine, or uracil. pyruvate A three-carbon molecule that is the end product of glycolysis; each glucose molecule yields two pyruvate molecules.
Q quantitative trait A trait that is determined by the effects of more than one gene; such a trait usually exhibits continuous variation rather than discrete either–or values. quaternary structure The structural level of a protein composed of more than one polypeptide chain, each of which has its own tertiary structure; the individual chains are called subunits.
R radial canal Any of five canals that connect to the ring canal of an echinoderm’s water–vascular system. radial cleavage The embryonic cleavage pattern of deuterostome animals in which cells divide parallel to and at right angles to the polar axis of the embryo. radial symmetry A type of structural symmetry with a circular plan, such that dividing the body or structure through the midpoint in any direction yields two identical sections. radicle The part of the plant embryo that develops into the root. radioactive isotope An isotope that is unstable and undergoes radioactive decay, releasing energy. radioactivity The emission of nuclear particles and rays by unstable atoms as they decay into more stable forms. radula Rasping tongue found in most mollusks. reaction center A transmembrane protein complex in a photosystem that receives energy from the antenna complex exciting an electron that is passed to an acceptor molecule. reading frame The correct succession of nucleotides in triplet codons that specify amino acids on translation. The reading frame is established by the first codon in the sequence as there are no spaces in the genetic code. realized niche The actual niche occupied by an organism when all biotic and abiotic interactions are taken into account. receptor-mediated endocytosis Process by which specific macromolecules are transported into eukaryotic cells at clathrin-coated pits, after binding to specific cell-surface receptors.
glossary
rav32223_gloss_G1-G24.indd G-18
11/20/09 3:52:00 PM
receptor protein A highly specific cell-surface receptor embedded in a cell membrane that responds only to a specific messenger molecule. receptor tyrosine kinase (RTK) A diverse group of membrane receptors that when activated have kinase enzymatic activity. Specifically, they phosphorylate proteins on tyrosine. Their activation can lead to diverse cellular responses. recessive An allele that is only expressed when present in the homozygous condition, but being “hidden” by the expression of a dominant allele in the heterozygous condition. redia A secondary, nonciliated larva produced in the sporocysts of liver flukes. regulatory protein Any of a group of proteins that modulates the ability of RNA polymerase to bind to a promoter and begin DNA transcription. replicon An origin of DNA replication and the DNA whose replication is controlled by this origin. In prokaryotic replication, the chromosome plus the origin consist of a single replicon; eukaryotic chromosomes consist of multiple replicons. replisome The macromolecular assembly of enzymes involved in DNA replication; analogous to the ribosome in protein synthesis. reciprocal altruism Performance of an altruistic act with the expectation that the favor will be returned. A key and very controversial assumption of many theories dealing with the evolution of social behavior. See altruism. reciprocal cross A genetic cross involving a single trait in which the sex of the parents is reversed; for example, if pollen from a white-flowered plant is used to fertilize a purple-flowered plant, the reciprocal cross would be pollen from a purple-flowered plant used to fertilize a whiteflowered plant. reciprocal recombination A mechanism of genetic recombination that occurs only in eukaryotic organisms, in which two chromosomes trade segments; can occur between nonhomologous chromosomes as well as the more usual exchange between homologous chromosomes in meiosis. recombinant DNA Fragments of DNA from two different species, such as a bacterium and a mammal, spliced together in the laboratory into a single molecule. recombination frequency The value obtained by dividing the number of recombinant progeny by the total progeny in a genetic cross. This value is converted into a percentage, and each 1% is termed a map unit. reduction The gain of an electron by an atom, often with an associated proton. reflex In the nervous system, a motor response subject to little associative modification; a reflex is among the simplest neural pathways, involving only a sensory neuron, sometimes (but not always) an interneuron, and one or more motor neurons. reflex arc The nerve path in the body that leads from stimulus to reflex action. refractory period The recovery period after membrane depolarization during which the membrane is unable to respond to additional stimulation. reinforcement In speciation, the process by which partial reproductive isolation between
populations is increased by selection against mating between members of the two populations, eventually resulting in complete reproductive isolation. replica plating A method of transferring bacterial colonies from one plate to another to make a copy of the original plate; an impression of colonies growing on a Petri plate is made on a velvet surface, which is then used to transfer the colonies to plates containing different media, such that auxotrophs can be identified. replication fork The Y-shaped end of a growing replication bubble in a DNA molecule undergoing replication. repolarization Return of the ions in a nerve to their resting potential distribution following depolarization. repression In general, control of gene expression by preventing transcription. Specifically, in bacteria such as E. coli this is mediated by repressor proteins. In anabolic operons, repressors bind DNA in the absence of corepressors to repress an operon. repressor A protein that regulates DNA transcription by preventing RNA polymerase from attaching to the promoter and transcribing the structural gene. See operator. reproductive isolating mechanism Any barrier that prevents genetic exchange between species. residual volume The amount of air remaining in the lungs after the maximum amount of air has been exhaled. resting membrane potential The charge difference (difference in electric potential) that exists across a neuron at rest (about 70 mV). restriction endonuclease An enzyme that cleaves a DNA duplex molecule at a particular base sequence, usually within or near a palindromic sequence; also called a restriction enzyme. restriction fragment length polymorphism (RFLP) Restriction enzymes recognize very specific DNA sequences. Alleles of the same gene or surrounding sequences may have base-pair differences, so that DNA near one allele is cut into a different-length fragment than DNA near the other allele. These different fragments separate based on size on electrophoresis gels. retina The photosensitive layer of the vertebrate eye; contains several layers of neurons and light receptors (rods and cones); receives the image formed by the lens and transmits it to the brain via the optic nerve. retinoblastoma susceptibility gene (Rb) A gene that, when mutated, predisposes individuals to a rare form of cancer of the retina; one of the first tumor-suppressor genes discovered. retrovirus An RNA virus. When a retrovirus enters a cell, a viral enzyme (reverse transcriptase) transcribes viral RNA into duplex DNA, which the cell’s machinery then replicates and transcribes as if it were its own. reverse genetics An approach by which a researcher uses a cloned gene of unknown function, creates a mutation, and introduces the mutant gene back into the organism to assess the effect of the mutation. reverse transcriptase A viral enzyme found in retroviruses that is capable of converting their RNA genome into a DNA copy.
Rh blood group A set of cell-surface markers (antigens) on the surface of red blood cells in humans and rhesus monkeys (for which it is named); although there are several alleles, they are grouped into two main types: Rh-positive and Rh-negative. rhizome In vascular plants, a more or less horizontal underground stem; may be enlarged for storage or may function in vegetative reproduction. rhynchocoel A true coelomic cavity in ribbonworms that serves as a hydraulic power source for extending the proboscis. ribonucleic acid (RNA) A class of nucleic acids characterized by the presence of the sugar ribose and the pyrimidine uracil; includes mRNA, tRNA, and rRNA. ribosomal RNA (rRNA) A class of RNA molecules found, together with characteristic proteins, in ribosomes; transcribed from the DNA of the nucleolus. ribosome The molecular machine that carries out protein synthesis; the most complicated aggregation of proteins in a cell, also containing three different rRNA molecules. ribosome-binding sequence (RBS) In prokaryotes, a conserved sequence at the 5 end of mRNA that is complementary to the 3 end of a small subunit rRNA and helps to position the ribosome during initiation. ribozyme An RNA molecule that can behave as an enzyme, sometimes catalyzing its own assembly; rRNA also acts as a ribozyme in the polymerization of amino acids to form protein. ribulose 1,5-bisphosphate (RuBP) In the Calvin cycle, the five-carbon sugar to which CO2 is attached, accomplishing carbon fixation. This reaction is catalyzed by the enzyme rubisco. ribulose bisphosphate carboxylase/oxygenase (rubisco) The four-subunit enzyme in the chloroplast that catalyzes the carbon fixation reaction joining CO2 to RuBP. RNA interference A type of gene silencing in which the mRNA transcript is prevented from being translated; small interfering RNAs (siRNAs) have been found to bind to mRNA and target its degradation prior to its translation. RNA polymerase An enzyme that catalyzes the assembly of an mRNA molecule, the sequence of which is complementary to a DNA molecule used as a template. See transcription. RNA primer In DNA replication, a sequence of about 10 RNA nucleotides complementary to unwound DNA that attaches at a replication fork; the DNA polymerase uses the RNA primer as a starting point for addition of DNA nucleotides to form the new DNA strand; the RNA primer is later removed and replaced by DNA nucleotides. RNA splicing A nuclear process by which intron sequences of a primary mRNA transcript are cut out and the exon sequences spliced together to give the correct linkages of genetic information that will be used in protein construction. rod Light-sensitive nerve cell found in the vertebrate retina; sensitive to very dim light; responsible for “night vision.” root The usually descending axis of a plant, normally below ground, which anchors the plant and serves as the major point of entry for water and minerals. glossary
rav32223_gloss_G1-G24.indd G-19
G-19
11/20/09 3:52:00 PM
root cap In plants, a tissue structure at the growing tips of roots that protects the root apical meristem as the root pushes through the soil; cells of the root cap are continually lost and replaced. root hair In plants, a tubular extension from an epidermal cell located just behind the root tip; root hairs greatly increase the surface area for absorption. root pressure In plants, pressure exerted by water in the roots in response to a solute potential in the absence of transpiration; often occurs at night. Root pressure can result in guttation, excretion of water from cells of leaves as dew. root system In plants, the portion of the plant body that anchors the plant and absorbs ions and water. R plasmid A resistance plasmid; a conjugative plasmid that picks up antibiotic resistance genes and can therefore transfer resistance from one bacterium to another. rule of addition The rule stating that for two independent events, the probability of either event occurring is the sum of the individual probabilities. rule of multiplication The rule stating that for two independent events, the probability of both events occurring is the product of the individual probabilities. rumen An “extra stomach” in cows and related mammals wherein digestion of cellulose occurs and from which partially digested material can be ejected back into the mouth.
S salicylic acid In plants, an organic molecule that is a long-distance signal in systemic acquired resistance. saltatory conduction A very fast form of nerve impulse conduction in which the impulses leap from node to node over insulated portions. saprobes Heterotrophic organisms that digest their food externally (e.g., most fungi). sarcolemma The specialized cell membrane in a muscle cell. sarcomere Fundamental unit of contraction in skeletal muscle; repeating bands of actin and myosin that appear between two Z lines. sarcoplasmic reticulum The endoplasmic reticulum of a muscle cell. A sleeve of membrane that wraps around each myofilament. satellite DNA A nontranscribed region of the chromosome with a distinctive base composition; a short nucleotide sequence repeated tandemly many thousands of times. saturated fat A fat composed of fatty acids in which all the internal carbon atoms contain the maximum possible number of hydrogen atoms. Schwann cells The supporting cells associated with projecting axons, along with all the other nerve cells that make up the peripheral nervous system. sclereid In vascular plants, a sclerenchyma cell with a thick, lignified, secondary wall having many pits; not elongate like a fiber. sclerenchyma cell Tough, thick-walled cells that strengthen plant tissues. scolex The attachment organ at the anterior end of a tapeworm. scrotum The pouch that contains the testes in most mammals.
G-20
scuttellum The modified cotyledon in cereal grains. second filial (F2) generation The offspring resulting from a cross between members of the first filial (F1) generation. secondary cell wall In plants, the innermost layer of the cell wall. Secondary walls have a highly organized microfibrillar structure and are often impregnated with lignin. secondary growth In vascular plants, an increase in stem and root diameter made possible by cell division of the lateral meristems. secondary immune response The swifter response of the body the second time it is invaded by the same pathogen because of the presence of memory cells, which quickly become antibody-producing plasma cells. secondary induction An induction between tissues that have already differentiated. secondary metabolite A molecule not directly involved in growth, development, or reproduction of an organism; in plants these molecules, which include nicotine, caffeine, tannins, and menthols, can discourage herbivores. secondary plant body The part of a plant consisting of secondary tissues from lateral meristem tissues; the older trunk, branches, and roots of woody plants. secondary structure In a protein, hydrogenbonding interactions between – CO and – NH groups of the primary structure. secondary tissue Any tissue formed from lateral meristems in trees and shrubs. Second Law of Thermodynamics A statement concerning the transformation of potential energy into heat; it says that disorder (entropy) is continually increasing in the universe as energy changes occur, so disorder is more likely than order. second messenger A small molecule or ion that carries the message from a receptor on the target cell surface into the cytoplasm. seed bank Ungerminated seeds in the soil of an area. Regeneration of plants after events such as fire often depends on the presence of a seed bank. seed coat In plants, the outer layers of the ovule, which become a relatively impermeable barrier to protect the dormant embryo and stored food. segment polarity gene Any of certain genes in Drosophila development that are expressed in stripes that subdivide the stripes created by the pair-rule genes in the process of segmentation. segmentation The division of the developing animal body into repeated units; segmentation allows for redundant systems and more efficient locomotion. segmentation gene Any of the three classes of genes that control development of the segmented body plan of insects; includes the gap genes, pair-rule genes, and segment polarity genes. segregation The process by which alternative forms of traits are expressed in offspring rather than blending each trait of the parents in the offspring. selection The process by which some organisms leave more offspring than competing ones, and their genetic traits tend to appear in greater proportions among members of succeeding generations than the traits of those individuals that leave fewer offspring.
selectively permeable Condition in which a membrane is permeable to some substances but not to others. self-fertilization The union of egg and sperm produced by a single hermaphroditic organism. semen In reptiles and mammals, sperm-bearing fluid expelled from the penis during male orgasm. semicircular canal Any of three fluid-filled canals in the inner ear that help to maintain balance. semiconservative replication DNA replication in which each strand of the original duplex serves as the template for construction of a totally new complementary strand, so the original duplex is partially conserved in each of the two new DNA molecules. senescent Aged, or in the process of aging. sensory (afferent) neuron A neuron that transmits nerve impulses from a sensory receptor to the central nervous system or central ganglion. sensory setae In insect, bristles attached to the nervous system that are sensitive mechanical and chemical stimulation; most abundant on antennae and legs. sepal A member of the outermost floral whorl of a flowering plant. septation In prokaryotic cell division, the formation of a septum where new cell membrane and cell wall is formed to separate the two daughter cells. septum, pl. septa A wall between two cavities. sequence-tagged site (STS) A small stretch of DNA that is unique in a genome, that is, it occurs only once; useful as a physical marker on genomic maps. seta, pl. setae (L., bristle) In an annelid, bristles of chitin that help anchor the worm during locomotion or when it is in its burrow. severe acute respiratory syndrome (SARS) A respiratory infection with an 8% mortality rate that is caused by a coronavirus. sex chromosome A chromosome that is related to sex; in humans, the sex chromosomes are the X and Y chromosomes. sex-linked A trait determined by a gene carried on the X chromosome and absent on the Y chromosome. Sexual dimorphism Morphological differences between the sexes of a species. sexual reproduction The process of producing offspring through an alternation of fertilization (producing diploid cells) and meiotic reduction in chromosome number (producing haploid cells). sexual selection A type of differential reproduction that results from variable success in obtaining mates. shared derived character In cladistics, character states that are shared by species and that are different from the ancestral character state. shoot In vascular plants, the aboveground portions, such as the stem and leaves. short interspersed element (SINE) Any of a type of retrotransposon found in humans and other primates that does not contain the biochemical machinery needed for transposition; half a million copies of a SINE element called Alu is nested in the LINEs of the human genome. shotgun sequencing The method of DNA sequencing in which the DNA is randomly cut into small fragments, and the fragments cloned and sequenced. A computer is then used to assemble a final sequence.
glossary
rav32223_gloss_G1-G24.indd G-20
11/20/09 3:52:00 PM
sieve cell In the phloem of vascular plants, a long, slender element with relatively unspecialized sieve areas and with tapering end walls that lack sieve plates. signal recognition particle (SRP) In eukaryotes, a cytoplasmic complex of proteins that recognizes and binds to the signal sequence of a polypeptide, and then docks with a receptor that forms a channel in the ER membrane. In this way the polypeptide is released into the lumen of the ER. signal transduction The events that occur within a cell on receipt of a signal, ligand binding to a receptor protein. Signal transduction pathways produce the cellular response to a signaling molecule. simple sequence repeat (SSR) A one- to threenucleotide sequence such as CA or CCG that is repeated thousands of times. single-nucleotide polymorphism (SNP) A site present in at least 1% of the population at which individuals differ by a single nucleotide. These can be used as genetic markers to map unknown genes or traits. sinus A cavity or space in tissues or in bone. sister chromatid One of two identical copies of each chromosome, still linked at the centromere, produced as the chromosomes duplicate for mitotic division; similarly, one of two identical copies of each homologous chromosome present in a tetrad at meiosis. small interfering RNAs (siRNAs) A class of micro-RNAs that appear to be involved in control of gene transcription and that play a role in protecting cells from viral attack. small nuclear ribonucleoprotein particles (snRNP) In eukaryotes, a complex composed of snRNA and protein that clusters together with other snRNPs to form the spliceosome, which removes introns from the primary transcript. small nuclear RNA (snRNA) In eukaryotes, a small RNA sequence that, as part of a small nuclear ribonucleoprotein complex, facilitates recognition and excision of introns by basepairing with the 5 end of an intron or at a branch site of the same intron. sodium–potassium pump Transmembrane channels engaged in the active (ATP-driven) transport of Na+, exchanging them for K+, where both ions are being moved against their respective concentration gradients; maintains the resting membrane potential of neurons and other cells. solute A molecule dissolved in some solution; as a general rule, solutes dissolve only in solutions of similar polarity; for example, glucose (polar) dissolves in (forms hydrogen bonds with) water (also polar), but not in vegetable oil (nonpolar). solute potential The amount of osmotic pressure arising from the presence of a solute or solutes in water; measure by counterbalancing the pressure until osmosis stops. solvent The medium in which one or more solutes is dissolved. somatic cell Any of the cells of a multicellular organism except those that are destined to form gametes (germ-line cells). somatic cell nuclear transfer (SCNT) The transfer of the nucleus of a somatic cell into an enucleated egg cell that then undergoes
development. Can be used to make ES cells and to create cloned animals. somatic mutation A change in genetic information (mutation) occurring in one of the somatic cells of a multicellular organism, not passed from one generation to the next. somatic nervous system In vertebrates, the neurons of the peripheral nervous system that control skeletal muscle. somite One of the blocks, or segments, of tissue into which the mesoderm is divided during differentiation of the vertebrate embryo. Southern blot A technique in which DNA fragments are separated by gel electrophoresis, denatured into single-stranded DNA, and then “blotted” onto a sheet of filter paper; the filter is then incubated with a labeled probe to locate DNA sequences of interest. S phase The phase of the cell cycle during which DNA replication occurs. specialized transduction The transfer of only a few specific genes into a bacterium, using a lysogenic bacteriophage as a carrier. speciation The process by which new species arise, either by transformation of one species into another, or by the splitting of one ancestral species into two descendant species. species, pl. species A kind of organism; species are designated by binomial names written in italics. specific heat The amount of heat that must be absorbed or lost by 1 g of a substance to raise or lower its temperature 1°C. specific transcription factor Any of a great number of transcription factors that act in a time- or tissue-dependent manner to increase DNA transcription above the basal level. spectrin A scaffold of proteins that links plasma membrane proteins to actin filaments in the cytoplasm of red blood cells, producing their characteristic biconcave shape. spermatid In animals, each of four haploid (n) cells that result from the meiotic divisions of a spermatocyte; each spermatid differentiates into a sperm cell. spermatozoa The male gamete, usually smaller than the female gamete, and usually motile. sphincter In vertebrate animals, a ring-shaped muscle capable of closing a tubular opening by constriction (e.g., between stomach and small intestine or between anus and exterior). spicule Any of a number of minute needles of silica or calcium carbonate made in the mesohyl by some kinds of sponges as a structural component. spindle The structure composed of microtubules radiating from the poles of the dividing cell that will ultimately guide the sister chromatids to the two poles. spindle apparatus The assembly that carries out the separation of chromosomes during cell division; composed of microtubules (spindle fibers) and assembled during prophase at the equator of the dividing cell. spindle checkpoint The third cell-division checkpoint, at which all chromosomes must be attached to the spindle. Passage through this checkpoint commits the cell to anaphase. spinnerets Organs at the posterior end of a spider’s abdomen that secrete a fluid protein that becomes silk.
spiracle External opening of a trachea in arthropods. spiral cleavage The embryonic cleavage pattern of some protostome animals in which cells divide at an angle oblique to the polar axis of the embryo; a line drawn through the sequence of dividing cells forms a spiral. spiralian A member of a group of invertebrate animals; many groups exhibit spiral cleavage. Mollusks, annelids, and flatworms are examples of spiralians. spliceosome In eukaryotes, a complex composed of multiple snRNPs and other associated proteins that is responsible for excision of introns and joining of exons to convert the primary transcript into the mature mRNA. spongin A tough protein made by many kinds of sponges as a structural component within the mesohyl. spongy parenchyma A leaf tissue composed of loosely arranged, chloroplast-bearing cells. See palisade parenchyma. sporangium, pl. sporangia A structure in which spores are produced. spore A haploid reproductive cell, usually unicellular, capable of developing into an adult without fusion with another cell. sporophyte The spore-producing, diploid (2n) phase in the life cycle of a plant having alternation of generations. stabilizing selection A form of selection in which selection acts to eliminate both extremes from a range of phenotypes. stamen The organ of a flower that produces the pollen; usually consists of anther and filament; collectively, the stamens make up the androecium. starch An insoluble polymer of glucose; the chief food storage substance of plants. start codon The AUG triplet, which indicates the site of the beginning of mRNA translation; this codon also codes for the amino acid methionine. stasis A period of time during which little evolutionary change occurs. statocyst Sensory receptor sensitive to gravity and motion. stele The central vascular cylinder of stems and roots. stem cell A relatively undifferentiated cell in animal tissue that can divide to produce more differentiated tissue cells. stereoscopic vision Ability to perceive a single, three-dimensional image from the simultaneous but slightly divergent two-dimensional images delivered to the brain by each eye. stigma (1) In angiosperm flowers, the region of a carpel that serves as a receptive surface for pollen grains. (2) Light-sensitive eyespot of some algae. stipules Leaflike appendages that occur at the base of some flowering plant leaves or stems. stolon A stem that grows horizontally along the ground surface and may form adventitious roots, such as runners of the strawberry plant. stoma, pl. stomata In plants, a minute opening bordered by guard cells in the epidermis of leaves and stems; water passes out of a plant mainly through the stomata. stop codon Any of the three codons UAA, UAG, and UGA, that indicate the point at which mRNA translation is to be terminated. glossary
rav32223_gloss_G1-G24.indd G-21
G-21
11/20/09 3:52:00 PM
stratify To hold plant seeds at a cold temperature for a certain period of time; seeds of many plants will not germinate without exposure to cold and subsequent warming. stratum corneum The outer layer of the epidermis of the skin of the vertebrate body. striated muscle Skeletal voluntary muscle and cardiac muscle. stroma In chloroplasts, the semiliquid substance that surrounds the thylakoid system and that contains the enzymes needed to assemble organic molecules from CO2. stromatolite A fossilized mat of ancient bacteria formed as long as 2 bya, in which the bacterial remains individually resemble some modernday bacteria. style In flowers, the slender column of tissue that arises from the top of the ovary and through which the pollen tube grows. stylet A piercing organ, usually a mouthpart, in some species of invertebrates. suberin In plants, a fatty acid chain that forms the impermeable barrier in the Casparian strip of root endoderm. subspecies A geographically defined population or group of populations within a single species that has distinctive characteristics. substrate (1) The foundation to which an organism is attached. (2) A molecule on which an enzyme acts. subunit vaccine A type of vaccine created by using a subunit of a viral protein coat to elicit an immune response; may be useful in preventing viral diseases such as hepatitis B. succession In ecology, the slow, orderly progression of changes in community composition that takes place through time. summation Repetitive activation of the motor neuron resulting in maximum sustained contraction of a muscle. supercoiling The coiling in space of doublestranded DNA molecules due to torsional strain, such as occurs when the helix is unwound. surface tension A tautness of the surface of a liquid, caused by the cohesion of the molecules of liquid. Water has an extremely high surface tension. surface area-to-volume ratio Relationship of the surface area of a structure, such as a cell, to the volume it contains. suspensor In gymnosperms and angiosperms, the suspensor develops from one of the first two cells of a dividing zygote; the suspensor of an angiosperm is a nutrient conduit from maternal tissue to the embryo. In gymnosperms the suspensor positions the embryo closer to stored food reserves. swim bladder An organ encountered only in the bony fish that helps the fish regulate its buoyancy by increasing or decreasing the amount of gas in the bladder via the esophagus or a specialized network of capillaries. swimmerets In lobsters and crayfish, appendages that occur in lines along the ventral surface of the abdomen and are used in swimming and reproduction. symbiosis The condition in which two or more dissimilar organisms live together in close association; includes parasitism (harmful to one
G-22
of the organisms), commensalism (beneficial to one, of no significance to the other), and mutualism (advantageous to both). sympatric speciation The differentiation of populations within a common geographic area into species. symplast route In plant roots, the pathway for movement of water and minerals within the cell cytoplasm that leads through plasmodesmata that connect cells. symplesiomorphy In cladistics, another term for a shared ancestral character state. symporter A carrier protein in a cell’s membrane that transports two molecules or ions in the same direction across the membrane. synapomorphy In systematics, a derived character that is shared by clade members. synapse A junction between a neuron and another neuron or muscle cell; the two cells do not touch, the gap being bridged by neurotransmitter molecules. synapsid Any of an early group of reptiles that had a pair of temporal openings in the skull behind the eye sockets; jaw muscles attached to these openings. Early ancestors of mammals belonged to this group. synapsis The point-by-point alignment (pairing) of homologous chromosomes that occurs before the first meiotic division; crossing over takes place during synapsis. synaptic cleft The space between two adjacent neurons. synaptic vesicle A vesicle of a neurotransmitter produced by the axon terminal of a nerve. The filled vesicle migrates to the presynaptic membrane, fuses with it, and releases the neurotransmitter into the synaptic cleft. synaptonemal complex A protein lattice that forms between two homologous chromosomes in prophase I of meiosis, holding the replicated chromosomes in precise register with each other so that base-pairs can form between nonsister chromatids for crossing over that is usually exact within a gene sequence. syncytial blastoderm A structure composed of a single large cytoplasm containing about 4000 nuclei in embryonic development of insects such as Drosophila. syngamy The process by which two haploid cells (gametes) fuse to form a diploid zygote; fertilization. synthetic polyploidy A polyploidy organism created by crossing organisms most closely related to an ancestral species and then manipulating the offspring. systematics The reconstruction and study of evolutionary relationships. systemic acquired resistance (SAR) In plants, a longer-term response to a pathogen or pest attack that can last days to weeks and allow the plant to respond quickly to later attacks by a range of pathogens. systemin In plants, an 18-amino-acid peptide that is produced by damaged or injured leaves that leads to the wound response. systolic pressure A measurement of how hard the heart is contracting. When measured during a blood pressure reading, ventricular systole (contraction) is what is being monitored.
T 3 poly-A tail In eukaryotes, a series of 1–200 adenine residues added to the 3 end of an mRNA; the tail appears to enhance the stability of the mRNA by protecting it from degradation. T box A transcription factor protein domain that has been conserved, although with differing developmental effects, in invertebrates and chordates. tagma, pl. tagmata A compound body section of an arthropod resulting from embryonic fusion of two or more segments; for example, head, thorax, abdomen. Taq polymerase A DNA polymerase isolated from the thermophilic bacterium Thermus aquaticus (Taq); this polymerase is functional at higher temperatures, and is used in PCR amplification of DNA. TATA box In eukaryotes, a sequence located upstream of the transcription start site. The TATA box is one element of eukaryotic core promoters for RNA polymerase II. taxis, pl. taxes An orientation movement by a (usually) simple organism in response to an environmental stimulus. taxonomy The science of classifying living things. By agreement among taxonomists, no two organisms can have the same name, and all names are expressed in Latin. T cell A type of lymphocyte involved in cellmediated immunity and interactions with B cells; the “T” refers to the fact that T cells are produced in the thymus. telencephalon The most anterior portion of the brain, including the cerebrum and associated structures. telomerase An enzyme that synthesizes telomeres on eukaryotic chromosomes using an internal RNA template. telomere A specialized nontranscribed structure that caps each end of a chromosome. telophase The phase of cell division during which the spindle breaks down, the nuclear envelope of each daughter cell forms, and the chromosomes uncoil and become diffuse. telson The tail spine of lobsters and crayfish. temperate (lysogenic) phage A virus that is capable of incorporating its DNA into the host cell’s DNA, where it remains for an indeterminate length of time and is replicated as the cell’s DNA replicates. template strand The DNA strand that is used as a template in transcription. This strand is copied to produce a complementary mRNA transcript. tendon (Gr. tendon, stretch) A strap of cartilage that attaches muscle to bone. tensile strength A measure of the cohesiveness of a substance; its resistance to being broken apart. Water in narrow plant vessels has tensile strength that helps keep the water column continuous. tertiary structure The folded shape of a protein, produced by hydrophobic interactions with water, ionic and covalent bonding between side chains of different amino acids, and van der Waal’s forces; may be changed by denaturation so that the protein becomes inactive.
glossary
rav32223_gloss_G1-G24.indd G-22
11/20/09 3:52:00 PM
testcross A mating between a phenotypically dominant individual of unknown genotype and a homozygous “tester,” done to determine whether the phenotypically dominant individual is homozygous or heterozygous for the relevant gene. testis, pl. testes In mammals, the sperm-producing organ. tetanus Sustained forceful muscle contraction with no relaxation. thalamus That part of the vertebrate forebrain just posterior to the cerebrum; governs the flow of information from all other parts of the nervous system to the cerebrum. therapeutic cloning The use of somatic cell nuclear transfer to create stem cells from a single individual that may be reimplanted in that individual to replace damaged cells, such as in a skin graft. thermodynamics The study of transformations of energy, using heat as the most convenient form of measurement of energy. thermogenesis Generation of internal heat by endothermic animals to modulate temperature. thigmotropism In plants, unequal growth in some structure that comes about as a result of physical contact with an object. threshold The minimum amount of stimulus required for a nerve to fire (depolarize). thylakoid In chloroplasts, a complex, organized internal membrane composed of flattened disks, which contain the photosystems involved in the light-dependent reactions of photosynthesis. Ti (tumor-inducing) plasmid A plasmid found in the plant bacterium Agrobacterium tumefaciens that has been extensively used to introduce recombinant DNA into broadleaf plants. Recent modifications have allowed its use with cereal grains as well. tight junction Region of actual fusion of plasma membranes between two adjacent animal cells that prevents materials from leaking through the tissue. tissue A group of similar cells organized into a structural and functional unit. tissue plasminogen activator (TPA) A human protein that causes blood clots to dissolve; if used within 3 hours of an ischemic stroke, TPA may prevent disability. tissue-specific stem cell A stem cell that is capable of developing into the cells of a certain tissue, such as muscle or epithelium; these cells persist even in adults. tissue system In plants, any of the three types of tissue; called a system because the tissue extends throughout the roots and shoots. tissue tropism The affinity of a virus for certain cells within a multicellular host; for example, hepatitis B virus targets liver cells. tonoplast The membrane surrounding the central vacuole in plant cells that contains water channels; helps maintain the cell’s osmotic balance. topoisomerase Any of a class of enzymes that can change the topological state of DNA to relieve torsion caused by unwinding. torsion The process in embryonic development of gastropods by which the mantle cavity and anus move from a posterior location to the front of the body, closer to the location of the mouth.
totipotent A cell that possesses the full genetic potential of the organism. trachea, pl. tracheae A tube for breathing; in terrestrial vertebrates, the windpipe that carries air between the larynx and bronchi (which leads to the lungs); in insects and some other terrestrial arthropods, a system of chitin-lined air ducts. tracheids In plant xylem, dead cells that taper at the ends and overlap one another. tracheole The smallest branches of the respiratory system of terrestrial arthropods; tracheoles convey air from the tracheae, which connect to the outside of the body at spiracles. trait In genetics, a characteristic that has alternative forms, such as purple or white flower color in pea plants or different blood type in humans. transcription The enzyme-catalyzed assembly of an RNA molecule complementary to a strand of DNA. transcription complex The complex of RNA polymerase II plus necessary activators, coactivators, transcription factors, and other factors that are engaged in actively transcribing DNA. transcription factor One of a set of proteins required for RNA polymerase to bind to a eukaryotic promoter region, become stabilized, and begin the transcription process. transcription bubble The region containing the RNA polymerase, the DNA template, and the RNA transcript, so called because of the locally unwound “bubble” of DNA. transcription unit The region of DNA between a promoter and a terminator. transcriptome All the RNA present in a cell or tissue at a given time. transfection The transformation of eukaryotic cells in culture. transfer RNA (tRNA) A class of small RNAs (about 80 nucleotides) with two functional sites; at one site, an “activating enzyme” adds a specific amino acid, while the other site carries the nucleotide triplet (anticodon) specific for that amino acid. transformation The uptake of DNA directly from the environment; a natural process in some bacterial species. transgenic organism An organism into which a gene has been introduced without conventional breeding, that is, through genetic engineering techniques. translation The assembly of a protein on the ribosomes, using mRNA to specify the order of amino acids. translation repressor protein One of a number of proteins that prevent translation of mRNA by binding to the beginning of the transcript and preventing its attachment to a ribosome. translocation (1) In plants, the long-distance transport of soluble food molecules (mostly sucrose), which occurs primarily in the sieve tubes of phloem tissue. (2) In genetics, the interchange of chromosome segments between nonhomologous chromosomes. transmembrane domain Hydrophobic region of a transmembrane protein that anchors it in the membrane. Often composed of α-helices, but sometimes utilizing β-pleated sheets to form a barrel-shaped pore.
transmembrane route In plant roots, the pathway for movement of water and minerals that crosses the cell membrane and also the membrane of vacuoles inside the cell. transpiration The loss of water vapor by plant parts; most transpiration occurs through the stomata. transposable elements Segments of DNA that are able to move from one location on a chromosome to another. Also termed transposons or mobile genetic elements. transposition Type of genetic recombination in which transposable elements (transposons) move from one site in the DNA sequence to another, apparently randomly. transposon DNA sequence capable of transposition. trichome In plants, a hairlike outgrowth from an epidermal cell; glandular trichomes secrete oils or other substances that deter insects. triglyceride (triacylglycerol) An individual fat molecule, composed of a glycerol and three fatty acids. triploid Possessing three sets of chromosomes. trisomic Describes the condition in which an additional chromosome has been gained due to nondisjunction during meiosis, and the diploid embryo therefore has three of these autosomes. In humans, trisomic individuals may survive if the autosome is small; Down syndrome individuals are trisomic for chromosome 21. trochophore A specialized type of free-living larva found in lophotrochozoans. trophic level A step in the movement of energy through an ecosystem. trophoblast In vertebrate embryos, the outer ectodermal layer of the blastodermic vesicle; in mammals, it is part of the chorion and attaches to the uterine wall. tropism Response to an external stimulus. tropomyosin Low-molecular-weight protein surrounding the actin filaments of striated muscle. troponin Complex of globular proteins positioned at intervals along the actin filament of skeletal muscle; thought to serve as a calciumdependent “switch” in muscle contraction. trp operon In E. coli, the operon containing genes that code for enzymes that synthesize tryptophan. true-breeding Said of a breed or variety of organism in which offspring are uniform and consistent from one generation to the next; for example. This is due to the genotypes that determine relevant traits being homozygous. tube foot In echinoderms, a flexible, external extension of the water–vascular system that is capable of attaching to a surface through suction. tubulin Globular protein subunit forming the hollow cylinder of microtubules. tumor-suppressor gene A gene that normally functions to inhibit cell division; mutated forms can lead to the unrestrained cell division of cancer, but only when both copies of the gene are mutant. turgor pressure The internal pressure inside a plant cell, resulting from osmotic intake of water, that presses its cell membrane tightly against the cell wall, making the cell rigid. Also known as hydrostatic pressure. glossary
rav32223_gloss_G1-G24.indd G-23
G-23
11/20/09 3:52:00 PM
tympanum In some groups of insects, a thin membrane associated with the tracheal air sacs that functions as a sound receptor; paired on each side of the abdomen.
U ubiquitin A 76-amino-acid protein that virtually all eukaryotic cells attach as a marker to proteins that are to be degraded. unequal crossing over A process by which a crossover in a small region of misalignment at synapsis causes two homologous chromosomes to exchange segments of unequal length. uniporter A carrier protein in a cell’s membrane that transports only a single type of molecule or ion. uniramous Single-branched; describes the appendages of insects. unsaturated fat A fat molecule in which one or more of the fatty acids contain fewer than the maximum number of hydrogens attached to their carbons. urea An organic molecule formed in the vertebrate liver; the principal form of disposal of nitrogenous wastes by mammals. urethra The tube carrying urine from the bladder to the exterior of mammals. uric acid Insoluble nitrogenous waste products produced largely by reptiles, birds, and insects. urine The liquid waste filtered from the blood by the kidney and stored in the bladder pending elimination through the urethra. uropod One of a group of flattened appendages at the end of the abdomen of lobsters and crayfish that collectively act as a tail for a rapid burst of speed. uterus In mammals, a chamber in which the developing embryo is contained and nurtured during pregnancy.
V vacuole A membrane-bounded sac in the cytoplasm of some cells, used for storage or digestion purposes in different kinds of cells; plant cells often contain a large central vacuole that stores water, proteins, and waste materials. valence electron An electron in the outermost energy level of an atom. variable A factor that influences a process, outcome, or observation. In experiments, scientists attempt to isolate variables to test hypotheses. vascular cambium In vascular plants, a cylindrical sheath of meristematic cells, the division of which produces secondary phloem outwardly and secondary xylem inwardly; the activity of the vascular cambium increases stem or root diameter. vascular tissue Containing or concerning vessels that conduct fluid. vas deferens In mammals, the tube carrying sperm from the testes to the urethra. vasopressin A posterior pituitary hormone that regulates the kidney’s retention of water. vector In molecular biology, a plasmid, phage or artificial chromosome that allows propagation of recombinant DNA in a host cell into which it is introduced. vegetal pole The hemisphere of the zygote comprising cells rich in yolk.
G-24
vein (1) In plants, a vascular bundle forming a part of the framework of the conducting and supporting tissue of a stem or leaf. (2) In animals, a blood vessel carrying blood from the tissues to the heart. veliger The second larval stage of mollusks following the trochophore stage, during which the beginning of a foot, shell, and mantle can be seen. ventricle A muscular chamber of the heart that receives blood from an atrium and pumps blood out to either the lungs or the body tissues. vertebrate A chordate with a spinal column; in vertebrates, the notochord develops into the vertebral column composed of a series of vertebrae that enclose and protect the dorsal nerve cord. vertical gene transfer (VGT) The passing of genes from one generation to the next within a species. vesicle A small intracellular, membranebounded sac in which various substances are transported or stored. vessel element In vascular plants, a typically elongated cell, dead at maturity, which conducts water and solutes in the xylem. vestibular apparatus The complicated sensory apparatus of the inner ear that provides for balance and orientation of the head in vertebrates. vestigial structure A morphological feature that has no apparent current function and is thought to be an evolutionary relic; for example, the vestigial hip bones of boa constrictors. villus, pl. villi In vertebrates, one of the minute, fingerlike projections lining the small intestine that serve to increase the absorptive surface area of the intestine. virion A single virus particle. viroid Any of a group of small, naked RNA molecules that are capable of causing plant diseases, presumably by disrupting chromosome integrity. virus Any of a group of complex biochemical entities consisting of genetic material wrapped in protein; viruses can reproduce only within living host cells and are thus not considered organisms. visceral mass Internal organs in the body cavity of an animal. vitamin An organic substance that cannot be synthesized by a particular organism but is required in small amounts for normal metabolic function. viviparity Refers to reproduction in which eggs develop within the mother’s body and young are born free-living. voltage-gated ion channel A transmembrane pathway for an ion that is opened or closed by a change in the voltage, or charge difference, across the plasma membrane.
W water potential The potential energy of water molecules. Regardless of the reason (e.g., gravity, pressure, concentration of solute particles) for the water potential, water moves from a region where water potential is greater to a region where water potential is lower. water–vascular system A fluid-filled hydraulic system found only in echinoderms that provides body support and a unique type of locomotion via extensions called tube feet.
Western blot A blotting technique used to identify specific protein sequences in a complex mixture. See Southern blot. wild type In genetics, the phenotype or genotype that is characteristic of the majority of individuals of a species in a natural environment. wobble pairing Refers to flexibility in the pairing between the base at the 5 end of a tRNA anticodon and the base at the 3 end of an mRNA codon. This flexibility allows a single tRNA to read more than one mRNA codon. wound response In plants, a signaling pathway initiated by leaf damage, such as being chewed by a herbivore, and lead to the production of proteinase inhibitors that give herbivores indigestion.
X X chromosome One of two sex chromosomes; in mammals and in Drosophila, female individuals have two X chromosomes. xylem In vascular plants, a specialized tissue, composed primarily of elongate, thick-walled conducting cells, which transports water and solutes through the plant body.
Y Y chromosome One of two sex chromosomes; in mammals and in Drosophila, male individuals have a Y chromosome and an X chromosome; the Y determines maleness. yolk plug A plug occurring in the blastopore of amphibians during formation of the archenteron in embryological development. yolk sac The membrane that surrounds the yolk of an egg and connects the yolk, a rich food supply, to the embryo via blood vessels.
Z zinc finger motif A type of DNA-binding motif in regulatory proteins that incorporates zinc atoms in its structure. zona pellucida An outer membrane that encases a mammalian egg. zone of cell division In plants, the part of the young root that includes the root apical meristem and the cells just posterior to it; cells in this zone divide every 12–36 hr. zone of elongation In plants, the part of the young root that lies just posterior to the zone of cell division; cells in this zone elongate, causing the root to lengthen. zone of maturation In plants, the part of the root that lies posterior to the zone of elongation; cells in this zone differentiate into specific cell types. zoospore A motile spore. zooxanthellae Symbiotic photosynthetic protists in the tissues of corals. zygomycetes A type of fungus whose chief characteristic is the production of sexual structures called zygosporangia, which result from the fusion of two of its simple reproductive organs. zygote The diploid (2n) cell resulting from the fusion of male and female gametes (fertilization).
glossary
rav32223_gloss_G1-G24.indd G-24
11/20/09 3:52:00 PM
Credits
Photo Credits Chapter 1 Opener: © Soames Summerhays/Natural Visions; 1.1d: © Dr. Donald Fawcett & Porter/Visuals Unlimited; 1.1e: © Lennart Nilsson/Albert Bonniers Förlag AB; 1.1f: © Ed Reschke; 1.1i-j: © Getty RF; 1.1k-l: © Volume 44/Getty RF; 1.1m: © Steve Harper/Grant Heilman Photography, Inc.; 1.1n: © Robert and Jean Pollock; 1.1o: NASA; 1.5: © Huntington Library/SuperStock; 1.11a: © Dennis Kunkel/Phototake; 1.11b: © Karl E. Deckart/Phototake; 1.12a: © Alan L. Detrick/Photo Researchers, Inc.; 1.12b: © DAVID M. DENNIS/Animals Animals - Earth Scenes; 1.12c: © Volume 46/Corbis RF; 1.12d: © Corbis RF; 1.12e: © Mediscan/Corbis; 1.12f: © Volume 15/Photodisc/Getty RF; 1.12g: © Corbis RF; 1.12h: © Tom Brakefield/Corbis; 1.12i: © Volume 44/Photodisc/Getty RF; 1.12j: © Volume 64/Corbis RF; 1.12k: © T.E. Adams/Visuals Unlimited; 1.12l: © Douglas P. Wilson/Frank Lane Picture Agency/Corbis; 1.12m: © R. Robinson/Visuals Unlimited; 1.12n: © Kari Lounatman/Photo Researchers, Inc.; 1.12o: © Dwight R. Kuhn; 1.12p: © Alfred Pasieka/Science Photo Library/Photo Researchers, Inc.
Chapter 2 Opener: Courtesy of IBM Zurich Research Laboratory. Unauthorized use not permitted; 2.2: Image Courtesy of Veeco Instruments, Inc.; 2.10a: © Glen Allison/Getty Images RF; 2.10b: © PhotoLink/Getty RF; 2.10c: © Jeff Vanuga/Corbis; 2.13: © Hermann Eisenbeiss/National Audubon Society Collection/Photo Researchers, Inc.
Chapter 3 Opener: © Jacob Halaska/Index Stock Imagery; 3.10b: © Asa Thoresen/Photo Researchers, Inc.; 3.10c: © J.Carson/Custom Medical Stock Photo; 3.11b: © J.D. Litvay/Visuals Unlimited; 3.12: © Scott Johnson/Animals Animals - Earth Scenes; 3.13a: © Driscoll, Youngquist & Baldeschwieler, Caltech/SPL/Photo Researchers, Inc.; 3.13b: © PhotoLink/Getty RF.
Chapter 4 Opener: © Dr. Gopal Murti/Photo Researchers, Inc.; Table 4.1a: © David M. Phillips/Visuals Unlimited; Table 4.1b: © Mike Abbey/Visuals Unlimited; Table 4.1c: © David M. Phillips/Visuals Unlimited; Table 4.1d: © Mike Abbey/Visuals Unlimited; Table 4.1e: © DR TORSTEN WITTMANN/Photo Researchers, Inc.; Table 4.1f: © Med. Mic. Sciences, Cardiff Uni./Wellcome Images; Table 4.1g: © Microworks/Phototake; Table 4.1h: © Stanley Flegler/Visuals Unlimited; p. 62 (plasma membrane): © Dr. Don W. Fawcett/ Visuals Unlimited; 4.3: © Phototake; 4.4: Courtesy
of E.H. Newcomb & T.D. Pugh, University of Wisconsin; 4.5a: © Eye of Science/Photo Researchers, Inc.; 4.8b: © Dr. Richard Kessel & Dr. Gene Shih/Visuals Unlimited; 4.8c: © John T. Hansen, Ph.D/Phototake; 4.8d: Reprinted by permission from Macmillan Publishers Ltd: Nature, 323, 560-564, “The nuclear lamina is a meshwork of intermediate-type filaments,” Ueli Aebi, Julie Cohn, Loren Buhle, Larry Gerace, © 1986; 4.10c: © R. Bolender & D. Fawcett/Visuals Unlimited; 4.11c: © Dennis Kunkel/Phototake; 4.14: From “Microbody-Like Organelles in Leaf Cells,” Sue Ellen Frederick and Eldon H. Newcomb, SCIENCE, Vol. 163: 1353-1355 © 21 March 1969. Reprinted with permission from AAAS; 4.15: © Dr. Henry Aldrich/Visuals Unlimited; 4.16c: © Dr. Donald Fawcett & Dr. Porter/Visuals Unlimited; 4.17c: © Dr. Jeremy Burgess/Photo Researchers, Inc.; 4.23a-b: © William Dentler, University of Kansas; 4.24a-b: © SPL/Photo Researchers, Inc.; 4.25: © BioPhoto Associates/Photo Researchers, Inc.; 4.27a: Courtesy of Daniel Goodenough; 4.27b-c: © Dr. Donald Fawcett/Visuals Unlimited.
Chapter 5 Opener: © Dr. Gopal Murti/Science Photo Library/ Photo Researchers, Inc.; p. 91 (top)-5.3: © Don W. Fawcett/Photo Researchers, Inc.; 5.12a-c: © David M. Phillips/Visuals Unlimited; 5.15a: Micrograph Courtesy of the CDC/Dr. Edwin P. Ewing, Jr.; 5.15b: © BCC Microimaging, Inc., Reproduced with permission; 5.15c (top)-(bottom): © The Company of Biologists Limited; 5.16b: © Dr. Brigit Satir.
Chapter 6 Opener: © Robert Caputo/Aurora Photos; 6.3a-b: © Spencer Grant/PhotoEdit; 6.11b: © Professor Emeritus Lester J. Reed, University of Texas at Austin.
Chapter 7 Opener: © Creatas/PunchStock RF; 7.18a: © Wolfgang Baumeister/Photo Researchers, Inc.; 7.18b: National Park Service.
Chapter 8 Opener: © Corbis RF; 8.1: Courtesy Dr. Kenneth Miller, Brown University; 8.8a-b: © Eric Soder; 8.20: © Dr. Jeremy Burgess/Photo Researchers, Inc.; 8.22a: © John Shaw/Photo Researchers, Inc.; 8.22b: © Joseph Nettis/National Audubon Society Collection/Photo Researchers, Inc.; 8.24: © Clyde H. Smith/Peter Arnold Inc.
BioPhoto Associates/Photo Researchers, Inc.; 10.6: © CNRI/Photo Researchers, Inc.; 10.10: Image courtesy of S. Hauf and J-M. Peters, IMP, Vienna, Austria; 10.11a-g, 10.12: © Andrew S. Bajer, University of Oregon; 10.13a-b: © Dr. Jeremy Pickett-Heaps; 10.14a: © David M. Phillips/Visuals Unlimited; 10.14b: © Guenter Albrecht-Buehler, Northwestern University, Chicago; 10.15: © B.A. Palevits & E.H. Newcomb/ BPS/Tom Stack & Associates.
Chapter 11 Opener: © Science VU/L. Maziarski/Visuals Unlimited; 11.3b: Reprinted, with permission, from the Annual Review of Genetics, Volume 6 © 1972 by Annual Reviews, www.annualreviews.org; 11.7a-h: © Clare A. Hasenkampf/Biological Photo Service.
Chapter 12 Opener: © Corbis RF; 12.1: © Norbert Schaefer/ Corbis; 12.2: © David Sieren/Visuals Unlimited; 12.3: © Leslie Holzer/Photo Researchers, Inc.; 12.11: From Albert F. Blakeslee “CORN AND MEN: The Interacting Influence of Heredity and Environment—Movements for Betterment of Men, or Corn, or Any Other Living Thing, One-sided Unless They Take Both Factors into Account,” Journal of Heredity, 5: 511-518, © 1914 Oxford University Press; 12.14: © DK Limited/Corbis.
Chapter 13 Opener: © Adrian T. Sumner/Photo Researchers, Inc.; 13.1a-b: © Cabisco/Phototake; p. 241: © BioPhoto Associates/Photo Researchers, Inc.; 13.3: © Bettmann/Corbis; p. 243(left): From Brian P. Chadwick and Huntington F. Willard, “Multiple spatially distinct types of facultative heterochromatin on the human inactive X chromosome,” PNAS vol. 101 no. 50:1745017455, Fig. 3 © 2004 National Academy of Sciences, U.S.A.; 13.4: © Kenneth Mason; 13.33: © Jackie Lewin, Royal Free Hospital/Photo Researchers, Inc.; 13.12: © Colorado Genetics Laboratory, University of Colorado Denver.
Chapter 14
Opener: RMF/Scientifica/Visuals Unlimited.
Opener: © Volume 29/Getty RF; 14.5a-b: Courtesy of Cold Spring Harbor Laboratory Archives; 14.6: © Barrington Brown/Photo Researchers, Inc.; 14.11: From M. Meselson and F.W. Stahl/PNAS 44(1958):671; 14.16a-b: From Biochemistry by Stryer. © 1995, 1981, 1988, 1995 by Lupert Stryer. Used with permission of W.H. Freeman and Company; 14.20: © Dr. Don W. Fawcett/Visuals Unlimited.
Chapter 10
Chapter 15
Opener: © Stem Jems/Photo Researchers, Inc.; 10.2a-b: Courtesy of William Margolin; 10.4: ©
Opener: © Dr. Gopal Murti/Visuals Unlimited; 15.3: From R.C. Williams, PNAS 74(1977):2313;
Chapter 9
C-1
rav32223_cred_C1-C6.indd C-1
11/20/09 3:37:44 PM
15.5: Image courtesy of the University of Missouri-Columbia, Agricultural Information; 15.9: © Dr. Oscar Miller; 15.12b: Courtesy of Dr. Bert O’Malley, Baylor College of Medicine; 15.14c: Created by John Beaver using ProteinWorkshop, a product of the RCSB PDB, and built using the Molecular Biology Toolkit developed by John Moreland and Apostol Gramada (mbt.sdsc.edu). The MBT is financed by grant GM63208; 15.17: From “The Structural Basis of Ribosome Activity in Peptide Bond Synthesis,” Poul Nissen, Jeffrey Hansen, Nenad Ban, Peter B. Moore, and Thomas A. Steitz, SCIENCE Vol. 289: 920-930 © 11 August 2000. Reprinted with permission from AAAS.
Chapter 16 Opener: © Dr. Claus Pelling; 16.10a-b: Courtesy of Dr. Harrison Echols; 16.22: Reprinted with permission from the Annual Review of Biochemistry, Volume 68 © 1999 by Annual Reviews, www.annualreviews.org.
Chapter 17 Opener: © Prof. Stanley Cohen/Photo Researchers, Inc.; 17.2d: Courtesy of Biorad Laboratories; 17.7: © SSPL/The Image Works; 17.9: Courtesy of Lifecodes Corp, Stamford CT; 17.10: © Matt Meadows/Peter Arnold Inc.; 17.12a: © 2007, Illumina Inc. All rights reserved; 17.16: © R. L. Brinster, School of Veterinary Medicine, University of Pennsylvania; 17.19(right): © Rob Horsch, Monsanto Company.
Chapter 18 Opener: © William C. Ray, Director, Bioinformatics and Computational Biology Division, Biophysics Program, The Ohio State University; 18.2b: Reprinted by permission from Macmillan Publishers Ltd: Bone Marrow Transplantation 33, 247-249, “Secondary Philadelphia chromosome after non-myeloablative peripheral blood stem cell transplantation for a myelodysplastic syndrome in transformation,” T Prebet, A-S Michallet, C Charrin, S Hayette, J-P Magaud, A Thiébaut, M Michallet, F E Nicolini © 2004; 18.4a: Courtesy of Celera Genomics; 18.4b: © Gregory D. May; 18.4c: © 2007, Illumina Inc. All rights reserved; 18.11a-d: From Fredy Altpeter, Vimla Vasil, Vibha Srivastava, Eva Stöger and Indra K. Vasil, “Accelerated production of transgenic wheat (Triticum aestivum L.) plants,” Plant Cell Reports, Vol. 16, pp. 12-17 © 1996 Springer; 18.12: Image from the RCSB PDB (www.pdb.org); PDB ID 1AZ2; Harrison, D.H., Bohren, K.M., Petsko, G.A., Ringe, D., Gabbay, K.H. (1997) “The alrestatin double-decker: binding of two inhibitor molecules to human aldose reductase reveals a new specificity determinant,” Biochemistry 36(51): 16134-40, 1997; 18.13: © Royalty-Free/Corbis; 18.14: © Grant Heilman/ Grant Heilman Photography, Inc.
Chapter 19 Opener: © Andrew Paul Leonard/Photo Researchers, Inc.; 19.1a-c: © Carolina Biological Supply Company/Phototake; 19.5b(1)-(4): © J. Richard Whittaker, used by permission; 19.8b: © University of Wisconsin-Madison; 19.9: © APTV/AP Photo; 19.13a: © Steve Paddock and Sean Carroll; 19.13b-d: © Jim Langeland, Steve Paddock and Sean Carroll; 19.16a: © Dr. Daniel St. Johnston/Wellcome Images; 19.16b:
C-2
© Schupbach, T. and van Buskirk, C.; 19.16c: From Roth et al., 1989, courtesy of Siegfried Roth; 19.17: Courtesy of E.B. Lewis; 19.20a-b: From Boucaut et al., 1984, courtesy of J-C Boucaut.
Chapter 20 Opener: © Cathy & Gordon ILLG; 20.2: © Corbis RF.
Chapter 21 Opener: © Photodisc/Getty RF; 21.3a-b: © Breck P. Kent/Animals Animals - Earth Scenes; 21.8a-b: © Courtesy of Lyudmila N. Trut, Institute of Cytology & Genetics, Siberian Dept. of the Russian Academy of Sciences; 21.11: © Kevin Schafer/Peter Arnold Inc.; 21.15a: © James Hanken, Museum of Comparative Zoology, Harvard University, Cambridge.
Chapter 22 Opener: © Chris Johns/National Geographic/ Getty Images; 22.2: © Porterfield/Chickering/ Photo Researchers, Inc.; 22.3: © Barbara Gerlach/ Visuals Unlimited; 22.7a: © Jonathan Losos; 22.7b: © Chas McRae/Visuals Unlimited; 22.7c-d: © Jonathan Losos; 22.13a-b: © Jeffrey Taylor; 22.16a(1): © Photo New Zealand/ Hedgehog House; 22.16a(2): © Jim Harding/First Light; 22.16a(3): © Colin Harris/Light Touch Images/Alamy; 22.16a(4)-(5): © Focus New Zealand Photo Library.
Chapter 23 Opener: © G. Mermet/Peter Arnold Inc.; 23.1a: Reproduced by kind permission of the Syndics of Cambridge University Library, Darwin’s Notebook ‘B’, ‘Tree of Life’ Sketch, p. 36 from DAR.121 D312; 23.8a: Image #5789, photo by D. Finnin/American Museum of Natural History; 23.8b: © Roger De La harpe/Animals Animals - Earth Scenes; 23.10a: © Lee W. Wilcox; 23.10b: © Dr. Richard Kessel & Dr. Gene Shih/ Visuals Unlimited.
Chapter 24 Opener: © Martin Harvey/Gallo Images/Corbis; 24.1a: © Steve Gschmeissner/Photo Researchers, Inc.; 24.1b: © Leslie Saint-Julien, National Human Genome Research Institute; 24.1c: © David M. Phillips/Visuals Unlimited; 24.1d: © Nigel Cattlin/Visuals Unlimited/Getty Images; 24.1e: © James Stevenson/Photo Researchers, Inc.; 24.1f: © AGB Photo Library/Grant Heilman Photography, Inc.; 24.1g: © Stephen Frink/Corbis; 24.1h: © Dr. Dennis Kunkel/Visuals Unlimited; 24.1i: © Steve Gschmeissner/Photo Researchers, Inc.; 24.1j: Photo by Gary Kramer, USDA Natural Resources Conservation Service; 24.1k: © T. Brain/Photo Researchers, Inc.; 24.1l: © McDonald Wildlife Photography/Animals Animals - Earth Scenes; 24.1m: © Digital Vision RF; 24.1n: © Corbis RF; 24.1o: © Nicole Duplaix/National Geographic/ Getty Images; 24.1p: © Ian Murray/Getty Images; 24.13: Courtesy of Dr. Lewis G. Tilney and Dr. David S. Roos, University of Pennsylvania; 24.14a: © Eye of Science/Photo Researchers, Inc.; 24.14b: © LSHTM/Stone/Getty Images; 24.14c: © Dr. Dennis Kunkel/Visuals Unlimited.
Chapter 25 Opener: © Michael&Patricia Fogden/Minden Pictures; 25.4a: © Michael Persson; 25.4b: ©
E.R. Degginger/Photo Researchers, Inc.; 25.5: © Dr. Anna Di Gregorio, Weill Cornell Medical College; 25.10a: © Chuck Pefley/Getty Images; 25.10b: © Darwin Dale/Photo Researchers, Inc.; 25.10c: © Aldo Brando/Peter Arnold Inc.; 25.10d: © Tom E. Adams/Peter Arnold Inc.; 25.11a-c: From “Induction of Ectopic Eyes by Targeted Expression of the Eyeless Gene in Drosophila,” G. Halder, P. Callaerts, Walter J. Gehring, SCIENCE, Vol. 267: 1788-1792 © 24 March 1995. Reprinted with permission from AAAS; 25.12a-b: Courtesy of Dr. William Jeffrey.
Chapter 26 Opener: © Jeff Hunter/The Image Bank/Getty Images; 26.1: © T.E. Adams/Visuals Unlimited; p. 508 (bottom): © NASA/Photo Researchers, Inc.; 26.2: NASA/JPL/UA/Lockheed Martin; 26.5a: © Tom Walker/Riser/Getty Images; 26.5b: © Volume 8/Corbis RF; 26.5c: © Volume 102/ Corbis RF; 26.5d: © Volume 1/Photodisc/Getty RF; 26.14: © Sean W. Graham, UBC Botanical Garden & Centre for Plant Research, University of British Columbia.
Chapter 27 Opener: © Dr. Gopal Murti/Visuals Unlimited; 27.2: From “Three-dimensional structure of poliovirus at 2.9 A resolution,” JM Hogle, M Chow, and DJ Filman, SCIENCE Vol. 229: 1358-1365 © 27 September 1985. Reprinted with permission from AAAS; 27.3a: © Dept. of Biology, Biozentrum/SPL/Photo Researchers, Inc.; © Corbis RF.
Chapter 28 Opener: © David M. Phillips/Visuals Unlimited; 28.1: © J. William Schopf, UCLA; 28.2: © Roger Garwood & Trish Ainslie/Corbis; 28.5a: © SPL/ Photo Researchers, Inc.; 28.5b; © Dr. R. Rachel and Prof. Dr. K. O. Stetten, University of Regensburg, Lehrstuhl fuer Mikrobiologie, Regensburg, Germany; 28.5c: © Andrew Syred/ SPL/Photo Researchers, Inc.; 28.5d: © Microfiield Scientific Ltd/SPL/Photo Researchers, Inc.; 28.5e: © Alfred Paseika/SPL/Photo Researchers, Inc.; 28.5f: © Dr. Robert Calentine/Visuals Unlimited; 28.5g: © Science VU/S. Watson/Visuals Unlimited; 28.5h: © Dennis Kunkel Microscopy, Inc.; 28.5i: © Prof. Dr. Hans Reichenbach, Helmholtz Centre for Infection Research, Braunschweig; p. 552(top left): © Dr. Gary Gaugler/Science Photo Library/Photo Researchers, Inc.; p. 552(top center): © CNRI/ Photo Researchers, Inc.; p. 552(top right): © Dr. Richard Kessel & Dr. Gene Shih/Visuals Unlimited; 28.6b: © Jack Bostrack/Visuals Unlimited; 28.8b: © Julius Adler; 28.9a: © Science VU/S. W. Watson/Visuals Unlimited; 28.9b: © Norma J. Lang/Biological Photo Service; 28.10a: © Dr. Dennis Kunkel/Visuals Unlimited.
Chapter 29 Opener: © Wim van Egmond/Visuals Unlimited; 29.1: © Andrew H. Knoll/Harvard University; 29.6-29.7: © Science VU/E. White/Visuals Unlimited; 29.8a: © Andrew Syred/Photo Researchers, Inc.; 29.10a: © Manfred Kage/Peter Arnold Inc.; 29.10b: © Edward S. Ross; 29.11: © Vern Carruthers, David Elliott; 29.13: © David M. Phillips/Visuals Unlimited; 29.15: © Michael
c re d i t s
rav32223_cred_C1-C6.indd C-2
11/20/09 3:37:45 PM
Abbey/Visuals Unlimited; 29.16: © Prof. David J.P. Ferguson, Oxford University; 29.18(top right): © Brian Parker/Tom Stack & Associates; 29.19: © Michele Bahr and D. J. Patterson, used under license to MBL; 29.20: © David Fleetham/Visuals Unlimited; 29.22: © Dennis Kunkel/Phototake; 29.23: © Andrew Syred/Photo Researchers, Inc.; 29.24a: © Manfred Kage/Peter Arnold Inc.; 29.24b: © Wim van Egmond/Visuals Unlimited; 29.24c: © Runk/Schoenberger/Grant Heilman photography, Inc.; 29.25: © William Bourland, image used under license to MBL; 29.26: © Eye of Science/Photo Researchers, Inc.; 29.27: © Phil A. Harrington/Peter Arnold Inc.; 29.28: © Manfred Kage/Peter Arnold Inc.; 29.29: © Ric Ergenbright/Corbis; 29.30: © Peter Arnold Inc./ Alamy; 29.31: © John Shaw/Tom Stack & Associates; 29.32: © Mark J. Grimson and Richard L. Blanton, Biological Sciences Electron Microscopy Laboratory, Texas Tech University.
Chapter 30 Opener: © S.J. Krasemann/Peter Arnold Inc.; 30.3: © Dr. Richard Kessel & Dr. Gene Shih/Visuals Unlimited; 30.4: © Wim van Egmond/Visuals Unlimited; 30.5b: © Dr. Diane S. Littler; 30.6(left): © Dr. John D. Cunningham/Visuals Unlimited; 30.6(right): © Dr. Charles F. Delwiche, University of Maryland; 30.7: © David Sieren/Visuals Unlimited; 30.8: © Edward S. Ross; 30.11: © Lee W. Wilcox; 30.12a: Courtesy of Hans Steur, The Netherlands; 30.15: © Dr. Jody Banks, Purdue University; 30.16: © Kingsley Stern; 30.17: © Stephen P. Parker/Photo Researchers, Inc.; 30.18: © NHPA/Photoshot; 30.20(left): © Ed Reschke; 30.20(right): © Mike Zensa/Corbis; 30.21b: © Biology Media/Photo Researchers, Inc.; 30.22: © Patti Murray/Animals Animal - Earth Scenes; 30.24a: © Jim Strawser/Grant Heilman Photography, Inc.; 30.24b: © Nancy Hoyt Belcher/ Grant Heilman Photography, Inc.; 30.24c: © Robert Gustafson/Visuals Unlimited; 30.25 (bottom right): © Goodshoot/Alamy RF; 30.26a: © David Dilcher and Ge Sun; 30.27: Courtesy of Sandra Floyd; 30.31: © Dr. Joseph Williams.
Chapter 31 Opener: © Ullstein-Joker/Peter Arnold Inc.; 31.1a: © Dr. Ronny Larsson; 31.1b: Contributed by Don Barr, Mycological Society of America; 31.1c: © Carolina Biological Supply Company/Phototake; 31.1d: Contributed by Don Barr, Mycological Society of America; 31.1e: © Dr. Yuuji Tsukii; 31.1f: © Yolande Dalpe, Agriculture and Agri-Food Canada; 31.1g: © inga spence/Alamy; 31.1h: © Michael&Patricia Fogden; 31.2b: © Garry T. Cole/ Biological Photo Service; 31.3(inset): © Micro Discovery/Corbis; 31.3(right): © Michael&Patricia Fogden/Corbis; 31.4: © Eye of Science/Photo Researchers, Inc.; 31.5a: © Carolina Biological Supply Company/Phototake; 31.5b: © L. West/ Photo Researchers, Inc.; 31.6(left): © Daniel P. Fedorko; 31.7: Contributed by Daniel Wubah, Mycological Society of America; 31.8: Contributed by Don Barr, Mycological Society of America; 31.9a, 31.10a: © Carolina Biological Supply Company/Phototake; 31.11a: © Alexandra Lowry/ The National Audubon Society Collection/Photo Researchers, Inc.; 31.12a: © Richard Kolar/ Animals Animals - Earth Scenes; 31.12b: © Ed Reschke/Peter Arnold Inc.; 31.13: © David Scharf/
Photo Researchers, Inc.; 31.14(left): © Nigel Cattlin/Alamy; 31.14(right): © B. Borrell Casal/ Frank Lane Picture Agency/Corbis; 31.15a: © Ken Wagner/Phototake; 31.15b: © Robert & Jean Pollock/Visuals Unlimited; 31.15c: © Robert Lee/ Photo Researchers, Inc.; 31.16: © Ed Reschke; 31.17a: © Eye of Science/Photo Researchers, Inc.; 31.17b: © Dr. Gerald Van Dyke/Visuals Unlimited; 31.18: © Scott Camazine/Photo Researchers, Inc.; 31.19a: Courtesy of Ralph Williams/USDA Forest Service; 31.19b: © agefotostock/SuperStock; 31.19c: USDA Forest Service Archive, USDA Forest Service, Bugwood.org; 31.20a: © Dayton Wild/Visuals Unlimited; 31.20b: © Manfred Kage/ Peter Arnold Inc.; 31.21(inset): Courtesy of Dr. Peter Daszak; 31.21: © School of Biological Sciences, University of Canterbury, New Zealand.
Chapter 32 Opener: © Volume 53/Corbis RF; Table 32.1a: © Volume 86/Corbis RF; Table 32.1b: © Corbis RF; Table 32.1c: © David M. Phillips/Visuals Unlimited; Table 32.1d: © Corbis RF; Table 32.1e: © Edward S. Ross; Table 32.1f: © Volume 65/ Corbis RF; Table 32.1g: © Cleveland P. Hickman; Table 32.1h: © Cabisco/Phototake; Table 32.1i: © Ed Reschke; 32.6: © Steven C. Zinski.
Chapter 33 Opener: © Denise Tackett/Tackett Productions; 33.1a: © Andrew J. Martinez/Photo Researchers, Inc.; 33.2 (left): © Roland Birke/Phototake; 33.4: © VIOLA’S PHOTO VISIONS INC./Animals Animals - Earth Scenes; 33.5: © Neil G. McDaniel/ Photo Researchers, Inc.; 33.6: © Kelvin Aitken/ Peter Arnold Inc.; © Brandon Cole/Visuals Unlimited; 33.8: © Amos Nachoum/Corbis; 33.9: © Biosphoto/Leroy Christian/Peter Arnold Inc.; 33.10: © David Wrobel/Visuals Unlimited; 33.11(top): © Tom Adams/Visuals Unlimited; 33.12: © Dwight Kuhn; 33.13: © The Natural History Museum/Alamy; 33.14(left): © Dennis Kunkel/Phototake; 33.15: © L. Newman & A. Flowers/Photo Researchers, Inc.; 33.16: © Peter Funch, Aarhus University; 33.17: © Gary D. Gaugler/Photo Researchers, Inc.; 33.18: © Educational Images Ltd., Elmira, NY, USA. Used by Permission; 33.19: © T.E.Adams/Visuals Unlimited.
Chapter 34 Opener: © James H. Robinson/Animals Animals - Earth Scenes; 34.1a: © Marty Snyderman/Visuals Unlimited; 34.1b: © Alex Kerstitch/Visuals Unlimited; 34.1c: © Douglas Faulkner/Photo Researchers, Inc.; 34.1d: © agefotostock/SuperStock; 34.2: © A. Flowers & L. Newman/Photo Researchers, Inc.; 34.4: © Eye of Science/Photo Researchers, Inc.; 34.5a: © Demian Koop, Kathryn Green, Daniel J. Jackson; 34.5b: © Kjell Sandved/Butterfly Alphabet; 34.6: © Kelvin Aitken/Peter Arnold Inc.; 34.7: © Rosemary Calvert/Getty Images; 34.8: © Photodisc Green/ Getty Images; 34.10: © AFP/Getty Images; 34.11: © Jeff Rotman/Photo Researchers, Inc.; 34.12: © Kjell Sandved/Butterfly Alphabet; 34.13: © Ken Lucas/Visuals Unlimited; 34.15: © Ronald L. Shimek; 34.16: © Fred Grassle, Woods Hole Oceanographic Institution; 34.17: © David M. Dennis/Animals Animals - Earth Scenes; 34.18: © Pascal Goetgheluck/Photo Researchers, Inc.;
34.19b: © Robert Brons/Biological Photo Service; 34.20b: © Fred Bavendam/Minden Pictures; 34.27a: © National Geographic/Getty Images; 34.27b: © S. Camazine/K. Visscher/Photo Researchers, Inc.; 34.28: © T.E. Adams/Visuals Unlimited; 34.31: © David Liebman Pink Guppy; 34.32: © Kjell Sandved/Butterfly Alphabet; 34.33a: © Cleveland P. Hickman; 34.33b: © Valorie Hodgson/Visuals Unlimited; 34.33c: © Gyorgy Csoka, Hungary Forest Research Institute, Bugwood.org; 34.33d: © Kjell Sandved/Butterfly Alphabet; 34.33e: © Greg Johnston/Lonely Planet Images/Getty Images; 34.33f: © Nature’s Images/ Photo Researchers, Inc.; 34.35: © Dwight Kuhn; 34.36: © Kjell Sandved/Butterfly Alphabet; 34.37a: © Alex Kerstich/Visuals Unlimited; 34.37b: © Edward S. Ross; 34.38b: © Frederic Pacorel/Getty Images; 34.39: © Wim van Egmond/Visuals Unlimited; 34.40a: © Alex Kerstitch/Visuals Unlimited; 34.40b: © Randy Morse, GoldenStateImages.com; 34.40c: © Daniel W. Gotshall/Visuals Unlimited; 34.40d: © Reinhard Dirscherl/Visuals Unlimited; 34.40e: © Jeff Rotman/Photo Researchers, Inc.
Chapter 35 Opener: © PHONE Ferrero J.P./Labat J.M./Peter Arnold Inc.; 35.2: © Eric N. Olson, PhD/The University of Texas MD Anderson Cancer Center; 35.4a: © Rick Harbo; 35.5: © Heather Angel/ Natural Visions; 35.9(top): © agefotostock/ SuperStock; 35.9(bottom left): © Corbis RF; 35.9(bottom right): © Brandon Cole/www. brandoncole.com/Visuals Unlimited; 35.11: © Volume 33/Corbis RF; 35.13a: © Federico Cabello/SuperStock; 35.13b: © Raymond Tercafs/ Bruce Coleman/Photoshot; 35.16a: © John Shaw/ Tom Stack & Associates; 35.16b: © Suzanne L. Collins & Joseph T. Collins/Photo Researchers, Inc.; 35.16c: © Jany Sauvanet/Photo Researchers, Inc.; 35.22: © Paul Sareno, courtesy of Project Exploration; 35.24a(left): © William J. Weber/ Visuals Unlimited; 35.24a(right): © Frans Lemmens/Getty Images; 35.24b, 35.24c(left): © Jonathan Losos; 35.24c(right): © Rod Planck; 35.24d(left): © Volume 6/Corbis RF; 35.24d(right): © Zigmund Leszczynski/Animals Animals - Earth Scenes; 35.28: © Layne Kennedy/Corbis; 35.29a: © Corbis RF; 35.29b: © Arthur C. Smith III/Grant Heilman Photography, Inc.; 35.29c: © David Boyle/Animals Animals - Earth Scenes; 35.29d: © John Cancalosi/Peter Arnold Inc.; 35.32: © Stephen Dalton/National Audubon Society Collection/Photo Researchers, Inc.; 35.33a (left): © B.J Alcock/Visuals Unlimited; 35.33a(right): © Dave Watts/Alamy; 35.33b(left): © Volume 6/ Corbis RF; 35.33b(right): © W. Perry Conway/ Corbis; 35.33c(left): © Stephen J. Krasemann/ DRK Photo; 35.33c(right): © Juergen & Christine Sohns/Animals Animals - Earth Scenes; 35.34: © Alan G. Nelson/Animals Animals - Earth Scenes; 35.35a: © Peter Arnold Inc./Alamy; 35.35b: © Martin Harvey/Peter Arnold Inc.; 35.35c (left): © Joe McDonald/Visuals Unlimited; 35.35c (right): © Dynamic Graphics Group/IT Stock Free/ Alamy; 35.39: © AP/Wide World Photos.
Chapter 36 Opener: © Susan Singer; 36.4(top left)-(top right): © Dr. Robert Lyndon; 36.4(bottom left)-(bottom right): © Biodisc/Visuals Unlimited; 36.6a: © c re d i t s
rav32223_cred_C1-C6.indd C-3
C-3
11/20/09 3:37:45 PM
Brian Sullivan/Visuals Unlimited; 36.6b-c: © EM Unit, Royal Holloway, University of London, Egham, Surrey; 36.7: © Jessica Lucas & Fred Sack; 36.8: © Andrew Syred/Science Photo Library/ Photo Researchers, Inc.; 36.9a-b: Courtesy of Allan Lloyd; 36.10: © Runk/Shoenberger/Grant Heilman Photography, Inc.; 36.11a: © Lee W. Wilcox; 36.11b: © George Wilder/Visuals Unlimited; 36.11c: © Lee W. Wilcox; 36.12(top): © NC Brown Center for Ultrastucture Studies, SUNY, College of Environmental Science and Forestry, Syracuse, NY; 36.12(bottom): USDA Forest Service, Forest Products Laboratory, Madison, WI; 36.13b: © Dr. Richard Kessel & Dr. Gene Shih/Visuals Unlimited; 36.14: © Biodisc/ Visuals Unlimited; 36.15b, 36.16b: Reprinted from Cell, Volume 99, Issue 5, Myeong Min Lee & John Schiefelbein, “WEREWOLF, a MYB-Related Protein in Arabidopsis, Is a Position-Dependent Regulator of Epidermal Cell Patterning,” pp. 473483, © 24 November 1999, with permission from Elsevier.; 36.17(top left): © Carolina Biological Supply Company/Phototake; 36.17(top right): Photo by George S. Ellmore; 36.17(bottom left): © Lee W. Wilcox; 36.17(bottom right): Photo by George S. Ellmore; 36.19a: © E.R. Degginger/ Photo Researchers, Inc.; 36.19b: © Peter Frischmuth/Peter Arnold Inc.; 36.19c: © Walter H. Hodge/Peter Arnold Inc.; 36.19d: © Gerald & Buff Corsi/Visuals Unlimited; 36.19e: © Kingsley Stern; 36.20: Courtesy of J.H. Troughton and L. Donaldson/Industrial Research Ltd.; 36.23a-b: © Ed Reschke; 36.26: © Ed Reschke/Peter Arnold Inc.; 36.27a: © Ed Reschke; 36.27b: © Biodisc/ Visuals Unlimited; 36.28a: © Jerome Wexler/ Visuals Unlimited; 36.28b: © Lee W. Wilcox; 36.28c: © Runk/Shoenberger/Grant Heilman Photography, Inc.; 36.28d: © Chase Studio Inc/ Photo Researchers, Inc.; 36.28e: © Charles D. Winters/Photo Researchers, Inc.; 36.28f: © Lee W. Wilcox; 36.29 (left)-(right): © Scott Poethig, University of Pennsylvania; 36.30a: © Kjell Sandved/Butterfly Alphabet; 36.30b: © Pat Anderson/Visuals Unlimited; 36.31a: © Gusto/ Photo Researchers, Inc.; 36.31b: © Peter Chadwick/Dorling Kindersley/Getty Images; 36.32(top left), (top right), (bottom left), (bottom right): Reprinted from Current Biology, Volume 7, Issue 8, Julie Hofer, Lynda Turner, Roger Hellens, Mike Ambrose, Peter Matthews, Anthony Michael, Noel Ellis, “UNIFOLIATA regulates leaf and flower morphogenesis in pea,” pp. 581-587, © 1 August 1997, with permission from Elsevier; 36.34: © Ed Reschke.
Chapter 37 Opener: © Norm Thomas/The National Audubon Society Collection/Photo Researchers, Inc.; 37.4: © Edward Yeung (University of Calgary) and David Meinke (Oklahoma State University); 37.6a-d: Kindly provided by Prof. Chun-ming Liu, Institute of Botany, Chinese Academy of Sciences; 37.7: © Jan Lohmann, Max Planck Institute for Developmental Biology; 37.8c: © Ben Scheres, University of Utrecht; 37.8d-e: Courtesy of George Stamatiou and Thomas Berleth; 37.10 (left)-(right): © A. P. Mähönen; 37.11(top): © S.Kirchner/photocuisine/Corbis; 37.11(bottom): © Barry L. Runk/Grant Heilman Photography, Inc.; 37.13a: © Ed Reschke/Peter Arnold Inc.; 37.13b: © David Sieren/Visuals Unlimited; 37.15 (top
C-4
left)-(top center): © Kingsley Stern; 37.15(top right): Courtesy of Robert A. Schisling; 37.15(center left): © James Richardson/Visuals Unlimited; 37.15(center): © Kingsley Stern; 37.15(center right): © Charles D. Winters/Photo Researchers, Inc.; 37.16a: © Edward S. Ross; 37.16b: © Nigel Cattlin/Visuals Unlimited; 37.16c: © Phil Ashley/Getty Images; 37.16d: © John Kaprielian/Photo Researchers, Inc.; 37.18a: © Nigel Cattlin/Alamy; 37.18b: © PHONE Thiriet Claudius/Peter Arnold Inc.
41.29: © Runk/Schoenberger/Grant Heilman Photography, Inc.; 41.31: © Amnon Lichter, The Volcani Center; 41.34a: © John Solden/Visuals Unlimited; 41.34b: From D. R. McCarty, C. B. Carson, P. S. Stinard, and D. S. Robertson, “Molecular Analysis of viviparous-1: An Abscisic Acid-Insensitive Mutant of Maize,” The Plant Cell, Vol. 1, Issue 5, pp. 523-532 © 1989 American Society of Plant Biologists; 41.34c: © ISM/ Phototake.
Chapter 38
Opener: © Heather Angel/Natural Visions; 42.3a: © Fred Habegger/Grant Heilman Photography, Inc.; 42.3b: © Pat Breen, Oregon State University; 42.4: Courtesy of Lingjing Chen & Renee Sung; 42.5a; © Mack Henley/Visuals Unlimited; 42.5a(i): © Michael Gadomski/Animals Animals - Earth Scenes; 42.5b: © Max Planck Institute; 42.5b(i): © Ove Nilsson and Detlef Weigel, Salk Institute/Max Planck Institute; 42.7: © Jim Strawser/Grant Heilman Photography, Inc.; 42.12a-d: Courtesy of John L. Bowman; 42.15: © John Bishop/Visuals Unlimited; 42.16: © Paul Gier/Visuals Unlimited; 42.17a-b; Courtesy of Enrico Coen; 42.19a-b: © L. DeVos - Free University of Brussels; 42.20: © Kingsley Stern; 42.21: © David Cappaert, Bugwood.org; 42.23: © Michael Fogden/Animals Animals - Earth Scenes; 42.24a-b: © Thomas Eisner, Cornell University; 42.25: © John D. Cunningham/Visuals Unlimited; 42.26: © Edward S. Ross; 42.27a: © David Sieren/Visuals Unlimited; 42.27b: © Barbara Gerlach/Visuals Unlimited; 42.30: © Jerome Wexler/Photo Researchers, Inc.; 42.31a: © Sinclair Stammers/Photo Researchers, Inc.; 42.31b-d: From N. Kuchuk, R. G. Herrmann and H.-U. Koop, “Plant regeneration from leaf protoplasts of evening primrose (Oenothera hookeri),” Plant Cell Reports, Vol. 17, Number 8, pp. 601-604 © 5 May 1998 Springer; 42.32a: © Anthony Arendt/Alamy; 42.32b: © DAVID LAZENBY/Animals Animals - Earth Scenes.
Opener: © Richard Rowan’s Collection Inc/Photo Researchers, Inc.; 38.4a-b: © Jim Strawser/Grant Heilman Photography, Inc.; 38.7: © Ken Wagner/ Phototake; 38.11a-b: © Dr. Ryder/Jason Borns/ Phototake; 38.14: © Herve Conge/ISM/Phototake; 38.15a: © Ed Reschke; 38.15b: © Jon Bertsch/ Visuals Unlimited; 38.16: © Mark Boulton/Photo Researchers, Inc.; 38.18a: © Andrew Syred/Photo Researchers, Inc.; 38.18b: © Bruce Iverson Photomicrography.
Chapter 39 Opener: © Photodisc/Getty RF; 39.4a: © Hulton Archive/Getty Images; 39.4b: © UNESCO/M.L. Bonsirven-Fontana; 39.6a-d: Photo courtesy of the International Plant Nutrition Institute (IPNI), Norcross, Georgia, U.S.A.; 39.8: © George Bernard/Animals Animals - Earth Scenes; 39.9: © Ken Wagner/Phototake; 39.9(inset): © Bruce Iverson; 39.11a: © Kjell Sandved/Butterfly Alphabet; 39.11b: © Runk/Schoenberger/Grant Heilman Photography, Inc.; 39.13: © Don Albert; 39.11c: © Perennov Nuridsany/Photo Researchers, Inc.; 39.11d: © Barry Rice; 39.16a-b: Courtesy of Nicholas School of the Environment and Earth Sciences, Duke University. Photo by Will Owens; 39.18: Greg Harvey USAF; 39.19a: Office of the Guadiamar Green Corridor; 39.19b: © Marcelo del Pozo/Reuters; 39.19c: © AP/Wide World Photo.
Chapter 40 Opener: © Emily Keegin/fstop/Getty Images RF; 40.1: © Richard la Val/Animals Animals - Earth Scenes; 40.2: Photo by Scott Bauer, USDA/ARS; 40.3a: Photo by William Wergin and Richard Sayre/USDA/ARS; 40.3b: Photo by Scott Bauer, USDA/ARS; 40.6: © C. Allan Morgan/Peter Arnold Inc.; Table 40.1a-c: © Inga Spence/Visuals Unlimited; Table 40.1d: © Heather Angel/Natural Visions; Table 40.1e: © Pallava Bagla/Corbis; 40.7: © Adam Jones/Photo Researchers, Inc.; 40.8(left): © Gilbert S. Grant/Photo Researchers, Inc.; 40.8b(right): © Lee W. Wilcox; 40.9: © Michael J. Doolittle/Peter Arnold Inc.; 40.13: © Courtesy R.X. Latin. Reprinted with permission from Compendium of Cucurbit Diseases, 1996, American Phytopathological Society, St. Paul, MN.
Chapter 41 Opener: © Alan G. Nelson/Animals Animals Earth Scenes; 41.5a-d: © Niko Geldner, UNIL; 41.8: © Ray F. Evert; 41.10a(1)-(3): © Jee Jung and Philip Benfey; 41.11: © Lee W. Wilcox; 41.13: © Frank Krahmar/Zefa/Corbis; 41.16: © Don Grall/ Index Stock Imagery; 41.26a-c: © Prof. Malcolm B. Wilkins, Botany Dept, Glasgow University; 41.28: © Robert Calentine/Visuals Unlimited;
Chapter 42
Chapter 43 Opener: © Dr. Roger C. Wagner, Professor Emeritus of Biological Sciences, University of Delaware; Table 43.1a: © Ed Reschke; Table 43.1b: © Arthur Siegelman/Visuals Unlimited; Table 43.1c: © Ed Reschke; Table 43.1d: © Gladden Willis, M.D./Visuals Unlimited; Table 43.1e: © Ed Reschke; 43.3: © J Gross, Biozentrum/Photo Researchers, Inc.; 43.4: © BioPhoto Associates/ Photo Researchers, Inc.; Table 43.2a: © Ed Reschke; Table 43.3b: © Dr. John D. Cunningham/ Visuals Unlimited; Table 43.2c: © Chuck Brown/ Photo Researchers, Inc.; Table 43.2d: © Ed Reschke; Table 43.2e: © Kenneth Eward/Photo Researchers, Inc.; Table 43.3a-c: © Ed Reschke.
Chapter 44 Opener: Courtesy of David I. Vaney, University of Queensland Australia; 44.3: © Enrico Mugnaini/ Visuals Unlimited; 44.13: © John Heuser, Washington University School of Medicine, St. Louis, MO.; 44.15: © Ed Reschke; 44.17b: © Science VU/Lewis-Everhart-Zeevi/Visuals Unlimited; 44.25: © Dr. Marcus E. Raichle, Washington University, McDonnell Center for High Brain Function; 44.27: © Lennart Nilsson/ Albert Bonniers Förlag AB; 44.30: © E.R. Lewis/ Biological Photo Service.
c re d i t s
rav32223_cred_C1-C6.indd C-4
11/20/09 3:37:45 PM
Chapter 45 Opener: © Omikron/Photo Researchers, Inc.; 45.11d: © Dr. John D. Cunningham/Visuals Unlimited; 45.21: © A. T. D. Bennett; 45.24: © Leonard Lee Rue III.
Chapter 46 Opener: © Nature’s Images/Photo Researchers, Inc.; 46.10: © John Paul Kay/Peter Arnold Inc.; 46.11: © Bettmann/Corbis.
Chapter 47 Opener: © HAL BERAL/ Grant Heilman Photography, Inc.; 47.3a: © Ed Reschke/Peter Arnold Inc.; 47.3b: © David Scharf/Peter Arnold Inc.; 47.3c: © Dr. Holger Jastrow/http://www. uni-mainz.de/FB/Medizin/Anatomie/workshop/ EM/EMAtlas.html; 47.3d: © CNRI/Photo Reserachers, Inc.; 47.3e: © Dr. Kessel & Dr. Kardon/Tissue & Organs/Visuals Unlimted/Getty Images; 47.3f: © Ed Reschke/Peter Arnold Inc.; 47.3g: © Ed Reschke; 47.3h: © Ed Reschke/Peter Arnold Inc.; 47.10a-b: © Dr. H.E. Huxley; 47.21: © Treat Davidson/Photo Researchers, Inc.
Chapter 48 Opener: © Gerlach Nature Photography/Animals Animals - Earth Scenes; 48.10: © Ron Boardman/ Stone/Getty Images; 48.19: Courtesy AMGEN.
Chapter 49 Opener: © Photodisc/Alamy RF; 49.1; © Bruce Watkins/Animals Animals - Earth Scenes; 49.3: © Juniors Bildarchiv/Alamy; 49.13a: © Clark Overton/Phototake; 49.13b: © Martin Rotker/ Phototake; 49.14: © Kenneth Eward/BioGrafx/ Photo Researchers, Inc.
Chapter 50 Opener: © BioPhoto Associates/Photo Researchers, Inc.; 50.16a-b: © Ed Reschke; 50.16c: © Dr. Gladden Willis/Visuals Unlimited.
Chapter 51 Opener: © Rick & Nora Bowers/Alamy.
Chapter 52 Opener: © National Museum of Health and Medicine, Armed Forces Institute of Pathology/AP Photo; 52.3: © Manfred Kage/Peter Arnold Inc.; 52.6: © Wellcome Images; 52.12a-b: © Dr. Andrejs Liepins/Photo Researchers, Inc.; 52.22: © CDC/ Science Source/Photo Researchers, Inc.
Chapter 53 Opener: © Geordie Torr/Alamy; 53.1: © Dennis Kunkel Microscopy, Inc.; 53.2: © Fred McConnaughey/The National Audubon Society Collection/Photo Researchers, Inc.; 53.4: © Doug Perrine/SeaPics.com; 53.6: © Hans Pfletschinger/Peter Arnold Inc.; 53.7a: © Jonathan Losos; 53.7b: © David A. Northcott/ Corbis; 53.7c-d: © Michael Fogden/OSF/ Animals Animals - Earth Scenes; 53.8: © 2009 Frans Lanting/www.lanting.com; 53.9a: © Jean Phllippe Varin/Jacana/Photo Researchers, Inc.; 53.9b: © Tom McHugh/The National Audubon Society Collection/Photo Researchers, Inc.; 53.9c: © Corbis Volume 86 RF; 53.12: © David M. Phillips/Photo Researchers, Inc.; 53.17: © Ed Reschke; 53.21a: © Jonathan A. Meyers/Photo Researchers, Inc.; 53.21b: © The McGraw-Hill
Companies, Inc./Jill Braaten, photographer; 53.21c: © The McGraw-Hill Companies, Inc./ Bob Coyle, photographer; 53.21d: © Kumar Sriskandan/Alamy.
Chapter 54 Opener: © Lennart Nilsson/Albert Bonniers Förlag AB, A Child Is Born, Dell Publishing Company; 54.1c-d: © David M. Phillips/Visuals Unlimited; 54.3a-d: Dr. Mathias Hafner (Mannheim University of Applied Sciences, Institute for Molecular Biology, Mannheim, Germany) and Dr. Gerald Schatten (Pittsburgh Development Centre Deputy Director, MageeWoman’s Research Institute Professor and Vice-Chair of Obstetrics, Gynecology & Reproductive Sciences and Professor of Cell Biology & Physiology Director, Division of Developmental and Regenerative Medicine University of Pittsburgh School of Medicine Pittsburgh, PA 15213); 54.7: © David M. Phillips/ Visuals Unlimited; 54.8a: © Cabisco/Phototake; 54.9: © David M. Phillips/Visuals Unlimited; 54.11a: From “An Atlas of the Development of the Sea Urchin Lytechinus variegatus. Provided by Dr. John B. Morrill (left to right) Plate 20, pg 62, #I; 54.11b: From “An Atlas of the Development of the Sea Urchin Lytechinus variegatus. Provided by Dr. John B. Morrill (left to right) Plate 33, pg 93, #C; 54.11c: From “An Atlas of the Development of the Sea Urchin Lytechinus variegatus. Provided by Dr. John B. Morrill (left to right) Plate 38, pg 105, #G; 54.17a-b: © Courtesy of Manfred Frasch; 54.20c(1)-(2): © Roger Fleischman, University of Kentucky; 54.26a, 54.27a-d: © Lennart Nilsson/ Albert Bonniers Förlag AB, A Child Is Born, Dell Publishing Company.
Chapter 55 Opener: © K. Ammann/Bruce Coleman/ Photoshot; 55.2: © Dr. Nicolette Siep; 55.4a-b: Reprinted from Cell, Volume 86, Issue 2, Jennifer R Brown, Hong Ye, Roderick T Bronson, Pieter Dikkes and Michael E Greenberg, “A Defect in Nurturing in Mice Lacking the Immediate Early Gene fosB,” pp. 297-309, © 26 July 1996, with permission from Elsevier; 55.5a-b: Reprinted by permission from Macmillan Publishers Ltd: Nature Neuroscience 7, 1048-1054, “The neurobiology of pair bonding,” Larry J Young, Zuoxin Wang © 2004; 55.6a-c: © Boltin Picture Library/The Bridgeman Art Library; 55.7: © William Grenfell/Visuals Unlimited; 55.8: © Thomas McAvoy, Life Magazine/Time, Inc./ Getty Images; 55.9: © Harlow Primate Laboratory; 55.11: © Roger Wilmhurst/The National Audubon Society Collection/Photo Researchers, Inc.; 55.12a: © Linda Koebner/ Bruce Coleman/Photoshot; 55.12b: © Jeff Foott/ Tom Stack & Associates; 55.13a-c: © SuperStock; 55.14: Courtesy of Bernd Heinrich; 55.15b: © Fred Breunner/Peter Arnold Inc.; 55.15c: © George Lepp/Getty Images; 55.18: © Dwight Kuhn; 55.21: © Tom Leeson; 55.22b: © Scott Camazine/Photo Researchers, Inc.; 55.23a: © Gerald Cubitt; 55.24: © Nina Leen, Life Magazine/Time, Inc./Getty Images; 55.27(left): © Peter Steyn/Getty Images; 55.27(right): © Gerald C. Kelley/Photo Researchers, Inc.; 55.28a: © Bruce Beehler/Photo Researchers, Inc.; 55.28b: © B. Chudleigh/Vireo; 55.30: © Cathy & Gordon
ILLG; 55.31a: © Michael&Patricia Fogden/ Minden Pictures/National Geographic Image Collection; 55.32a: Reprinted by permission from Macmillan Publishers Ltd: Nature 338, 249-251, “Parental care and mating behavior of polyandrous dunnocks,” T. Burke, N. B. Daviest, M. W. Bruford, B. J. Hatchwell © 1989; 55.33: © Nick Gordon - Survival/OSF/Animals Animals Earth Scenes; 55.35: © Steve Hopkin/Getty Images; 55.36: © Heinrich Van Den Berf/Peter Arnold Inc.; 55.37: © Stuart Westmorland/Getty Images; 55.38: © Mark Moffett/Minden Pictures; 55.39: © Nigel Dennis/National Audubon Society Collection/Photo Researchers, Inc.
Chapter 56 Opener: © Volume 44/Photodisc/Getty RF; 56.1: © Michael Fogden/Animals Animals - Earth Scenes; 56.4: © Stone Nature Photography/Alamy; 56.13: © Christian Kerihuel; 56.15: Courtesy of Barry Sinervo; 56.21(left): © Juan Medina/Reuters/ Corbis; 56.21(right): © Oxford Scientific/ Photolibrary.
Chapter 57 Opener: © Corbis RF; 57.1: © Daryl & Sharna Balfour/Okopia/Photo Researchers, Inc.; 57.6a-d: © Jonathan Losos; 57.10a: © Edward S. Ross; 57.10b: © Raymond Mendez/Animals Animals Earth Scenes; 57.11a-b: © Lincoln P. Brower; 57.12: © Michael&Patricia Fogden/Corbis; 57.13: © Milton Tierney/Visuals Unlimited; 57.15: © Merlin D. Tuttle/Bat Conservation International; 57.16: © Eastcott/Momatiuk/The Image Works; 57.17: © Volume 44/Photodisc/Getty RF; 57.18: © Michael Fogden/DRK Photo; 57.19: © Charles T. Bryson, USDA Agricultural Research Service, Bugwood.org; 57.21a: © F. Stuart Westmorland/ Photo Researchers, Inc.; 57.21b: © Ann Rosenfeld/ Animals Animals - Earth Scenes; 57.23: © David Hosking/National Audubon Society Collection/ Photo Researchers, Inc.; 57.24b-d: © Tom Bean; 57.25a-b: © Studio Carlo Dani/Animals Animals Earth Scenes; 57.26: © Educational Images Ltd., Elmira, NY, USA. Used by Permission.
Chapter 58 Opener: © Photodisc/Getty RF; 58.3: © Worldwide Picture Library/Alamy; 58.6: Jeff Schmaltz, MODIS Rapid Response Team, NASA/ GSFC; 58.7a: U.S. Forest Service; 58.19a: © Layne Kennedy/Corbis.
Chapter 59 Opener: GSFC/NASA; 59.10: © Andoni Canela/ agefotostock; 59.11: © Image Plan/Corbis RF; 59.14a: © Art Wolfe/Photo Researchers, Inc.; 59.14b: © Bill Banaszowski/Visuals Unlimited; 59.16: Provided by the SeaWiFS Project, NASA/ Goddard Space Flight Center, and ORBIMAGE; 59.17: © Digital Vision/Getty RF; 59.19a: © Jim Church; 59.19b: © Ralph White/Corbis; 59.22a: © Peter May/Peter Arnold Inc.; 59.22b: © 2009 Frans Lanting/www.lanting.com; 59.23: © Gilbert S. Grant/National Audubon Society Collection/Photo Researchers, Inc.; 59.25a: NASA/Goddard Space Flight Center Scientific Visualization Studio; 59.27: NASA Goddard Institute for Space Studies; 59.29a: © Dr. Bruno Messerli; 59.29b: © Prof. Lonnie Thompson, Ohio State University. c re d i t s
rav32223_cred_C1-C6.indd C-5
C-5
11/20/09 3:37:45 PM
Chapter 60 Opener: © Norbert Rosing/National Geographic Image Collection; 60.2: © John Elk III; 60.3a: © Frank Krahmer/Masterfile; 60.3b: © Michael&Patricia Fogden/Minden Pictures; 60.3c: © Heather Angel/Natural Visions; 60.3d: © NHPA/Photoshot; 60.5a: © Edward S. Ross; 60.5b: © Inga Spence/Visuals Unlimited/Getty Images; 60.6a: © Jean-Leo Dugast/Peter Arnold Inc.; 60.6b: © Oxford Scientific/Photolibrary;
C-6
60.8: © Michael Fogden/DRK Photo; 60.9a: © Brian Rogers/Natural Visions; 60.9b: © David M. Dennis/Animals Animals - Earth Scenes; 60.9c: © Michael Turco, 2006; 60.9d: © David A. Northcott/Corbis; 60.13(right): © Dr. Morley Read/Photo Researchers, Inc.; 60.13(left): © Randall Hyman; 60.14: © John Gerlach/Animals Animals - Earth Scenes; 60.16: © Peter Yates/ Science Photo Library/Photo Researchers, Inc.; 60.17(left): © Jack Jeffrey; 60.17(right): © Jack
Jeffrey/PhotoReseourceHawaii.com; 60.18: © Tom McHugh/Photo Researchers, Inc.; 60.20: © Merlin D. Tuttle/Bat Conservation International; 60.21a: ANSP © Steven Holt/ stockpix.com; 60.21b: U.S. Fish and Wildlife Service; 60.23: © Wm. J. Weber/Visuals Unlimited; 60.24a-b: © University of WisconsinMadison Arboretum; 60.26b: © Studio Carlo Dani/Animals Animals - Earth Scenes.
c re d i t s
rav32223_cred_C1-C6.indd C-6
11/20/09 3:37:45 PM
Index
Boldface page numbers correspond with boldface terms in the text. Page numbers followed by an “f” indicate figures; page numbers followed by a “t” indicate tabular material.
A A band, 969 Aardvark, 525, 525f ABC model, of floral organ specification, 846, 846f, 847f, 848, 848f ABO blood group, 90t, 230t, 234-235, 235f, 1077 Abscisic acid, 779, 779f, 826t, 836, 836f Abscission, 823-824, 823f Abscission zone, 823, 823f Absolute dating, 424 Absorption in digestive tract, 982, 989-990, 989f water and minerals in plants, 771f, 773-775, 774f-775f Absorption spectrum, of photosynthetic pigments, 152-154, 152f, 153f Abstinence, 1100 Acacia, mutualism with ants, 809, 809f, 1198, 1198f Acari (order), 682 Acceptor stem, 291-292, 291f Accessory digestive organs, 983f, 988-989, 988f-989f, 994-995, 995f Accessory pigment, 152, 153f Accessory sex organs female, 1097-1098, 1098f male, 1092-1093, 1093f Acetaldehyde, 35f Acetic acid, 35f Acetyl-CoA in Krebs cycle, 131, 132, 133f, 138, 138f from protein catabolism, 141f from pyruvate, 130, 130f uses of, 142 Acetylcholine, 897-898, 897f-898f, 909t, 910, 912, 912f, 973, 1034 Acetylcholine (ACh) receptor, 172, 893f, 912, 912f Acetylcholinesterase (AChE), 898 Achiasmate segregation, 214 Acid, 29-30 Acid growth hypothesis, 830, 831f Acid precipitation, 1246, 1246f-1247f Acid rain, 1247, 1247f Acid soil, 789 Acini, 989
Acoela, 644f, 660, 660f Acoelomate, 637, 637f, 643, 644f, 656-660, 657f, 659f-661f Acoelomorpha, 644f Acromegaly, 950 Acrosomal process, 1106 Acrosome, 1106 ACTH, 947-948 Actin, 970f Actin filament, 76, 76f, 84, 84f Actinobacteria, 550f Actinomyces, 550f, 561 Actinopoda (phylum), 583 Action potential, 893-895 all-or-none law of, 894 falling phase of, 893, 894f generation of, 893-895, 894f-895f propagation of, 894-895, 895f rising phase of, 893, 894f, 895, 895f undershoot phase of, 893, 894f Action spectrum, 153 of chlorophyll, 153, 153f Activation energy, 111, 111f, 113-114 Activator, 117, 308, 313, 314-315, 314f-315f, 316-317 allosteric, 117 Active immunity, 1063 Active site, 114, 114f Active transport, across plasma membrane, 99-102, 104t Acute-phase protein, 1059 ADA-SCID, 345 Adaptation, speciation and, 443, 443f Adapter protein, 176, 178 Adaptive radiation, 446-447, 446f-447f, 450, 450f Adaptive significance, of behavior, 1148 Adaptive value, of egg coloration, 1147-1148, 1147f Addiction, drug, 900-901, 900f Adenine, 42, 42f, 259f, 260, 262 Adenohypophysis, 946 Adenosine diphosphate. See ADP Adenosine monophosphate. See AMP Adenosine triphosphate. See ATP Adenovirus, 531f Adenylyl cyclase, 179-180, 180f, 946 ADH. See Antidiuretic hormone Adherens junction, 84 Adhesion, 27, 27f Adipose cells, 868 Adipose tissue, 868, 868f ADP, 113, 113f Adrenal cortex, 954, 954f Adrenal gland, 953-954, 954f Adrenal medulla, 953-954, 954f
Adrenocorticotropic hormone (ACTH), 947-948 Adsorption, of virus to host, 533 Adventitious plantlet, 858 Adventitious root, 742, 746f, 765f Aerenchyma, 780, 781f Aerial root, 742, 743f Aerobic capacity, 974 Aerobic metabolism, 129 Aerobic respiration, 124, 126, 126f, 129, 136f ATP yield from, 137-138, 137f evolution of, 143 regulation of, 138, 138f Aesthetic value, of biodiversity, 1263 Afferent arteriole, 1046 Afferent neuron. See Sensory neuron Aflatoxin, 630, 630f African savanna, 1186f African sleeping sickness, 574 African violet, 748f Afrovenator, 709f Age, at first reproduction, 1173 Age structure, of population, 1169 Agent Orange, 831 Aging, telomerase and, 273 Agriculture applications of genetic engineering to, 346-349, 346f-348f applications of genomics to, 368-369, 368f-369f effect of global warming on, 1252-1253 pollution due to, 1251 Agrobacterium tumefaciens, 346, 346f, 832, 833f AIDS, 470-471, 531, 532t, 535-538, 1079 deaths in United States, 535 gene therapy for, 345, 345t Air pollution, monitoring with lichens, 627 Akiapolaau, 1270f Alanine, 35f, 46, 47f Alaskan near-shore habitat, 1271-1272, 1272f Albinism, 227t, 228, 228f Albumin, 1019 Aldosterone, 954, 1035, 1050, 1051, 1052f Aleurone, 764f, 765 Alfalfa plant bug, 803, 803f Alkaptonuria, 227t, 279 Allantoin, 1044 Allantois, 706, 708f, 1089, 1116 Allee effect, 1176 Allee, Warder, 1176
Allele, 225 multiple, 233t, 233-235, 235f temperature-sensitive, 235, 235f Allele frequency, 397, 399-400 changes in populations, 398-400, 399f Allelopathy, 807, 807f Allen’s rule, 1164 Allergy, 1075, 1076f Alligator, 707t, 711, 711f Allometric growth, 1128 Allomyces, 615t, 620, 621f Allopatric speciation, 442, 442f, 444-445, 444f Allopolyploidy, 445, 445f, 477, 477f, 479f Allosteric activator, 117 Allosteric enzymes, 117 Allosteric inhibitor, 117, 117f Allosteric site, 117 Alpha helix, 48 Alpha wave, 905 Alternate leaf, 744, 744f Alternation of generations, 850 Alternative splicing, 290, 320, 321f, 322f, 361, 361f Altricial young, 1153 Altruism, 1154-1157, 1155f-1157f reciprocal, 1154-1155, 1155f Alveolata, 515f, 570f, 576-579, 569f-579f Alveoli, 1007-1008, 1008f Alveoli, of protists, 576, 576f Alzheimer disease, 906-907 Amborella, 607, 607f Amborella trichopoda, 521-522, 522f, 607, 607f American basswood, 836f American woodcock (Scolopax minor), 933 Amino acid, 44 abbreviations for, 47f catabolism of, 141, 141f chemical classes of, 46, 47f as neurotransmitters, 898-899 in proteins, 36f, 44 structure of, 44-46, 47f twenty common, 47f Amino acid derivative, 939 Amino group, 35, 35f Aminoacyl-tRNA synthetase, 291-291, 291f-292f Ammonia, 1044, 1045f Amniocentesis, 252, 252f Amnion, 1089, 1116 Amniotic egg, 706, 708f, 1089 Amniotic fluid, 1116 Amniotic membrane, 1116
I-1
rav32223_Index_I1-I33.indd I-1
11/25/09 11:54:44 AM
Amoeba, 571, 583-584, 583f slime mold, 585, 585f Amoeba proteus, 583f AMP, 112f, 113, 124 Amphibia (class), 698f, 703-706, 704f-705f Amphibian, 641t, 698f, 703-706, 704f-705f brain of, 903, 903f characteristics of, 703, 703t circulation in, 703, 1024, 1024f classification of, 705-706, 705f development in, 952, 952f eggs of, 1249f evolution of, 697, 703, 704-705, 704f-705f fertilization in, 1088, 1088f-1089f first, 704-705 gastrulation in, 1114, 1114f heart of, 703, 1024, 1024f invasion of land by, 704-705, 704f-705f kidney of, 1043 legs of, 703, 704f lungs of, 703, 1007, 1007f nitrogenous wastes of, 1044, 1045f nuclear transplant in, 380 orders of, 703t population declines in, 1258t, 1264-1266, 1264f-1265f prolactin in, 951 reproduction in, 704 respiration in, 703, 1004, 1003f-1004f Amphioxus. See Branchiostoma Ampullae of Lorenzini, 934 Amygdala, 905 Amylopectin, 40, 40f Amyloplast, 75, 739, 820, 820f Amylose, 39, 40, 40f Anabaena, 563 Anabolism, 117 Anaerobic respiration, 124, 139 Analogous structures, 11, 11f, 498 Anaphase meiosis I, 210, 211f, 212f, 214, 215, 216f-217f meiosis II, 213f, 214, 217f mitotic, 192f, 195f, 196-197, 197f, 216f Anaphase A, 195f, 197-198 Anaphase B, 195f, 197-198 Anaphase-promoting complex (APC), 201 Anatomical dead space, 1010 Ancestral characters, 458-459, 459f Anchoring junction, 83f, 84 Andrews, Tommie Lee, 336, 336f Androecium, 608, 608f, 848-849 Androgen, 956 Aneuploidy, 214, 250, 481 Angelman syndrome, 251-252 Angina pectoris, 1033 Angiosperm. See Flowering plant Angle of incidence, 1231 Animal(s) body plan of, evolution of, 636-640, 636f-637f, 639f classification of, 522-525, 640, 641t-642t, 643-645, 644f-645f
I-2
coevolution of plants and, 807 communication and, 1144-1147, 1144f-1147f development in, 372-373, 373f, 635t diversity in, 633-646 evolution of, 583, 645-646, 646f fruit dispersal by, 762, 763f gap junctions in, 83f, 84 general features of, 634, 634t-635t habitats of, 635t movement in, 634t multicellularity in, 634t obtaining nutrients, 634t phylogeny of, 640, 643-645, 644f-645f pollination by, 852-854, 852f-853f sexual life cycle in, 208, 208f sexual reproduction in, 519, 635t succession in animal communities, 1203, 1203f transgenic, 342 Animal breeding, thoroughbred horses, 414, 414f Animal cells cell division in, 188f cytokinesis in, 197, 197f genetically modified domesticated, 349 sexual life cycle in, 208, 208f structure of, 66f, 80-81, 81f, 81t Animal pole, 377, 377f, 1110, 1110f Animalia (kingdom), 13, 13f, 513f, 514, 515f, 517f, 518t, 640 Anion, 19, 96 Annelid, 140, 643, 644f, 673-676, 673f-676f body plan of, 673-674, 673f classes of, 674-676 connections between segments, 674 excretory system of, 674 segmentation in, 523, 523f, 639-640, 643, 673-674 Annelida (phylum), 641t, 643, 644f, 673-676, 673f-676f Annotation, 359 Annual plants, 859f, 860 Anolis lizard courtship display of, 443, 443f dewlap of, 443, 443f Anonymous marker, 248, 248f Anopheles mosquito, 358f, 475f, 487, 1079 Anoxygenic photosynthesis, 143, 148, 156 Ant ant farmer-fungi symbiosis, 629, 629f mutualism with acacias, 809, 809f, 1198, 1198f social, 1158f Antagonistic effector, 877-878, 877f Anteater, 431f, 525, 525f Antenna complex (photosynthesis), 154-155, 155f, 157 Antennal gland, 1041 Antennapedia complex, 388f, 389
Antennapedia gene, 388, 494 Anterior pituitary, 946, 947-948, 948-951, 950f Anther, 608, 608f, 848f, 849 Antheridium, 594, 594f Anthocyanin, 824 Anthophyta (phylum), 602t Anthozoa (class), 654-655, 654f Anthrax, 554, 561t Anthropoid, 721, 721f-722f Antibiotic resistance, 558 Antibiotics, bacteria susceptibility to, 64 Antibody, 1063, 1068-1074, 1069f-1074f. See also Immunoglobulin (Ig) antigen-binding site on, 1070, 1070f-1071f monoclonal, 1077-1078, 1078f polyclonal, 1077 recombinant, 349 specificity of, 1069-1070, 1070f Anticodon loop, 291-292, 291f Antidiuretic hormone (ADH), 947, 947f, 1034, 1049, 1050-1051, 1051f Antigen, 1061-1062, 1062f, 1074, 1074f, 1078f Antigen-binding site, 1070, 1070f-1071f Antigen drift, 1079 Antigen-presenting cell, 1066 Antigen shift, 1079 Antigenic determinant, 1062 Antiparallel strands, in DNA, 262f, 263 Antiporter, 100 Anura (order), 703, 703t, 705-706, 705f Aorta, 1029 Aortic body, 1011, 1011f Aortic valve, 1026 AP gene, in plants, 499-500, 499f-500f APC. See Anaphase-promoting complex Ape, 720t, 721-726 compared to hominids, 722 evolution of, 721-726 Aperture (pollen grain), 609 Apex, 730 Aphasia, 906 Aphid, feeding on phloem, 782, 782f Apical meristem, 731, 732, 732f-733f, 832f Apical surface, 866, 987 Apicomplexans, 576, 576f, 577-578 Aplysina longissima, 650f Apoda (order), 703, 703t, 705f, 706 Apolipoprotein B, 320-321 Apomixis, 857 Apoplast route, 775, 775f Apoptosis, 305, 1067, 1067f in development, 390-391, 391f genetic control of, 390-391, 391f mechanism of, 390-391 Appendicular locomotion, 975 Appendix, 990, 990f Aquaculture, 1248
Aquaporin, 98, 104t, 772, 773f, 1050 Aqueous solution, 97 Aquifer, 1210 Aquifex, 515f, 516, 550f Arabidopsis aquaporins of, 772 auxin transport in, 830 columella cells in, 739 CONSTANS gene in, 843 det2 mutant in, 817, 817f development in, 375, 499 embryonic flower mutant in, 841, 841f genome of, 358f, 364, 475f, 476-477, 479f, 486, 489, 595 GLABROUS3 mutant in, 735, 735f HOBBIT gene in, 757-758, 758f hot mutants in, 825 KANADI gene in, 747f LEAFY COTYLEDON gene in, 759 LEAFY gene in, 841 MONOPTEROS gene in, 758, 758f overexpression of flowering gene in, 841f PHABULOSA gene in, 747f PHAVOLUTA gene in, 747f phytochrome genes in, 815f, 816 scarecrow mutant in, 740, 740f, 820, 820f SHOOTMERISTEMLESS gene in, 756, 757f short root mutant, 820, 820f small RNAs in, 317 suspensor mutant in, 755, 756f thaliana, 755, 757f, 759 too many mouths mutant in, 734, 734f touch responses in, 821 transposons in, 484 trichome mutation in, 734f vernalization in, 844 WEREWOLF gene in, 739-740, 740f WOODEN LEG gene in, 759, 759f YABBY gene in, 747f Arachidonic acid, 943 Araneae (order), 681-682, 682f Arbuscular mycorrhizae, 622, 628, 628f Archaea (domain), 13, 13f, 483, 514, 515, 515f, 516t, 517f, 518t, 547, 549f Archaea (kingdom), 514 Archaeal viruses, 533 Archaebacteria, 516, 549f. See also Prokaryote bacteria versus, 547 cell wall of, 64, 548-549 characteristics of, 516, 516t gene architecture in, 549 membrane lipids of, 548, 549f nonextreme, 516 plasma membrane of, 63-64, 548 Archaefructus, 607, 607f Archaeopteryx, 425, 425f, 712, 712f, 714, 714f
index
rav32223_Index_I1-I33.indd I-2
11/25/09 11:54:45 AM
Archegonium, 594, 594f Archenteron, 638, 639f, 1114 Archosaur, 709, 709f Aristotle, 512 Armadillo, 525, 525f Armillaria, 614, 629f Arousal, state of consciousness, 905 ART. See Assisted reproductive technology Arteriole, 1030 Arteriosclerosis, 1033 Artery, 1030, 1030f Arthropod, 641t, 643, 644, 678-687, 679f-687f body plan of, 679-681, 679f-681f circulatory system of, 680, 680f classification of, 523f, 524-525 economic importance of, 678 excretory system of, 680f, 681 exoskeleton of, 679-680, 679f groups of, 679t jointed appendages of, 680 locomotion in, 976 molting in, 680 nervous system of, 680, 681f, 901f, 902 respiratory system of, 680-681, 681f, 1006 segmentation in, 523, 523f, 639-640, 679, 679f taste in, 926, 926f Arthropoda (phylum), 635, 641t, 644, 645f, 678-687, 679f-687f, 685t Artificial selection, 10, 403, 422-423, 422f-423f domestication, 422-423, 423f laboratory experiments, 422, 422f Artificial transformation, 558 Ascaris, 208, 641t, 663 Ascocarp, 624, 624f Ascomycetes, 615, 615f, 624-625, 624f Ascomycota (phylum), 615, 615f, 615t, 623-624 Ascospore, 624, 624f Ascus, 624, 624f Asexual reproduction, 572 in ascomycetes, 624-625 in plants, 857-859, 858f in protists, 572 in sponges, 651 in zygomycetes, 621, 621f Aspen, 859 Aspergillus flavus, 630, 630f Aspirin, 348, 943 Assemblage, 1186 Assembly, of virus particle, 533 Assisted reproductive technology (ART), 1102 Assortative mating, 402 Aster (mitosis), 195, 196f Asteroidea (class), 689, 689f, 690 Asthma, 1012 Atherosclerosis, 55, 1033, 1033f Atmosphere of early earth, 509 reducing, 509 Atmospheric circulation, 1231-1233, 1231f-1232f
Atom, 2f, 3, 18-19 chemical behavior of, 20, 20f energy within, 21, 21f isotopes of, 19-20, 19f neutral, 19 scanning tunneling microscopy of, 18f structure of, 18-20, 19f Atomic mass, 18-19 Atomic number, 18 ATP, 43-44, 44f energy storage molecule, 112-113 production of , 113, 113f. See also ATP synthase in electron transport chain, 124, 124f, 135-136, 135f, 136f in glycolysis, 127, 127f, 129 in Krebs cycle, 132, 131f, 133f in photosynthesis, 148, 149f, 151, 156-160, 156f, 158f-159f regulation of aerobic respiration, 138, 138f role in metabolism, 125 structure of, 44f, 112, 112f synthesis of, 125-126, 125f, 126f uses of in active transport, 100-102, 100f, 101f in coupled transport, 101-102, 101f in endergonic reactions, 113, 113f, 125 in muscle contraction, 971, 971f in protein folding, 51, 51f in sodium-potassium pump, 100-101, 100f ATP cycle, 113, 113f ATP-dependent remodeling factor, 317, 317f ATP synthase, 126, 126f, 136, 136f, 156, 158-160, 159f Atrial natriuretic hormone, 956, 1051 Atrial peptide, 343 genetically engineered, 343 Atrioventricular (AV) node, 1027, 1028f, 1034 Atrioventricular (AV) valve, 1026, 1027f Atrium, 1023, 1023f Attachment in HIV infection cycle, 536-537 of virus to host, 533 Auditory tube, 922 Australopithecine, 722-723 early, 723 Australopithecus, 722 Australopithecus afarensis, 724 Autocrine signaling, 169-170 Autoimmune disease, 1075 Autologous blood donation, 1077 Automated DNA sequencing, 337f, 339 Autonomic nervous system, 888, 889f, 909, 909t, 910, 910f, 911f Autophosphorylation, 175-176, 175f Autopolyploidy, 445, 445f, 477, 479f
Autosome, 241 nondisjunction involving, 250-251, 250f Autotroph, 123, 558, 559, 1214 Aux/IAA protein, 829-830, 830f Auxin cytokinin and, 832f discovery of, 825, 827-828, 827f-828f effects of, 828, 829f gravitropism and, 819, 820 mechanism of action of, 828-830, 829f phototropism and, 829f synthetic, 829f, 830-831 thigmotropism and, 821 Auxin binding protein, 829 Auxin receptor, 829 Auxin response factor (ARF), 829 AV node. See Atrioventricular node AV valve. See Atrioventricular valve Avascular bone, 966 Avery, Oswald, 257 Aves (class), 699f, 712-715, 712f, 714f-715f Avian cholera, 1061 Avian influenza, 539, 1079 Avirulent pathogen, 811 Axial locomotion, 975 Axil, 744 Axillary bud, 730f, 744, 744f, 802, 803f Axon, 872, 873t conduction velocities of, 895-896, 895t diameter of, 895 myelinated, 895-896, 895f, 895t, 896f unmyelinated, 895-896, 895f, 895t Aznalcóllar mine spill (Spain), 799-800, 799f Azolla, 599
B B cell, 1062t, 1063, 1063f B lymphocyte, 1063, 1063 Babbitt, Bruce, 1275 Bacillary dysentery, 560 Bacillus, 550f, 552 Bacillus anthracis, 550f, 561t Bacillus thuringiensis insecticidal protein, 347-348 Bacon, Francis, 5 Bacteria, 550f-551f. See also Prokaryote ancient, 546, 546f archaebacteria versus, 547 cell wall of, 64, 548-549 endosymbiotic, 568 flagella of, 64f, 65, 548, 553, 553f genetically engineered, 564 Gram staining of, 552-553, 552f-553f intestinal, 564 photosynthetic, 63-64, 64f, 150, 156, 156f, 547, 548, 569-570 plasma membrane of, 63-64, 93, 548
Bacteria (domain), 13, 13f, 483, 515, 515-516, 515f, 516t, 547, 549f Bacteria (kingdom), 514, 517f, 518t Bacterial artificial chromosome (BAC), 330-331, 356 Bacterial disease in humans, 558, 560-563, 561t, 562f in plants, 560 Bacteriochlorophyll, 559 Bacteriophage, 258, 528, 530-531, 530f, 533-534, 534f cloning vector, 330, 331f Hershey-Chase experiment with, 258-259, 258f induction of, 533-534 lysogenic cycle of, 533-534, 534f lytic cycle of, 533, 534f temperate, 533 virulent, 533 Bacteriophage lambda, 533 cloning vector, 330, 331f Bacteriophage T2, 531f Bacteriophage T4, 530f, 533 Bacteriorhodopsin, 95, 95f Bait protein, in DNA-binding hybrid, 341, 341f Ball-and-socket joint, 967, 968f Bank (fishing on continental shelf ), 1243 Barley, genome of, 363, 476, 479f Barnacle, 683-684, 683f competition among species of, 1188, 1188f Barometer, 1006 Baroreceptor, 919, 1034, 1035f Barr body, 243, 243f, 251 Barro Colorado Island, 1221 Basal body, 79, 79f Basal ganglia, 902t, 904 Basal metabolic rate (BMR), 995 Basal surface, 866 Base, 29-30 Base-pairs, 262, 262f Base substitution, 299, 300f Basidiocarp, 623, 623f Basidiomycetes, 615, 615f, 622-623, 623f Basidiomycota (phylum), 615, 615f, 615t, 622 Basidiospore, 622, 623f Basidium, 622, 623f Basophil, 1062, 1062t Bat, 525f, 717-718, 717f pollination by, 854, 1196f vampire, 1155, 1155f Bates, Henry, 1195 Batesian mimicry, 1195, 1195f, 1196 Batrachochytrium dendrobatidis, 619, 630 Beadle, George, 6, 279 Bean, 760, 760f, 765f, 822, 823f Bee chromosome number in, 189t pollination by, 852, 852f-853f solitary, 852 Beetle, species richness in, 469-470, 469f
index
rav32223_Index_I1-I33.indd I-3
I-3
11/25/09 11:54:45 AM
Behavior, 1132-1159. See also specific types adaptation to environmental change, 1164, 1164f adaptive significance of, 1148 altruism, 1154-1157, 1155f-1157f cognitive, 1141, 1141f-1142f communication and, 1144-1147, 1144f-1147f development of, 1139-1141 foraging, 1148-1149, 1148f innate, 1133, 1133f learning and, 1135, 1135f, 1137-1138, 1138f, 1140 migratory, 1142-1144, 1142f-1143f reproductive strategies, 1150-1154, 1150f-1153f study of, 1133-1134, 1133f territorial, 1149, 1149f Behavioral ecology, 1147-1149, 1148 Behavioral genetics, 1135-1137, 1135f-1137f in fruit flies, 1135-1136 in mice, 1136, 1136f Behavioral genomics, 369 Behavioral isolation, 438t, 439, 439f Bergey’s Manual of Systematic Bacteriology, 550 Beta wave, 905 β barrel, 50, 95, 95f β-oxidation, 141, 142f β-pleated sheet, 48, 95, 95f β α β motif, 50, 50f Betacyanin, 824 Bicarbonate, 30 bicoid gene, 384, 385f, 386 Bicuspid valve, 1026 Biennial plants, 860 Bilateral symmetry, 636-637, 636f-637f Bilaterally symmetrical flower, 499, 849-850, 849f Bilateria, 644f, 656-660, 657f, 659f-661f Bile, 983, 988f Bile pigments, 989 Bile salts, 989 Bilirubin, 1077 Binary fission, 187, 187f Binocular vision, 721, 933 Binomial name, 512 Biochemical pathway, 118, 118f evolution of, 118 regulation of, 118-119, 119f Biodiversity, 4, 1223-1226. See also Species richness biodiversity crisis, 1257-1261, 1257f-1260f conservation biology, 1256-1278 economic value of, 1261-1263, 1261f-1263f ethical and aesthetic values of, 1263 factors responsible for extinction, 1264-1275 Bioenergetics, 107 Biofilm, 548, 561-562 Biogenic amine, 899
I-4
Biogeochemical cycle, 1208-1214, 1208f-1213f in forest ecosystem, 1212-1213, 1213f Biogeography, 430, 432 island, 1226-1227, 1226f pattersn of species diversity, 1225, 1225f Bioinformatics, 359, 364 Biological community, 3f, 4, 1186-1187, 1186f-1187f Biological species concept, 437-438, 438t, 463 weaknesses in, 440-441 Biomarker, 547 Biome, 1235-1238, 1235f-1238f climate and, 1236, 1236f distribution of, 1235f predictors of biome distribution, 1236, 1236f Biopharming, 348-349 Bioremediation, 564 Biosphere, 3f, 4, 1230-1253 influence of human activity on, 1245-1253 Biostimulation, 564 Bioterrorism, 368, 368t Biotic potential, 1173 Bipedalism, 722, 723-724 Bipolar cell, 930, 931f Biramous appendage, 524, 524f Birch (Betula), 854f Bird, 641t, 699f, 712-715, 712f, 714f-715f altruism in, 1156-1157, 1157f bones of, 712 brain of, 903, 903f characteristics of, 712, 715 circulation in, 715, 1025, 1025f cost of reproduction in, 1171, 1172f declining populations of songbirds, 1268, 1268f digestive tract of, 984, 984f evolution of, 425, 424f-425f, 463, 466, 467f, 712, 712f, 714, 714f eyes of, 933 fertilization in, 1088-1089, 1088f-1089f, 1112f gastrulation in, 1114-1115, 1115f habituation in, 1137 kidney of, 1043-1044, 1044f locomotion in, 976-977, 977f magnetic field detection by, 934 migration of, 1142-1143, 1143f, 1252 nitrogenous wastes of, 1044, 1045f orders of, 713t parental care in, 464 pollination by, 852-854, 853f present day, 715 respiration in, 715, 1008, 1009f selection and beak sizes, 409-410, 410f, 418-419, 418f-419f sex chromosomes of, 241t territorial behavior in, 1149, 1149f thermoregulation in, 715 Bird flu, 539, 1079 Birdsong, 1140, 1140f, 1145, 1149
Birth control, 1098-1101, 1099f, 1099t, 1101f Birth control pill. See Oral contraceptives 1,3 Bisphosphoglycetate, 127, 128f Bithorax complex, 388f, 388-389, 494 Bivalent, 209 Bivalve mollusk, 667, 668f, 669 Bivalvia (class), 671, 671f Black walnut (Fuglans nigra), 807, 807f Blackman, F. F., 150 Bladder swim, 701-702, 701f urinary, 1045, 1046f Bladderwort (Utricularia), 794 Blade, of leaf, 730f, 747 BLAST algorithm, 359 Blastocladiomycetes, 619-620, 620f Blastocladiomycota (phylum), 615, 615f, 619 Blastocoel, 1110 Blastoderm, 1114, 1115f Blastodisc, 1111 Blastomere, 373, 373f, 1110, 1112 Blastopore, 392f, 635, 638, 639f, 1114 Blastula, 635, 1110 Bleaching (global warming), 1252 Blending inheritance, 399 Blinking, 908 Blood, 869t, 870, 1018-1021, 1018f-1021f functions of, 1018-1019 regulation of, 1034-1035, 1035f Blood acidosis, 30 Blood alkalosis, 30 Blood cells, 1019f Blood clotting, 1021, 1021f Blood flow, 1034-1035 Blood group ABO, 90t, 233t, 234-235, 235f, 397 genetic variation in, 397-398 Blood plasma, 1019 Blood pressure measurement of, 1029-1030, 1029f sensing, 919 Blood transfusion, 1077 Blood typing, 1077 Blood vessel, 1026-1030 characteristics of, 1030-1033, 1030f-1033f paracrine regulation of, 942-943 tissue layers of, 1030, 1030f Blue crab, 644f Blue-footed booby, 439, 439f Blue-light receptors, in plants, 818, 818f BMR. See Basal metabolic rate Bobolink (Dolichonyx oryzivorus), 1143, 1143f Body cavity evolution of, 637f, 638 kinds of, 638 Body plan animal, evolution of, 636-640, 636f-637f, 639f of vertebrates, 864-865, 865f
Body position, sensing of, 924-925, 924f-925f Body size, metabolic heat and, 881-882, 882f Body temperature, regulation of. See Thermoregulation Bohr effect, 1014 Bohr, Niels, 18 Bohr shift, 1014 Boll weevil (Anthonomus grandis), 684f Bolus, 985 Bone, 869t, 870, 963-967 avascular, 966 compact, 965f, 966 development of, 963-966, 964f endochondral, 965-966, 965f intramembranous, 963, 964f, 965 medullary, 965f, 966 remodeling of, 966-967, 966f-967f spongy, 965f, 966 structure of, 965f, 966 vascular, 966 Bone morphogenetic protein 4 (BMP4), 1124, 1124f Bony fish, 701-702, 701f, 1004-1006, 1004f, 1042 Book lung, 681 Borrelia burgdorferi, 550f, 561t Bottleneck effect, 402f, 403, 403f Bottom-up effect, 1219, 1221-1223, 1222f Botulism, 550f, 554, 561t Bowman’s capsule, 1042, 1047, 1047f Box jellyfish, 655, 655f Boysen-Jensen, Peter, 827 Brachiopoda (phylum), 642t, 643, 644f, 676, 677-678, 677f-678f Brachyury gene, 496-497, 497f Bract, 749 Bradykinin, 942 Brain, 902t of amphibians, 903, 903f of birds, 903, 903f divisions of, 902-903, 902t of fish, 902-903, 903f of mammals, 903, 903f primitive, 902 of reptiles, 903, 903f size of, 903, 903f of vertebrates, 903f Brainstem, 905 Branch point (nucleotide), 290, 290f Branchial chamber, 1004 Branching diagrams, 457, 457f Branching morphogenesis, 1118 Branchiostoma, 696, 696f Hox genes in, 389 Branchless gene, in Drosophila, 1118 Brassica evolution of, 495, 495f genome of, 479f Brassica juncea, 799 Brassinosteroid, 826t, 834, 834f Bread mold, 279 Breakbone fever, 1253
index
rav32223_Index_I1-I33.indd I-4
11/25/09 11:54:45 AM
Breathing, 1009-1012, 1010f-1012f mechanics of, 1002, 1010-1011, 1010f negative pressure, 1007 positive pressure, 1007 rate of, 1010-1011 regulation of, 1011-1012, 1011f Brenner, Sydney, 282, 283, 299 Briggs, Winslow, 828, 829f Bright-field microscope, 62t Brittle star, 689, 689f, 690 Bronchi, 1007, 1008f Brood parasite, 1140, 1140f Brown algae, 517f, 518, 569, 580, 580f, 581f Brush border, 988 Bryophyte, 463f, 593-595, 593f-595f Bryozoa (phylum), 641t, 643, 644f, 676-677, 677f Bt crops, 347-348 Budding, virus release from cells, 537 Buffer, 30, 30f Bulb (plant), 746, 746f Bulbourethral gland, 1091f, 1092 Bulk transport, 102 Bumblebee (Bombus), 852f Bushmeat, 471 Buttercup (Ranunculus), 741f alpine, New Zealand, 450-451, 450f Butterfly, 807, 880 effect of global warming on, 1252, 1252f eyespot on wings of, 498, 498f metapopulations of, 1167, 1168f mimicry in, 1195-1196, 1195f Buttress root, 743, 743f
C C3 photosynthesis, 161, 164, 164f, 165f C4 photosynthesis, 164-165, 164f, 165f, 749 Cactus finch (Geospiza scandens), 9f, 418f, 441, 448, 448f Cadherin, 83f, 84, 84f, 391-392 Cadherin domain, 391 Caecilian, 703, 703t, 705f, 706 Caenorhabditis elegans development in, 373, 374f, 390-391, 391f, 644, 662 small RNAs in, 317 transposons in, 484 CAL gene, 495, 495f Calciferol. See Vitamin D Calcitonin, 320, 321f, 952-953 Calcitonin gene-related peptide (CGRP), 320, 321f Calcium in fertilization, 1108, 1108f homeostasis, 952-953, 953f in muscle contraction, 972-973, 972f-973f as second messenger, 181-182, 182f California condor (Gymnogyps californianus), 1276-1277
Callus (plant), 858f, 859 Calmoudulin, 45t, 181, 182f Calorie, 108 Calvin cycle, 160-163, 161, 161f carbon fixation in, 160-163, 161f, 547 discovery of, 161 Calvin, Melvin, 161 Calyx, 848 CAM plants, 164, 165, 165f Cambrian explosion, 645-646, 646f Camel, 525 cAMP. See Cyclic AMP Campylobacter pylori, 562 Canaliculi, 870, 965, 965f Cancer, 175, 202 of breast, 808 cell cycle control in, 202-204, 203f of cervix, 541 hormonal responses in, 957 lung, 1012, 1012f telomerase and, 273 treatment of gene therapy, 345t viruses and, 540-541 Candida, 630 Candida milleri, 625 CAP. See Catabolite activator protein 5 Cap mRNA, 288, 188f Capillary, 1030, 1030f, 1031 Capsid, viral, 529, 529f Capsule, of bacteria, 63f, 64, 553 Captive breeding, 1276-1277, 1276f Carbohydrates, 33, 36f, 37, 38-41 catabolism of, 124, 138 function of, 37t structure of, 36f Carbon chemistry of, 24, 34-37 isotopes of, 19, 19f in plants, 790, 790t, 795-797, 795f-796f prokaryotes need for, 559 Carbon-12, 19, 19f Carbon-13, 19, 19f Carbon-14, 19, 19f, 20 Carbon cycle, 1208-1209, 1208f Carbon dioxide atmospheric, 1209, 1252, 1251f as electron acceptor, 139 from ethanol fermentation, 140 from Krebs cycle, 131-132, 133f from pyruvate oxidation, 130, 130f transport in blood, 1002-1015, 1015f use in photosynthesis, 147-151, 149f Carbon fixation, 148, 151, 160-163, 161f, 546-547, 563, 1209 Carbonic acid, 30, 114 Carbonic anhydrase, 114 Carbonyl group, 35, 35f Carboxyl group, 35, 35f, 44-46, 46f Cardiac cycle, 1026, 1027f Cardiac muscle, 871-872, 871t, 872f Cardiac output, 1034 Cardioacceleratory center, 1034 Cardioinhibitory center, 1034 Cardiovascular disease, 1033, 1033f
Carnivore, 525, 525f, 982 digestive system of, 991f human removal of, 1220-1221 primary, 1215, 1215f secondary, 1215, 1215f teeth of, 984, 984f top, 1218 in trophic level ecosystem, 1215, 1215f, 1218 Carnivorous plants, 793-794, 794f Carotene, 153-154, 348, 348f Carotenoid, 152f, 153-154, 153f, 853 Carotid body, 1011, 1011f Carpel, 606, 608, 608f, 848f, 849 Carrier protein, 90t, 96, 97, 97f, 104t Carrying capacity, 1174 Cartilage, 869t, 870, 963 Cartilaginous fish, 698f, 700-701, 700f, 1043, 1065 Casparian strip, 741, 741f Cassava (Mannihot esculenta), 805, 806t Castor bean (Ricinus communis), 807, 807f Cat coat color in, 233t, 235, 235f, 243, 243f ovary in, 1096f Catabolism, 117 of proteins and fats, 140-142, 141f, 142f Catabolite activator protein (CAP), 310-311, 310f Catalyst, 25, 37, 111-112, 111f Catecholamine, 899 Caterpillar, 809 Cation, 19, 96 Cattle, 475f, 525f Caudal protein, 386, 386f Caudata. See Urodela (order) Caudipteryx, 714, 714f Cavitation, 777, 777f Cayuga Lake, 1218, 1218f CD4 cells, 535 cdc2 gene, 199 Cdc2 kinase, 200-201, 201f Cdk. See Cyclin-dependent protein kinase Cdk1, 200 cDNA library, 332, 332f Cech, Thomas J., 116 Cecum, 990, 990f Cedar Creek experimental fields, 1223-1224, 1223f Cell(s) earliest, 546, 546f in hierarchical organization of living things, 2f, 3 as information-processing systems, 14 origin of, 512, 546, 546f shape of, 390 size of, 60, 61f in prokaryotes, 548 structure of, 62-63, 62f visualizing structure of, 60-62 Cell adhesion, 83-85
Cell adhesion protein, 93, 94f Cell body, of neuron, 872, 873t, 889, 889f Cell communication, 168-183 Cell cycle, 192-198 duration of, 192-193, 201-202 genetic analysis of, 199 growth factors and, 202 Cell cycle control, 198-204 in cancer cells, 202-204, 203f, 204f checkpoints, 200, 200f history of investigation into, 198-200 in multicellular eukaryotes, 201-202, 202f Cell death, 390-391, 391f Cell determination, 375, 1117 Cell division, 186-204. See also Cell cycle in animal cells, 188f during development, 372, 373-375, 373f-374f, 390 in prokaryotes, 187-188, 188f, 548 in protists, 188f in yeast, 188f Cell identity, 82, 82t Cell junction, 83-85, 83f, 84f, 85f Cell-mediated immunity, 1063, 1066-1068, 1066t, 1067f, 1069f Cell membrane, 81t Cell migration, in development, 391-392, 392f Cell plate, 195f, 197-198, 198f Cell signaling between cells autocrine signaling, 169-170 by direct contact, 169, 169f, 170 endocrine signaling, 169, 169f, 170 paracrine signaling, 169, 169f, 170 synaptic signaling, 169, 169f, 170 receptor proteins, 171-178 Cell surface of prokaryotes, 553-554 of protists, 571 Cell surface marker, 63, 82, 82t, 90t, 91, 93, 94f Cell surface receptor, 93, 94f, 171-173, 172f, 172t Cell theory, 12, 12f, 59-63 Cell wall, 63, 63f of archaebacteria, 64, 548 of bacteria, 64, 548, 552 of eukaryotes, 67f, 78t, 81t of fungi, 616 of plant cells, 40, 67f, 80, 80f, 81t, 393, 393f, 731, 731f primary, 80, 80f of prokaryotes, 63, 63f, 64, 81t, 548-549, 552-554, 552f-553f secondary, 80, 80f Cellular blastoderm, 384, 384f, 1110 Cellular immune response, 345 Cellular organization, as characteristic of life, 2-3f, 3, 508, 508f Cellular respiration, 123
index
rav32223_Index_I1-I33.indd I-5
I-5
11/25/09 11:54:45 AM
Cellular slime mold, 585, 585f Cellulose, 37t, 39, 40-41, 40f breakdown of, 41, 617, 620, 625 Celsius, 108 Centers for Disease Control (CDC), 368 Centipede, 641t, 679t, 686-687, 687f Central chemoreceptor, 927 Central Dogma, 280, 280f Central nervous system, 872, 901-909, 901f-908f Central vacuole, 65 Centriole, 66f, 76-77, 77f, 81t Centromere, 189f, 191, 193, 193f, 211 Centrosome, 76-77 Cephalization, 637 Cephalopod, 667-668, 668f Cephalopoda (class), 668f, 671-672, 671f-672f Cercariae, 658, 659f Cercomeromorpha (class), 659-660, 660f Cerebellum, 902, 902t Cerebral cortex, 902t, 904, 904f, 905f, 932-933 Cerebral hemisphere, 903, 904f Cerebrum, 902t, 903 Cervical cap (birth control), 1099t, 1100 cGMP. See Cyclic GMP (cGMP) CGRP. See Calcitonin gene-related peptide Chaetae, 673f, 674 Chaetognatha (phylum), 642t, 643, 645f Chagas disease, 487, 488, 488f, 574 Chain terminator, 336 Chambered nautilus (Nautilus pompilius), 667, 667f, 671-672 Chancre, 562 Channel-linked receptor, 171-172, 172f, 172t Channel protein, 96, 97f, 104t Chaperone protein, 51, 51f Chara, 592, 592f Character displacement, 447, 447f, 1190 Character state, 458 Charales, 521, 521f, 592, 592f Chargaff, Ertwin, 260 Chargaff’s rules, 260 Charging reaction, tRNA, 292, 292f Charophyte, 589, 592, 592f Checkpoint, cell cycle, 198, 200, 200f Chelicerae, 681 Chelicerata (class), 679t, 681-682, 682f Chelonia (order), 707t, 710, 710f Chemical bond, 23, 25. See also specific types of bonds Chemical defenses of animals, 1194, 1194f of plants, 1193 Chemical digestion, 982 Chemical messenger, 938-939, 938f Chemical reaction, 25 activation energy, 111-112, 111f energy changes in, 110-111, 111f
I-6
Chemical synapse, 170, 896 Chemiosmosis, 134-136, 134f, 135f, 136f, 137f, 156, 158-159 Chemoautotroph, 1214 Chemoheterotroph, 559 Chemolithoautotroph, 559 Chemolithotroph, 548 Chemoreceptor, 916, 925-927, 926f-927f central, 927 internal, 927 peripheral, 927 Chewing, 967, 982, 984 “Chewing the cud,” 991 Chiasmata, 210, 211f, 215 terminal, 211 Chicken, 189t clutch size in, 414 development in, 1110f genome of, 482 Chicken pox, 529, 532t, 1061 Chief cells, 986, 986f Chihuahua, 423f Childbirth, 947, 1128, 1128f. See also Uterine contractions positive feedback during, 878f Chilling, of plant, 825 Chimpanzee (Pan), 457, 457f chromosome number in, 189t cognitive behavior in, 1141, 1141f genome of, 362-363, 475f, 476, 482, 482f, 484 Chiral molecule, 35, 35f Chitin, 37t, 41, 41f, 616, 962 Chiton, 668f, 670, 670f Chitridiomycetes, 619 Chlamydia, 561t heart disease and, 563 sexually-transmitted disease, 562-563, 562f Chlamydia trachomatis, 561t, 562 Chlamydomonas, 244, 591, 591f, 595 Chloramphenicol, 554 Chlorella, 154 Chlorofluorocarbons, 1248-1250 Chlorophyll, 148, 149f absorption spectra of, 152, 152f action spectrum of, 153, 153f structure of, 152-153, 152f Chlorophyll a, 152, 152f Chlorophyll b, 152, 152f Chlorophyta (phylum), 521, 521f, 582 Chlorophyte, 591-594, 591f-592f Chloroplast, 67f, 74-75, 74f, 78t, 81t, 518t diversity of, 569 DNA of, 74, 74f of euglenoids, 573-574, 574f genetic code in, 284 genome of, 364 maternal inheritance, 244 origin of, 517, 517f, 569-570, 569f photosynthesis, 147-165 Choanocyte, 641t, 650f, 651 Choanoflagellate, 520, 571f, 583, 583f, 644f Cholecystokinin (CCK), 993, 993f, 994t, 996, 997, 997f
Cholera, 180, 534, 560, 561t Cholesterol, 54 in cardiovascular disease, 1033 structure of, 54f uptake by cells, 103 Chondrichthyes (class), 699t, 700-701, 700f Chondroitin, 870 Chordata (phylum), 513f, 641t, 645f, 693, 694-695, 695f Chordate characteristics of, 694, 694f eyes of, 928f, 929 nonvertebrate, 695-696, 695f-696f segmentation in, 523, 523f, 639-640 vertebrate, 696-697, 697f-698f Chorion, 706, 708f, 1089 Chorionic villi sampling, 253, 253f Chromatid, 191, 191f, 193, 193f. See also Sister chromatid(s) Chromatin, 68, 68f, 190, 190f, 316-317, 316f-317f Chromatin-remodeling complex, 317 Chromosomal mutation, 300-301, 301f Chromosomal theory of inheritance, 240-241, 240f exceptions to, 244 Chromosome, 65, 78t, 81t, 193 artificial, 330-331, 356 bacterial artificial chromosome (BAC), 330-331, 356 banding patterns, 353, 354f discovery of, 189 duplication of, 480f-481f, 481 of eukaryotes, 65, 189-191, 189f-191f, 189t, 548 fusion of, 482 homologous, 191, 191f, 209-210, 209f of prokaryotes, 548 structure of, 189-191, 190f-191f yeast artificial chromosome (YAC), 331, 356 Chromosome number, 189, 189t, 207-208 Chronic obstructive pulmonary disease (COPD), 1012 Chrysalis, 686 Chrysophyta (phylum), 580 Chylomicron, 990 Chyme, 987 Chymotrypsin, 988 Chytrid, 615, 615f, 619, 619f Chytridiomycetes, 619 Chytridiomycosis, 630, 630f Chytridiomycota (phylum), 615, 615f, 615t, 619-620, 619f Cichlid fish Lake Barombi Mbo, 446 Lake Malawi, 495-496, 496f Lake Victoria, 449-450, 449f, 1271 pike cichlid, 412-413, 412f Cigarette smoking. See Smoking Cilia, 66f, 79-80, 79f, 80f. See also Ciliate Ciliate, 284, 576, 579-580, 578f
Circadian rhythm, in plants, 818, 822, 823f Circulatory system, 638, 874, 874f, 1018-1035 of amphibians, 703, 1024, 1024f of annelids, 673f, 674 of arthropods, 680, 680f of birds, 715, 1025, 1025f closed, 638, 1022f, 1023 of fish, 699, 1023, 1023f of invertebrates, 1022-1023, 1022f of mammals, 1025, 1025f of mollusk, 669 open, 638, 1022f, 1023 of reptiles, 709, 709f, 1024 of vertebrates, 1023-1025, 1023f-1025f Cisternae, of Golgi body, 71, 71f Cisternal space, 69 Citrate, 131, 132, 133f Citrate synthetase, 138, 138f Citric acid cycle. See Krebs cycle Clade, 459 Cladistics, 458-461, 459f-460f Cladogram, 459, 459f Cladophyll, 746f, 747 Clam, 666, 667, 668, 671, 671f Clark’s nutcracker (Nucifraga columbiana), 1138, 1138f Class (taxonomic), 512, 513f, 514 Classical conditioning, 1137 Classification, 461, 512-514 of animals, 522-525, 640 grouping organisms, 514-520 of organisms, 512-514 of prokaryotes, 549-550, 549f-551f of protists, 520, 520f, 570f-571f, 571 systematics and, 461-464, 462f-464f of viruses, 519-520 Clean Air Acts, 421 Cleavage, 373, 373f, 635t, 1106t, 1110-1112, 1110f-1112f holoblastic, 1110-1111, 1111f, 1111t in insects, 1110 in mammals, 1112, 1112f meroblastic, 1111-1112, 1111t, 1112f radial, 638, 639f spiral, 638, 639f, 643 Cleavage furrow, 195f, 197, 197f Climate. See also Global climate change, Global warming biomes and, 1236, 1236f effects on ecosystems, 1230-1235, 1230f-1234f El Niño and, 1243-1244, 1244f, 1252 elevation and, 1234, 1234f human impact on climate change, 1250-1253 microclimate, 1235 selection to match climatic conditions, 404
index
rav32223_Index_I1-I33.indd I-6
11/25/09 11:54:45 AM
solar energy and, 1230-1235, 1231f-1232f species richness and, 1224f, 1225 See also Global warming Clinical trials, gene therapy, 345, 345t Clitellata (class), 675-676, 675f-676f Clitellum, 673f, 675 Clitoris, 1094, 1094f Clonal selection, 1063 Clone, 330 Clone-by-clone sequencing, 357, 357f Cloning DNA libraries, 331-332, 331f host/vector systems, 330-331, 331f identifying specific DNA in complex mixtures, 332-333 isolating specific clones from library, 333, 333f of plants, 858f, 859 reproductive, 381 of sheep, 381, 381f therapeutic, 383, 383f Cloning vector, 330 expression vectors, 342 plasmids, 330, 331f Clonorchis sinensis, 658, 659f Closed circulatory system, 638, 1022f, 1023 Clostridium botulinum, 550f, 561t Clover, 842f Club moss, 598, 601t Clutch size, in birds, 414, 1172, 1172f Cnidaria (phylum), 635t, 636, 636f, 637, 641t, 644f, 652-655, 652f-653f body plan of, 653, 653f body structure of, 652, 652f circulatory system of, 1022, 1022f classes of, 654-655 digestive cavity of, 982, 982f life cycle of, 653, 653f nervous system of, 901-902, 901f Coactivator, 174, 314-315, 315f Coal, 1246 Coastal ecosystem, destruction of, 1248 Cocaine, 900, 900f Coccidioides posadasii, 625 Coccus, 552 Cochlea, 921f, 922-923, 923f Cocklebur, 842f Coding strand, 280, 285f, 286f Codominance, 233t, 234, 234f Codon, 282, 283t, 298f spaced or unspaced, 282-283 start, 283 stop (nonsense), 283, 296f, 297 Coelom, 637f, 638 formation of, 639, 639f Coelomate, 637f Coenzyme, 117 Coevolution, 1193 mutualism and, 1198 of plants and animals, 807, 1193-1194, 1193f, 1196 predation and, 1193 Cofactor, 117
Cognition, animal, 1141, 1141f-1142f Cognitive behavior, 1141 Cohesin, 191, 191f, 193, 193f, 201 Cohesion, 26, 27f, 27t Coleochaetales, 521, 521f, 592, 592f Coleoptera (order), 684f, 685t Coleoptile, 765, 765f Coleorhiza, 765, 765f Collagen, 45t, 81, 81f, 392, 868, 868f, 870 Collar cell. See Choanocyte Collared flycatcher, 442, 442f Collecting duct, 1047, 1047f Collenchyma cells, 736, 736f Colloblast, 656 Colon, 990. See also Large intestine Colon cancer, 990 Colonial flagellate hypothesis, for origin of metazoans, 645 Colonization, human influence on, 1270-1271 Color blindness, 227t, 242, 933 Color vision, 930, 930f Coloration, warning, 1194, 1195f Colorectal cancer. See Colon cancer Columella root cap, 739, 739f Columnar epithelium, 866, 867t pseudostratified, 867t simple, 866, 867t Comb jelly, 641t, 656, 656f Combination joint, 967, 968f Combined DNA Index System (CODIS), 355 Commensalism, 564, 626, 1197, 1197f Communicating junction, 83f, 84-85 Communication, animal, 1144-1147, 1144f-1147f Community, 3f, 4, 1186-1187, 1186f-1187f across space and time, 1187, 1187f concepts of, 1186 fossil records of, 1187 Community ecology, 1185-1204 Compact bone, 965f, 966 Compaction, 1112 Companion cells, 738, 738f Comparative anatomy, 11, 11f Comparative biology, 464-470, 465f-469f Comparative genomics, 362-363, 474-477, 475f, 500 medical applications of, 487-488, 488f Comparator, 876 Compartmentalization in eukaryotes, 517, 518-519, 548 in prokaryotes, 548 Competition among barnacle species, 1188, 1188f direct and indirect effects of, 1200-1201, 1201f effect of parasitism on, 1200 experimental studies of, 1191-1192, 1191f exploitative, 1188 interference, 1188
interspecific, 1188, 1191, 1191f reduction by predation, 1199-1200, 1200f resource, 1190-1191, 1190f sperm, 1151 Competitive exclusion, 1189-1190, 1189f Competitive inhibitor, 117, 117f Complement system, 1059-1060 Complementary base-pairing, 43, 43f, 262, 262f, 265, 265f base-pairs, 262, 262f Complete flower, 848, 848f Complexity, as characteristic of life, 3 Compound, 23 Compound eye, 414, 414f, 680, 680f, 681f Compound leaf, 748, 748f Compsognathus, 714 Concentration gradient, 96, 100 Concurrent flow, 1005, 1005f Condensation, 37 Condensin, 191, 193, 201 Conditioning classical (pavlovian), 1137 operant, 1138 Condom, 1099f, 1099t, 1100 Conduction (heat transfer), 880 Cone (eye), 930, 930f, 931f Confocal microscope, 62t Confuciornis, 714f Congression, 196 Conidia, 624, 624f Conifer, 602t, 603, 603f, 607f Coniferophyta (phylum), 602t Conjugation, 554 in bacteria, 554-556, 555f gene transfer by, 555-556, 556f in ciliates, 579, 579f Conjugation bridge, 555, 555f Connective tissue, 864, 868, 868f, 869t, 870 dense, 868, 869t dense irregular, 868 dense regular, 868 loose, 868, 869t special, 868, 870 Connell, Joseph, 1188 Consensus sequence, 357 Conservation biology, 1256-1278 Conservation of synteny, 482, 483f Conservative replication, 263-265, 263f CONSTANS gene, of Arabidopsis, 843 Constitutive heterochromatin, 359 Consumer, 1215, 1215f Consumption, of resources, 1181 Contig, 353, 357 Continental drift, 432 Continental shelf, 1241f, 1242-1243 Continuous variation, 232, 233f Contraception, 1098-1101, 1099f, 1099t, 1101f Contractile root, 742, 743f Contractile vacuole, 73, 99, 103 Control experiment, 6 Controlling elements, 480 Conus arteriosus, 1023, 1023f
Convection (heat transfer), 880 Convergent evolution, 430, 430-432, 431f, 458, 464-465, 498-499, 498f, 502 Cooksonia, 596, 596f COPD, 1012 Coprophagy, 992 Copy numbers, 486 Coral, 636, 641t, 654 Coral reef, 654-655, 1243, 1243f, 1252 Coriolis effect, 1232-1233, 1232f Cork, 745f Cork cambium, 732, 733f, 744, 745, 745f Cork cells, 745 Corm, 746 Corn (Zea mays), 164, 369f, 743f, 765f, 836f artificial selection in, 422, 423f chromosome number in, 189t endosperm of, 760, 760f epistasis in, 236, 236f genome of, 363f, 475f, 476, 479f, 489 grain color in, 233t, 235-236, 236f, 245-246, 245f oil content of kernels, 422 recombination in, 245, 245f transgenic, 347 Cornea, 929, 929f Corolla, 848, 848f Coronary artery, 1029 Corpus callosum, 902t, 903-904, 904f Corpus luteum, 1097, 1097f Correns, Carl, 240, 244 Cortex (plant), 741, 741f, 744 Cortical granule, 1108 Corticosteroid, 954 Corticotropin, 947 Corticotropin-releasing hormone (CRH), 949 Cortisol, 943f, 954 Corynebacterium diphtheriae, 534 Cost of reproduction, 1171 Costa Rica, biosphere reserves in, 1277, 1277f Cotransduction frequency, 556-557 Cotton genome of, 479f transgenic, 347 Cotyledon, 759 Countercurrent flow, 1005, 1005f Countercurrent heat exchange, 881, 881f Countertransport, 102 Coupled transport, 101-102, 101f, 104t Courtship behavior/signaling, 439, 439f, 443, 443f, 1144f, 1145, 1152, 1152f of Anolis lizards, 443, 443f of blue-footed boobies, 439, 439f of lacewings, 439, 439f Covalent bond, 23t, 24-25, 24f Cowper’s gland, 1091f, 1092 Cowpox, 1061 COX. See Cyclooxygenase COX-2 inhibitor, 943
index
rav32223_Index_I1-I33.indd I-7
I-7
11/25/09 11:54:45 AM
Crab, 641t, 682, 683, 683f Cranial neural crest cells, 1120 Crassulacean acid metabolism, 164 Crassulacean acid pathway, 165 Craton, 546 Crawling, cellular, 79 Crayfish, 683 Creighton, Harriet, 245-246, 245f Cretinism, 952 CRH. See Corticotropin-releasing hormone Cri-du-chat syndrome, 300 Crick, Francis, 259-263, 261f, 280, 282, 283, 299 Crinoidea (class), 689f Cro-Magnons, 725, 725f Crocodile, 699f, 707t, 711, 711f, 1025 parental care in, 464, 465f Crocodylia (order), 699f, 707t, 710f, 711, 711f Crop plant artificial selection in, 422, 423f breeding of, 489 transgenic, 346-349 Cross-fertilization, 223, 223f Cross-pollination, 223, 223f, 851 Crossing over, 209f, 210, 210f, 211, 212f, 215, 216f, 244-246, 245f multiple crossovers, 247, 247f Crown gall, 832, 833f CRP. See Cyclic AMP (cAMP) response protein Crustacean, 679t, 682-684, 682f-683f body plan in, 682, 683f decapod, 683, 683f habitats of, 682 reproduction in, 682-683 sessile, 683-684, 683f Ctenidia, 668 Ctenophora (phylum), 642t, 643, 644f, 656, 656f Cuboidal epithelium, 866, 867t simple, 866, 867t Cubozoa (class), 655, 655f Cuenot, Lucien, 233 Culex, 686f Cultivation, 788-789, 788f Cutaneous respiration, 1006 Cuticle, of plant, 734 Cutin, 734 Cuttlefish, 667, 668, 672 Cyanobacteria, 64, 64f, 143, 148, 152, 517f, 547, 548, 554f, 559, 563. See also Lichen Cyanogenic glycosides, 805, 806t, 807 Cycad, 602t, 603, 605, 605f, 607f Cycadophyta (phylum), 602t, 605, 605f Cyclic AMP (cAMP), as second messenger, 173, 179-181, 180f Cyclic AMP (cAMP) response protein (CRP), 310-311, 310f Cyclic GMP (cGMP), 174, 932 signal transduction in photoreceptors, 932, 932f Cyclic photophosphorylation, 156, 156f, 160
I-8
Cyclin, 199-200, 199f, 373, 374f degradation of, 323 discovery of, 199 Cyclin-dependent protein kinase (Cdk), 199-200, 199f, 200f, 201-202, 202f, 373, 374f, 375 Cycliophora (phylum), 642t, 644f, 660, 661f CYCLOIDIA gene, of snapdragons, 499, 849-850, 849f Cyclooxygenase-1 (COX-1), 943 Cyclooxygenase-2 (COX-2), 943 Cyclosome, 201 Cysteine, 35f Cystic fibrosis, 51-52, 227t, 233, 249t, 335, 484 gene therapy for, 345, 345t Cytochrome, 45t Cytochrome b6-f complex, 157-158, 158f, 159f Cytochrome bc1, 134, 134f Cytochrome c, 134, 134f Cytokine, 942, 1067-1068, 1069f Cytokinesis, 192, 192f, 194f, 195f, 197, 212f-213f, 214 in animal cells, 197, 197f in fungi, 198 in plant cells, 197-198, 198f Cytokinin, 826t, 831-832, 831f-832f synthetic, 831f Cytological maps, 353 Cytoplasm, 62, 892t Cytoplasmic receptor, 1057 Cytosine, 42, 42f, 259f, 260, 262 Cytoskeleton, 65, 67f, 75-79, 76f, 78t attachments to, 93, 94f Cytosol, 62 Cytotoxic T cell, 1062t, 1066-1067, 1066t, 1067f
D 2,4-D, 829f, 830 Dachshund, 423f Dalton (unit of mass), 19 Dance language, of honeybees, 1146, 1146f Darevsky, Ilya, 1085 Dark-field microscope, 62t Dark reaction, 150 Darwin, Charles, 399, 403, 412, 1156. See also Galápagos finch critics of, 432-433 invention of theory of natural selection, 9-11 Malthus and, 10 On the Origin of Species, 8, 10, 397 photograph of, 8f plant studies, 825, 827 theory of evolution, 8-10, 397 voyage on Beagle, 1, 1f, 8, 9f, 10, 418 Darwin, Francis, 827 Dating, of fossils, 424, 424f Day-neutral plant, 842f, 843 DDT, 577-578, 1245, 1245f Deamination, 141 of amino acids, 141, 141f
Decapentaplegic protein, in Drosophila, 1117, 1117f Decapod crustacean, 683, 683f Deciduous forest, temperate, 1238, 1238f Deciduous plant, 860 Decomposer, 563, 1215 Decomposition, 563 Deductive reasoning, 4-5, 5f Deep sea, 1244-1245, 1244f Deer, 525f Defensin, 805, 1057, 1057f Deforestation, 1210, 1210f, 1246-1247 Degeneracy, 284 Dehydration reaction, 37, 37f Dehydrogenation, 123 Deinococcus, 550f Delamination, 1113 Delayed hypersensitivity, 1076 Deletion, 282-283, 300, 301f Delta wave, 905 Demography, 1168 Denaturation, of proteins, 52-53, 52f Dendrite, 872, 873t, 889, 889f Dendritic cell, 1062-1063, 1062t Dendritic spines, 889 Dengue fever, 1253 Denitrification, 1211 Denitrifier, 563 Dense connective tissue, 868, 869t Dense irregular connective tissue, 868 Dense regular connective tissue, 868 Density-dependent effect, 1175-1176, 1175f-1176f Density-independent effects, 1176, 1176f Dental caries, 561-562, 561t Deoxyhemoglobin, 1013 Deoxyribonucleic acid. See DNA Dephosphorylation, of proteins, 170 Depolarization, 892-893, 893f Derepression, 312 Derived characters, 458-459, 459f shared, 458, 463-464 Dermal tissue, of plants, 731, 733-736, 734f-735f, 756, 758, 803 Desert, 1237 Desmosome, 83f, 84 Determinate development, 638, 639f Determination, 375-377, 375f-376f molecular basis of, 376 reversal of, 380-381 standard test for, 375-376, 375f Detritivore, 1215, 1215f Deuterostome, 523, 523f, 638, 639f, 643, 644f, 645, 1114 Development in animals, 372-373, 373f, 635t, 638, 639f apoptosis in, 390-391, 391f of behavior, 1139-1141 in Caenorhabditis elegans, 373, 374f, 390-391, 391f cell differentiation in, 375-379, 375f-379f cell division in, 372, 373-375, 373f-374f
cell migration in, 391-392, 392f cellular mechanisms of, 373-393 as characteristic of life, 3, 508 defined, 372 determination, 375-377, 375f-376f in Drosophila, 494 evidence for, 428-429, 428f evolution of, 492-504, 497f of eye, 501-504, 501f-503f in frogs, 373f gene expression in, 304 induction, 377-378, 377f of limbs, 497-498, 497f morphogenesis, 373, 390-393, 391f-393f nuclear reprogramming, 380-383, 380f-383f overview of, 372-373 pattern formation, 373, 383-389, 384f-388f in plants, 374-375 morphogenesis, 392-393, 393f in sea urchins, 493, 493f in tunicates, 376f, 377 of wings, 497, 497f Dewlap, of Anolis lizard, 443, 443f Diabetes insipidus, 98, 1050 Diabetes mellitus, 955 treatment of, 955 type I (insulin-dependent), 955 type II (non-insulin-dependent), 955 Diacylglycerol, 180f, 181 Diagnostics, 1078-1079, 1078f Diaphragm (birth control), 1099f, 1099t, 1100 Diaphragm (muscle), 1009, 1010f Diapsid, 708f, 709, 709f Diastole, 1026, 1027f Diastolic pressure, 1029, 1029f Diatom, 571, 580-581, 581f Diazepam, 899 Dicer, 319, 319f, 320 Dichlorophenoxyacetic acid (2,4-D), 829f, 830 Dichogamous plant, 855 Dictyostelium discoideum, 180, 358f, 585, 585f Dideoxynucleotide, 336-337, 337f Didinium, 1192, 1192f Diencephalon, 902t, 903 Diethystilbestrol (DES), 957 Differential-interference-contrast microscope, 62t Differentiation, 14, 372-373, 375-379, 375f-379f Diffuse pollution, 1246 Diffusion, 96-97, 96f, 104t facilitated, 96-97, 97f, 104t Frick’s Law of, 1002 Digestion, 123 chemical, 982 in insects, 686 of plant material, 717 in small intestine, 987, 988, 988f-989f in stomach, 986-987
index
rav32223_Index_I1-I33.indd I-8
11/25/09 11:54:45 AM
Digestive system, 874, 874f, 981-998 of birds, 984, 984f of carnivores, 991f of herbivores, 991f, 992 of insectivores, 991f of invertebrates, 982, 982f of nematodes, 982, 982f of ruminants, 991, 992f types of, 982-983, 982f-983f of vertebrates, 982-983, 983f variations in, 990-992, 991f-992f Digestive tract, 982f, 983 layers of, 983, 983f neural and hormonal regulation of, 993, 993f, 994t Dihybrid cross, 228-229, 229f, 233t Dihydroxyacetone phosphate, 128f Dikaryon, 617, 623 Dikaryotic hyphae, 616 Dinoflagellate, 576-577, 576f-577f Dinosaur, 424f, 453, 462f, 697, 707t, 708-709, 708f-709f feathered, 714 parental care in, 464, 465f Dioecious plant, 606, 855 Dioxin, 831 Diphtheria, 534, 560, 561t Diploblastic animal, 637, 643 Diploid (2n), 191, 208, 208f, 225, 1109 partial, 556 Diplomonads, 570f, 572-573, 573f Diplontic life cycle, 590, 590f Diptera (order), 684f, 685t Direct contact, cell signaling by, 169, 169f, 170 Directional selection, 410-411, 410f-411f Disaccharide, 38-39, 39f Disassortative mating, 402 Disease causes of, 487 evolution of pathogens, 470-471, 470f-471f pathogen-host genome differences, 487-488 Dispersive replication, 263f, 264, 265 Disruptive selection, 409-410, 410f, 445-446 Dissociation, of proteins, 53 Distal convoluted tubule, 1047, 1047f, 1049-1050 Distal-less gene, 498, 498f, 524, 524f Disturbances, biological, 1203, 1204, 1204f DNA, 12-13, 41-42, 256-275. See also Gene analysis of, 334-341 antiparallel strands, 262f, 263 central dogma, 280, 280f chromatin in, 68 in chromosomes. See Chromosome cloning of. See Cloning coding strand, 280, 285f, 286f complementary. See cDNA library double helix, 41-42, 41f, 43, 43f, 261-262, 261f, 262f
functions of, 37t gel electrophoresis of, 328-329, 329f genetic engineering. See Genetic engineering junk. See DNA, noncoding major groove of, 262f manipulation of, 327-349 methylation of, 252 minor groove of, 262f of mitochondria, 74 noncoding, 359-360, 485-486 of prokaryotes, 62 proof that it is genetic material, 256-259, 257f-258f protein-coding, 359 recombinant. See Recombinant DNA replication of. See Replication RNA versus, 43, 43f segmental duplications, 481 sequencing of, 50, 336-337, 336f-338f, 339. See also Genome sequencing with sticky ends, 328, 328f structural, 359, 360t structure of, 37t, 42-43, 43f, 259-263, 259f-262f supercoiling of, 267, 267f template strand, 265, 265f three-dimensional structure of, 259-261, 259f-260f topological state of, 267 in transformation. See Transformation Watson-Crick DNA molecule, 262f, 263 X-ray diffraction pattern of, 260-261, 260f DNA-binding motifs, in regulatory proteins, 306-307, 307f DNA-binding proteins, 48 DNA fingerprint, 335-336, 336f DNA gyrase, 267, 267f, 268t, 269, 269f DNA helicase, 267, 268t, 269f DNA library, 331-332, 331f DNA ligase, 268t, 269, 269f-270f, 328, 328f, 331f DNA microarray, 364 analysis of cancer, 364 preparation of, 364, 365f DNA polymerase, 265-266, 265f proofreading function of, 273 DNA polymerase delta, 271 DNA polymerase epsilon, 271 DNA polymerase I, 266-267, 268t, 269f-270f DNA polymerase II, 266-267 DNA polymerase III, 265f, 266-270, 268t, 268f-270f beta subunit of, 268, 268f processivity of, 268 sliding clamp, 268, 268f-269f DNA primase, 268-269, 268t, 269f, 272 DNA rearrangement, 483, 1072-1074, 1073f
DNA repair, 273-275, 274f DNA sequence data, cladistics and, 460, 460f DNA vaccine, 344-345 DNA virus, 529, 529f, 531, 532t Docking (protein on ER), 296f, 297 Dodder (Cuscuta), 742, 794 Dog Brachyury gene mutation in, 496 breeds of, 422-423, 423f chromosome number in, 189t “Dolly” (cloned sheep), 381, 381f Dolphin, evolution of, 425 Domain (protein), 50-51, 51f Domain (taxonomic), 513, 513f Domestication, 422-423, 423f Dominant hemisphere, 905-906, 906f Dominant trait, 224-228, 224f-225f codominance, 233t, 234, 234f in humans, 227t incomplete dominance, 233t, 234, 234f Dopamine, 899, 900, 1134 Dormancy in plants, 823-824, 823f-824f in seed, 824, 824f, 836, 836f Dorsal body cavity, 864, 865f Dorsal nerve cord, 1118 Dorsal protein, 386-387, 387f Dorsal root, 909 Dorsal root ganglia, 909, 910f Dosage compensation, 243 Double circulation, 1024 Double covalent bond, 24, 24f Double fertilization, 608, 609f, 610, 856-857, 856f-857f Double helix, 41-42, 41f, 43, 43f, 261-261, 261f, 262f Douche, 1100 Down, J. Langdon, 250 Down syndrome, 250, 250f maternal age and, 250-251, 250f, 252 translocation, 250 Drought tolerance, in plants, 780, 780f Drugs for AIDS treatment, 537-538, 537f drug addiction, 900-901, 900f drug development, 487-488, 488f manufacture of illegal, 605 nonsteroidal anti-inflammatory drug, 943 pharmaceutical plants, 1261-1262, 1261f Duchenne muscular dystrophy, 227t, 249t Duck-billed platypus, 475f, 487, 719f, 1090 Dugesia, 657f, 658 Duodenum, 987, 988f Duplication (mutation), 300, 301f, 480, 480f-481f, 481 Dwarfism, 950 Dynactin complex, 77 Dynein, 77, 77f, 79
E Ear sensing gravity and acceleration, 924-925, 924f structure of, 920-922, 920f-922f Ear popping, 922 Earth age of, 11 atmosphere of early Earth, 509 circumference of, 4-5, 5f formation of, 17 orbit around sun, 1231, 1231f origin of life on, 509-510, 511f rotation of, 1231-1233, 1231f-1232f Earthworm, 641t, 675, 675f, 901f, 902 circulatory system of, 1022f digestive system of, 982, 982f locomotion in, 962, 962f nephridia of, 1040, 1041f Ebola virus, 529, 532t, 540, 540f Ecdysis, 680 Ecdysone, 957, 957f Ecdysozoan, 523-524, 523f, 643, 644-645, 644f-645f ECG. See Electrocardiogram Echinoderm, 523f, 641t, 645, 687-690, 688f-689f body plan of, 688-689, 688f classes of, 689-690 development in, 687-688 diversity in, 689f endoskeleton of, 688-689 nervous system of, 901f regeneration in, 689 reproduction in, 689 respiration in, 1003f water-vascular system of, 688, 689 Echinodermata (phylum), 641t, 645f, 687-690, 688f-689f Echinoidea (class), 689f, 690 Echolocation, 924 Ecological footprint, 1181-1182, 1181f Ecological isolation, 438, 438f, 438t Ecological pyramid, 1218-1219, 1219f inverted, 1218, 1219f Ecological species concept, 441 Ecology behavioral, 1147-1149 community, 1185-1204 of fungi, 625-629, 626f-629f population, 1162-1182 Economic value, of biodiversity, 1261-1263, 1261f-1263f Ecosystem, 3f, 4, 1208. See also specific types biogeochemical cycles in, 1208-1214, 1208f-1213f climate effects on, 1230-1235, 1230f-1234f disruption of ecosystems, 1271, 1272f dynamics of, 1207-1227 effect of global warming on, 1251-1252, 1251f effect of human activity on, 1245-1250
index
rav32223_Index_I1-I33.indd I-9
I-9
11/25/09 11:54:45 AM
energy flow through, 1214-1219 stability of, 1223-1226, 1223f trophic levels in, 1217-1223, 1218f-1222f Ecotone, 1187, 1187f Ectoderm, 637, 637f, 864, 1113, 1113f Ectomycorrhizae, 628, 628f Ectoprocta, 641t, 644f Ectotherm, 710, 880-881 Edema, 994, 1032 Edge effect, 1267 EEG. See Electroencephalogram Eel, 975, 975f Effector, 876 antagonistic, 877-878, 877f Effector protein, 179-182, 179f Efferent arteriole, 1047 EGF. See Epidermal growth factor Egg amniotic, 706, 708f fertilization, 1106-1109, 1106t, 1107f-1109f of frogs, 1109, 1109f of reptiles, 706, 708f Egg coloration, adaptive value of, 1147-1148, 1147f Ejaculation, 1093 EKG. See Electrocardiogram El Niño Southern Oscillation, 1243-1244, 1244f, 1252 Elasmobranch, 934, 1043 Elastin, 81, 81f, 392 Eldredge, Niles, 451 Electrical synapse, 896 Electricity, detection of, 934 Electrocardiogram (ECG, EKG), 1028, 1028f Electroencephalogram (EEG), 905 Electromagnetic receptor, 916 Electromagnetic spectrum, 151, 151f Electron, 18, 19, 19f in chemical behavior of atoms, 20, 20f energy level of, 21, 21f valence, 22 Electron acceptor, 124, 124f, 139-140, 139f Electron carriers, 124, 125f, 134-135 Electron microscope, 61, 61f, 62t microscopy of plasma membrane, 91-92, 91f scanning, 61, 62t, 91 transmission, 61, 62t, 91 Electron orbital, 19, 20f Electron transport chain, 124f, 125, 132, 133f ATP production in, 134-136, 134f, 135f, 136f photosynthetic, 156 production of ATP by chemiosmosis, 135-136, 135f Electronegativity, 24, 25t, 34 Electrophoresis, 398 Element, 18 inert, 22 in living systems, 22-23 periodic table, 22-23, 22f
I-10
Elephant, 525, 525f Elephant seal, 403, 403f, 1002f Elevation, climate and, 1234, 1234f Elongation factor, 295, 295f EF-Tu, 295, 295f Embryo implantation, prevention of, 1100 Embryo (plant), 754, 754f Embryo sac, 850, 850f, 851, 851f Embryo transfer, 1102 Embryogenesis, 754f Embryonic development human, 429f in plants, 754-760, 754f-760f Embryonic flower mutant, in Arabidopsis, 841, 841f Embryonic stem cells, 342-343, 342f-343f, 379, 379f Emergent properties, 4, 14 Emerging viruses, 540 Emerson, R. A., 236 Emphysema, 1012 Enantiomer, 35, 35f Encephalitozoon cuniculi, 358f, 618, 618f Endangered species conservation biology, 1256-1278 preservation of, 1275-1276 Endemic species, 1258-1261, 1259f, 1260t Endergonic reaction, 110-111, 111f, 113, 113f Endochondral development, of bone, 965-966, 965f Endocrine gland, 866, 938. See also specific glands Endocrine signaling, 169, 169f, 170 Endocrine system, 873, 874f, 937-957, 938 Endocytosis, 102, 102f, 104t receptor-mediated, 102f, 103, 104t Endoderm, 637, 637f, 864, 1113, 1113f Endodermis, 741, 741f, 775 Endogenous opiate, 899 Endomembrane system, 65, 69-73 Endonuclease, 266 Endoparasite, 1199 Endophyte, 626, 626f Endoplasmic reticulum (ER), 65, 69-71, 78t, 81t origin of, 568, 568f proteins targeted to, 296f, 297 rough, 69-70, 70f smooth, 70, 70f Endorphin, 899 Endoskeleton, 962, 963, 963f of echinoderm, 688-689 of vertebrates, 696 Endosperm, 754, 754f, 760, 760f Endospore, 554 Endosteum, 966 Endosymbiont theory, 75, 75f, 568-569, 569f, 570 Endosymbiosis, 75, 75f, 517, 568-569, 569f secondary, 569 Endothelin, 942
Endothelium, 1030, 1030f Endotherm, 710, 715, 716, 876, 880, 881-882, 882f Energy, 108. See also specific types of energy as characteristic of life, 3 feeding behavior and, 997, 997f flow in living things, 3, 108-109 flow through ecosystem, 1214-1219 forms of, 108 laws of thermodynamics, 109-110 prokaryotes need for, 559 Energy expenditure, 995, 997 Energy level, 21, 21f Enhancement effect, 157, 157f Enhancer, 313-314, 314f Enkephalin, 899 Enteric bacteria, 551f Enterobacteriaceae, 558 Enterogastrone, 993 Enthalpy, 110 Entropy, 110, 110f Environment effect on enzyme function, 116-117, 116f effect on gene expression, 233t, 235, 235f individual responses to changes in, 1162-1163 limitations on population growth, 1173-1174, 1174f-1175f Environmental Protection Agency (EPA), U.S., 798 Environmental variation, coping with, 1163, 1163f EnviroPig, 349 Enzymatic DNA sequencing, 336-337, 337f Enzymatic receptor, 172-173, 172f, 172t Enzyme, 44, 45t, 113-117 activation energy, 113-114 attached to membranes, 93, 94f catalytic cycle of, 114, 115f cofactors, 117 defects in gene disorders, 279 digestive, 994t genetic variation in, 398 inhibitors and activators of, 117, 117f intracellular receptors as, 174 multienzyme complex, 115-116, 115f nonprotein, 116 pH effect on, 52-53, 116-117, 116f restriction, 328, 328f, 331f, 353, 353f RNA, 116 temperature effect on, 52-53, 116, 116f Enzyme-substrate complex, 114, 114f Eosinophil, 1062, 1062t Ephedra, 602t, 605, 760 Ephedrine, 605 Epidermal cells, of plants, 734, 734f, 740 Epidermal growth factor (EGF), 202, 942
Epidermis, of plant, 731, 733, 741f Epididymis, 1092 Epigenetic, 380 Epilimnion, 1239 Epinephrine, 170, 182, 899 Epiparasite, 628 Epiphyseal growth plate, 966 Epiphyses, 965, 965f Epistasis, 233t, 235-236, 236f, 414 Epithelial tissue, 864, 865-866, 867t columnar, 866, 867t cuboidal, 866, 867t keratinized, 866 regeneration of, 866 simple, 866 squamous, 866, 867t stratified, 866 structure of, 866 Epithelium, 865 EPSP. See Excitatory postsynaptic potential Equilibrium constant, 111 Equilibrium model, of island biogeography, 1226-1227, 1226f Equilibrium potential, 891, 892t Equisetum, 599, 599f ER. See Endoplasmic reticulum Eratosthenes, 4-5, 5f Erythrocytes, 870, 1019, 1019f facilitated diffusion in, 97 membrane of, 90t Erythropoiesis, 1021 Erythropoietin, 956, 1021 Escherichia coli (E. coli), 533, 1164 cell division in, 186-187, 188f conjugation map of, 555, 555f, 556, 556f DNA repair in, 274-275 harmful traits of, 558 introduction of foreign DNA into, 329-330 lac operon of, 308, 309-310, 308f-310f mutations in, 558 replication in, 266-270 Esophagus, 985-986, 986f Essay on the Principle of Population (Malthus), 10 Essential amino acids, 998 Essential nutrient, 997-998, 998t in plants, 790t EST. See Expressed sequence tag Estrogen, 956, 1093t Estrus, 1090, 1097 Estuary, 1243 Ethanol, 35f Ethanol fermentation, 140, 140f Ethics ownership of genomic information, 369 of stem cell research, 379 value of biodiversity, 1263 Ethology, 1133-1134 Ethylene, 826t, 835-836, 835f Etiolation, 817, 817f Eucalyptus, 749 Euchromatin, 190 Eudicot, 499, 607f, 608 leaf of, 741-742, 741f, 748, 748f
index
rav32223_Index_I1-I33.indd I-10
11/25/09 11:54:45 AM
Euglena, 574, 575f Euglenoid, 573-574, 574f Euglenozoa, 570f, 573-575, 574f Eukarya (domain), 13, 13f, 483, 513f, 515, 515f, 516f, 518-519, 549f Eukaryote, 13, 545 cell division in, 187, 548 cell structure in, 65-69, 66f, 67f, 68f, 81t cell wall of, 67f, 78t, 81t chromosomes of, 65, 78t, 189-191, 189f-191f, 189t, 548 compartmentalization in, 517, 518-519, 548 cytoskeleton of, 65, 75-79, 76f DNA of, 62 endomembrane system of, 65, 69-71 evolution of, 75, 75f, 188, 568-570, 568f-569f flagella of, 66f, 78t, 79-80, 79f, 80f, 81t, 548 gene expression in, 305, 312-315, 313f-315f, 322f genome of, 358f gene organization in, 360t noncoding DNA in, 359-360 initiation in, 295 key characteristics of, 518-519, 518t origin of, 517-518, 517f, 568-570, 568f-570f plasma membrane of, 66f prokaryotes versus, 81t, 547-548 promoters of, 287-288 replication in, 271-273, 271f-272f ribosomes of, 68-69, 69f transcription factor in, 313-314, 314f transcription in, 287-289, 288f transcriptional control in, 305, 312-315, 322f translation in, 295 vacuoles of, 81t Eumetazoa (subkingdom), 640, 643, 644f, 652-656, 652f-656f Euryarchaeota, 550f Eusociality, 1156 Eutherian, 524, 525f Eutrophic lake, 1240-1241, 1240f Evaporation, 880 Evening primrose (Oenothera biennis), 852 Evergreen forest temperate, 1238 warm moist, 1235f, 1236 Evolution, 396-397. See also Coevolution of aerobic respiration, 143 agents of, 401-405, 401f-405f interactions among, 406-407, 407f of amphibians, 697, 703, 704-705, 704f-705f of apes, 721-726 of biochemical pathways, 118 of birds, 424f-425f, 425, 463, 466, 467f, 712, 712f, 714, 714f
of Brassica, 495, 495f of complex characters, 466, 467f controversial nature of theory, 432-433 convergent, 430, 430-432, 431f, 458, 464-465, 498-499, 498f, 502 Darwin’s theory of, 8-10, 432 of development, 492-504 of diseases, 470-471, 470f-471f of eukaryotes, 75, 75f, 188 evidence for, 417-433 age of Earth, 11 anatomical record, 428-430, 428f-430f biogeographical studies, 430 comparative anatomy, 11, 11f convergence, 431-432, 431f development, 428-429, 428f experimental tests, 411-413, 412f-413f, 422, 22f fossil record, 10-11, 424-428, 424f-427f homologous structures, 428, 428f imperfect structures, 429-430, 429f molecular biology, 11-12, 11f vestigial structures, 430, 430f of eye, 414, 414f, 429, 429f, 501-504, 501f-503f of eyespot on butterfly wings, 498f of fish, 698, 700-701, 700f, 702, 702f of flight, 467f of flowers, 469-470, 499, 848-850 of fruit, 606f of gas exchange, 1002-1003, 1003f gene flow and, 401, 401f, 406-407, 407f genetic drift and, 401f, 402-403, 402f, 406 genetic variation and, 396-397, 397f, 412, 412f of genomes, 474-489 of glycolysis, 129, 143 of heart, 1026f of homeobox genes, 389 of hominids, 722-724 of horses, 414, 414f, 426-428, 426f-427f human impact on, 453 of humans. See Human evolution on islands, 431-432, 431f, 444-445, 444f of land plants, 521f, 571, 589-590 of leaf, 596-597, 597f of life on earth, 511f of mammals, 525f, 697, 698f, 718, 718f marsupial-placental convergence, 430-431, 431f of mitosis, 570 of mollusks, 667 mutation and, 301, 401, 401f, 406 natural selection. See Natural selection of nitrogen fixation, 143 of oysters, 426
of photosynthesis, 139, 143, 156 of plants, 390 of primates, 721-726, 721f-726f of prosimians, 721 rate of, 461 of reproductive isolation, 441-442, 442f of reproductive systems, 1087-1088, 1088f of reptiles, 697, 708-709, 708f-709f of seed plants, 602-603, 603f of shark, 701 of snakes, 425 of social system, 1157-1159 speciation and, 451-452, 451f in spurts, 451-452 of tobacco, 477f, 480, 480f of vertebrate brain, 903f of vertebrates, 697, 698f, 1121, 1121f of whales, 425, 425f of wheat, 478f of wings, 497, 498, 976-977, 977f Evolutionary adaptation, as characteristic of life, 3 Evolutionary age, species richness and, 1225 Evolutionary conservation, 14 Excision repair, 274-275, 274f Excitation-contraction coupling, 972, 972f Excitatory postsynaptic potential (EPSP), 898, 899-900, 899f Excretion, by kidney, 1048 Excretory system annelids, 674 of arthropods, 679f, 680f, 681 of flatworms, 657-658, 657f of mollusks, 669 Exercise bone remodeling and, 967f effect on metabolic rate, 995 muscle metabolism during, 974-975 Exergonic reaction, 110-111, 111f Exhalant siphon, 671, 671f Exocrine gland, 866 Exocytosis, 103, 103f, 104t Exon, 289, 289f Exon shuffling, 290 Exonuclease, 266, 268 Exoskeleton, 41, 41f, 679-680, 679f, 962-963, 963f Experiment, 5f, 6 control, 6 test, 6 Expiration, 1009-1011, 1010f Exploitative competition, 1188 Expressed sequence tag (EST), 361, 361f Expression vector, 342 Extensor muscles, 969f External fertilization, 1088, 1089f External intercostal muscle, 1009 Exteroceptor, 916 Extinction, 452-453, 452f conservation biology, 1256-1278 disruption of ecosystems and, 1271, 1272f
due to human activities, 1257-1258 due to prehistoric humans, 1257-1258, 1257f factors responsible for, 1264-1275, 1264f-1274f genetic variation and, 1274 habitat loss, 1264t, 1266-1268 in historical time, 1258, 1258t introduced species and, 1264t, 1269-1271 of Lake Victoria cichlid fish, 449-450, 449f, 1271 loss of keystone species, 1272, 1273f mammals, extinct, 718t over time, 452-453 overexploitation and, 1264t, 1268-1269 population size and, 1273-1275, 1273f-1274f in prehistoric time, 1257-1258, 1257f Extra-pair copulation, 1153-1153, 1153f Extracellular fluid, 892t Extracellular matrix, 80-81, 81f, 868 Extracellular regulated kinase, 178f Extraembryonic coelom, 1116 Extraembryonic membrane, 1116, 1116f Extraterrestrial life, 508-509, 509f Extremophile, 516, 547 Extrusion, 99 Eye, 928-933, 928f-933f compound, 414,414f, 680, 680f, 681f development of, 501-504, 501f-503f, 1125f evolution of, 414, 414f, 429, 429f, 501-504, 501f-503f, 928-929, 928f focusing of, 929f of insects, 414, 414f, 501, 501f of mollusks, 429, 429f, 501, 501f of planarian, 501, 501f structure of, 929-930, 929f of vertebrates, 429, 429f, 501, 501f, 929-930, 929f Eye color in fruit fly, 240-241, 240f in humans, 232-233, 233t Eyeless gene, 342, 502, 502f
F F plasmid, 554-556, 555f F plasmid transfer, 555, 555f F1 generation. See First filial generation F2 generation. See Second filial generation Facilitated diffusion, 96-97, 97f, 104t Facilitation, 1203 Facultative symbiosis, 626 FAD, 44, 131 FADH in ATP yield, 137, 137f contributing electrons to electron transport chain, 134, 134f, 135 from Krebs cycle, 131, 132, 133f
index
rav32223_Index_I1-I33.indd I-11
I-11
11/25/09 11:54:45 AM
Fallopian tube, 1097, 1097f Family (taxonomic), 512, 513f, 513 Farsightedness, 929f Fast-twitch muscle fiber, 974, 974f Fat(s), 37t absorption in small intestine, 989-990 caloric content of, 53 as energy-storage molecules, 54-55 structure of, 53-54, 54f Fatty acids, 36f, 55 catabolism of, 141-142, 142f polyunsaturated, 53, 54f saturated, 53, 54f trans-fatty acids, 55 unstaurated, 53, 54f Fatty acid desaturase, 93 Feather, 712, 712f Feather star, 689 Feces, 990 Fecundity, 1169 Feedback inhibition, 117, 118-119, 119f Female infertility, 1101 Female reproduction, hormonal control of, 1093t Female reproductive system, 875f, 876, 1090, 1090f, 1094-1098, 1094f-1098f Fermentation, 124, 129, 139-140, 140f ethanol, 140, 140f Fern, 589f, 590, 598-601, 599, 599f-600f, 601t Ferredoxin, 158, 159f Fertilization, 208, 208f, 1087-1090, 1106-1109, 1106t, 1107f-1109f in amphibians, 1088, 1088f-1089f in birds, 1088-1089, 1088f-1089f double, 608, 609f, 610, 856-857, 856f-857f external, 1088, 1089f in fish, 1087f, 1088, 1088f internal, 1087-1090, 1087f-1090f in plants, 605, 609, 609f, 610, 856-857, 856f-857f in reptiles, 1089-1090 Fertilization envelope, 1108 Fertilizer nitrogen, 1211 phosphorus, 1212 pollution from, 1251 Fever, 883 Fiber, dietary, 990 Fibrin, 1021 Fibrinogen, 1019 Fibroblast growth factor, 378, 378f, 1118 Fibronectin, 81, 81f, 392, 392f Fiddlehead, 600, 600f Filament (flower), 608, 608f, 848f, 849 Filial imprinting, 1139 Filopodia, 1113 Filovirus, 532t, 540, 540f Filtration, 1040 in kidney, 1045, 1046-1047, 1047f Finch, Darwin’s, 8, 9f beaks of, 408, 418-419, 418f, 1191, 1191f
I-12
Finger, grasping, 721 Firefly, 1145, 1145f First filial generation, 224-225, 225f, 228-229, 229f First Law of Thermodynamics, 109 Fish, 641t, 698-702, 698f-702f aquaculture, 1248 armored, 699t bony, 701-702, 701f, 1004-1006, 1004f, 1042 brain in, 902-903, 903f cartilaginous, 698f, 700-701, 700f, 1043, 1065 characteristics of, 698-702 circulation in, 699, 1023, 1023f depletion of, 1247-1248, 1248f evolution of, 698, 700-701, 700f, 702, 702f fertilization in, 1087f, 1088, 1088f hearing in, 920-921, 921f heart in, 1023, 1023f jawed, 699-700, 700f jawless, 700, 1065-1066 kidney of cartilaginous fish, 1043 freshwater fish, 1042, 1043f marine bony fish, 1042, 1043f lobe-finned, 698f, 699t, 702, 702f, 704f nitrogenous wastes of, 1045f path to land, 702, 702f predation on insects, 408, 408f prostaglandins in, 943 ray-finned, 698f, 699t, 702, 702f respiration in, 1004-1006, 1003f-1005f spiny, 699t, 700 swimming by, 975-976, 975f taste in, 926 viviparous, 1087, 1087f FISH. See Fluorescence in situ hybridization Fitness, 405-406, 406f, 414 5 Cap mRNA, 288, 288f Flagella, 65 of bacteria, 64f, 65, 548, 553, 553f of eukaryotes, 66f, 78t, 79-80, 79f, 80f, 81t, 548 of prokaryotes, 63f, 65, 81t, 548, 552, 553, 553f of protists, 572-573, 575f Flame cells, 657-658 Flatworm, 523f, 641t, 643, 657-660, 657f, 659f-660f classification of, 658-660 digestive cavity of, 657, 657f, 982 excretion and osmoregulation in, 657-658, 657f, 1040-1041, 1040f-1041f eyespot of, 657, 657f, 928, 928f free-living, 657, 658 nervous system of, 657f, 658, 901f, 902 reproduction in, 657f, 658 Flavin adenine dinucleotide. See FAD Flavivirus, 531f, 532t Flemming, Walther, 189, 207 Flesh-eating disease, 560 Flexor muscles, 969f
Flight skeleton, 712 Flipper, 710 Flooding, plant responses to, 780, 781f Floral leaf, 749 Floral meristem identity gene, 846, 846f Floral organ identity gene, 846, 846f-847f, 848 Florigen, 844 Flower complete, 848 evolution of, 469-470, 499, 848-850 floral symmetry, 499 incomplete, 848 initiation of flowering, 840-841, 840f male and female structures, separation of, 855-856 morphology of, 848-849 production of 842-848, 842f-848f autonomous pathway of, 845-846, 845f-846f flowering hormone, 844 formation of floral meristems and floral organs, 846, 846f-847f, 848, 848f gibberellin-dependent pathway, 845 light-dependent pathway, 842-844, 842f-843f phase change and, 840-841, 841f temperature-dependent pathway, 844 shape of, 499 structure of, 848-849, 848f Flower color, 853-854, 853f Flowering hormone, 844 Flowering plant, 589f, 602t, 606-610, 606f-610f angiosperm, 606, 754f dichogamous, 855 dioecious, 855 evolution of, 469-470 fertilization in, 856-857, 856f-857f gamete formation in, 850-851, 850f-851f gene duplication in, 499-500, 499f-500f life cycle of, 608-610, 609f, 840f monoecious, 855 pollination. See Pollination trends in, 849-850, 849f Fluid mosaic model, 89, 90f, 92-93 Fluidity, membrane, 92-93, 93f Fluke, 658-659, 659f Fluorescence in situ hybridization (FISH), 353, 354f Fluorescence microscope, 62t Fly, eye development in, 502, 502f Flying fox, declining populations of, 1272-1273, 1273f Flying phalanger, 431f Flying squirrel, 431f Folic acid, 998t Foliose, 627f
Follicle-stimulating hormone (FSH), 948, 1093, 1093t, 1094f Food, caloric content of, 995 Food and Drug Administration (FDA), U.S., antiretroviral drugs, 537-538 Food energy, 995-997 Food intake, regulation of, 995-997 Food poisoning, 1079 Food preservation, 52-53 Food security, 792 Food storage, in plants, 759-760, 760f Food storage root, 742, 743f Food supply, population cycles and, 1177 Foraging behavior, 1148-1149, 1148f Foraminifera (phylum), 571, 584, 584f Forebrain, 902f, 902t human, 903-905, 904f-905f Forest ecosystem biogeochemical cycles in, 12-1213, 1213f effect of deforestation on, 1246-1247 Fork head gene, in Drosophila, 1117 fosB gene, 1136 Fossil record, 424-428, 424f-427f angiosperms, 606-607, 607f community, 1187 early eukaryotic, 568, 568f evidence for evolution, 10-11, 424-428, 424f-427f, 432 gaps in, 425, 432 history of evolutionary change, 425-426, 425f microfossils, 546, 546f Founder effect, 402-403 Four o’clock, flower color in, 233t, 234, 234f, 244 Fox, 423, 423f FOXP2 gene, 485, 1147 Frameshift mutation, 283, 299 Franklin, Rosalind, 260-261, 260f Free energy, 110 Free water, 98, 98f Freeze-fracture microscopy, 91-92, 91f Frequency-dependent selection, 407-408, 408f Freshwater habitat, 1238-1241, 1239f-1240f changes with water depth, 1239-1240, 1239f-1240f oxygen availability in, 1239 pollution of, 1246, 1246f Frick’s Law of Diffusion, 1002 Frog (Rana), 703, 703t, 705-706, 705f chromosome number in, 189t declining populations of, 1265, 1265f development in, 373f, 1110f, 1111f fertilization in, 1088-1089, 1089f-1090f, 1109, 1109f gastrulation in, 1114, 1114f hybridization between species of, 439, 440 Frond, 600, 600f Frontal lobe, 904, 904f Fructose, 38, 39f
index
rav32223_Index_I1-I33.indd I-12
11/25/09 11:54:45 AM
Fructose 1,6-bisphosphate, 128f, 138, 138f Fructose 6-phosphate, 128f, 138, 138f Fruit, 597, 608 development of, 761-763, 762f-763f dispersal of, 762, 763f evolution of, 606f kinds of, 762, 763f ripening of, 835-836, 835f Fruit fly (Drosophila) behavioral genetics in, 1135-1136 body color in, 246-247, 246f branchless gene in, 1118 bristle number in, 422, 422f development in, 494, 1117-1118, 1117f eye color in, 240-241, 240f eyeless gene from, 342 gene expression of, 304f genetic map of, 246-247, 246f, 354 genome of, 354, 358f, 362, 475f, 486 Hawaiian, 443, 447, 447f heart development in, 1118, 1118f hedgehog signaling molecule in, 1124 heterozygosity in, 398 homeotic genes in, 5, 388, 388f homeotic mutations in, 307, 494 meiosis in, 214 Morgan’s experiments with, 240-241, 240f, 354 pattern formation in 383-389, 384f-388f forming the axis, 384-387, 385f-387f producing the body plan, 384f-385f, 387-388 proteasome, 323f salivary gland development in, 1117-1118, 1117f segmentation in, 388-389, 388f selection for negative phototropism, 410-411, 411f sex chromosomes of, 241, 241t toll receptor in, 1056 transposons in, 484 wing traits in, 246-247, 246f X chromosome of, 241, 245 Fruticose lichen, 627f FSH. See Follicle-stimulating hormone FtsZ protein, 188, 188f Fucus (zygote), 754, 755, 755f Fumarate, 132, 133f Funch, Peter, 660 Function, of living systems, 13 Functional genomics, 364-366, 365f-366f, 484, 500 Functional group, 35, 35f Functional magnetic resonance imaging (fMRI), 1134, 1134f Fundamental niche, 1188, 1188f Fungal disease, 626 in animals, 630, 630f in humans, 630 in plants, 629-630, 629f, 804-805, 804f
Fungal garden, of leafcutter ants, 629, 629f Fungi, 614-630. See also Lichen; Mycorrhizae body of, 616, 616f carnivorous, 617-618, 617f cell types in, 614 cytokinesis in, 198 ecology of, 625-629, 626f-629f endophytic, 626, 626f genome of, 477 key characteristics of, 615, 615t major groups of, 615, 615f, 615t mating type in, 177 mitosis in, 616-618 obtaining nutrients, 614, 617-618, 617f phylogeny of, 615, 615f, 615t reproduction in, 614, 617, 617f in rumen, 620 in symbioses, 626-629 Fungi (kingdom), 13, 13f, 514, 517f, 518t Fusarium, 630 Fusion protein, 341, 341f
G G-protein, 173, 179-183, 179f, 912, 912f, 946 G-protein-coupled receptor, 946 G-protein-linked receptor, 95, 172f, 172t, 173, 179-183, 179f G0 phase, 192-193, 202 G1 phase, 192, 192f, 202 G1/S checkpoint, 200, 200f, 201f G2/M checkpoint, 200, 200f, 201f G2 phase, 192, 192f GA-TRXN protein, 833f GABA, 898 GABA receptor, 899 Gal4 gene, 341, 341f Galápagos finch, 8, 9f, 408, 418, 418f, 440-441, 448, 448f Gallbladder, 988f, 989 Gallstones, 989 Gametangium, 590 Gamete, 208, 208f, 214, 1084 plant, 850-851, 850f-851f prevention of fusion of, 438t, 440 Gametic intrafallopian transfer (GIFT), 1102 Gametophyte, 590, 590f, 594f, 595, 608, 608f, 609, 850-851 Gametophytic self-incompatibility, 856, 856f Ganglia, 909, 910f Ganglion cell, 930, 931f Gap genes, 385f, 387 Gap junction, 83f, 84 Gap phase, 192, 192f Garden pea (Pisum sativum) chromosome number in, 189t flower color in, 224-228, 225f, 226f, 231-232, 231f genome of, 479 Knight’s experiments with, 222 Mendel’s experiments with 222-229, 222f-229f
choice of garden pea, 223, 223f experimental design, 223 seed traits in, 224-225, 229f Garrod, Archibald, 278-279 Gas exchange, 1002-1003 in animals, 1003f evolution of, 1001-1002, 1003f in lungs, 1009, 1010f in single cell organisms, 1003f in tissues, 1010f Gastric inhibitory peptide (GIP), 993, 993f, 994t, 996, 997, 997f Gastric juice, 986, 986f Gastrin, 993, 993f, 994t Gastrodermis, 652, 652f Gastrointestinal tract. See Digestive tract Gastropod, 668, 668f, 669, 670f Gastropoda (class), 670-671, 670f Gastrovascular cavity, 982, 1022, 1022f Gastrula, 635 Gastrulation, 392, 392f, 1106t, 1112-1116, 1113f-1116f, 1113t in amphibian, 1114, 1114f in birds, 1114-1115, 1115f in mammals, 1115, 1115f in sea urchins, 1113-1114, 1113f Gated ion channel, 96, 892, 893f, 917 Gause, Georgii, 1189 Gehring, Walter, 502 Gel electrophoresis of DNA, 328-329, 329f Gene, 13, 225 co-option of existing gene for new function, 496-497, 497f copy number, 486 functional analysis of, 500-501 inactivation of, 482 nature of, 278-281 one-gene/one-polypeptide hypothesis, 280 pleiotropic effect of, 413 in populations, 396-414 segmental duplication, 481 Gene cloning, 330 Gene disorder enzyme deficiency in, 279 important disorders, 227t Gene disorder. See Genetic disorder Gene duplication, 480, 480f-481f, 481, 499-500, 500f Gene expression, 278-301, 298f, 298t Central Dogma, 280, 280f chromatin structure and, 316-317, 316f-317f control of, 14, 304-324 in development, 1117 environmental effects on, 233t, 235, 235f, 308-309 in eukaryotes, 305, 312-315, 313f-315f, 322f in plants, 830f in polyploids, 480 posttranscriptional control, 317-321, 318f-319f, 321f in prokaryotes, 305, 308-312, 308f-312f
regulatory proteins, 305-307, 306f-307f RNA in, 281 transcriptional control, 305, 308, 312-315, 313f-315f translational control, 321 Gene flow, 401-402, 401f, 406-407, 407f interactions among evolutionary forces, 406-407, 407f speciation and, 442 Gene-for-gene hypothesis, 811, 811f Gene therapy, 345, 345t General transcription factor, 313, 313f Generalized transduction, 556-557, 557f Generation time, 1168, 1169f Generative cell, 605, 609f, 610 Genetic code, 42-43, 43f, 282-284, 282f, 283t, 284f in chloroplasts, 284 in ciliates, 284 deciphering, 283 degeneracy of, 283-284 in mitochondria, 284 triple nature of, 282-283, 282f universality of, 284 Genetic counseling, 252-253 Genetic disorder, 249-253, 249t enzyme deficiency, 279 gene therapy for, 345, 345t genetic counseling in, 252 important disorders, 227t, 249t prenatal diagnosis of, 252-253, 252f-253f Genetic drift, 401f, 402-403, 402f, 406, 443 Genetic engineering, 341-343, 342f-343f agricultural applications of, 346-349, 346f-348f bacteria and, 564 human proteins produced in bacteria, 343-344 medical applications of, 343-345, 344f, 345t social issues raised by, 348 Genetic Information Nondiscrimination Act (GINA), 369 Genetic map, 244-248, 352-355, 353 of Drosophila, 246-247, 246f of humans, 247-248, 248f using recombination to make maps, 245f, 246-247, 246f Genetic mosaic, 243 Genetic recombination. See Recombination Genetic relationships, 1155f Genetic sex determination, 1086 Genetic template, 1140 Genetic variation evolution and, 396-397, 397f, 412, 412f genes within populations, 396-414 maintenance of, 407-409, 408f-409f in nature, 398, 398f
index
rav32223_Index_I1-I33.indd I-13
I-13
11/25/09 11:54:46 AM
Genetics population, 397 of prokaryotes, 554-559, 555f-558f reverse, 343 Genome, 13. See also specific organisms of chloroplasts, 364 conserved regions in, 362-363 downsizing of, 479, 479f eukaryotic, 358f gene organization in, 360t noncoding DNA in, 359-360 evolution of, 474-489 finding genes in, 358-359 gene swapping evidence in, 483-484, 483f human. See Human genome of mitochondria, 364 of moss, 595 prokaryotic, 358f rearrangement of, 482, 482f size and complexity of, 358, 358f, 486 of virus, 529, 531 Genome map, 352-355, 353f-355f. See also Physical map Genome sequencing, 356-358, 356f-357f clone-by-clone method, 357, 357f databases, 358-359 shotgun method, 357, 357f using artificial chromosomes, 356 Genome-wide association (GWA) mapping, microarray analysis and, 364-365 Genomic imprinting, 251-252, 381 Genomic library, 331 Genomics, 352-369, 363f agricultural applications of, 368-369, 368f-369f applications of, 367-369, 368f-369f behavioral, 369 comparative, 362-363, 363f, 474-477, 475f, 500 functional, 364-366, 365f-366f medical applications of, 368, 487-488, 488f ownership of genomic information, 369 Genotype, 226 Genotype frequency, 399f, 400 Genus, 512, 513 Geographic distribution, variation within species, 437, 437f Geographic isolation, 437t Geography, of speciation, 444-446, 444f-445f Germ cell, 1092 Germ layers, 864, 1113 Germ-line cells, 208, 208f Germination, of seeds, 393, 393f, 610, 764-766, 764f-766f, 817 GH. See Growth hormone Ghrelin, 996 GHRH. See Growth hormonereleasing hormone (GHRH) Giant clam (Tridacna maxima), 667, 667f
I-14
Giant redwood (Sequoiadendron giganteum), 859f Giardia, 573, 573f Gibberellin, 826t, 832-834, 833f-834f, 845 Gibbon (Hylobates), 457, 457f Gibbs’ free energy, 110 GIFT. See Gametic intrafallopian transfer Gigantism, 950 Gill(s) of fish, 699, 702, 1004-1006, 1004f-1005f internal, 699 Gill cover, 702 Gill filament, 1005 Ginkgo biloba, 605f, 606 Ginkgophyta (phylum), 602t, 603, 605f, 606, 607f GIP. See Gastric inhibitory peptide Girdling of tree, 738 GLABROUS3 mutant, in Arabidopsis, 735, 735f Glacier, 1251, 1251f Glaucoma, juvenile, 227-228, 227f Gliding joint, 967, 968f Global climate change, 369f, 1187, 1209 crop production and, 795-797 Global warming, 1250-1253 carbon dioxide and, 1251, 1251f computer models of, 1250 effect on humans, 1252-1253 effect on natural ecosystems, 1251-1252, 1251f geographic variation in, 1250, 1250f Globulin, 1019 Glomeromycetes, 622 Glomeromycota (phylum), 615, 615f, 615t, 622 Glomerulus, 1042, 1042f, 1046, 1047f Glomus, 615, 615t Glottis, 1007, 1008f Glucagon, 955, 994-995, 995f Glucocorticoids, 954 Gluconeogenesis, 995 Glucose in aerobic respiration, 132 alpha form of, 38, 39, 39f beta form of, 38, 39, 39f blood, regulation of, 994-995, 995f catabolism of, 124 oxidation of, 25, 124-125 polymers of, 40f priming of, 127, 128f reabsorption in kidney, 1048 structure of, 38, 38f, 39f Glucose 6-phosphate, 128f Glucose repression, 310-311, 310f Glucose transporter, 45t, 97, 101, 101f Glutamate, 141, 141f, 898 Glyceraldehyde 3-phosphate, 127, 128f, 161f, 162 Glycerol, 53, 55, 55f Glycerol phosphate, 35f Glycine, 46, 47f
Glycogen, 37t, 40, 40f Glycogenolysis, 995 Glycolipid, 71, 82, 90f, 90t, 91 Glycolysis, 125, 126f, 127-130, 127f, 128f, 129f, 138f evolution of, 129, 143 Glycoprotein, 69, 71, 81, 90f, 90t, 91 Glycoprotein hormones, 948 Glyphosate, 346, 347f Gnathostomulida, 643 Gnathozoa, 643 Gnetophyta (phylum), 602t, 605-606, 605f, 607f GnRH. See Gonadotropin-releasing hormone Goblet cell, 866 Goiter, 949, 949f Golden rice, 348, 348f Golgi apparatus, 70-71, 70f, 71f, 78t, 81t Golgi body, 70, 739 Golgi, Camillo, 70 Golgi tendon organs, 919 Gonadotropin-releasing hormone (GnRH), 949, 1093, 1094f Gonorrhea, 561t, 562, 562f Gooseneck barnacle (Lepas anatifera), 683f Gore, Al, 1250 Gorilla (Gorilla), 457, 457f, 482, 482f Gould, Stephen Jay, 451 Gout, 1044 Graafian follicle, 1095, 1096f Graded potential, 892-893, 893f Gradualism, 451, 451f Gram-negative bacteria, 552-553, 552f-553f Gram-positive bacteria, 550f, 552-553, 552f-553f Gram stain, 552-553, 552f-553f Grana, 74, 74f Grant, Peter, 419, 441 Grant, Rosemary, 419, 441 Granular leukocytes, 1019 Granulosa cell, 1095 Grape, 834, 834f Grass, 1237 Grasshopper, 1022f Grassland, temperate, 1237 Gravitropism, 819-820, 819f-820f negative, 819f, 820 positive, 820 Gravity sensing, in plants, 819f, 820 Green algae, 463f, 517-518, 517f, 571, 589, 589f, 591-592, 591f-592f Greenbriar (Smilax), 741f Greenhouse gas, 1251, 1251f Gregarine, 578, 578f Greyhound dog, 422-423, 423f Griffith, Frederick, 257, 257f, 329, 557 Gross primary productivity, 1215 Ground finch, 448, 448f large ground finch (Geospiza magnirostris), 9f, 418f, 448f medium ground finch (Geospiza fortis), 419, 419f, 441, 448f small ground finch (Geospiza fuliginosa), 441, 448f
Ground meristem, 732, 733f, 741, 758 Ground substance, 868 Ground tissue, 731, 736-737, 736f, 756, 758 Groundwater, 1210 Growth, as characteristic of life, 3, 508 Growth factor, 202, 203f, 942 cell cycle and, 202, 203f characteristics of, 202, 203f Growth factor receptor, 202 Growth hormone (GH), 948, 950-951, 950f Growth hormone-inhibiting hormone (GHIH), 949 Growth hormone-releasing hormone (GHRH), 949 GTP, 132, 133f Guanine, 42, 42f, 259f, 260, 262 Guano, 1044 Guard cells, 734, 734f Guppy, selection on color in, 412-413, 412f-413f Gurdon, John, 380 Gurken protein, 386, 387f Gustation, 926 Gut, 996 Guttation, 776 Gymnopphiona. See Apoda (order) Gymnosperm, 603, 605f, 607f Gynoecium, 608, 608f, 849
H H band, 969 H1N1 virus, 1079 H5N1 virus, 539, 1079 HAART therapy, 538 Haberlandt, Gottlieb, 831 Habitat destruction, 1266, 1266f Habitat, economic value of, 1262, 1262f Habitat fragmentation, 1267-1268, 1267f Habitat loss, 1245-1247, 1245f-1247f, 1264t, 1266-1268, 1266f-1268f Habitat occupancy, population dispersion and, 1167 Habituation, 900, 1137 Haeckel, Ernst, 645 Haemophilus influenzae, 352, 352f, 353, 357 Hagfish, 698f, 699, 699t Hair, 716 Hair cell, 921, 921f Hair-cup moss (Polytrichum), 594f Hairpin, 286, 286f Haldane, J. B. S., 1155 Half-life, 19-20, 424 Halobacterium, 95f, 550f Halophyte, 781 Halorespiration, 564 Hamilton, William D., 1155-1156 Hamstring, 968, 969f Handicap hypothesis, 1152 Hansen disease (leprosy), 560, 561t Hantavirus, 540 Haplodiploidy, 1156
index
rav32223_Index_I1-I33.indd I-14
11/25/09 11:54:46 AM
Haplodiplontic life cycle, 590, 590f, 592, 596 Haploid (n), 191, 208, 208f, 225 Haplotype, genomic, 361, 362f Hardy, Godfrey H., 399 Hardy-Weinberg equation, 399-400 Hardy-Weinberg equilibrium, 399-400, 399f Hardy-Weinberg principle, 399-400 Hashimoto thyroiditis, 1075 Hatfill, Steven J., 368 Haversian canals, 966 Haversian lamellae, 966 Haversian system, 965f, 966 Hawaiian Drosophila, 443, 447, 447f Hawaiian Islands, 1270, 1270f hCG. See Human chorionic gonadotropin Head, of vertebrates, 696, 697f Hearing, 920-925, 920f-925f Heart, 1023 of amphibians, 703, 1024, 1024f of birds, 1025, 1025f cardiac cycle, 1026, 1027f contraction of, 1026 development in Drosophila, 1118 of fish, 1023, 1023f four-chambered, 1025, 1026-1030 of mammals, 1025, 1025f of reptiles, 1024 Heart attack, 1033 Heart disease, chlamydia and, 563 Heat, 108-109, 1216 Heat-losing center, 882 Heat of vaporization, 28 of water, 27t, 28 Heat shock protein (HSP), 825 Heat transfer, 879-880, 879f Heavy chain (polypeptide), 1069, 1070f Heavy metal, phytoremediation for, 799-800, 799f Hedgehog signaling molecule, in Drosophila, 1124 Helical virus, 530 Helicase, DNA, 267, 268t, 269f Helicobacter, 551f Helicobacter pylori, 561t, 562, 987 Heliotropism, 822f Helium, 23f Helix-turn-helix motif, 50, 50f, 306-307, 307f, 311 Helper T cell, 1062t, 1066, 1067-1068, 1069f Hematopoiesis, 1021, 1062-1063 Heme group, 1013 Hemidesmosome, 83f, 84 Hemiptera (order), 685t Hemocyanin, 1013 Hemoglobin, 45t, 49, 53, 531f, 1013-1014, 1019 affinity for oxygen, 1014, 1014f effect of pH and temperature on, 1014, 1014f evolution of, 11, 11f structure of, 46, 48, 49, 1013, 1013f Hemolymph, 669, 1023 Hemolytic disease of newborns (HDN), 1077
Hemophilia, 227t, 242-243, 242f, 249t Hemorrhagic fever, 540 Hensen’s node, 1124 Hepatitis B, 532t, 539 Hepatitis virus, 344, 539 Herbicide resistance, in transgenic plants, 346-347, 347f Herbivore, 982 digestive system of, 991f, 992 plant defenses against, 810, 810f, 1193-1194, 1193f teeth of, 984f in trophic level ecosystem, 1215, 1215f Heredity, 221-236. See also Gene entries as characteristic of life, 508 mechanism as evidence for evolution, 11 Hermaphrodite, 658, 1085, 1085f Herpes simplex virus, 344, 531f, 532t Herpes zoster, 529 Hershey-Chase experiment, 258-259, 258f Heterochromatin, 190 Heterochrony, 493 Heterokaryon, 616, 623 Heterotherm, 880 Heterotrimeric G protein, 179, 179f Heterotroph, 123, 139, 559, 634t Heterozygosity, 398 Heterozygote, 225, 227t, 399-400 Heterozygote advantage, 408-409, 409f Hexapoda (class), 679t, 684, 684f, 685t, 686, 686f Hfr cells, 555, 555f Hibernation, 883 High-density lipoprotein (HDL), 54, 1033 Hill, Robin, 151 Hindbrain, 902, 902f, 902t Hinge joint, 967, 968f Hippocampus, 902t, 903, 905 Hippopotamus, 525, 525f Hirudinea (class), 676, 676f Histogram, 232, 233f Histone, 190, 190f, 316-317, 316f HIV. See Human immunodeficiency virus HLA. See Human leukocyte antigen (HLA) H.M.S. Beagle (Darwin’s ship), 1, 1f, 8, 9f, 10, 418 HOBBIT gene, in Arabidopsis, 757-758, 758f Holistic concept, of community, 1186 Holoblastic cleavage, 1110-1111, 1111f, 1111t Holoenzyme, 284f, 285 Holothuroidea (class), 689f Holt-Oram syndrome, 497 Homeobox, 389, 493, 646 Homeodomain, 307, 389 Homeodomain motif, 307 Homeodomain protein, 14, 14f Homeosis, 494
Homeostasis, 14, 305, 876-878, 876f-878f calcium, 952-953, 953f as characteristic of life, 3, 508 Homeotherm, 880 Homeotic genes, 388 complexes, 388-389 in Drosophila, 388, 388f evolution of, 389 in mouse, 388f Homeotic mutants, 388 Hominid, 482f, 722-724, 723f compared to apes, 722 evolution of, 722-724 Hominoid, 722-723, 721f, 722f Homo erectus, 724, 725 Homo floresiensis, 724, 724f Homo (genus), 722, 724 Homo habilis, 724 Homo heidelbergensis, 725 Homo neanderthalensis, 725 Homo sapiens, 723, 724, 725, 726f Homokaryotic hyphae, 616 Homologous chromosomes, 191, 191f, 209-210, 209f Homologous recombination, 555 Homologous structures, 11, 11f, 428, 428f, 464, 465f, 497 Homologue, 191, 211 Homoplasty, 459-460, 460f, 464-465, 465f, 498 Homoptera (order), 684f, 685t Homosporous plant, 596 Homozygote, 225, 227t Honeybee (Apis mellifera) altruism in, 1156, 1156f dance language of, 1146, 1146f Hooke, Robert, 12, 59 Horizontal gene transfer, 483, 483f, 516, 521-522, 522f, 548 Hormonal control of digestive tract, 993, 993f, 994t, 997f of osmoregulatory functions, 1050-1052, 1051f-1052f Hormone, 44, 45t, 169f, 170, 938, 940t-941t. See also specific hormones chemical classes of, 939 female reproductive hormones, 1093t hydrophilic, 939, 942, 942f, 945-946, 945f lipophilic, 939, 942, 942f, 943-945, 943f-944f male reproductive hormones, 1093, 1093t, 1094f plant. See Plant hormone protein, 45t steroid, 173-174, 173f treatment for infertility, 1102 Hormone-activated transcription factor, 944 Hormone response element, 944 Horn (animal), 717 Hornwort, 463f, 589f, 595, 595f Horse, 525, 525f, 865f chromosome number in, 189t evolution of, 414, 414f, 426-428, 426f-427f
eyes of, 501f teeth of, 984f thoroughbred, 414, 414f Horsetail, 189t, 596, 599, 599f, 601t Host range, of virus, 529 Host restriction, 328 Hot mutants, in Arabidopsis, 825 Hotspots, 1259-1261, 1259f-1260f, 1260t population growth in, 1260-1261, 1260f Hox genes, 389, 493, 494, 523f, 524, 639, 646, 756 Hubbard Brook Experimental Forest, 1212-1213, 1213f Human birth weight in, 411, 411f cleavage in, 1112 development in, 1125-1129, 1126f-1128f effect of global warming on, 1252-1253 effect on biosphere, 1245-1250 evolutionary relationships of, 457, 457f extinctions due to in historical time, 1258, 1258t in prehistoric times, 1257-1258, 1257f forebrain of, 903-905, 904f-905f gastrulation in, 1115 genetic map of, 247-248, 248f influence on flower morphology, 850 language of, 1147 plant toxins, susceptibility to, 807-808, 807f sexual differentiation in, 1086 skin of, 918, 918f survivorship curve for, 1170, 1170f-1171f teeth of, 717, 717f Human chorionic gonadotropin (hCG), 1097 Human chromosomes, 189-191, 189-f, 189t, 190f, 241-243 alterations in chromosome number, 250-251, 250f-251f artificial, 356 chromosome number, 189t karyotype, 191f sex chromosomes, 241-243, 241t, 248f Human disease bacterial, 558, 560-563, 561t, 562f effect of global warming on, 1253 flukes, 658-659, 659f fungal, 630 nematodes, 661f, 662-663 viral, 539-541 Human evolution, 402, 457, 457f, 721-726, 721f-726f human races, 726, 726f Human Gene Mutation Database, 250 Human genome, 4 comparative genomics, 474-476, 475f gene swapping in, 484
index
rav32223_Index_I1-I33.indd I-15
I-15
11/25/09 11:54:46 AM
segmental duplication in, 480f-481f, 481 single nucleotide, polymorphisms in, 248 transposable elements in, 484 Human Genome Project, 253, 354, 357-358, 359 Human immunodeficiency virus (HIV), 531, 531f, 532t, 535-538, 1080, 1080f effect on immune system, 535, 1080 evolution of, 470-471, 470f-471f during infection, 537 human effect of, 1080 infection cycle of, 536-537, 536f, 1080 latency period in humans, 535 progression of, 1080 testing for presence, 535 tracking evolution of AIDS among individuals, 471, 471f transmission of, 535 treatment of, 537-538, 537f blocking viral entry, 538 combination therapy, 538 HAART therapy, 538 integrase inhibitors, 538 protease inhibitors, 538 reverse transcriptase inhibitors, 538 vaccine therapy, 538 Human leukocyte antigen (HLA), 1066 Human population in developing and developed countries, 1180-1181, 1180f, 1180t growth of, 1178-1182, 1179f-1181f, 1180t decline in growth rate, 1181 exponential, 1178, 1179f future situation, 1180-1181 in hotspots, 1260-1261, 1260f population pyramids, 1178-1180, 1179f Hummingbird, 852, 853f, 883 Humoral immunity, 1063, 1068-1074, 1069-1074f Humus, 787 Hunchback protein, 386, 386f Huntington disease, 249, 249t, 300, 335, 898 Hyalin, 1108 Hybridization (between species), 222, 437-438, 438f, 440-441 Hybridization (nucleic acid), 332-333, 333f Hybridoma cell, 1078 Hydra, 641t, 652f, 653, 655, 982f, 1022f Hydration shell, 28, 29f Hydrocarbon, 34 in ancient rocks, 547 Hydrochloric acid, gastric, 986, 987 Hydrocortisone, 943f, 954 Hydrogen, 24, 24f
I-16
Hydrogen bond, 23t, 26 in proteins, 48, 48f structure of, 27f in water, 26, 26f Hydrogen ion, 29-30 Hydrogenated oils, 55 Hydrolysis, 37, 37f Hydrophilic hormone, 939, 942, 942f, 945-946, 945f Hydrophilic molecule, 28 Hydrophobic exclusion, 28-29 Hydrophobic interaction, 23t Hydrophobic molecule, 28 Hydroponics, 791, 791f Hydrostatic skeleton, 962, 962f Hydrothermal vent, 1244-1245 Hydroxyapatite, 963 Hydroxyl group, 35, 35f, 43 Hydrozoa (class), 655, 655f Hymen, 1098 Hymenoptera (order), 684f, 685t Hypercholesterolemia, 249t Hyperosmotic solution, 98, 98f Hyperpolarization, 892-893, 893f Hypersensitive response, in plants, 811, 812f Hypersensitivity, delayed, 1076 Hypertension, 1030 Hyperthyroidism, 951 Hypertonic solution, 98, 98f, 1039 Hyperventilation, 1010-1011, 1012 Hyphae, 616, 616f, 617 Hypolimnion, 1239 Hypoosmotic solution, 98, 98f Hypophysectomy, 950 Hypophysis, 946 Hypothalamohypophyseal portal system, 948 Hypothalamus, 876, 882-883, 883f, 905 control of anterior pituitary, 948-949, 948f production of neurohormones, 947 Hypothesis, 5-6, 5f Hypothyroidism, 951 Hypotonic solution, 98, 98f Hyracotherium, 426-428, 426f
I Ichthyosaur, 707t Ichthyosauria (order), 707t Ichthyostega, 704-705, 705f Icosahedron, 530, 530f ICSI. See Intracytoplasmic sperm injection Ileum, 987 Immune system, 875f, 876, 1055-1080 cells of, 1062t effect of HIV on, 1080 organs of, 1064-1065, 1064f-1065f pathogens that invade, 1079-1080, 1080f Immunity active, 1063, 1074f adaptive, 1061-1066, 1061f-1065f, 1062t
cell-mediated, 1063, 1066-1068, 1066t, 1067f, 1069f humoral, 1063, 1068-1074, 1069f-1074f innate, 1056-1058, 1057f, 1068 passive, 1063 Immunoglobulin A (IgA), 1071t, 1072 Immunoglobulin D (IgD), 1071t, 1072 Immunoglobulin E (IgE), 1071t, 1072, 1075, 1076f Immunoglobulin G (IgG), 1071f, 1071t, 1072 Immunoglobulin (Ig), 1063, 1063f. See also Antibody classes of, 1071-1072, 1071t diversity of, 1072-1074 structure of, 1069-1070, 1070f Immunoglobulin M (IgM), 1071-1072, 1071f, 1071t Immunohistochemistry, 61 Immunological tolerance, 1075 Immunosuppression, 1080 Implantation, 1125 Imprinting, 1139 In situ hybridization, 353 In vitro fertilization, 1102 In vitro mutagenesis, 342 Incomplete dominance, 233t, 234, 234f Incomplete flower, 848, 848f Incus, 921 Independent assortment, 214, 229, 229f Indeterminate development, 638, 639f Indian pipe (Hypopitys uniflora), 794, 794f Individualistic concept, of community, 1186 Indoleacetic acid (IAA), 828-829, 829f Indolebutyric acid, 830 Induced fit, 114, 114f Inducer exclusion, 310 Induction (development), 377-378, 377f, 1117 primary, 1124 secondary, 1124, 1125f Induction of phage, 533-534, 534f Induction of protein, 308 Inductive reasoning, 5 Industrial melanism, 420-421, 420f-421f in peppered moth, 420-421, 420f-421f Inert element, 22 Inferior vena cava, 1029 Infertility, 1101 female, 1101 male, 1101 treatment of, 1102 Inflammatory response, 1058-1059, 1060f Influenza, 532t, 539 bird flu, 539 Influenza virus, 529f, 531f, 532t, 539, 1079 H subtypes, 539 H1N1 strain, 1079
H5N1 strain, 539, 1079 N subtypes, 539 origin of new strains, 539-540 recombination in, 539 types and subtypes of, 539 Infrared radiation, sensing of, 934, 934f Ingen-Housz, Jan, 150 Ingression, 1113 Inhalant siphon, 671, 671f Inheritance, patterns of, 221-236 Inhibiting hormone, 948, 949 Inhibition, 1203 Inhibitor, 117 allosteric, 117, 117f competitive, 117, 117f noncompetitive, 117, 117f Inhibitory postsynaptic potential (IPSP), 899, 899f, 900 Initiation complex, 288, 288f, 294, 294f, 313, 313f Initiation factor, 294, 294f Initiator tRNA, 294, 294f Innate behavior, 1133, 1133f Innate releasing mechanism, 1133 Inner cell mass, 1112, 1112f Inner ear, 922, 922f Inorganic phosphate, 113 Inositol phosphate, 180f, 181 Inositol triphosphate (IP3/calcium) second messenger system, 179, 180f, 181, 181f Inositol triphosphate (IP3), 946 Insect, 679t, 684-686, 684f, 685t, 686f Bt crops resistance to, 347-348 chromosome number in, 189t cleavage in, 1110 digestive system of, 686 diversity among, 684f excretory organs in, 1041, 1041f external features of, 684, 685f, 686 eyes of, 414, 414f, 501, 501f, 680, 680f, 681f, 928f fish predation on, 408, 408f hormones in, 956f, 957 internal organization of, 686 locomotion in, 976-977 nitrogenous wastes of, 1044, 1045f orders of, 685t pheromones of, 686 pollination by, 852, 852f-853f respiration in, 1003f selection for pesticide resistance in, 404-405, 405f sense receptors of, 686 sex chromosomes of, 241, 241t social, 1157, 1158f taste in, 926, 926f thermoregulation in, 880, 880f wings of, 498-499, 498f, 684, 686f Insectivore, digestive system of, 991f Insectivorous leaf, 750 Insertion sequence (IS), 555, 555f Insertional inactivation, 330 Instantaneous reaction, 110 Instinct, learning and, 1138, 1138f, 1140, 1140f Insulin, 954-955, 955f, 994-995, 995f, 996
index
rav32223_Index_I1-I33.indd I-16
11/25/09 11:54:46 AM
Insulin-like growth factor, 942, 950 Insulin receptor, 176, 176f Insulin receptor protein, 176 Integral membrane protein, 89, 90f, 94, 95f Integrase inhibitor, 538 Integrin, 81, 81f, 392, 392f Integrin-mediated link, 84 Integument (flower), 602 Integumentary system, 875f, 876 Intelligent design theory, against theory of evolution, 432-433 Intercalated disk, 871, 1027 Interference competition, 1188 Interferon, 1057-1058 Intergovernmental Panel on Climate Change, 795, 1250, 1253 Interior protein network, 90t, 91 Interleukin-1 (IL-1), 1059 Intermediate filament, 76, 76f, 83f, 84 Intermembrane space, of mitochondria, 74 Internal chemoreceptor, 927 Internal fertilization, 1087-1090, 1087f-1090f Internal membranes, of prokaryotes, 554, 554f Internal organs, of vertebrates, 696, 697f International Human Genome Sequencing Consortium, 357 Internet, 183 Interneurons, 873t, 888, 888f Internode, 730f, 744, 744f Interoceptor, 916 Interoparity, 1173 Interphase, 192, 192f, 193-194, 193f-194f Intersexual selection, 1150f, 1151-1152 Interspecific competition, 1188, 1191, 1191f Intertidal region, 1241f, 1243 Intestine, 982f. See also Large intestine; Small intestine Intracellular receptor, 172t, 173-174, 173f Intracytoplasmic sperm injection (ICSI), 1102 Intramembranous development, of bone, 963, 964f, 965 Intramolecular catalysis, 116 Intrasexual selection, 1151, 1152f Intrauterine device (IUD), 1099t, 1100 Intrinsic factor, 987 Introduced species, 1264t, 1269-1271 efforts to combat, 1271 removing, 1276 Intron, 289, 289f, 298t, 320, 321f, 359, 360t, 486 distribution of, 290 Invaginate, 1113 Inversion, 300-301, 301f Invertebrate, 635 circulatory system of, 1022-1023, 1022f digestive system of, 982, 982f
marine, loss of larval stage, 468, 469f osmoregulatory organs of, 1040-1041, 1040f-1041f vision in, 928-929, 928f Iodine, 949 Ion(s), 19 Ion channel, 90t, 96-97, 97f, 171, 172f, 172t, 891 chemically gated, 892 gated, 96, 892, 893f ligand-gated, 892 stimulus-gated, 917, 917f transient receptor potential, 918 voltage-gated, 893, 894f Ionic bond, 23-24, 23f, 23t, 48, 48f Ionic compound, 24 Ionization of water, 29 IP. See Inositol phosphate IP3. See inositol triphosphate IPSP. See Inhibitory postsynaptic potential Irreducible complexity argument, against theory of evolution, 433 IS. See Insertion sequence Island biogeography of, 1226-1227, 1226f evolution on, 431-432, 431f, 444-445, 444f extinctions on, 1258, 1266, 1266f Island biogeography, 1226-1227, 1226f Island dwarfism, 724 Islets of Langerhans, 954-955, 988f, 989 Isocitrate, 132, 133f Isomer, 35 of sugars, 38, 39f Isomotic regulation, 99 Isomotic solution, 98, 98f Isoptera (order), 684f, 685t Isotonic solution, 98, 98f, 1039 Isotope, 19, 19f radioactive, 19, 424, 424f IUD. See Intrauterine device Ivins, Bruce E., 368 Ivy, 744f
J Jacob syndrome, 251 Jasmonic acid, 810 Jaundice, 989 Jaws evolution of, 698, 700, 700f of fish, 699-700, 700f, 1065-1066 Jejunum, 987 Jellyfish, 634t, 636, 641t, 655-656, 655f-656f Jenner, Edward, 344, 1061, 1061f Jimsonweed (Datura stramonium), 852 Joint, 967 movement at, 968, 968f-969f types of, 967, 968f Jointed appendages, of arthropods, 680 Joule, 108 Juvenile glaucoma, 227-228, 227f Juvenile hormone, 957, 957f
K K-selected population, 1177, 1178t KANADI gene, in Arabidopsis, 747f Karyogamy, 622, 623f, 624, 624f Karyotype, 191, 191f human, 191f Kaufmann, Thomas, 389 Keratin, 76, 866 Keratinized epithelium, 866 α-Ketoglutarate, 132, 133f, 141, 141f α-Ketoglutarate dehydrogenase, 133f Kettlewell, Bernard, 420-421 Key innovation, 446 Key stimulus, 1133, 1133f Keystone species, 1201, 1201f loss of, 1272, 1273f Khorana, H. Gobind, 283 Kidney, 956 of amphibians, 1043 of birds, 1043-1044, 1044f excretion in, 1048 filtration in, 1046-1047, 1047f of fish cartilaginous fish, 1043 freshwater fish, 1042, 1043f marine bony fish, 1042, 1043f hormonal regulation of, 1050-1052, 1051f-1052f of mammals, 1043-1044, 1044f, 1045-1050, 1046f-1050f reabsorption in, 1046, 1048, 1049f, 1050-1051, 1051f of reptiles, 1043 secretion in, 1046, 1048 of vertebrates, 1041-1044, 1042f-1044f Killer strain, Paramecium, 579 Killfish (Rivulus hartii), 412-413, 412f Kilocalorie, 108, 995 Kin selection, 1155-1157, 1155f-1156f Kinase cascade, 176-177, 177f, 178 Kinesin, 77, 77f Kinetic energy, 108, 108f Kinetochore, 187f, 191f, 193, 193f, 211, 211f, 216 Kinetoplastid, 574-575, 575f Kingdom (taxonomy), 512, 513f, 514 evolutionary relationships among kingdoms, 517f Kinocilium, 920, 921f Kinorhyncha (phylum), 640, 644f Klinefelter syndrome, 251, 251f Knee-jerk reflex, 908, 908f Knight, T. A., 222 Knockout mice, 342-343, 342f-343f Kölreuter, Josef, 222 Komodo dragon (Varanus komodoensis), 1258-1259 Krebs, Charles, 1177 Krebs cycle, 118, 125, 126f, 130, 131-133, 131f, 133f, 141, 141f ATP production in, 132, 131f, 133f, 138, 138f products of, 133f reductive, 547 Kristensen, Reinhardt, 660 Kurosawa, Eiichi, 832-833
L Labyrinth, 920 lac operon, 308, 309-310, 308f-310f lac repressor, 45t, 309-310, 309f Lacewing (Chrysoperia), courtship song of, 439, 439f Lactation, 1128 Lactic acid fermentation, 140, 140f Lactose, 39 Lactose intolerance, 39, 988 Lacunae, 870 Lagging strand, 267f, 268-269, 269f-270f Lake, 1239-1241, 1239f-1240f eutrophic, 1240-1241, 1240f oligotrophic, 1240, 1240f thermal stratification of, 1239-1240, 1240f Lake Victoria cichlid fish, 449-450, 449f, 1271 Lamarck, Jean-Baptiste, 397 Lamellae, 1005 Lamellipodia, 1113 Lamprey, 698f, 699, 699t Lancelet, 696, 696f Land plants evolution of, 521f, 571, 589-590 innovations in, 597f Langerhans, Paul, 954 Language, 905-906, 906f Large intestine, 983, 983f, 990, 990f Large offspring syndrome, 381 Larva loss in marine invertebrates, 468, 469f of snails, 466-468, 467f-468f Larynx, 985, 985f Latent virus, 529 Lateral geniculate nuclei, 932, 933f Lateral line system, 701, 920, 921f Lateral meristem, 731, 732, 733f Lateral root cap, 739, 739f LDL. See Low-density lipoprotein Leading strand, 267f, 268, 269f-270f, 272f Leaf, 730f, 747-750, 747f-749f, 809, 809f abscission of, 823-824, 823f-824f alternate, 744, 744f of carnivorous plant, 793-794 compound, 748, 748f establishing top and bottom of, 747, 747f evolution of, 596-597, 597f external structure of, 747-748, 747f-748f internal structure of, 748-749, 749f modified, 749-750 opposite, 744, 744f pinnately compound, 748f simple, 748, 748f transpiration of water from. See Transpiration whorled, 744, 744f Leaf-cutter ant, 629, 629f Leaflet, 748
index
rav32223_Index_I1-I33.indd I-17
I-17
11/25/09 11:54:46 AM
LEAFY COTYLEDON gene, in Arabidopsis, 759 LEAFY gene, in Arabidopsis, 841 Learning, 906 behavior and, 1135, 1135f, 1137-1138, 1138f, 1140, 1140f Leber’s hereditary optic neuropathy (LHON), 244 Leech, 641t, 675-676, 676f Leeuwenhoek, Anton van, 12, 59 Leg(s), of amphibians, 703, 704f Leishmaniasis, 488, 574 Lens, 929, 929f Lenticel, 745, 746f Leopard frog (Rana), postzygotic isolation in, 440, 440f Leopold, Aldo, 1221 Lepidoptera (order), 684f, 685t Lepidosauria, 699f Leprosy, 560, 561t Leptin, 996, 996f Lettuce, genome of, 479f Leucine zipper motif, 307, 307f Leukocytes, 870, 1019, 1058 granular, 1019 nongranular, 1019 Lewis, Edward, 388 Lichen, 626-627, 627f as air quality indicators, 627 foliose, 627f fruticose, 627f Life characteristics of, 2-3 hierarchical organization of, 3-4, 3f origin of. See Origin of life science of, 2-4 Life cycle of brown algae, 581f of Chlamydomonas, 591f of fern, 600, 600f of flowering plant, 609f of moss, 594f of Paramecium, 579f of pine, 604-605, 604f of plants, 590, 590f, 608-610, 609f of Plasmodium, 577f of Ulva, 592f Life history, 1171-1173, 1171f-1172f Life table, 1169-1170, 1170t Ligand, 168, 169f Ligand-gated channel, 892 Light, cue to flowering in plants, 842-844, 842f-843f Light chain (polypeptide), 1069, 1070f Light-dependent reactions, of photosynthesis, 148, 149f, 150, 156-160, 156f-160f Light-harvesting complex, 155, 155f, 157 Light-independent reactions, of photosynthesis, 148, 150, 150f Light microscope, 61, 61f, 62t Light-response genes, 815-816, 815f-816f Lignin, 736 Lily, 851f Limb bud, 497
I-18
Limb, development of, 497-498, 497f Limbic system, 900, 902t, 905 LINE. See Long interspersed element Lineus, 642t, 503, 672, 672f Linkage disequilibrium, 361 Linkage map. See Genetic map Linnaeus, Carolus, 512 Lion (Panthera leo), 438, 438f, 984f Lipase, 988 Lipid(s), 33, 36f, 37, 53-56. See also Phospholipid functions of, 37t, 53-56 membrane, 548, 549f structure of, 53-56 Lipid bilayer, 56, 56f Lipid raft, 91 Lipophilic hormone, 939, 942, 942f, 943-945, 943f-944f Lipopolysaccharide, 553, 553f, 1056 Little paradise kingfisher (Tanysiptera hydrocharis), 444, 444f Liver, 988f, 989, 994 Liverwort, 463f, 589f, 590, 593, 593f Lizard, 699f, 707t, 711, 711f Llama, 525 Lobe-finned fish, 698f, 699t, 702, 702f, 704f Lobster, 682, 683, 683f Local anaphylaxis, 1075 Locomotion, 639, 975-977 in air, 976-977, 977f appendicular, 975 axial, 975 on land, 976, 976f in water, 975-976, 975f Locomotor organelles, of protists, 572 Logarithmic scale, 29 Long-day plant, 842-843, 842f facultative, 843 obligate, 843 Long interspersed element (LINE), 360, 361f Long-term depression (LTD), 906, 907f Long-term memory, 906 Long-term potentiation (LTP), 906, 907f Long terminal repeat (LTR), 360-361, 361f Loop of Henle, 1044, 1047, 1047f, 1048-1049 Loose connective tissue, 868, 868f, 869t Lophophore, 523f, 642t, 643, 676-678, 677f-678f Lophotrochozoan, 523-524, 523f, 643, 644f, 669 Lorenz, Konrad, 1139, 1139f, 1146 Loricifera (phylum), 642t, 644f Low-density lipoprotein (LDL), 54, 103, 320-321, 1033 LTP. See Long-term potentiation LTR. See Long terminal repeat Lubber grasshopper (Romalea guttata), 684f Lumen, of endoplasmic reticulum, 69 Luna moth (Actias luna), 684f
Lung(s), 1006-1008, 1007f-1009f of amphibians, 703, 1007, 1007f of birds, 1008, 1009f of mammals, 1007-1008, 1008f of reptiles, 1007 structure and function of, 1009, 1010f Lung cancer, 1012, 1012f smoking and, 1012 Luteinizing hormone (LH), 948, 950, 1093, 1093t, 1094f Lycophyta (phylum), 589f, 596, 597, 597f, 598, 598f, 601t Lyme disease, 560, 561t Lymph, 1032 Lymph heart, 1032 Lymphatic system, 875f, 876, 1032-1033, 1032f Lymphocyte, 1063, 1063f, 1064, 1065f Lysenko, T. D., 844 Lysogenic cycle, of bacteriophage, 533-534, 534f Lysogeny, 533 Lysosomal storage disorder, 71 Lysosome, 71-72, 72f, 78t, 81t Lysozyme, 1056 Lytic cycle, of bacteriophage, 258, 533, 534f
M M phase. See Mitosis M-phase-promoting factor (MPF), 198-199, 199f, 200, 200f, 201 MacArthur, Robert, 1190, 1226 macho-1 gene, 377, 378, 378f MacLeod, Colin, 257 Macrogymus, 620 Macromolecule, 2f, 33, 36f, 37, 37f, 37t Macronucleus, 578, 578f Macronutrients, in plants, 790-791, 790t Macrophage, 1058, 1058f Madreporite, 689 MADS-box genes, 389, 493, 494, 499, 500, 500f Magnetic field, sensing of, 934 Maidenhair tree (Ginkgo biloba), 605f, 606 Maize. See Corn (Zea mays) Major groove, 262f, 305-306, 306f Major histocompatibility complex (MHC), 1064, 1065f MHC class I protein, 1066, 1066t MHC class II protein, 1066, 1066t MHC proteins, 45t, 82-83, 1066 Malaria, 577-578, 577f, 808, 1253 drug development, 487-488, 488f eradication of, 577 genome of, 475f sickle cell anemia and, 250, 409, 409f vaccine for, 578, 1079
Malate, 132, 133f Male infertility, 1101 Male reproduction, hormonal control of, 1093t Male reproductive system, 875f, 876, 1091-1094, 1091f-1094f, 1093t Malleus, 921 Malpighian tubule, 679f, 680f, 681 MALT. See Mucosa-associated lymphoid tissue Malthus, Thomas, 10 Maltose, 39, 39f Mammal, 641t, 698f, 716-720, 716f-719f brain of, 903, 903f characteristics of, 716-718, 716f-717f circulatory system of, 1025, 1025f classification of, 718-719, 718f cleavage in, 1112, 1112f digestion of plants by, 717 egg-laying. See Monotreme evolution of, 525f, 697, 698f, 718, 718f extinctions, 718t flying, 717-718, 717f gastrulation in, 1115, 1115f kidney of, 1043-1044, 1044f, 1045-1050, 1046f-1050f lungs of, 1007-1008, 1008f marine, 720t nitrogenous wastes of, 1044, 1045f nuclear transplant in, 380-381, 381f orders of, 720t placental. See Placental mammal pouched. See Marsupial reproduction in, 1090f respiration in, 1003f, 1007-1008, 1008f saber-toothed, 465f thermoregulation in, 716 Mammalia (class), 513f, 698f, 716-720, 716f-719f Mammary gland, 716 Manatee, 430 Mandible, of crustaceans, 678-679, 679t Mangold, Hilde, 1122 Mangrove, 780-781, 781f Mangrove swamp, 1243, 1248 Mannose-binding lectin (MBL) protein, 1057, 1060 Mantle, 667, 668f Mantle cavity, 1004 MAP kinase. See Mitogen-activated protein kinase Marine habitat, 1241-1245, 1241f-1244f human impacts on, 1247-1248, 1248f Markers, cell, 63 Markov, Georgi, 808 Marler, Peter, 1140 Marrow cavity, 966 Mars, life on, 509, 509f Marsilea, 600
index
rav32223_Index_I1-I33.indd I-18
11/25/09 11:54:46 AM
Marsupial, 525f, 719, 719f, 1090, 1090f, 1098 marsupial-placental convergence, 430-431, 431f saber-toothed, 465f Mass extinction, 452-453, 452f Mast cell, 1062, 1062t Mastication, 967, 982, 984 Mastiff, 423f Maternal inheritance, 244 Maternity plant, 858 Mating assortative, 402 disassortative, 402 nonrandom, 401f, 402 See also Courtship entries Mating behavior, 439, 439f selection acting on, 443, 443f sexual selection and, 1151-1152, 1151f-1152f Mating ritual, 439 Mating success, 405 Mating system, 1153-1154, 1153f Mating type, in fungi, 177 Matrix extracellular. See Extracellular matrix of mitochondria, 74 Matter, 18 Mauna kea silversword (Argyroxiphium sandwicense), 1259, 1259f Mayr, Ernst, 437 Mccarty, Maclyn, 257 McClintock, Barbara, 245-246, 245f, 360, 480 MCS. See Multiple cloning site Measles, 532t Mechanical isolation, 438t, 439-440 Mechanoreceptor, 916, 917-919, 918f-919f Mediator, 314-315, 315f Medicago truncatula, 479, 479f, 483f, 489 genome of, 479f Medicine antibodies in medical treatment, 1077-1079, 1078f applications of genetic engineering, 343-345, 344f, 345t applications of genomics to, 368, 368t, 487-488, 488f Medulla oblongata, 902, 902t Medullary bone, 965f, 966 Medullary cavity, 965f, 966 Medusa, 653, 653f, 655, 655f Meerkat (Suricata suricata), 1158, 1159f Megakaryocyte, 1021 Megapascal, 770 Megaphyll, 747 Meiosis, 208-218, 208f compared to mitosis, 215-218, 216f-217f errors in, 214 sequence of events during, 209-214, 208f-213f
Meiosis I, 209-210, 209f, 211f, 212f, 216, 216f, 217f Meiosis II, 209-210, 209f, 213f, 214 Meissner corpuscle, 918f Melanin, 951 Melanocyte-stimulating hormone (MSH), 948, 951, 997 Melanotropin-inhibiting hormone (MIH), 949 Melatonin, 956 Membrane(s), 88-104. See also specific membranes Membrane attack complex, 1060, 1060f Membrane potential, 97, 890-891 Memory, 906 long-term, 906 short-term, 906 Mendel, Gregor, 11, 301, 399 experiments with garden pea 222-229, 222f-229f experimental design, 223 portrait of, 223f rediscovery of ideas, 232 Mendeleev, Dmitri, 22 Mendelian ratio, 225 modified, 236, 236f Meninges, 907 Menstrual cycle, 1095-1097, 1095f-1096f follicular (proliferative) phase, 1095-1096, 1095f luteal phase, 1095f, 1097 menstrual phase, 1097 ovulation, 1095f, 1096-1097, 1096f secretory phase, 1097 Menstruation, 1090 Mercury pollution, 1246 Mereschkowsky, Konstantin, 568-569 Meristem, 374-375, 731-732, 731f apical, 731, 732, 732f-733f, 832f floral, 846, 846f-847f ground, 732, 733f, 741, 758 lateral, 731, 732, 733f primary, 732, 758 Merkel cells, 918f, 919 Meroblastic cleavage, 1111-1112, 1111t, 1112f Merodiploid, 556 Meselson-Stahl experiment, 264-265, 264f Mesencephalon. See Midbrain Mesenchyme, 963 Mesoderm, 637, 637f, 864, 1113, 1113f Mesoglea, 653, 653f Mesohyl, 651 Mesophyll, 748-749 palisade, 749, 749f spongy, 749, 749f Messenger RNA (mRNA), 42, 69, 281. See also Primary transcript degradation of, 321 5 cap, 288, 288f making cDNA library, 332, 332f mature, 288
poly-A tail of, 289, 289f posttranscriptional control in eukaryotes, 317-321, 318f-319f, 321f pre-mRNA splicing, 289-291, 290, 290f translation. See Translation transport from nucleus, 321, 322f Metabolic rate, 995 Metabolism, 117, 508 biochemical pathways, 118-119, 118f evolution of, 142-143 in prokaryotes, 559-560 Metamorphosis, 384, 384f Metaphase meiosis I, 211, 211f, 212f, 216f meiosis II, 213f, 214, 217f mitotic, 192f, 195f, 196, 196f, 197f, 216f Metaphase plate, 195f, 196, 211, 211f Metazoa, 640, 644f Metazoan, origin of, 645 Methane, 139, 1209, 1251 Methanococcus, 550f Methanogen, 139, 516, 517f Methicilin-resistant Staphylococcus aureus (MRSA), 559 Methyl group, 35f Methylation of DNA, 252, 316, 316f of histones, 316 MHC. See Major histocompatibility complex Micelle, 56, 56f Micro-RNA (miRNA), 281, 318-319, 319f, 320, 360, 360t Microarray DNA, 364, 365f protein, 367 Microbe-associated molecular pattern (MAMP), 1056 Microbody, 72, 78t Microclimate, 1235 Microfilament, 76 Microfossil, 546, 546f Micrognathozoa, 642t, 643, 644f Micronucleus, 578, 578f Micronutrients, in plants, 790-791, 790t Microorganism, 1056 Microphyll, 747 Micropyle, 604, 604f, 605, 608f Microscope, 59-61 invention of, 59 resolution of, 60 types of, 61, 62t Microsporidia, 615, 615f, 618-619, 618f Microtubule-organizing centers, 76 Microtubule(s), 76, 76f, 80, 81t, 188f kinetochore, 188f, 193, 193f spindle, 188f Microvilli, 866, 987-988, 988f Midbrain, 902f, 902t, 903 Middle ear, 921, 921f Middle lamella, 80, 80f, 198 Miescher, Friedrich, 259
Migration, 1142-1143, 1142f-1143f of birds, 1142-1143, 1143f, 1252 of monarch butterfly, 1142, 1142f orientation and, 1142-1144, 1142f-1143f MIH. See Melanotropin-inhibiting hormone Milk, 1128 Milk let-down reflex, 1128 Milk snake (Lampropeltis triangulum), geographic variation in, 437f Milk sugar, 39 Miller, Stanley L., 509 Miller-Urey experiment, 509-510, 510f Millipede, 641t, 679t, 686-687, 687f Mimicry Batesian, 1195, 1195f, 1196 Müllerian, 1195-1196, 1195f Mineral(s) absorption by plants, 771f, 773-775, 774f-775f in plants, 790t, 791, 791f in soil, 787-788, 787f transport in plants, 770-783 Minimal medium, 558 Miracidium, 658, 659f miRNA. See Micro-RNA Missense mutation, 299, 300f Mite, 678, 682 Mitochondria, 73-75, 74, 74f, 78t, 81t, 126f, 136f, 162f, 518t division of, 74 DNA of, 74 genome of, 364 maternal inheritance, 244 origin of, 75, 75f, 517, 517f, 568-569, 569f ribosomes of, 74f Mitogen-activated protein (MAP) kinase, 176-177, 177f, 178, 182-183, 202, 203f Mitosis, 189, 192, 192f, 193-194, 193f-194f compared to meiosis, 215-218, 216f-217f evolution of, 570 in fungi, 616-618 Mitral valve, 1026 Mobile genetic elements, 360 Model building, 7 Molar concentration, 29 Mole, 29 Molecular biology, 4 central dogma of, 280, 280f Molecular clock, 461 Molecular cloning, 330, 558. See also Cloning Molecular formula, 24 Molecular hybridization, 332-333, 333f Molecular motor, 77, 77f, 79 Molecular record, evidence for evolution, 11-12, 11f Molecule, 2f, 3, 23, 24 Mollicutes, 64
index
rav32223_Index_I1-I33.indd I-19
I-19
11/25/09 11:54:46 AM
Mollusca (phylum), 641t, 643, 644f, 666-672, 667f-672f Mollusk, 523f, 641t, 643, 644f, 666-672, 667f-672f body plan of, 667-668, 668f circulatory system of, 669 classes of, 670-672 diversity among, 667, 667f economic significance of, 667 evolution of, 667 excretion in, 669 eye of, 429, 429f, 501, 501f, 928f, 929 feeding an prey capture in, 668-669, 669f locomotion in, 976 nervous system of, 901f reproduction in, 669, 669f shell of, 668 Molting, in arthropods, 680 Molting hormone, 957 Monarch butterfly (Danaus plexippus), migration of, 1142, 1142f Monoamine oxidase-A (MAOA), 1137, 1141 Monoamine oxidase (MAO), 1137 Monoclonal antibody, 1077-1078, 1078f Monocot, 607f, 608 leaves of, 741f, 748, 748f, 749 Monocyte, 1062, 1062t Monoecious plant, 855 Monogamy, 1153 Monohybrid cross, 224-228, 226f, 230-231 Monokaryotic hyphae, 616, 622-623 Monomer, 36f, 37 Mononucleosis, 532t Monophyletic group, 461-462, 462f, 464 MONOPTEROS gene, in Arabidopsis, 758, 758f Monosaccharide, 38, 38f, 39f Monosomy, 189, 250 Monotreme, 525f, 718-719, 719f, 1090 Monsoon, 1234 Moon snail, 669 Morgan, Thomas Hunt, 240, 245, 246, 301, 354 Morning after pill (birth control), 1100 Morphine, 805, 806t Morphogen, 386, 384, 385f, 386-387, 386f-387f, 1110, 1122 Morphogenesis, 373, 390-393, 391f-393f in plants, 392-393, 393f, 759, 759f Morphology, adaptation to environmental change, 1163, 1163f Mortality, 1169 Mortality rate, 1169 Mosquito, 189t, 358f, 475f, 577-578, 577f, 684, 686f Moss, 463f, 589f, 590, 594-595, 594f-595f Moth, 853f, 880, 880f Motif, protein, 50, 50f
I-20
Motor effector, 888 Motor neurons, 873t, 888, 888f Motor protein, 77, 77f, 194, 971 Motor unit, 973, 973f Mouse (Mus musculus) behavioral genetics in, in 1136, 1136f Brachyury gene mutation in, 496 chromosome number in, 189t coat color in, 404, 404f embryo of, 694f eye development in, 502, 502f genome of, 475f, 476, 487 homeotic genes in, 388f knockout, 342-343, 342f, 343f marsupial, 431f ob gene in, 996, 996f Mouth, 984-985, 985f Mouthparts of arthropods, 679t of insects, 684, 685f MPF. See M-phase-promoting factor mRNA. See Messenger RNA MRSA, 559 MSH. See Melanocyte-stimulating hormone Mucosa-associated lymphoid tissue (MALT), 1064, 1064f, 1065, 1065f Mucosa, of gastrointestinal tract, 983, 983f Mucus, 1056 Müller, Fritz, 1195 Müllerian mimicry, 1195-1196, 1195f Multicellular organism, 518t cell cycle control in, 201-202, 202f Multicellularity in animals, 634t in eukaryotes, 519 in protists, 572 Multidrug-resistant strains, 560-561 Multienzyme complex, 115-116, 115f, 130 Multigene family, 359 Multiple cloning site (MCS), 330 Multipotent stem cells, 379 Muscle lactic acid accumulation in, 140, 140f metabolism during rest and exercise, 974-975 organization of, 969f Muscle contraction, 969-975, 969f-974f sliding filament model of, 969-971, 970f-971f Muscle fatigue, 975 Muscle fiber, 871, 970f fast-twitch (type II), 974, 974f slow-twitch (type I), 974, 974f types of, 973-974 Muscle spindle, 919, 919f Muscle tissue, 864, 864f, 870-872, 871t, 872f Muscular dystrophy Duchenne, 227t, 249t gene therapy for, 345 Muscular system, 874f
Muscularis, of gastrointestinal tract, 983, 983f Musculoskeletal system, 873, 961-977 Mushroom, 614, 614f, 615t, 616, 617, 617f, 623, 623f Mussel, 667, 671 Mutagen, 273 Mutation cancer and, 203f evolution and, 401, 401f, 406 interactions among evolutionary forces, 406-407, 407f, 495-496 kinds of, 299-301, 299f-301f in prokaryotes, 558-559 Mutualism, 564, 626, 1197f-1198f, 1198 coevolution and, 1198 fungal-animal, 628-629, 629f Mutually exclusive events, 230 Mycellium, 616, 616f primary, 622 secondary, 623 Mycobacterium tuberculosis, 560-561, 561t evasion of immune system, 1079-1080 multidrug-resistant strains, 560-561 Mycoplasma, 64 Mycorrhizae, 593, 627-628, 628f, 793 arbuscular, 622, 628, 628f ectomycorrhizae, 628, 628f Myelin sheath, 872, 890, 890f Myofibril, 871, 969, 969f Myofilament, 969, 969f Myoglobin, 974, 1014 Myosin, 44, 45t, 79, 970, 970f, 971. See also Thick myofilament Myriapoda (class), 679t, 686-687 Myriapods, 687f
N NAA. See Naphthalene acetic acid NAD+, 44, 123-124, 123f as electron acceptor, 124, 125f regeneration of, 129-130, 129f NADH, 123 in ATP yield, 137, 137f contributing electrons to electron transport chain, 132, 133f, 135 as electron acceptor, 124, 125f from glycolysis, 126f, 127, 127f inhibition of pyruvate dehydrogenase, 138, 138f from Krebs cycle, 131-132, 131f in photosynthesis, 148, 149f, 151, 156-160, 158f-159f from pyruvate oxidation, 130, 130f recycling into NAD, 129-130, 129f structure of, 125f NADH dehydrogenase, 134, 134f NADP reductase, 158, 159f Nanog gene, 382 nanos gene, 384, 385f, 386
Naphthalene acetic acid (NAA), 830 National Center for Biotechnology Information (NCBI), 355 Native lymphocyte, 1063 Natriuretic hormone, 1035 Natural killer (NK) cell, 1058, 1059f, 1062t Natural selection, 8, 10, 397, 403 adaptation to environmental conditions, 1164 ecological species concept and, 441 evidence of, 418-421, 418f-421f evolution and, 9, 10, 404, 433 experimental studies of, 411-413, 412f-413f invention of theory of, 9-11 maintenance of variation in populations, 407-409, 408f-409f in speciation, 443 testing predictions of, 10-12 Nauplius larva, 682-683, 683f Neanderthals, 725 Nearsightedness, 929f Nectar, 608 Nectary, 608 Negative feedback loop, 876, 877f, 949, 949f, 1175 Negative gravitropism, 819f, 820 Negative pressure breathing, 1007 Negative-strand virus, 531 Neisseria gonorrhoeae, 561t, 562, 562f, 1080 Nematocyst, 641t, 652f, 653-654 Nematoda (phylum), 641t, 643, 644, 645f, 661-663, 662f Nematode, 523f, 644-645. See also Caenorhabditis elegans circulatory system of, 1022f digestive system of, 982, 982f eaten by fungi, 617, 617f, 618 plant parasites, 803-804, 803f-804f Nemertea (phylum), 642t, 644f, 672-673, 672f Neocallimastigo mycetes, 619, 620, 628-629 Neocallimastix, 620 Neocallismastigo mycota (phylum), 615, 615f, 620 Neodermata (class), 658 Neonate, 1128 Neotyphodium, 626, 626f Nephridia, 669, 673f, 674, 1040, 1041f Nephrogenic diabetes insipidus, 98 Nephron, 1042, 1042f, 1046-1048 organization of, 1042f structure and filtration, 1046-1048, 1047f transport processes in, 1048-1050, 1049f-1050f Nephrostome, 669, 1040 Neritic waters, 1241f, 1242 Nerve, stimulation of muscle contraction, 972-973, 972f-973f Nerve cord, dorsal, 694, 694f, 695f
index
rav32223_Index_I1-I33.indd I-20
11/25/09 11:54:46 AM
Nerve growth factor, 942 Nerve tissue, 871t, 872, 873t Nervous system, 518t, 873, 874f, 887-912 of arthropods, 680, 680f, 901f, 902 central, 872, 901-909, 901f-908f of cnidarians, 901-902, 901f of earthworms, 901f, 902 of echinoderms, 901f of flatworms, 657f, 658, 901f, 902 of mollusks, 901f neurons and supporting cells, 889-890, 889f-890f peripheral, 872, 888, 909-912, 909f-912f, 909t, 911t Net primary productivity, 1215 Neural crest, 696, 1119-1121, 1119f-1121f Neural groove, 1118, 1119f Neural plate, 1118 Neural tube, 1119, 1119f Neuroendocrine reflex, 947 Neurofilament, 76 Neuroglia, 872, 889 Neurohormone, 938-939, 947 Neurohypophysis, 946 Neuromuscular junction, 897, 898f, 973, 973f Neuron, 872, 889-890, 889f-890f. See also specific types of neurons Neuropeptide, 899 Neuropeptide Y, 997 Neurospora Beadle and Tatum’s experiment with, 279-280, 279f chromosome number in, 189t nutritional mutants in, 279-280 Neurotransmitter, 169f, 170, 896-899, 897f, 898f in behavior, 1134 drug addiction and, 900-901, 900f Neurotropin, 942 Neurulation, 392, 1118-1119, 1119f Neutron, 18, 19f Neutrophil, 1058, 1062, 1062t New World monkey, 721, 721f New York City, watersheds of, 1262-1263, 1263f New Zealand alpine buttercup, 450-451, 450f Newton, Sir Isaac, 5, 7 Niche, 1188 competition for niche occupancy, 1188, 1188f fundamental, 1188, 1188f niche overlap and coexistence, 1189-1190 realized, 1188, 1188f restrictions, 188-1189 Nicolson, Garth J., 89 Nicotinamide adenine dinucleotide. See NAD+ Nicotinamide monophosphate. See NMP Nicotine, 900-901 Nicotine receptor, 900
Nile perch, 1271, 1271f Nirenberg, Marshall, 283 Nitric oxide as neurotransmitter, 899 regulation of blood pressure flow by, 1035 Nitrification, 1211 Nitrogen electron energy levels for, 23f in plants, 792, 792f, 797 Nitrogen cycle, 1210-1211, 1211f Nitrogen fixation, 563 evolution from, 143 in nitrogen cycle, 1211, 1211f in plants, 792, 792f Nitrogenous base, 42, 42f, 259-260, 259f tautomeric forms of, 261 Nitrogenous wastes, 1044, 1045f, 1211 Nitrous oxide, 1251 NMP, 124 No-name virus, 540 Noble gas, 22 Nocieptor, 918 Node (plant stem), 730f, 744, 744f Nodes of Ranvier, 872, 889f, 890 Nodule (plant), 792, 792f Noncompetitive inhibitor, 117, 117f Noncyclic photophosphorylation, 157-158, 158f Nondisjunction, 250-251, 250f-250f involving autosomes, 250-252, 250f involving sex chromosomes, 251, 251f Nonequilibrium state, living systems in, 14 Nonextreme archaebacteria, 516 Nongranular leukocytes, 1019 Nonpolar covalent bond, 24-25 Nonpolar molecule, 28-29 Nonrandom mating, 401f, 402 Nonsense mutation, 299, 300f Nonspecific repair mechanism, 274-275, 274f Nonsteroidal anti-inflammatory drug (NSAID), 943, 1075 Nonvertebrate chordate, 695-696, 695f-696f Norepinephrine, 899 Normal distribution, 232, 233f Northern blot, 335 Northern elephant seal, 403, 403f Norwalk virus, 349 Notochord, 497, 497f, 641t, 694, 694f, 695f, 1118 NSAID. See Nonsteroidal antiinflammatory drug Nucellus, 604, 604f, 608f Nuclear envelope, 62, 65, 68, 68f, 188f, 194f, 195 Nuclear lamins, 68, 68f Nuclear pore, 65, 68f Nuclear receptor, 174 Nuclear receptor superfamily, 174 Nuclear reprogramming, 380, 382, 382f
Nucleic acids, 33, 37, 42, 259. See also DNA; RNA functions of, 37t structure of, 36f, 41-44, 42f viruses and, 529, 529f Nuclein, 259 Nucleoid, 62, 63f, 187, 548 Nucleoid region, 554 Nucleolus, 65, 68, 68f, 78t Nucleosome, 190, 190f, 316 Nucleotide, 13, 37t, 42, 42f, 259, 259f numbering carbon atoms in, 259-260, 259f Nucleotide oligerization domain (NOD)-like receptor (NLR), 1057 Nucleus, cellular, 65-68, 66f, 68f, 78t, 82t origin of, 568, 568f transplantation of in amphibians, 380 cloning of animals, 380f, 381, 381f transport of RNA out of, 321, 322f Nudibranch, 670-671, 670f Nüsslein-Volhard, Christiane, 384 Nutrient essential, 997-998, 998t fungi obtaining nutrients, 614, 617-618, 617f limiting, 1212 plant, 790-792, 790t, 791f Nutrition, 518t Nutritional deficiencies, in fish, 699 Nutritional mutants, in Neurospora, 279-280, 279f Nutritional mutations, 279 Nutritional strategies, in protists, 572
O Oak (Quercus), 738, 841f ob gene, in mice, 996, 996f Obesity, 995 Obligate symbiosis, 626 Ocean oligotrophic, 1242, 1242f open, 1242 Ocean circulation, 1233-1235, 1233f Ocelli, 680, 680f Ocipital lobe, 904, 904f Octet rule, 22, 23f, 24 Octopus, 641t, 667, 668, 671-672, 671f Odonata (order), 685t Offspring number of, 1172, 1172f parent-offspring interactions, 1139-1140, 1139f parental investment per offspring, 1172-1173, 1172f size of each, 1172, 1172f Oil (fossil fuel), 1208f, 1209 clean up of oil spill, 564 oil-degrading bacteria, 564 Oil gland, 866, 1056 Oils (plants), 53, 55, 805 in corn kernels, 422
Okazaki fragment, 268-269, 269f, 270f Old World monkey, 721, 721f Olfaction, 926 Olfactory receptor genes, 482 Oligodendrocyte, 890 Oligosaccharin, 826t, 834-835 Oligotrophic lake, 1240, 1240f Oligotrophic ocean, 1242, 1242f Ommatidia, 680, 681f phenotypic variation in, 414, 414f Omnivore, 982, 984f On the Origin of Species (Darwin), 8, 10, 397 Oncogene, 175, 203 One-gene/one-enzyme hypothesis, 6, 280 One-gene/one-polypeptide hypothesis, 6, 280 Onychophora (phylum), 640, 642t, 645f Oocyte primary, 1095, 1096f secondary, 1096, 1096f Oogenesis, 1096f Oomycete, 580, 581-582 Open circulatory system, 638, 1022f, 1023 Open reading frame (ORF), 359 Operant conditioning, 1138 Operator, 308 Opercular cavity, 1004, 1004f Operculum, 702 Operon, 286 Ophiuroidea (class), 689f, 690 Opisthosoma, 681 Opossum, 189t Opportunistic infections, 535 Opposite leaf, 744, 744f Optic tectum, 903 Optimal foraging theory, 1148 Optimum pH, 116, 116f Optimum temperature, 116, 116f Oral contraceptives, 1099f, 1099t, 1100 risk involved with, 1100 Oral surface, 688 Orangutan (Pongo), 457, 457f, 482f Orbital of electron, 19, 19f Orchid, 849, 849f Order (taxonomic), 512, 513f, 514 Ordered complexity, as characteristic of life, 2-3 Organ, 2f, 3, 864, 864f Organ system, 3f, 3, 864, 864f, 874f Organelle, 2f, 3, 62, 65, 78t, 81t Organic compound, 22-23 fermentation use of, 139-140, 140f Organic matter, in soil, 787, 787f Organism, 3-4, 3f Organizer, 1122-1125 Organogenesis, 1106t, 1116-1121, 1117f-1121f oriC site, 266, 271 Orientation, migratory behavior and, 1142-1144, 1142f-1143f
index
rav32223_Index_I1-I33.indd I-21
I-21
11/25/09 11:54:46 AM
Origin of life 508-510, 508f-511f deep in Earth’s crust, 509 extraterrestrial, 508-509, 509f Miller-Urey experiment, 509-510, 510f Origin of replication, 266, 266f, 271, 330 Ornithischia (order), 707t Orthoptera (order), 684f, 685t Oscillating selection, 408 Osculum, 650f, 651 Osmoconformer, 1039 Osmolarity, 1038-1040, 1039, 1039f Osmoregulator, 1039-1040 Osmoregulatory functions, of hormones, 1050-1052, 1051f-1052f Osmoregulatory organs, 1040-1041, 1040f-1041f Osmosis, 98, 98f, 104t, 770-771 Osmotic balance, 99, 1038-1040, 1039f Osmotic concentration, 98, 98f Osmotic potential. See Solute potential Osmotic pressure, 98, 99f, 1039 Osmotic protein, 45t Ossicle, 688 Osteoblast, 963 Osteocyte, 870 Osteoporosis, 967 Ostracoderm, 699t, 700 Otolith, 920 Outcrossing, 851, 855-856, 855f Outer bark, 745 Outer ear, 921 Outgroup, 458-459 Outgroup comparison, 458 Ovary (plant), 608, 608f, 848f, 849 Overexploitation, 1264t, 1268-1269 Oviduct. See Fallopian tube Oviparity, 1087 Ovoviviparity, 1087 Ovulation, 950, 1095f, 1096-1097, 1096f, 1100 Ovule, 602, 603f, 848f, 849 Oxaloacetate, 131, 132, 133f Oxidation, 21, 109, 109f, 123, 123f without oxygen, 139-140, 139f Oxidation-reduction (redox) reaction, 109, 109f, 123-124, 123f Oxidative phosphorylation, 126, 126f Oxygen atomic structure of, 19f, 24f in freshwater ecosystem, 1239 oxidation without, 139-140, 139f partial pressure, 1006-1007 from photosynthesis, 143 transport in blood, 1002-1015, 1003f, 1013f-1015f Oxygenic photosynthesis, 148 Oxyhemoglobin, 1013-1014, 1013f
I-22
Oxytocin, 947, 1093t Oyster, 641t, 667 evolution of, 426 Ozone depletion, 1248-1249, 1249f Ozone hole, 273, 1248-1250, 1249f
P P53 gene, 202-203, 203f P53 protein, 203, 203f Paal, Arpad, 827 Pacific giant octopus (Octopus dofleini ), 672f Pacific yew (Taxus brevifolia), 806t, 808 Pacinian corpuscle, 918f Pain receptor, 918 Pair-rule genes, 385f, 387 Paired appendages, of fish, 699 Paired-like homeodomain transcription factor 1(pitx1), 497-498 paleoAP3 gene, in plants, 499-500, 499f Paleopolyploid, 477 Palila, 1270f Palindrome, 328 Palisade mesophyll, 749, 749f Pancreas, 988-989, 988f secretions of, 988-989 Pancreatic amylase, 988 Pancreatic duct, 988, 988f Pancreatic hormone, 954-955, 955f Pancreatic juice, 983 Panspermia, 508 Pantothenic acid. See Vitamin B-complex vitamins Papermaking, 738 Parabasalids, 570f, 572-573, 573f Paracrine regulator, 938, 942-943 Paracrine signaling, 169, 169f, 170 Paramecium, 80f, 99, 578, 578f competitive exclusion among species of, 1189-1190, 1189f killer strains of, 579 life cycle of, 579f predation by Didinium, 1192, 1192f Paramylon granule, 574f Paraphyletic group, 462, 462f, 464, 464f Parapodia, 674 Parasite, 626 effect on competition, 1200 external, 1199, 1199f internal, 1199 manipulation of host behavior, 1199, 1199f Parasitic plant, 794, 794f Parasitic root, 742, 743f Parasitism, 564, 574, 1196, 1197f, 1198-1199, 1199f Parasitoid, 1199, 1199f Parasitoid wasp, 809, 809f
Parasympathetic division, 910, 911f, 911t Parasympathetic nervous system, 888, 889f, 910 Parathyroid hormone (PTH), 953, 953f Paratyphoid fever, 560 Parazoa, 640, 644f, 650-651, 650f Parenchyma cells, 736, 736f, 738, 741 Parent-offspring interactions, 1139-1140, 1139f Parental investment, 1150 Parietal cells, 986, 986f Parietal lobe, 904, 904f Parietal pleural membrane, 1009 Parsimony, principle of, 459-460, 460f Parthenogenesis, 1085 Partial diploid, 556 Partial pressure, 1006-1007 Passeriformes (order), 713t, 715, 715f Passive immunity, 1063 Passive transport, across plasma membrane, 96-99, 104t Pasteur, Louis, 6, 1061 Pathogen, 626 avirulent, 811 that invade immune system, 1079-1080, 1080f Pathogen-associated molecular pattern (PAMP), 1056 Pattern formation, 373, 383-389, 384f-388f in Drosophila, 383-389, 384f-388f in plants, 389 Pattern recognition receptor (PFF), 1056 Pauling, Linus, 48 Pavlov, Ivan, 1137 Pavlovian conditioning, 1137 Pax6 gene, 502-504, 502f-503f PCNA. See Platelet-derived growth factor PCNA. See Proliferating cell nuclear antigen PCR. See Polymerase chain reaction Peat moss (Sphagnum), 594-595 Pedigree analysis, 227, 227f, 242-243, 242f, 252 Pedipalp, 681 Peer review, 8 Pellicle, 574, 574f, 578, 578f Pelvic inflammatory disease (PID), 563 Pelycosaur, 708, 708f Penguin, 1089f Penicillin, 64, 70, 553 Penicillium, 624 Penis, 1091, 1093, 1093f Pentaradial symmetry, 687 Peppered moth (Biston betularia), industrial melanism and, 420-421, 420f-421f Pepsin, 986 Pepsinogen, 986 Peptic ulcer, 561t Peptide, 939
Peptide bond, 46, 46f, 296, 296f, 298f Peptide hormones, 947-948 Peptidoglycan, 64, 548, 552, 552f-553f Peptidyl transferase, 293 Peregrine falcon (Falco peregrinus), 1276, 1276f Perennial plants, 859-860, 859f Perforin, 1058 Pericardial cavity, 865, 865f Pericarp, 762 Pericentriolar material, 76 Pericycle, 741, 741f Periderm, 745, 745f Periodic table, 22-23, 22f Peripheral chemoreceptor, 927 Peripheral membrane protein, 89, 90f Peripheral nervous system, 872, 888, 909-912, 909f-912f, 909t, 911t Peristalsis, 986, 986f Peritoneal cavity, 865 Peritubular capillary, 1047, 1047f Periwinkle, 744f Permafrost, 1238 Peroxisome, 72-73, 72f Peroxisome biogenesis disorders (PBDs), 72 Pesticide resistance, in insects, 404-405, 405f Petal, 608, 608f development of, 499-500, 499f-500f Petiole, 747 pH, 29-30 of blood, 1014, 1014f effect on enzymes, 52, 116-117, 116f pH scale, 29-30, 30f of rainwater, 1246, 1246f of soil, 789, 789f of urine, 1048 PHABULOSA gene, in Arabidopsis, 747f Phage, 258-259, 258f Phage. See Bacteriophage Phage conversion, 534 in Vibrio cholerae, 534 Phagocytosis, 71, 102, 102f, 103, 104t Phagotroph, 572 Pharmaceuticals applications of genetic engineering, 348-349 from plants, 1261-1262, 1261f Pharyngeal pouch, 694, 694f Pharyngeal slits, 694, 695f Pharynx, 662, 662f, 694 Phase change, in plants, 840-841, 841f Phase-contrast microscope, 62t PHAVOLUTA gene, in Arabidopsis, 747f Phenotype, 226, 405, 408 Phenotype frequency, 399, 399f Phenylketonuria, 249t Pheromone, 439, 620, 686, 938, 1145 Phloem, 596, 738, 738f, 741f primary, 733f, 741f, 742 secondary, 733f transport in, 781-783, 782f, 783f
index
rav32223_Index_I1-I33.indd I-22
11/25/09 11:54:46 AM
Phloem loading, 783 Phlox, 852 Phoronida (phylum), 677-678, 678f Phosphatase, 171, 171f Phosphate group, 35, 35f, 42, 42f, 55t, 259-260, 261f Phosphodiester backbone, 261-262, 262f Phosphodiester bond, 42, 42f, 260, 260f, 261f Phosphoenolpyruvate, 128f Phosphofructokinase, 138, 138f 2-Phosphoglycerate, 128f 3-Phosphoglycerate, 128f Phospholipase C, 179, 180f Phospholipid, 37t, 55, 89 in membranes, 55-56, 55f, 89, 89f, 90t, 92-93 structure of, 55, 55f, 89, 89f, 92 Phosphorus, fertilizer, 1212 Phosphorus cycle, 1212, 1212f Phosphorylase kinase, 182, 182f Phosphorylation cascade, 176, 177f Phosphorylation, of proteins, 170-171, 171f, 198-199, 200-201 Phosphotyrosine, 176 Photic zone, 1239, 1239f Photoautotroph, 559, 1214 Photoefficiency, 153 Photoelectric effect, 152 Photoheterotroph, 559 Photolyase, 274, 274f Photomorphogenesis, 815 Photon, 151-152 Photoperiod, 842-844, 842f-843f Photopigment, 931 Photopsin, 930 Photoreceptor, 928 sensory transduction in, 931-932, 932f in vertebrates, 930-931, 930f-931f Photorepair, 274, 274f Photorespiration, 163-165, 163f-165f, 749, 795f-796f Photosynthesis, 25, 108, 147-165 anoxygenic, 143, 148 in bacteria, 63-64, 64f, 150, 156, 156f C3, 161, 164, 164f, 165f C4, 164-165, 164f, 165f, 749 Calvin cycle, 160-163, 161f carbon levels in plants and, 795-797 discovery of, 149-151, 150f electron transport system in, 156 evolution of, 139, 143, 156 light-dependent reactions of, 148, 149f, 150, 150f oxygen from, 143 oxygenic, 148 saturation of, 154, 154f soil and water in, 149-150 summary of, 148-149, 148f, 149f Photosynthetic pigments, 151-154 absorption spectra of, 152-154, 152f, 153f
Photosystem, 148-149, 149f architecture of, 154-155, 154f, 155f of bacteria, 156, 156f of plants, 156-158, 157f-159f Photosystem I, 157, 158f, 159f Photosystem II, 157, 158, 158f, 159f Phototroph, 572 Phototropin, 818, 818f Phototropism, 817-818, 817f auxin and, 829f negative, in Drosophila, 410-411, 411f Phycobiloprotein, 154 Phyla, animal, 640, 641t-642t Phyllotaxy, 744 Phylogenetic species concept (PSC), 463-464, 464f Phylogenetic tree, 12 Phylogenetics comparative biology and, 464-470, 465f-469f disease evolution and, 470-471, 470f-471f plant origins and, 521, 521f Phylogeny, 457, 457f of animals, 640, 643-645, 644f-645f of fungi, 615f of vertebrates, 698f Phylum, 512, 513f, 514, 640 Physical map, 353, 355, 355f correlation with genetic map, 355 landmarks on, 335, 353 types of, 353-354, 353f-354f Physiology, adaptation to environmental change, 1163, 1163t Phytoaccumulation, 798f Phytoalexin, 811 Phytochrome, 815-816, 815f expression of light-response genes, 815-816, 816f in plant growth responses, 817 Phytoestrogen, 806t, 808 Phytophthora infestans, 582 Phytoplankton, 1239 Phytoremediation, 797-800, 798f-799f for heavy metals, 799-800, 799f for trichloroethylene, 798-799, 798f for trinitrotoluene, 799 Phytovolatilization, 798f PI gene, in plants, 499-500, 499f-500f PID. See Pelvic inflammatory disease Pied flycatcher, 442, 442f PIF. See Prolactin-inhibiting factor Pigment, 151 photosynthetic pigments, 151-154, 152, 151f, 152f, 153f Pike cichlid (Crenicichla alta), 412-413, 412f Pillbug, 682
Pilus, 63f, 534, 553-554, 553f Pine, 602t, 603-605, 603f-604f Pine cone, 604 Pine needle, 604 Pineal gland, 956 Pinnately compound leaf, 748f Pinocytosis, 102, 102f, 103, 104t Pinworm (Enterobius), 641t, 662-663 Pit organ, 934, 934f Pitcher plant (Nepenthes), 750, 793, 794f Pith, 741f, 742, 744 Pituitary dwarfism, 950 Pituitary gland, 946-948, 947f anterior, 946, 947-948, 948-951, 950f posterior, 946-947 PKU. See Phenylketonuria Placenta, 716, 716f, 1112 formation of, 1125 functions of, 1125 hormonal secretion by, 1126, 1127f structure of, 1126f Placental mammal, 524, 525f, 719, 719f, 1090, 1090f marsupial-placental convergence, 430-431, 431f orders of, 720t Plague, 561t Planarian, 982 eyespot of, 501, 501f, 503 Plant(s). See also Flowering plant annual, 859f, 860 asexual reproduction in, 857-859, 858f biennial, 860 body plan in, 730-750 C3, 164, 164f, 165f C4, 164-165, 164f, 165f, 749 CAM, 164, 165, 165f carnivorous, 793-794, 794f cell walls, 80 chilling of, 825 circadian rhythm in, 818, 822, 823f classification of, 463-464, 463f, 521f cloning of, 858f, 859 coevolution of animals and, 807 conducting tubes in, 466, 466f development in 374-375, 392-393, 393f embryonic, 754-760, 754f-760f establishment of tissue systems, 757f-758f, 758-759 food storage, 759-760, 760f fruit formation, 761-763, 762f-763f morphogenesis, 392-393, 393f, 759, 759f seed formation, 760-761, 761f
digestion of plants, mammals, 717 dormancy in, 823-824, 823f-824f under drought stress, 780, 780f evolution of 390, 520-522, 521f-522f in land plants, 521f, 571, 589-590 genome of, 476-479, 477f-479f, 486 gravitropism in, 819-820, 819f-820f heliotropism in, 822f heterozygosity in, 398 leaves of, 747-750. See also Leaf life cycles of, 590, 590f life span of, 859-860, 859f nutritional adaptations in, 792-795, 792f-795f nutritional requirements in, 790-792, 790t, 791f organization of plant body, 730f parasitic, 794, 794f pattern formation in, 389 perennial, 859-860, 859f photomorphogenesis in, 815 photosynthesis in, 148-149, 148f photosystems of, 156-158, 157f-159f phototropism in, 817-818, 817f phytoremediation in, 797-800, 798f-799f plasmodesmata in, 67f, 84-85, 85f polyploidy in, 479, 479f primary plant body, 732 primary tissues of, 732 reproduction in, 839-860 responses to flooding, 780, 781f roots of, 739-743. See also Root saline conditions, under, 780-781, 781f secondary growth in, 732, 745f secondary metabolites of, 805, 806t, 808 secondary plant body, 732 secondary tissues of, 732 sensory systems in, 814-836 spacing of, 817 stem of, 743-747, 743f-746f. See also Stem thermotolerance in, 825 thigmotropism in, 821-822, 821f tissue culture, 859 tissues of, 733-738, 734f-738f, 742f transgenic. See Transgenic plants transport in, 769-783 turgor movement in, 821-822, 822f vacuole of plant cells, 73, 73f, 81t vascular. See Vascular plant vegetative propagation of, 746-747 wound response, 810, 810f
index
rav32223_Index_I1-I33.indd I-23
I-23
11/25/09 11:54:46 AM
Plant cells cell wall of, 67f, 80, 80f cytokinesis in, 197-198, 198f structure of, 67f, 81t Plant defenses, 802-812 against herbivores, 810, 810f, 1193-1194, 1193f animals that protect plants, 809, 809f pathogen-specific, 810-811, 811f-812f physical defenses, 802-805, 802f-804f toxins, 805-808, 805f, 806t, 807, 807f Plant disease, 802-812 bacterial, 560 fungal, 629-630, 629f, 804-805, 804f nematodes, 803, 803f-804f viral, 810f Plant hormone, 825-836 functions of, 826t that guide plant growth, 825 production and location of, 826t transport in phloem, 781-783, 782f-783f Plant receptor kinase, 175 Plantae (kingdom), 13, 13f, 514, 515f, 517f, 518t, 521f Plantlet, 858 Planula larva, 653, 655 Plasma cell, 1062t Plasma membrane, 62-63, 67f, 78t active transport across, 99-102, 104t of archaebacteria, 65, 548 of bacteria, 548 bulk transport across, 102-103 components of, 90t, 92-93 electron microscopy of, 91-92, 91f of eukaryotes, 66f, 78t fluid mosaic model, 89, 90f, 92-93, 548 passive transport across, 96-99 of prokaryotes, 63-64, 63f, 548 structure of, 62-63 Plasmid, 548 antibiotic resistance genes on, 558 cloning vector, 330, 331f conjugative, 554-556, 555f resistance, 558 Plasmodesmata, 67f, 84-85, 85f, 592 Plasmodium, 577-578, 577f, 1079 Plasmodium falciparum, 409, 409f, 487, 487f, 578 genome of, 358f, 475f, 488 Plasmodium (slime mold), 584-585, 585f Plasmolysis, 771 Plastid, 75 Platelet, 202, 1021 Platelet-derived growth factor (PDGF), 175, 202 Platyhelminthes (phylum), 641t, 643, 644f, 657-660, 657f, 659f, 902 Platyzoa, 643, 644f Pleiotropic effect, 233, 233t, 413
I-24
Plesiomorphy, 459 Plesiosaur, 707t Plesiosaura (order), 707t Pleural cavity, 865, 865f, 1009 Plexus, 983, 983f Pluripotent stem cells, 379, 1021 Pneumatophore, 742, 743f, 781 Pneumocystis jiroveci, 630 Pneumonia, bacterial, 560, 561t Poa annua, 1169, 1170t Poikilotherm, 880 Poinsettia, 843f Point mutation, 299 Point-source pollution, 1246 Polar body, 1096 Polar covalent bond, 25 Polar molecule, 25, 28 Polar nuclei, 851, 851f Polarity, in development, 383 Polarized character states, 458-459 Polio, 531f, 532t Pollen, 168, 609f dispersal of, 407, 407f Pollen grain, 603, 604, 604f, 605, 850, 851f formation of, 609, 609f, 850-851, 850f Pollen tube, 603, 604f, 609, 609f, 610, 610f Pollination, 604f, 608, 609-610, 610f, 851-857, 852f-857f by animals, 852-854, 852f-853f by bats, 854, 1196f by bees, 852, 852f-853f by birds, 852-854, 853f by insects, 852, 852f-853f by wind, 852, 854, 854f Pollinator, 851-852 Pollution, 1245-1250 diffuse, 1246 of freshwater habitats, 1246, 1246f habitat loss and, 1267 of marine habitats, 1248 phytoremediation, 797-800, 798f-799f point-source, 1246 Poly-A tail, of mRNA, 289, 289f Polyandry, 1153 Polychaeta (class), 674-675, 674f Polychaete, 641t, 674-675, 674f, 675f Polyclonal antibody, 1077 Polydactyly, 227t, 403 Polygenic inheritance, 232-233, 232f, 233t Polymer, 36f, 37, 40f Polymerase chain reaction (PCR), 339-340, 340f applications of, 340 procedure for, 339-340 Polymorphism in DNA sequence, 335-336, 398-399 in enzymes, 398, 398f single nucleotide, 248 Polynomial name, 512 Polynucleotides, 42
Polyp, of cnidarians, 653, 653f, 655, 655f Polypeptide, 36f, 46 Polyphyletic group, 462, 462f Polyplacophora (class), 670, 670f Polyploidy, 445, 477, 479f, 486, 1108 alteration of gene expression, 480 elimination of duplicated genes, 480, 480f in evolution of flowering plants, 479, 479f speciation through, 445, 445f synthetic polyploids, 478 transposon jumping in, 480-481 Polysaccharide, 39 Polyspermy, 1108 Polyubiquitination, 323 Polyunsaturated fatty acid, 53, 54f Polyzoa, 641t Pond, 1239-1241, 1239f-1240f Pons, 902, 902t Popper, Karl, 7 Population, 3f, 4, 1165 age structure of, 1168 change through time, 1170 human. See Human population metapopulations, 1167-1168, 1168f survivorship curves for, 1170, 1170f-1171f Population cycle, 1176-1177, 1177f Population demography, 1168-1171, 1169f-1171f Population dispersion clumped spacing, 1167 habitat occupancy and, 1167 human effect on, 1166 mechanisms of, 1166, 1166f randomly spaced, 1167 uniformly spaced, 1167 Population genetics, 397 Population growth factors affecting growth rate, 1168-1169, 1169f in hotspots, 1260-1261, 1260f limitations by environment, 1173-1174, 1174f-1175f Population pyramid, 1178-1180, 1179f Population range, 1165-1166, 1165f-1166f Population size density-dependent effects on, 1175-1176, 1175f-1176 density-independent effects on, 1176, 1176f extinction of small populations, 1273-1275, 1273f-1274f human, 1179f Pore protein, 95, 95f Porifera (phylum), 640, 641t, 643, 644f, 650-651, 650f Porphyrin ring, 152, 152f Portuguese man-of-war, 655, 655f Positive feedback loop, 878, 878f, 950, 1176 Positive gravitropism, 820 Positive pressure breathing, 1007
Positive-strand virus, 531 Postanal tail, 694, 694f-695f Posterior pituitary, 946-947 Postsynaptic cell, 896, 899-900, 899f Posttranscriptional control, 317-321, 318f-319f, 321f alternative splicing of primary transcript, 320, 321f, 322f RNA editing, 320-321 small RNA’s, 317-320, 318f-319f Postzygotic isolating mechanisms, 438, 438t, 440, 440f Potassium channel, voltage-gated, 893, 894f Potato eye of, 858 genome of, 479f Irish potato famine, 582 Potential energy, 21, 108, 108f Power of Movement of Plants, The (Darwin), 827 Poxvirus, 531f Prader-Willi syndrome, 251-252, 487 Prairie, 1237 Prairie chicken (Tympanuchus cupido pinnatus), 1274-1275, 1274f Prairie dog (Cynomys ludovivianus), 1146f Pre-mRNA splicing, 289-291, 290, 290f Precocial young, 1153 Predation, 1192 evolution of prey population, 412-413, 412f fish, 408, 408f population cycles and, 1177 prey populations and, 1192-1193 reduction of competition by, 1199-1200, 1200f species richness and, 1225 Predator animal defenses against, 1194, 1194f search image for prey, 407-408, 408f selection to avoid, 404, 404f Predator avoidance, 404, 404f Prediction, 5f, 6-7 Preganglionic neuron, 910 Pregnancy, high-risk, 252-253 Pressure-flow theory, of phloem thransport, 782, 783f Pressure potential, 772, 772f Presynaptic cell, 896 Prey defense, 1137 Prey protein, in DNA-binding hybrid, 341, 341f Prezygotic isolating mechanisms, 438-440, 438f-439f, 438t Priestly, Joseph, 149-150 Primary carnivore, 1215, 1215f Primary induction, 1124 Primary lymphoid organs, 1064, 1064f-1065f Primary meristem, 732, 758 Primary mesenchyme cell, 1113 Primary motor cortex, 904, 905f Primary mycellium, 622 Primary oocyte, 1095, 1096f Primary phloem, 733f, 741f, 742
index
rav32223_Index_I1-I33.indd I-24
11/25/09 11:54:47 AM
Primary plant body, 732 Primary producer, 1215, 1215f Primary productivity, 1186, 1215, 1222-1223, 1222f, 1224, 1224f, 1236, 1236f Primary somatosensoty cortex, 904, 905f Primary structure, of proteins, 46, 49f Primary succession, 1202, 1202f Primary tissue, 864 of plant, 732 Primary transcript, 288, 288f Primary xylem, 733f, 737, 741-742, 741f Primate, 525, 525f, 721 evolution of, 721-726, 721f-726f hunting for “bushmeat,” 471 language of, 1147, 1147f Primer, for replication, 268-269 Primitive streak, 1115 Primordium, 608, 608f Primosome, 269 Prion, 541-542, 542f Probability, 230-231 Procambium, 732, 733f, 759 Processivity, of DNA polymerase III, 268 Prochloron, 64, 64f Product of reaction, 25 Product rule, 230 Productivity, 1215 primary, 1186, 1215, 1222-1223, 1222f, 1224, 1224f, 1236, 1236f secondary, 1216 species richness and, 1225 Progesterone, 956, 1093t Proglottid, 659-660, 660f Progymnosperm, 602 Prokaryote, 13, 62, 545-564. See also Bacteria benefits of, 563-564 cell division in, 187-188, 188f, 548 cell organization of, 63-65, 63f cell size of, 548 cell structure in, 551-554, 552f-554f cell walls of, 63, 63f, 64, 81t, 548-549, 552-554, 552f-553f classification of, 549-550, 549f-551f compartmentalization in, 548 disease-causing, 561t diversity in, 547-550, 549f-550f DNA of, 62 eukaryotes versus, 81t, 547-548 first cells, 546, 546f flagella of, 63f, 65, 81t, 548, 553, 553f gene expression in, 305, 308-312, 308f-312f, 549 genetics of, 554-559, 555f-558f genome of, 358f internal membranes of, 554, 554f metabolic diversity in, 548 metabolism in, 559-560
mutations in, 558-559 plasma membranes in, 63-64, 63f, 548 recombination in, 548 replication in, 187-188, 187f, 266-270, 266f-270f, 549 ribosomes of, 63, 63f, 554 shape of, 551-552 size of, 548 symbiotic, 563-564 transcription in, 284-287, 284f-287f transcriptional control in, 305, 308-312, 308f-312f unicellularity of, 548 Prolactin, 948, 951, 1093t Prolactin-inhibiting factor (PIF), 949 Proliferating cell nuclear antigen (PCNA), 271 Prometaphase, 193f, 194f, 196 Promoter, 285, 285f in eukaryotes, 313-314, 313f Proofreading function, of DNA polymerase, 273 Prop root, 742, 743f Propane, 34 Prophage, 534, 534, 557 Prophase meiosis I, 210-211, 212f, 214f meiosis II, 213f, 214, 217f mitotic, 192f, 194f, 195, 216f Proprioceptor, 919 Prosimian, 721, 721f-722f Prosoma, 679 Prostaglandin, 37t, 54, 943 Prostate gland, 1092 Protease, 45t, 323, 816 Protease inhibitor, 538 Proteasome, 323-324, 323f-324f Protective coloring, in guppies, 412-413, 412f-413f Protective layer, 824 Protein, 33, 36f, 37, 433 anchoring, 94 catabolism of, 141, 141f, 142 central dogma, 280, 280f degradation of, 322-324, 323f-324f denaturation of, 52-53, 52f domains of, 50-51, 51f folding of, 51-52, 51f functions of, 37t, 44-46, 45t, 46f prediction of, 366-367, 367f in membranes, 88, 93-95 functions of, 93, 94f kinds of, 93, 94f movement of, 92-93, 93f structure of, 94-95, 95f transmembrane domains of, 94-95, 95f motifs of, 50, 50f, 367, 367f nonpolar regions of, 46-49, 48f one-gene/one-polypeptide hypothesis, 6, 280
phosphorylation of, 170-171, 171f, 198-199, 200-201 polar regions of, 46-49, 48f primary structure of, 46, 49f quaternary structure of, 46, 49, 49f renaturation of, 52f, 53 secondary structure of, 46, 48, 49f structure of, 37t, 46-49 synthesis of. See Translation tertiary structure of, 46, 48-49, 49f transport within cells, 70-71, 71f, 296f, 297 ubiquitination of, 323-324, 323f Protein-encoding gene, 359, 360t Protein hormones, 948 Protein kinase, 170, 171f, 173, 176-177, 177f, 945 Protein kinase A, 180, 180f, 182, 182f Protein kinase C, 181 Protein-protein interactions protein microarrays, 367 two-hybrid system, 340-341, 341f Proteobacteria, 551f Proteoglycan, 81, 81f Proteome, 366 Proteomics, 366-367 Prothoracicotropic hormone (PTTH), 957 Protist, 512-513, 567-585 asexual reproduction in, 572 cell division in, 188f cell surface of, 571 classification of, 520, 520f, 570f-571f, 571 cysts of, 571 cytokinesis in, 197 defining, 571-572 flagella of, 572-573, 575f locomotor organelles of, 572 nutritional strategies of, 572 Protista (kingdom), 13, 13f, 514, 517f, 518t, 571, 644f Proto-oncogene, 203-204, 204f Protoderm, 732 Protogyny, 1085f Proton, 18, 19f Protonephridia, 1040, 1040f Protoplast, plant, 858f, 859 Protostome, 523, 638, 639f, 643-645, 644f Proximal convoluted tubule, 1047, 1047f, 1048 Prusiner, Stanley, 541 Pseudocoelom, 637f, 638 Pseudocoelomate, 637f, 638, 643, 661-663, 661f-663f Pseudogene, 359, 360, 360t, 482 Pseudomonas fluorescens, 489 Pseudomurein, 548-549, 552 Pseudostratified columnar epithelium, 867t Psilotum, 599 Pterophyta (phylum), 596, 597, 597f, 598-601, 599f-600f, 601t Pterosaur, 707t Pterosauria (order), 707t
PTH. See Parathyroid hormone Pufferfish (Fugu rubripes), genome of, 475f, 476, 486 Pulmocutaneous circuit, 1024 Pulmonary artery, 1024, 1028 Pulmonary circulation, 1024 Pulmonary valve, 1026, 1027f Pulmonary vein, 703, 1024, 1024f, 1029 Pulvini, 822, 822f Punctuated equilibrium, 451, 451f Punnett, R. C., 227 Punnett square, 226f, 226-227, 229, 229f, 400 Pupa, 686 Purine, 42, 259f, 260 Pvull, 328 Pyramid of energy flow, 1218, 1219f Pyrimidine, 42, 259f, 260 Pyrogen, 883 Pyruvate conversion to acetyl-CoA, 130, 130f from glycolysis, 126f, 128f, 130 oxidation of, 130, 130f Pyruvate dehydrogenase, 115, 115f, 130, 138, 138f Pyruvate kinase, 128f
Q Q10, 878-879 Quantitative traits, 232, 233f Quaternary structure, of proteins, 46, 49, 49f Quiescent center, 739 Quinine, 806t, 808
R R plasmids, 558 R-selected population, 1177, 1178t Rabbit, 525f Rabies, 349, 532t Rabies virus, 531f Race, human, 726, 726f Radial canal, 688 Radial cleavage, 638, 639f Radial symmetry, 636, 636f Radially symmetrical flower, 499 Radiation (heat transfer), 879, 879f Radicle, 764, 765f Radioactive decay, 19 dating of fossils using, 424-425, 424f Radioactive isotope, 19 Radiolarian, 583-584, 584f Radula, 641t, 668-669, 669f Rain forest loss of, 1246-1247, 1247f tropical, 1236-1237, 1237f Rain shadow, 1233-1234, 1234f Ram ventilation, 1005 Rape case, 336, 336f Raphe, 581, 581f Ras protein, 176, 178, 178f, 203f, 204f Rat, genome of, 475f, 487 Raven, cognitive behavior in, 1141, 1142f
index
rav32223_Index_I1-I33.indd I-25
I-25
11/25/09 11:54:47 AM
Ray-finned fish, 698f, 699t, 702, 702f Ray (fish), 699t, 701 Ray initial, 738 Ray (parenchyma cells), 737-738 Reabsorption, 1040-1041, 1046 in kidney, 1046, 1048, 1049f, 1050-1051, 1051f Reactant, 25 Reaction center, 155, 155f Reading frame, 283 Realized niche, 1188, 1188f Receptor kinase, 945, 945f Receptor-mediated endocytosis, 102f, 103, 104t Receptor potential, 917 Receptor protein, 63, 90t, 93, 94f, 168, 169f intracellular, 171-174, 172f, 172t, 173f Receptor tyrosine kinase, 174-178, 175f-178f, 182-183, 202 autophosphorylation of, 175-176, 175f inactivation of, 178 Recessive trait, 224-228, 224f in humans, 227t Reciprocal altruism, 1154-1155, 1155f Reciprocal cross, 223 Recognition helix, 306 Recombinant DNA, 327 construction of, 327, 328, 328f introduction of foreign DNA into bacteria, 329-331, 331f in vaccine production, 344-345, 344f Recombination, 210, 245-247, 275 in eukaryotes, 548 homologous, 555 in prokaryotes, 548 using recombination to make maps, 245f, 246-247, 246f in viruses, 539 Recombination frequency, 246 Recombination nodule, 211 Recruitment, 973 Rectum, 990 Red algae, 463f, 517-518, 517f, 519, 521f, 570, 570f, 582, 582f, 589f Red-bellied turtle (Pseudemys rubriventris), 710f Red blood cell(s). See Erythrocytes Red-eyed tree frog (Agalychnis callidryas), 705f Red maple (Acer rubrum), 737f Red tide, 576-577, 577f Rediae, 658, 659f Redox, 109, 109f, 123-124, 123f, 124f Reduction, 7, 21, 109, 109f, 123, 123f Reduction division, 210 Reductionism, 7 Reflex, 907-908, 908f Regeneration in echinoderms, 689 of planarian eyespot, 501, 501f of ribbon worm eyespot, 503, 503f
I-26
Regulation, as characteristic of life, 508 Regulative development, 1112 Regulatory proteins, 305, 305-307, 306f-307f DNA-binding motifs in, 306-307, 307f Reinforcement, 442, 442f Relative dating, 424 Releasing hormone, 948-949 REM sleep, 905 Remodeling, bone, 966-967, 966f-967f Renal cortex, 1045, 1046f Renal medulla, 1045, 1046f Renal pelvis, 1045 Renaturation, of proteins, 52f, 53 Replica plating, 558 Replication, 263-266, 263f-265f conservative, 263-265, 263f direction of, 265, 266f, 267, 267f, 272f dispersive, 263f, 264, 265 elongation stage of, 265-266 enzymes needed for, 268t, 269-270, 269f errors in, 273 in eukaryotes, 271-273, 271f-272f in HIV infection cycle, 537 initiation stage of, 265-266, 271 lagging strand, 267f, 268-269, 269f-270f leading strand, 267f, 268, 269f-270f, 272f Meselson-Stahl experiment, 264-265, 264f Okazaki fragments, 268-269, 269f-270f in prokaryotes, 187-188, 187f, 266-270, 266f-270f, 549 rolling circle, 555, 555f semiconservative, 263-265, 263f semidiscontinuous, 267-268, 267f suppression between meiotic divisions, 216 termination stage of, 265-266, 269 of virus, 530 Replication fork, 268-269, 269f-270f Replication origin, 187-188, 187f Replicon, 266, 271 Replisome, 266f, 269-270, 269f-270f Reporter gene, 341, 341f Repression, 308, 312 Repressor, 308 Reproduction in amphibians, 704 as characteristic of life, 3, 508 cost of, 1171-1173, 1171f-1172f in crustaceans, 682-683 in echinoderms, 689 in fish, 701 in flatworms, 657f, 658 in fungi, 614, 617, 621 in mollusks, 669, 669f
in nematodes, 662 in plants, 839-860 in protists, 572 reproductive events per lifetime, 1173 Reproductive cloning, 381, 381f Reproductive isolation, 437, 438, 438t evolution of, 441-442, 442f Reproductive leaf, 749 Reproductive strategy, 1084-1086, 1085f-1086f, 1150-1154, 1150f-1153f Reproductive system, 875f, 876, 1084-1102 evolution of, 1087-1088, 1088f female, 875f, 876, 1090, 1090f, 1094-1098, 1094f-1098f male, 875f, 876, 1091-1094, 1091f-1094f, 1093t Reptile, 703t, 706-711, 708f-711f brain of, 903, 903f characteristics of, 706-707, 707t circulation in, 1024 eggs of, 706, 708f evolution of, 697, 708-709, 708f-709f fertilization in, 1089-1090 heart of, 709, 709f, 1024 kidney of, 1043 lungs of, 1007 nitrogenous wastes of, 1044, 1045f orders of, 707f, 710-711, 710f-711f present day, 709-710, 709f respiration in, 707 skin of, 707 skull of, 708f thermoregulation in, 710 Research, 7-8 Resolution (microscope), 60 Resource depletion, 1245-1250 Resource partitioning, 1190-1191, 1190f Resources competition for limited, 1189-1190, 1189f consumption of world’s, 1181 Respiration, 123-126, 1215 aerobic. See Aerobic respiration in amphibians, 703, 1004, 1003f-1004f in birds, 715, 1008, 1009f cutaneous, 1006 in echinoderms, 1003f in fish, 1004-1006, 1003f-1005f in insects, 1003f in mammals, 1003f, 1007-1008, 1008f Respiratory control center, 1011 Respiratory disease, 1012, 1012f Respiratory system, 875, 875f, 1001-1015 of arthropods, 680-681, 681f Resting potential, 890, 891-892, 892f Restoration ecology, 1275-1276, 1275f
Restriction endonuclease, 327-328, 328f, 331f Restriction fragment length polymorphism (RFLP) analysis, 335, 335f Restriction map, 328, 335, 353, 353f Restriction site, 328 Reticular-activating system, 905 Reticular formation, 905 Retina, 930, 931f Retinoblastoma susceptibility gene (Rb), 204, 204f Retrotransposon, 360, 486 Retrovirus, 280, 529, 531 Reverse genetics, 343 Reverse transcriptase, 280, 332, 332f, 531, 536f, 538 RFLP. See Restriction fragment length polymorphism analysis Rh factor, 1077 Rh-negative individual, 1077 Rh-positive individual, 1077 Rheumatic fever, 560 Rhinoceros, 525 Rhizobium, 563, 792, 793f Rhizoid, 594, 594f, 601 Rhizome, 600, 746, 746f, 858 Rhizopoda, 583, 583f Rhizopus, 615t, 621f Rhodophyta (phylum), 515f, 570f, 582, 582f Rhodopsin, 930 Rhynchocephalia (order), 707t, 710, 710f Ribbon worm, 642t, 672-673, 672f regeneration of eyespot, 503, 503f Ribonuclease, 52f, 53 Ribonucleic acid. See RNA Ribosomal RNA (rRNA), 69, 281 Ribosome, 63, 78t, 81t A site on, 292-293, 293f-296f, 295 E site on, 292-293, 293f, 294f, 296f of eukaryotes, 68-69, 69f, 78t free, 69 functions of, 293 membrane-associated, 69 of mitochondria, 74f P site on, 292-293, 293f-296f, 295, 296 of prokaryotes, 63, 293f, 554 structure of, 293, 293f in translation, 293-297, 294f-296f Ribosome-binding sequence, 294 Ribulose 1,5-bisphosphate (RuBP), 161, 161f, 162 Ribulose bisphosphate carboxylase/ oxygenase (rubisco), 161, 161f, 163 Rice (Oryza sativa), 368f genome of, 358f, 363, 363f, 475f, 476-477, 479f, 486, 489 golden, 348, 348f, 368 transgenic, 348, 348f, 368 world demand for, 368 Ricin, 807-808, 807f Ricksettsia, 517, 551f
index
rav32223_Index_I1-I33.indd I-26
11/25/09 11:54:47 AM
Rig helicase-like receptor (RLR), 1057 RISC (enzyme complex), 318, 319f RNA catalytic activity of, 116 central dogma, 280, 280f DNA versus, 43, 43f functions of, 37t in gene expression, 281 micro-RNA, 281, 318-319, 319f, 320 small, 317-320, 318f-319f structure of, 37t, 41-42 RNA editing, 320-321 RNA interference, 319-320, 319f, 322f RNA polymerase, 266, 271, 281f, 285 core polymerase, 284f, 285 in eukaryotes, 287-288 holoenzyme, 284f, 285 in prokaryotes, 284f, 285 RNA polymerase I, 270f RNA polymerase II, 312, 313, 314-315, 313f-315f RNA virus, 529, 529f, 531, 532t RNAi gene therapy, 345 Rocky Mountain spotted fever, 560 Rod, 930, 930f, 931f Rodent, 525, 525f Root, 596, 730f, 739-743, 739f-743f adventitious, 742, 746f, 765f gravitropic response in, 819f, 820 modified, 742-743, 742f structure of, 739-743, 739f-741f tissues of, 730-731 Root cap, 739, 739f columella, 739 lateral, 739 Root hair, 735-736, 735f, 739f, 741 Root pressure, 776 Root system, 730 Rosin, 604 Rossmann fold, 50 Rotifera (phylum), 642t, 643, 644f, 663, 663f Rough endoplasmic reticulum, 69-70, 70f Roundworm, 641t, 644, 661-663, 662f rRNA. see Ribosomal RNA Rubisco, 161, 161f, 163 Ruffini corpuscle, 918f Rule of addition, 230 Rule of eight, 22, 23f Rule of multiplication, 230 Rumen, 564, 620 Ruminant, 991, 991f-992f Rumination, 991 Runner, plant, 746, 746f, 858
S S-layer, 553 S (synthesis) phase, 192, 192f SA node. See Sinoatrial node Saber-toothed mammals, 464-465, 465f Saccharomyces cerevisiae, 625, 625f genome of, 358f, 475f, 625
Saccule, 924, 924f Sager, Ruth, 244 Salamander, 703, 703t, 706, 982f Salicylic acid, 810 Salinity plant adaptations to, 780-781, 781f soil, 789 Saliva, 984 Salivary gland, 984-985 development in Drosophila, 1117-1118, 1117f Salmonella, 534, 551f, 560, 561t evasion of immune system, 1079 type III system in, 560 Salt marsh, 1243 Saltatory conduction, 896, 896f Sand dollar, 641t, 689, 689f, 690 Sanger, Frederick, 46, 336, 339 Saprolegnia, 582 Sarcomere, 969, 970f, 971f Sarcoplasmic reticulum, 972, 972f SARS. See Severe acute respiratory syndrome Satiety factor, 996 Saturated fatty acid, 53, 54f Saturation, 97 Saurischia (order), 707t Savanna, 1237 Scaffold protein, 177, 177f Scallop, 666, 667 Scanning electron microscope, 61, 62t, 91 Scar (leaf), 744, 744f SCARECROW gene, in Arabidopsis, 740, 740f, 820, 820f Scarlet fever, 560 Schistosomes, 659, 659f Schistosomiasis, 659 Schleiden, Matthias, 12, 60 Schwann cells, 890, 890f Schwann, Theodor, 12, 60 SCID. See Severe combined immunodeficiency disease Science deductive reasoning in, 4-5 definition of, 4 descriptive, 4 hypothesis-driven, 5-7 inductive reasoning in, 5 Scientific method, 4, 7 Sclera, 929, 929f Sclerenchyma cells, 736-737, 736f SCN. See Suprachiasmatic nucleus SCNT. See Somatic cell nuclear transfer Scolex, 659, 660f Scouring rush. See Horsetail Scrotum, 1091 Scutellum, 764, 764f Scyphozoa (class), 655, 655f Sea anemone, 636, 636f, 641t, 654, 654f Sea cucumber, 641t, 689 Sea daisy, 689 Sea level, effect of global warming on, 1252 Sea lilly, 689
Sea slug, 641t, 670, 670f Sea star, 641t, 689, 689f, 690 Sea turtle, 707t Sea urchin, 641t, 689, 689f, 690 development in, 493, 493f, 1110f gastrulation in, 1113-1114, 1113f Sebaceous glands, 866, 1056 Second filial generation, 224-225, 224f, 228-229, 229f Second Law of Thermodynamics, 110, 110f, 433, 879 Second messenger, 173, 179-182, 180f calcium, 181-182, 182f cAMP, 173, 179-181, 180f, 181f, 182 cGMP, 174 for hydrophilic hormones, 945-946, 945f IP3/calcium, 179, 180f, 181, 181f Secondary carnivore, 1215, 1215f Secondary chemical compound, 1193 Secondary endosymbiosis, 569 Secondary growth, in plants, 732, 745f Secondary induction, 1124, 1125f Secondary lymphoid organs, 1064-1065, 1064f Secondary metabolite, 805, 806t, 808 Secondary mycellium, 623 Secondary oocyte, 1096, 1096f Secondary phloem, 733f Secondary plant body, 732 Secondary productivity, 1216 Secondary sexual characteristics, 1151 Secondary structure, of proteins, 46, 48, 49f Secondary succession, 1202 Secondary tissues, of plant, 732 Secondary xylem, 733f, 737 Secretin, 993, 994t Secretion, 1041 in kidney, 1046, 1048 in stomach, 986-987 Securin, 201 Seed, 392, 393f, 597, 602-603, 604f, 609f dispersal of, 1166, 1166f dormancy in, 824, 824f, 836, 836f formation of, 392, 393f, 604f, 605, 760-761, 761f germination of, 393, 393f, 610, 764-766, 764f-766f, 817 Seed bank, 764 Seed coat, 760 Seed plant, 596, 602t evolution of, 602-603, 603f Seedcracker finch (Pyrenestes ostrinus), 409-410, 410f Seedling growth of, 764-765, 764f-765f orientation of, 765 Segment polarity genes, 385f, 387
Segmental duplication, 359, 360t, 480f-481f, 481 Segmentation (animals), 639-640 in arthropods, 523, 523f, 639-640, 679, 679f in chordates, 523, 523f, 639-640 in Drosophila development, 388-389, 388f evolution of, 523-524, 523f, 639-640 molecular details of, 524 Segmentation genes, 384f, 387 Segregation of traits, 222, 226 Selectable marker, 330, 331f Selection, 401f, 403-404. See also Artificial selection; Natural selection to avoid predators, 404, 404f on color in guppies, 412-413, 412f-413f directional, 410-411, 410f-411f disruptive, 409-410, 410f frequency-dependent, 407-408, 408f interactions among evolutionary forces, 406-407, 407f limits of, 413-414, 414f to match climatic conditions, 404 oscillating, 408 for pesticide and microbial resistance, 404-405, 405f sexual, 405 stabilizing, 410f, 411, 411f Selective permeability, 96 Selective serotonin reuptake inhibitor (SSRI), 899 Self-fertilization, 223, 223f Self-incompatibility, in plants, 856, 856f gametophytic, 856, 856f sporophytic, 856, 856f Self-pollination, 851, 854-855 Self versus nonself recognition, 1066 Semelparity, 1173 Semen, 1092 Semicircular canal, 924f, 925, 925f Semiconservative replication, 263-265, 263f Semidiscontinuous replication, 267-268, 267f Semilunar valve, 1026 Senescence, in plants, 860 Sensitive plant (Mimosa pudica), 822, 822f Sensitivity, as characteristic of life, 3, 508 Sensor, 876 Sensory exploitation, 1152 Sensory information, path of, 916f Sensory neuron, 873t, 888, 888f Sensory organs, of flatworms, 657f, 658 Sensory receptor, 916-917, 916f-917f Sensory setae, 686 Sensory system, 873 Sensory transduction, 917, 917f
index
rav32223_Index_I1-I33.indd I-27
I-27
11/25/09 11:54:47 AM
Sensory transduction photoreceptor, 931-932, 932f SEP genes, 846, 848, 848f Sepal, 608, 608f Separase, 201 Separation layer, 824 Septation (cell division), 188, 188f September 11, 2001, events of, 368 Septum in binary fussion, 188 in fungal hyphae, 616, 616f Sequence-tagged site (STS), 354, 355f, 357 Sequential hermaphroditism, 1085, 1085f Serosa, of gastrointestinal tract, 983, 983f Serotonin, 899, 1134 Serotonin receptor, 321 Serum, 1019 Sessile crustaceans, 683-684, 683f Set point, 876 Severe acute respiratory syndrome (SARS), 532t, 540, 540f Severe combined immunodeficiency disease (SCID), 345, 345t Sex chromosome, 240, 241-243, 241t of birds, 241t of humans, 241-243, 241t, 248f of insects, 241t nondisjunction involving, 251, 251f Sex combs reduced (scr) gene, 1117 Sex determination, 1086, 1086f genetic sex, 1086 temperature-sensitive, 1086 Sex linkage, 240f, 241 Sex steroid hormones, 956 Sexual dimorphism, 662 Sexual reproduction, 207, 208-218, 519, 572, 1084-1086. See also Meiosis in animals, 635t Sexual selection, 405, 1150-1154, 1150f, 1151 Sexually transmitted disease (STD), 561t, 562-563, 562f, 1100 Shade leaf, 750 Shark, 699t, 700-701, 700f evolution of, 700 teeth of, 700-701 Sheep, cloning of, 380f, 381, 381f Shell, of mollusks, 667, 668, 670f, 671 Shigella, 560 Shingles, 529 Shipworm, 667 Shoot, 730, 730f, 743f elongation of, 817, 817f gravitropic response in, 819-820, 819f-820f tissues of, 730 Shoot system, 730 SHOOT MERISTEMLESS gene, in Arabidopsis, 756, 757f Shore crab, 1148, 1148f
I-28
Short-day plant, 842-843, 842f-843f facultative, 843 obligate, 843 Short interspersed element (SINE), 360, 361f, 363 Short root mutant, in Arabidopsis, 820, 820f Short tandem repeat (STR), 354-355, 368 Short-term memory, 906 Shotgun cloning, 357 Shotgun sequencing, 357, 357f Shrimp, 682, 683 Shugoshin, 215 Sickle cell anemia, 49, 227t, 233, 233t, 249-250, 249f, 249t, 299, 299f, 335, 408-409 malaria and, 250, 409, 409f Sieve area, 738 Sieve cells, 738 Sieve plate, 738, 738f Sieve tube, 738 Sieve-tube member, 738, 738f Sigmoidal growth curve, 1174 Sign stimulus, 1133, 1133f Signal recognition particle (SRP), 281, 296f, 297 Signal sequence, 296f, 297 Signal transduction pathway, 14, 168, 169-170, 169f changes in pathways, 494 in development, 494 Signaling molecule sonic hedgehog (Shh), 1124 Silent mutation, 299, 300f Silkworm moth (Bombyx mori), 956f Simberloff, Dan, 1227 Simian immunodeficiency virus (SIV), 470-471, 470f-471f Simple epithelium, 866 columnar, 866, 867t cuboidal, 866, 867t squamous, 866, 867t Simple leaf, 748, 748f Simple sequence repeats, 359, 360t Sin nombre virus, 540 SINE. See Short interspersed element Singer, S. Jonathan, 89 Single-copy gene, 359 Single covalent bond, 24, 24f Single nucleotide polymorphism (SNP), 248, 361, 362f in human genome, 361 single-base differences between individuals, 361-362 Single-strand-binding protein, 267, 268t, 269f-270f Sink (plant carbohydrate), 782-783, 783f Sinoatrial (SA) node, 1023 Sinosauropteryx, 714f Sinus venosus, 1023, 1023f Siphonaptera (order), 685t siRNA. See Small interfering RNA Sister chromatid, 191, 191f, 193, 193f, 209, 209f Sister chromatid cohesion, 210-211, 214, 215-216 Sister clade, 469
SIV. See Simian immunodeficiency virus 6-PDG gene, 414 Skate, 699t, 701 Skeletal muscle, 870-871, 871t Skeletal system, 874f, 962-963, 962f-963f Skeleton hydrostatic, 962, 962f types of, 962-963, 963f Skin as barrier to infection, 1056 of reptiles, 707 sensory receptors in human skin, 918f Skinner, B. F., 1138 Skinner box, 1138 Skull, 708f Sleep, 905 Sleep movement, in plants, 822, 823f Sliding clamp, DNA polymerase III, 268, 268f-269f Slime mold, 584-585, 585f cellular, 585, 585f plasmodial, 584-585, 585f Slow-twitch muscle fiber, 974, 974f Slug (mollusk), 666, 667, 668, 670-671 Small interfering RNA (siRNA), 318, 319f, 320 Small intestine, 983, 983f, 988f, 990f absorption in, 989-990, 989f accessory organs to, 988-989, 988f-989f digestion in, 987, 988, 988f-989f Small nuclear ribonucleoprotein (snRNP), 281, 290, 290f Smallpox, 344, 532t, 535, 1061 Smell, 926-927, 927f Smoking, 1012 cancer and, 1012, 1012f cardiovascular disease and, 1033 nicotine addiction, 901 Smooth endoplasmic reticulum, 70, 70f Smooth muscle, 870, 871t Snail, 641t, 666, 667, 668, 669, 670-671, 670f marine, larval disposal in, 466-468, 467f-468f Snake, 699f, 707t, 711, 711f evolution of, 425, 429f sensing infrared radiation, 934, 934f Snake venom, 45t, 433 Snapdragon, 499, 849, 849f Snodgrass, Robert, 524 SNP. See Single nucleotide polymorphism snRNP. See Small nuclear ribonucleoprotein Social system communication in social group, 1146, 1146f evolution of, 1157-1159 Sodium, reabsorption in kidney, 1049, 1049f, 1050f, 1051, 1052f
Sodium channel, voltage-gated, 893, 894f Sodium chloride, 23-24, 23f, 29f Sodium-potassium pump, 45t, 90t, 100-101, 100f, 104t, 890, 891f Soil, 787-789, 1163 acid, 789 air in, 787, 788f charges on soil particles, 787, 787f loss of, 788, 788f minerals in, 787-788, 787f organic matter in, 787, 787f saline, 789 water content of, 787-788, 788f water potential of, 776-777, 787 Solar energy. See also Sunlight climate and, 1230-1235, 1231f-1232f distribution over Earth’s surface, 1231, 1231f seasonal variation in, 1231, 1231f sunlight, 1163 Soldier fly (Ptecticus trivittatus), 684f Solenoid, 190-191, 190f Soluble receptor, 1057 Solute, 28, 97 Solute potential, 772, 772f Solvent, 27t, 28, 29f, 97 Somatic cell, 208, 208f Somatic cell nuclear transfer (SCNT), 381 Somatic motor neuron, 973, 973f Somatic nervous system, 888, 889f, 909-910, 909t Somatostatin, 949 Somite, 1119, 1119f Somitomere, 1119 Song, bird’s, 1140, 1140f, 1145, 1149 Songbirds, declining populations of, 1268, 1268f Sorghum, 164 genome of, 476, 479f Sori, 601 SOS response, 275 Sounds, navigation by, 923-924 Source-sink metapopulation, 1167-1168, 1168f Southern blot, 334f, 335-336 Southern, Edwin M., 335 Soybean (Glycine max) genome of, 479, 479f, 483f phytoestrogens in soy products, 808 transgenic, 347 Spatial heterogeneity, species richness and, 1224-1225, 1224f, 1225-1226 Spatial recognition, 906 Spatial summation, 900 Special connective tissue, 868, 870 Specialized transduction, 556, 557 Speciation, 436-453 allopatric, 442, 442f, 444-445, 444f gene flow and, 442 genetic drift and, 443 geography of, 444-446, 444f-445f
index
rav32223_Index_I1-I33.indd I-28
11/25/09 11:54:47 AM
long-term trends in, 452-453, 452f natural selection in, 443 polyploidy and, 445, 445f reinforcement, 442, 442f sympatric, 437, 445-446, 445f Species, 3f, 4, 512, 513 endemic, 1258-1261, 1259f, 1260t geographic variation within, 437, 437f hotspots, 1259-1261, 1259f-1260f, 1260t keystone, 1201, 1201f, 1272, 1273f nature of, 437 origin of, 436-453 sympatric, 437 Species concept biological, 437-438, 438t, 463 ecological, 441 Species diversity cline, 1225, 1225f Species name, 512 Species richness, 469-470, 469f, 1186. See also Biodiversity climate and, 1224f, 1225 effects of, 1223-1224, 1223f evolutionary age and, 1225 predation and, 1225 productivity and, 1224, 1224f spatial heterogeneity and, 1224-1225, 1224f, 1225-1226 in tropics, 1225-1226, 1225f Specific heat, 28 of water, 27t, 28 Specific repair mechanism, 274, 274f Specific transcription factor, 313, 313f Spectrin, 90t, 91, 94 Speech, genetic basis of, 485 Spemann, Hans, 1122 Spemann organizer, 1122-1125, 1122f-1125f Sperm, 1092, 1092f blockage of, 1100 destruction of, 1100 fertilization, 1106, 1106-1109, 1106t, 1107f-1109f penetration of egg by, 1106, 1107f, 1109 Sperm competition, 1151 Spermatid, 1092 Spermatogenesis, 1091f Spermatozoa, 1092 Spermicide, 1099f, 1100 Sphincter, 986 Sphygmomanometer, 1029 Spicule, 650f, 651 Spider, 641t, 681-682, 682f poisonous, 682, 682f Spinal cord, 902f, 907-909, 907f-908f injury to, 909 Spinal muscular atrophy, 487 Spindle apparatus, 188f, 195, 196 Spindle checkpoint, 200, 200f, 201f Spindle plaque, 617 Spine (plant), 749 Spinneret, 681 Spiracle, 680f, 681, 681f, 1006
Spiral cleavage, 638, 639f, 643 Spiralia, 643, 644f, 669 Spirillum, 552 Spirochaete, 550f, 552 Spliceosome, 289-290, 290f Sponge, 637, 641t, 643, 650-651, 651f, 901, 1022f Spongin, 650f, 651 Spongy bone, 965f, 966 Spongy mesophyll, 749, 749f Spontaneous reaction, 110 Sporangiophore, 621, 621f Sporangium, 585, 585f, 590, 590f, 594, 594f, 600f Spore of fern, 599-600 of fungi, 617, 617f of moss, 594, 594f of plant, 590, 590f Spore mother cell, 590, 590f Sporocyst, 658, 659f Sporocyte. See Spore mother cell Sporophyte, 590, 590f, 594f, 595, 595f, 600f, 609f, 610 Sporophytic self-incompatibility, 856, 856f Squamata (order), 707t, 710f, 711, 711f Squid, 667, 668, 671-672 SRP. See Signal recognition particle SSRI. See Selective serotonin reuptake inhibitor St. John’s wort (Hypericum perforatum), 1188-1189 Stabilizing selection, 410f, 411, 411f Stain, visualization of cell structure, 61-62 Stamen, 608, 608f, 848-849, 848f Stanley, Wendell, 519 Stapes, 921 Staphylococcus, 550f Staphylococcus aureus, antibiotic resistance in, 404-405, 558, 559 Star jelly, 655, 655f Starch, 36f, 37t, 39-40, 40f Starfish. See Sea star Starling (Sturnus vulgaris), migratory behavior of, 1143, 1143f START, in DNA synthesis, 199, 200 Start site, 285 Starter culture, 625 Stasis, 451 Statocyst, 924 Staurozoa (class), 655, 655f STD. See Sexually transmitted disease Ste5 protein, 177 Stegosaur, 707t Stele, 741 Stem, 596 gravitropic response in, 819-820, 819f modified, 745-747, 746f positive phototropism in, 817-818, 817f structure of, 743-745, 743f-745f
Stem cells, 378, 379f, 1020f, 1021 embryonic, 342-343, 342f-343f, 379, 379f ethics of stem cell research, 379 Stereoisomer, 35, 35f, 39, 39f Sterilization (birth control), 1100-1101, 1101f Steroid, 37t, 54, 55f, 939 Steroid hormone receptor, 173-174 Stickleback fish courtship signaling in, 1144f, 1145 gene evolution in, 498 Stigma, of flower, 598, 598f, 609 Stimulus, 916 Stimulus-gated ion channel, 917, 917f Stimulus-response chain, 1144f, 1145 Stipule, 730f, 744, 747 Stolon, 746, 746f, 858 Stomach, 986-987, 986f digestion in, 986-987 four-chambered, 991, 992f secretion by, 986-987 Stomata, 163-165, 163f-164f, 589, 734, 734f, 804f opening and closing of, 778, 778f, 779f STR. See Short tandem repeat Stramenopile, 515f, 570f, 580-582, 580f-581f Stratification (seed), 764 Stratified epithelial membrane, 866 Stratified epithelium, 866 pseudostratified columnar, 867t squamous, 866, 867t Stratospheric ozone depletion, 1248-1249, 1249f Streptococcus, 550f, 560, 561t Streptococcus mutans, 562 Streptococcus pneumoniae, transformation in, 257-258, 257f Streptococcus sobrinus, 562 Streptomyces, 550f Streptophyta (phylum), 521, 521f Streptophyte, 591 Striated muscle, 870 Stroke, 1033 Stroke volume, 1034 Stroma, 74, 74f, 148, 148f, 149f Stromatolite, 546, 546f Structural DNA, 359, 360t Structural formula, 24 Structural isomer, 35 Structure, of living systems, 13 STS. See Sequence-tagged site Sturtevant, Alfred, 354 Style, 608, 608f Stylet, 662 Suberin, 741, 803 Submucosa, of gastrointestinal tract, 983, 983f Subspecies, 437, 437f Substance P, 899 Substrate, 113, 117f Substrate-level phosphorylation, 125-126, 125f Subunit vaccine, 344, 344f, 349
Succession, 1202-1203 in animal communities, 1203, 1203f in plant communities, 1202-1203, 1202f primary, 1202, 1202f secondary, 1202 Succinate, 132, 133f Succinyl-CoA, 132, 133f Suckers, plant, 858 Sucrose, 28, 39, 39f transport in plants, 781, 782f Sugar isomers of, 38, 39f transport in plants, 781-782, 782f Sugarcane, 164, 189t, 363f chromosome number in, 189t genome of, 476, 479f Sulfhydryl group, 35f Sulfur bacteria, 139 Summation, 893, 893f, 900, 973, 974f Sundew (Drosera), 750, 793, 794f Sunflower (Helianthus annuus) , 822f genome of, 479f Sunlight, 1163. See also Solar energy in photosynthesis, 148, 150 regulation of stomatal opening and closing, 778 Supercoiling, of DNA, 267, 267f Superior vena cava, 1029 Suprachiasmatic nucleus (SCN), 956 Surface area-to-volume ratio, 60, 60f Surface marker. See Cell surface marker Surface tension, 26, 27f Survivorship, 1170 Survivorship curve, 1170, 1170f-1171f Suspensor, 754 suspensor mutant, of Arabidopsis, 755, 756f Sutherland, Earl, 945 Sutton, Walter, 240 Swallowing, 985, 985f Sweet woodruff, 744f Swim bladder, 701-702, 701f Swimmeret, 683, 683f Swimming, 975-976 by fish, 975-976, 975f by terrestrial vertebrates, 976 Symbiosis, 75, 563, 626 coevolution and, 1196 facultative, 626 fungi in, 626-629 obligate, 626 prokaryotes in, 563-564 Sympathetic chain, of ganglia, 910, 911f Sympathetic division, 910, 911f, 911t Sympathetic nervous system, 888, 889f, 910 Sympatric speciation, 437, 445-446, 445f Symplast route, 775, 775f Symplesiomorphy, 459 Symporter, 100 Synapomorphy, 459
index
rav32223_Index_I1-I33.indd I-29
I-29
11/25/09 11:54:47 AM
Synapse, 896-901, 897f-900f chemical, 170, 896 electrical, 896 structure of, 896-897, 897f Synapsid, 708, 708f Synapsis, 209, 209f, 212f Synaptic cleft, 896, 897f Synaptic integration, 900 Synaptic plasticity, 906 Synaptic signaling, 169, 169f, 170, 897f Synaptic vesicle, 896 Synaptonemal complex, 209, 209f Syncytial blastoderm, 384, 384f, 1110 Syngamy, 208 Synteny, 363, 363f conservation of, 482, 483f Synthetic polyploid, 478 Syphilis, 562, 562f Systematics, 456-458, 457, 457f classification and, 461-464, 462f-464f Systemic acquired resistance, in plants, 811, 812f Systemic anaphylaxis, 1075 Systemic circulation, 1024 Systemin, 810 Systole, 1026, 1027f Systolic pressure, 1029, 1029f
T 2, 4,5-T, 831 T box, 496 T cell(s), 1020f, 1062, 1062t, 1063, 1063f, 1068 antigen recognition by, 1062f, 1066t cytotoxic, 1062t, 1066-1067, 1066t, 1067f helper, 1062t, 1066, 1067-1068, 1069f HIV infection of, 531, 531f, 1080, 1080f T-cell receptor (TCR), 1064, 1065f, 1073-1074, 1074f T-even phage, 533 T-Helper cells, 535 T lymphocyte, 1063, 1063f T tubule. See Transverse tubule Table salt. See Sodium chloride Taenia saginata, 660, 660f TAF. See Transcription-associated factor Tagmata, 679 Taiga, 1238 Tandem cluster, 359 Tandem duplication, 300 Tannin, 805 Tapeworm, 641t, 659-660, 660f Taq polymerase, 339-340, 340f Tardigrada, 640, 642t, 645f Taste, 926, 926f Taste bud, 926, 926f, 984 Taste pore, 926 Tatum, Edward, 6, 279 Tautomer, of nitrogenous bases, 261
I-30
Taxol, 806t, 808 Taxonomic hierarchy, 512-514, 513f Taxonomy, 512-514 Tay-Sachs disease, 71, 249t, 253 Tbx5 gene, 497, 497f Teeth dental caries, 561-562, 561t of mammals, 717, 717f saber-toothed-ness, 464-465, 465f of sharks, 700-701 of vertebrates, 984, 984f Telencephalon, 902t, 903 Telomerase, 272-273, 272f Telomere, 271-272, 272f length of, 272 Telophase meiosis I, 212f, 214 meiosis II, 213f, 214, 216f, 217f mitotic, 192f, 195f, 197, 216f Telson, 683, 683f Temperate deciduous forest, 1238, 1238f Temperate evergreen forest, 1238 Temperate grassland, 1237 Temperate virus, 533 Temperature adaptation to specific range, 1162 altitude and, 1234, 1234f annual mean, 1231, 1231f carbon dioxide and, 1251 effect on chemical reactions, 25 effect on enzyme activity, 52, 116, 116f effect on flower production, 844 effect on oxyhemoglobin dissociation curve, 1014, 1014f effect on plant respiration, 797 effect on transpiration, 779 heat and water, 27t, 28 Temperature-sensitive sex determination, 1086 Template strand, 265, 265f, 280, 285f, 286f Temporal isolation, 438t, 439 Temporal lobe, 904, 904f Temporal summation, 900 Tendon, 968 Tendril, 730f, 746f, 747, 821 Tensile strength, 777 Terminal bud, 744, 744f Terminator, 285, 286, 286f Termite, 684f Terpene, 37t, 54, 55f Territorial behavior, 1149, 1149f Tertiary follicle, 1095 Tertiary structure, of proteins, 46, 48-49, 49f Test experiment, 6 Test tube baby, 1102 Testcross, 231-232, 231f, 232t, 241 Testes, 1091, 1091f, 1094f Testosterone, 943f, 956, 1091, 1093t Testudines, 699f Tetanus (disease), 554, 560, 973 Tetrad, 209 Tetrahedron, 26 Tetrapod, 497
Thalamus, 902t, 903, 904-905 Theory, 7, 432 Therapeutic cloning, 383, 383f Therapsid, 708, 708f Theria, 718 Thermal stratification, 1239-1240, 1240f Thermodynamics, 108 First Law of, 109 Second Law of, 110, 110f, 433, 879 Thermogenesis, 882 Thermophile, 139, 139f, 516, 517f, 550f Thermoproteus, 550f Thermoreceptor, 918 Thermoregulation in birds, 715 hypothalamus and mammalian, 882-883, 883f in insects, 880, 880f in mammals, 716 negative feedback loop, 876, 877f regulating body temperature, 878-883 in reptiles, 710 Thermotoga, 515f, 516 Thermotolerance, in plants, 825 Thick myofilament, 970-971, 970f-971f Thigmomorphogenesis, 821 Thigmonastic response, 821 Thigmotropism, 821-822, 821f Thin myofilament, 970-971, 970f-971f Thiomargarita namibia, 548 Thoracic breathing, 707 Thorn-shaped treehopper (Embonia crassiornis), 684f Threshold potential, 893 Thrombocytes, 870. See also Platelet(s) Thylakoid, 74, 74f, 148, 148f, 149f, 160, 160f Thymine, 42, 42f, 259f, 260 Thymine dimer, 274, 274f Thymus, 956, 1064, 1064f Thyroid gland, 949, 949f, 951-953, 952f-953f Thyroid hormone, 939, 951, 952, 952f Thyroid-stimulating hormone (TSH), 948, 949 Thyrotropin-releasing hormone (TRH), 949 Thyroxine, 943f, 949, 952f Ti plasmid, 346, 346f Tick, 560, 682 Tiger, 438, 438f Tiger salamander (Ambystoma tigrinum), 705f Tight junction, 83-84, 83f Tiktaalik, 704, 704f Tinbergen, Niko, 1146, 1147-1148, 1147f Tissue, 2f, 3, 82, 635, 864, 864f evolution of, 637 primary, 732, 864 secondary, 732
Tissue culture, plant, 859 Tissue plasminogen activator, 343 genetically engineered, 343-344 Tissue systems (plant), 730, 758-759 Tissue tropism, of virus, 529 Tmespiteris, 599 TMV. See Tobacco mosaic virus TNT. See Trinitrotoluene Toad (Bufo), 703, 703t, 705-706 hybridization between species of, 439, 440 Tobacco evolution of, 477f, 480, 480f genome of, 480, 480f Tobacco hornworm (Manduca sexta), 805, 805f Tobacco mosaic virus (TMV), 519-520, 519f, 529f Tocopherol. See Vitamin E Toe, grasping, 721 Toll-like receptor, 1056 Tomato (Lycopersicon esculentum) genome of, 479f wound response in, 810, 810f Tonicity, 1039 Tonoplast, 73 Too many mouths mutation, in Arabidopsis, 734, 734f Tooth. See Teeth Top-down effect, 1219-1221, 1220f Topoisomerase, 267 Topsoil, 787, 787f Torpor, 883 Torsion, 670 Tortoise, 707t, 710, 710f Totipotent cells, 379 Touch, receptors in human skin, 918-919, 918f Toxin, plant, 805, 806t, 807-808, 807f Toxoplasma gondii, 578, 578f Trace elements, 998 Trachea, 1007, 1008f Tracheae, 680, 681f, 1006, 1118 Tracheid, 589, 593, 737, 737f, 777 Tracheole, 680-681, 681f Tracheophyte, 589, 596-597 Trailing arbutus (Epigaea repens), 843 Trait, segregation of, 222, 226 Trans-fatty acids, 55 Transcription, 43, 280, 280f, 280-281 coupled to translation, 286-287, 287f DNA rearrangements and, 1073, 1073f elongation phase of, 285-286, 286f in eukaryotes, 287-289, 288f initiation of, 284f, 285, 288, 288f, 304-305, 322f posttranscriptional modifications, 288-289, 288f in prokaryotes, 284-287, 284f-287f termination of, 286, 286f, 288 Transcription-associated factor (TAF), 313, 313f
index
rav32223_Index_I1-I33.indd I-30
11/25/09 11:54:47 AM
Transcription bubble, 285-286, 285f, 286f Transcription complex, 315, 315f Transcription factor, 50, 202, 203f, 288, 288f, 312-314 cytoplasmic determinants, 376f, 377 in development, 494, 494f, 497-498 E2F, 203f in eukaryotes, 313-314, 314f FOXP2, 485 general, 313, 313f specific, 313 TFIID, 313, 313f translated regions of, 494 Transcription unit, 285 Transcriptional control, 305 in eukaryotes, 305, 312-315, 322f negative, 308-310 positive, 308 in prokaryotes, 305, 308-312, 308f-312f Transcriptome, 366 Transduction, 554, 556-557, 557f generalized, 556-557, 557f sensory, 917, 917f specialized, 556, 557 Transfer RNA (tRNA), 69, 281, 291-293 binding to ribosomes, 292-293, 293f charged, 292, 292f initiator, 294 structure of, 291-292, 291f in translation, 293-297, 294f-296f Transformation in bacteria, 257, 554, 557-558, 558f introduction of foreign DNA into bacteria, 329-330 in plants, 346, 346f Transforming growth factor beta, 1122 Transforming principle, 257-258, 257f Transfusion, of blood, 1077 Transgenic animals, 284f, 342, 343f, 349 Transgenic organism, 330, 365 Transgenic plants, 346-349, 365-366, 366f herbicide resistance in, 346-347, 347f, 366f social issues raised by, 348 Transient receptor potential ion channel (TRP), 918 Transition (mutation), 299 Translation, 280, 281 coupled to transcription, 286-287, 287f DNA rearrangements and, 1073, 1073f elongation stage of, 295-297, 294f-296f, 298f
initiation of, 293-295, 294f, 298f, 298t, 321 “start” and “stop” signals, 283 termination of, 296f, 297, 298f Translation factor, 321 Translation repressor protein, 321 Translational control, 321 Translocation (chromosome), 250, 300, 300f Translocation, Down syndrome, 250 Translocation (translation), 295f, 296 Transmembrane protein, 89, 90f, 90t, 94-95, 95f Transmembrane route, 775, 775f Transmissible spongiform encephalopathy (TSE), 541-542 Transmission electron microscope, 61, 62t, 91 Transpiration, 737, 770 environmental factors affecting, 779, 779f regulation of rate of, 778-779, 778f-779f Transport protein, 44, 45t, 63, 93, 94f, 104t Transposable element, 360-361, 360t Transposon, 360, 480-481 dead, 361, 361f in Drosophila, 484 in human genome, 484 Transverse tubule (T tubule), 972, 972f Transversion (mutation), 299 Tree finch (Camarhynchus), 448, 448f Trematoda (class), 658-659, 659f Treponema pallidum, 550f, 562 TRH. See Thyrotropin-releasing hormone Trichinella, 661f, 662 Trichinosis, 661f, 662 Trichloroethylene (TCE), phytoremediation for, 798-799, 798f Trichome, 734-735, 735f, 766f Trichomonas vaginalis, 573, 573f Tricuspid valve, 1026 Triglyceride, 36f, 53, 54f Trimester, 1125 Trinitrotoluene (TNT), phytoremediation for, 799 Triple covalent bond, 24, 24f Triple expansion (mutation), 300 Triplet-binding assay, 283 Triploblastic animal, 637, 640, 643 Trisomy, 189, 250, 250f Trisomy 21. See Down syndrome Trochophore, 643, 669, 669f Trophic cascade, 1219-1220, 1220f, 1221f Trophic level, 1214-1215, 1215f concepts to describe, 1215-1216 defined, 1215
energy loss between levels, 1216, 1216f energy processing in, 1216 number of levels, 1217-1218 trophic level interactions, 1219-1223, 1220f-1222f Trophoblast, 1112, 1112f Tropical ecosystem, 1225-1226 species richness in, 1225-1226, 1225f Tropical forest, destruction of, 1246-1247, 1247f Tropical rain forest, 1236-1237, 1237f loss of, 1246-1247, 1247f Tropomyosin, 972, 972f Troponin, 972, 972f TRP ion channel. See Transient receptor potential ion channel trp operon, 308, 311-312, 311f trp promoter, 311, 311f trp repressor, 311-312, 311f True-breeding plant, 222, 225f Trunk neural crest cells, 1120-1121, 1120f Trypanosoma brucei, 488 Trypanosoma cruzi, 488, 574 Trypanosome, 574-575, 575f Trypanosomiasis, 574 Trypsin, 988 Tryptophan, 47f, 829f repressor, 311-312, 312f TSE. See Transmissible spongiform encephalopathy TSH. See Thyroid-stimulating hormone Tuatara, 707t, 710, 710f Tubal ligation, 1101f Tuber, 746-747 Tuberculosis, 560-561, 561t Tubeworm, 641t, 675, 675f Tubulin, 76, 188, 194 Tumor-suppressor gene, 203, 203f, 204, 204f Tundra, 1238 Tunicate, 695-696, 695f development in, 376f, 377 Turbellaria (class), 658 Turgor, 99 Turgor movement, 821-822, 822f Turgor pressure, 99, 772, 772f, 778, 779f, 782-783, 821-822 Turner syndrome, 251, 251f Turpentine, 604 Turtle, 699f, 707t, 710, 710f Tutt, J. W., 420, 421 Twin studies, 1141 Two-hybrid system, protein-protein interactions, 340-341, 341f 2,4-D, 829f, 830 Tympanum, 686 Type A flu virus, 539 Type III secretion system, 560 Typhoid fever, 560, 561t Typhus, 561t Tyrannosaur, 707t
U Ubiquinone, 134, 134f Ubiquitin, 201, 323-324, 323f Ubiquitin ligase, 323, 323f Ubiquitin-proteasome pathway, 324, 324f Ulcer, 562, 987 Ultraviolet radiation, ozone layer and, 1248, 1249f Ulva, 592, 592f Unicellularity, of prokaryotes, 548 Uniporter, 100 Unipotent stem cells, 379 Uniramous appendage, 524, 524f Universal Declaration on the Human Genome and Human Rights, 369 Unsaturated fatty acid, 53, 54f Uracil, 42, 42f, 259f Urea, 1044, 1045f Ureter, 1045, 1046f Urethra, 1045, 1046f Urey, Harold C., 509 Uric acid, 1044, 1045f Uricase, 1044 Urinary bladder, 1045, 1046f Urinary system, 875, 875f Urine, 1041, 1044, 1047-1048, 1056 pH of, 1048 Urodela (order), 703, 703t, 705f, 706 Uropod, 683, 683f Uterine contractions, 878, 878f, 947, 1128, 1128f Uterine tube. See Fallopian tube Uterus, 1098, 1098f Utricle, 924, 924f UV-B, 1248 uvr genes, 274-275, 274f
V Vaccination, 1061 Vaccine DNA, 344-345 HIV, 538 malaria, 578, 1079 production using recombinant DNA, 344-345, 344f subunit, 344, 344f, 349 Vaccinia virus, 1061 Vacuole in ciliates, 578-579, 578f of eukaryotic cells, 81t of plant cells, 73, 73f, 81t Vaginal secretions, 1056 Valence electron, 22 Vampire bat (Desmodus rotundus), 1155, 1155f Van Beneden, Edouard, 207-208 van der Waals attractions, 23t, 48, 48f Van Helmont, Jan Baptista, 149 Van Niel, C. B. (small v for van), 150-151 Vancomycin, 64
index
rav32223_Index_I1-I33.indd I-31
I-31
11/25/09 11:54:47 AM
Vancomycin-resistant Staphylococcus aureus (VRSA), 559 Vanilla orchid, 742 Variable region, of immunoglobulin, 1069-1070, 1070f Variables, in hypotheses, 6 Varicella-zoster virus, 1061 Vas deferens, 1092 Vasa recta, 1047, 1047f Vascular bone, 966 Vascular cambium, 732, 733f, 745, 745f Vascular plant, 463f, 730, 730f extant phyla of, 596, 601t-602t features of, 596, 596f Vascular tissue of plants, 596, 731, 737-738, 737f-738f, 756, 759 Vasectomy, 1101f Vasoconstriction, 1030-1031, 1031f Vasodilation, 1030-1031, 1031f Vasopressin, 1034 Vector, cloning. See Cloning vector Vegetal plate, 1113 Vegetal pole, 1110, 1110f Vegetarian finch (Platyspiza), 418f, 448, 448f Vegetative propagation, 746-747 Vegetative reproduction, in plants, 858, 858f Vein (blood vessel), 1030, 1030f Vein (leaf), 747-748 Veliger, 669, 669f Velociraptor, 714, 714f Venous pump, 1031, 1031f Venous valve, 1031, 1031f Venter, Craig, 357 Ventral body cavity, 864, 865f Ventral root, 909 Ventricle, 1023, 1023f Venule, 1030, 1031, 1032f Venus flytrap (Dionaea muscipula), 750, 793, 794f, 821, 830 Vernalization, 844 Vertebral column, 696, 697f of fish, 698-699 Vertebrate, 635, 693-726 characteristics of, 696-697, 697f-698f circulatory system of, 1023-1025, 1023f-1025f development in, 1118-1119, 1119f digestive system of, 982-983, 983f variations in, 990-992, 991f-992f evolution of, 697, 698f, 1121, 1121f eye in, 1125f fertilization and development in, 1087-1090, 1087f-1090f hearing in, 921-922, 921f, 923 invasion of land by, 703-705, 704f-705f kidneys of, 1041-1044, 1042f-1044f locomotion in, 976, 976f
I-32
organization of body of, 864-865, 864f-865f photoreceptors of, 930-931, 930f-931f smell in, 926-927, 927f social systems of, 1157-1159, 1159f taste in, 926, 926f teeth of, 984, 984f Vertical gene transfer, 483 Vervet monkey (Ceropithecus aethiops), language of, 1147, 1147f Vesicle, 65 Vessel member, 737, 737f Vessel (xylem), 605, 777 Vestibular apparatus, 925 Vestigial structure, 430, 430f Vibrio cholerae, 180, 548, 551f, 561t phage conversion in, 534 Victoria (Queen of England), 242-243, 242f Villi, 987, 988f Vimentin, 76 Viridiplantae (kingdom), 519, 520, 521, 521f, 588, 590, 591 Virion, 528, 530 Viroid, 542 Virulent virus, 533 Virus, 519f, 528-542 bacteriophage. See Bacteriophage cancer and, 540-541 classification of, 519-520 disease-causing, 532t, 539-541 DNA, 529, 529f, 532t emerging, 540 genome of, 529, 531 host range of, 529 latent, 529 recombination in, 539 replication of, 530 RNA, 529, 529f, 532t shape of, 519f, 529f, 530-531 size of, 519, 519f, 531, 531f structure of, 529-531, 529f-531f, 532t temperate, 533, 534f tissue tropism, 529 virulent, 533, 534f Viscera, 870 Visceral mass, 668 Visceral muscle, 870 Visceral pleural membrane, 1009 Vision, 928-933, 928f-933f binocular, 721, 933 color, 930, 930f nearsightedness and farsightedness, 929f Visual acuity, 933 Vitamin, 997-998, 998t Vitamin A, 998t Vitamin B-complex vitamins, 998t Vitamin C, 998t Vitamin D, 953, 953f, 998t Vitamin E, 998t Vitamin K, 992, 998t Viviparity, 1087, 1087f Voltage-gated ion channel, 893, 894f potassium channel, 893, 894f sodium channel, 893, 894f
Volvox, 591-592, 591f Vomitoxin, 630 Von Frisch, Karl, 1146 VRSA, 559
W Wadlow, Robert, 950, 950f Wall cress. See Arabidopsis Wallace, Alfred Russel, 10 Warbler finch (Certhidea), 418f, 448, 448f Wasp, parasitoid, 809, 809f Water, 1162 absorption by plants, 773-775, 774f-775f adhesive properties of, 27, 27f cohesive nature of, 26, 27f, 27t forms of, 25-26, 26f heat of vaporization of, 27t, 28 hydrogen bonds in, 26, 26f ionization of, 29 lipids in, 56, 56f locomotion in, 975-976, 975f molecular structure of, 26, 26f osmosis, 97-99, 98f properties of, 27t, 28-29 reabsorption in kidney, 1048, 1050-1051, 1051f soil, 787-788, 788f as solvent, 27t, 28, 29f specific heat of, 27t, 28 transport in plants, 771f Water cycle, 1209-1210, 1209f-1210f disruption by deforestation, 1247 Water-dispersed fruit, 762, 763f Water mold, 581 Water potential, 770-772, 772f, 774f calculation of, 771-772, 772f at equilibrium, 772, 773f gradient from roots to shoots, 776-777 of soil, 787-788 Water storage root, 743, 743f Water-vascular system, 688, 688f, 689 Watersheds, of New York City, 1262-1263, 1263f Waterwheel (Aldrovanda), 794, 794f Watson, James, 259-263, 261f, 358 Weinberg, Wilhelm, 399 Welwitschia, 602t, 605, 605f Wendell, Stanley, 519-520 Went, Frits, 827-828, 828f WEREWOLF gene, in Arabidopsis, 740, 740f Western blot, 335 Whale, 525, 525f evolution of, 425, 425f, 430f overexploitation of, 1269, 1269f Whaling industry, 1269, 1269f Wheat (Triticum) chromosome number in, 189t evolution of, 478f genome of, 363, 363f, 476-477, 478f, 479f, 486 transgenic, 366f
Whisk fern, 596, 598-599, 599f, 601t White blood cells. See Leukocytes White fiber, 974 White-fronted bee-eater (Merops bullockoides), 1156-1157, 1157f Whooping cough, 560 Whorl (flower parts), 608, 608f Whorl (leaf pattern), 744, 744f Wieschaus, Eric, 384 Wild geranium (Geranium maculatum), 849f Wilkins, Maurice, 261 Wilson, Edward O., 1226-1227 Wind, pollination by, 852, 854, 854f Window leaf, 749-750 Wing traits, in fruit fly, 246-247, 246f Wings development of, 497, 497f, 976-977, 977f of insects, 498-499, 498f Wnt pathway, 1123 Wobble pairing, 296-297 Woese, Carl, 514 Wolf, 423f, 431f, 1163, 1163f captive breeding of, 1277 WOODEN LEG gene, in Arabidopsis, 759, 759f Woody plant, 744, 744f World Health Organization (WHO), 348, 560, 1079 Wound response, in plants, 810, 810f
X X chromosome, 241, 241t of fruit fly, 241, 245 human, 241-242, 248f inactivation of, 243, 243f nondisjunction involving, 251, 251f X-SCID, 345 Xenopus, 1122, 1123 Xylem, 596, 737-738, 737f, 741f primary, 733f, 737, 741-742, 741f secondary, 733f, 737 vessels, 605 water and mineral transport through, 776-777, 776f-777f
Y Y chromosome, 241-243, 241t nondisjunction involving, 251, 251f YABBY gene, in Arabidopsis, 747f YAC. See Yeast artificial chromosome Yeast, 614, 625, 625f cell division in, 188f chromosome number in, 189t ethanol fermentation in, 140f genome of, 358f, 475f Yeast artificial chromosome (YAC), 331, 356
index
rav32223_Index_I1-I33.indd I-32
11/25/09 11:54:47 AM
Yellow fever, 531f, 532t Yellowstone Park, return of wolves to, 1277 Yersinia pestis, 559, 561t Yersinia, type III system, 559-560 Yolk plug, 1114, 1114f Yolk sac, 706, 708f
Z Z diagram, 157, 158f Z line, 969 Zebra mussel (Dreissena polymorpha), 667, 1270, 1270f Zinc finger motif, 307
Zone cell of division, 739-740, 740f Zone of elongation, 740 Zone of maturation, 740-742, 740f, 741f Zoospore, 582, 619, 619f, 620 Zygomycetes, 615, 615f, 620, 621, 621f
Zygomycota (phylum), 615, 615f, 615t, 620-621, 621f Zygosporangium, 621, 621f Zygospore, 591f, 621, 621f Zygote, 208, 208f, 373 fungi, 621, 621f plant, 754, 754f, 755, 755f
index
rav32223_Index_I1-I33.indd I-33
I-33
11/25/09 11:54:47 AM